Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AMY2B	280	broad.mit.edu	37	1	104116388	104116388	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:104116388G>A	uc001duq.2	+	6	1188	c.572G>A	c.(571-573)CGT>CAT	p.R191H	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.R191H|AMY2B_uc001dus.1_5'Flank	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	191					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GATTATGTGCGTTCCAAGATT	0.413																0.070013	-43.019604	101.407047	53	704	KEEP	---	---	---	---	32	27	432	412	-1	capture	Missense_Mutation	SNP	104116388	104116388	AMY2B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	592	286
TCHH	7062	broad.mit.edu	37	1	152080354	152080354	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152080354C>T	uc001ezp.2	-	2	5339	c.5339G>A	c.(5338-5340)CGC>CAC	p.R1780H	TCHH_uc009wne.1_Missense_Mutation_p.R1780H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1780	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCTCCTGGCGGAGCTGTTC	0.592																0.194175	38.557786	47.534792	20	83	KEEP	---	---	---	---	13	10	47	48	-1	capture	Missense_Mutation	SNP	152080354	152080354	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15585	286
OR2L3	391192	broad.mit.edu	37	1	248224733	248224733	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248224733C>A	uc001idx.1	+	1	750	c.750C>A	c.(748-750)TAC>TAA	p.Y250*	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	250	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TAACTTTCTACTATGCACCTT	0.502																0.23871	91.210496	100.865902	37	118	KEEP	---	---	---	---	25	19	72	77	0.431818181818	capture	Nonsense_Mutation	SNP	248224733	248224733	OR2L3	1	C	A	A	A	1	0	0	0	0	0	1	0	0	259	20	5	4	10912	286
PTEN	5728	broad.mit.edu	37	10	89717672	89717672	+	Nonsense_Mutation	SNP	C	T	T	rs121909219		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717672C>T	uc001kfb.2	+	8	1728	c.697C>T	c.(697-699)CGA>TGA	p.R233*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	233	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R233*(61)|p.R233fs*10(4)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R233fs*12(1)|p.R233fs*20(1)|p.R233fs*25(1)|p.R233fs*23(1)|p.R233R(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGACCCACACGACGGGAAGA	0.423		R233*(JHUEM1_ENDOMETRIUM)|R233*(SW1783_CENTRAL_NERVOUS_SYSTEM)|R233*(NCIH1155_LUNG)|R233*(SF295_CENTRAL_NERVOUS_SYSTEM)|R233*(HEC59_ENDOMETRIUM)	31	p.R233*(JHUEM1-Tumor)|p.R233*(SW1783-Tumor)|p.R233*(SF295-Tumor)|p.T232fs(P31FUJ-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.385965	61.136332	61.786014	22	35	KEEP	---	---	---	---	11	14	29	12	-1	capture	Nonsense_Mutation	SNP	89717672	89717672	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	286
KIF20B	9585	broad.mit.edu	37	10	91498052	91498052	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:91498052C>A	uc001kgs.1	+	20	3526	c.3454C>A	c.(3454-3456)CTT>ATT	p.L1152I	KIF20B_uc001kgr.1_Missense_Mutation_p.L1112I|KIF20B_uc001kgt.1_Missense_Mutation_p.L363I|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1152					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						GCTTTCAGAACTTACACAAGG	0.343																0.266667	49.564273	53.254317	20	55	KEEP	---	---	---	---	12	9	26	32	0.428571428571	capture	Missense_Mutation	SNP	91498052	91498052	KIF20B	10	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	8209	286
WDR11	55717	broad.mit.edu	37	10	122649467	122649467	+	Silent	SNP	T	C	C			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:122649467T>C	uc010qtf.1	+	18	2527	c.2289T>C	c.(2287-2289)AAT>AAC	p.N763N	WDR11_uc010qte.1_Silent_p.N365N|WDR11_uc001lfd.1_Silent_p.N281N|WDR11_uc009xzn.2_Silent_p.N54N	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	763	WD 7.					integral to membrane					0						GTAAAGGAAATCAAAAATTAA	0.383																0.354167	55.363286	56.262161	17	31	KEEP	---	---	---	---	9	8	19	19	-1	capture	Silent	SNP	122649467	122649467	WDR11	10	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	17154	286
OR5D18	219438	broad.mit.edu	37	11	55587178	55587178	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55587178C>G	uc010rin.1	+	1	73	c.73C>G	c.(73-75)CAA>GAA	p.Q25E		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	25	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CCCAGAACTGCAAGTCCCACT	0.448																0.255319	73.25479	78.359665	24	70	KEEP	---	---	---	---	11	16	38	40	-1	capture	Missense_Mutation	SNP	55587178	55587178	OR5D18	11	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	11061	286
MAML2	84441	broad.mit.edu	37	11	95825767	95825767	+	Silent	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:95825767C>T	uc001pfw.1	-	2	2713	c.1428G>A	c.(1426-1428)GGG>GGA	p.G476G		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	476					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TTTTCTCCTGCCCAAATGGAC	0.512					501	T	MECT1|CRTC3	salivary gland mucoepidermoid								0.357143	77.389498	78.913821	30	54	KEEP	---	---	---	---	19	16	31	29	-1	capture	Silent	SNP	95825767	95825767	MAML2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	9120	286
REM2	161253	broad.mit.edu	37	14	23353987	23353987	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23353987C>T	uc001whf.1	+	2	273	c.208C>T	c.(208-210)CCT>TCT	p.P70S	REM2_uc010tnd.1_Missense_Mutation_p.P62S	NM_173527	NP_775798	Q8IYK8	REM2_HUMAN	rad and gem related GTP binding protein 2	70					regulation of transcription, DNA-dependent|small GTPase mediated signal transduction	intracellular|plasma membrane	ATP binding|GTP binding|transcription factor binding			large_intestine(1)|central_nervous_system(1)	2	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.012)		AGGCAGTATGCCTGTCCCCTA	0.607																0.241379	47.62563	52.939969	21	66	KEEP	---	---	---	---	10	12	27	42	-1	capture	Missense_Mutation	SNP	23353987	23353987	REM2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13118	286
FMN1	342184	broad.mit.edu	37	15	33261062	33261062	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33261062G>A	uc001zhf.3	-	4	2171	c.2171C>T	c.(2170-2172)CCA>CTA	p.P724L		NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	947	FH1.|Pro-rich.				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		TCCTGGGGGTGGTGGAGCAGG	0.507																0.230769	21.807546	24.361822	9	30	KEEP	---	---	---	---	7	2	22	11	-1	capture	Missense_Mutation	SNP	33261062	33261062	FMN1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	5893	286
PLCB2	5330	broad.mit.edu	37	15	40590478	40590478	+	Silent	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40590478G>A	uc001zld.2	-	11	1402	c.1101C>T	c.(1099-1101)GAC>GAT	p.D367D	PLCB2_uc010bbo.2_Silent_p.D367D|PLCB2_uc010ucm.1_Silent_p.D367D	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	367	PI-PLC X-box.				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TGGGCTCCTCGTCAGGGGGTT	0.602					1073											0.224138	28.14292	32.201812	13	45	KEEP	---	---	---	---	11	4	26	25	-1	capture	Silent	SNP	40590478	40590478	PLCB2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11931	286
IGF1R	3480	broad.mit.edu	37	15	99456497	99456497	+	Missense_Mutation	SNP	G	T	T	rs45553041		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99456497G>T	uc002bul.2	+	8	1864	c.1814G>T	c.(1813-1815)CGC>CTC	p.R605L	IGF1R_uc010urq.1_Missense_Mutation_p.R605L|IGF1R_uc010bon.2_Missense_Mutation_p.R605L|IGF1R_uc010urr.1_Missense_Mutation_p.R55L	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	605	Fibronectin type-III 1.				anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	TTGTACATTCGCACCAATGCT	0.532					471											0.294737	77.964927	81.545078	28	67	KEEP	---	---	---	---	15	18	28	48	0.454545454545	capture	Missense_Mutation	SNP	99456497	99456497	IGF1R	15	G	T	T	T	1	0	0	0	0	1	0	0	0	494	38	4	4	7496	286
TP53	7157	broad.mit.edu	37	17	7578518	7578518	+	Missense_Mutation	SNP	C	T	T	rs28934875		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578518C>T	uc002gim.2	-	5	606	c.412G>A	c.(412-414)GCC>ACC	p.A138T	TP53_uc002gig.1_Missense_Mutation_p.A138T|TP53_uc002gih.2_Missense_Mutation_p.A138T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.A6T|TP53_uc010cng.1_Missense_Mutation_p.A6T|TP53_uc002gii.1_Missense_Mutation_p.A6T|TP53_uc010cnh.1_Missense_Mutation_p.A138T|TP53_uc010cni.1_Missense_Mutation_p.A138T|TP53_uc002gij.2_Missense_Mutation_p.A138T|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.A45T|TP53_uc002gio.2_Missense_Mutation_p.A6T|TP53_uc010vug.1_Missense_Mutation_p.A99T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	138	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		A -> D (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> S (in LFS; germline mutation).|A -> V (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.A138V(17)|p.A138P(13)|p.0?(7)|p.A138fs*32(5)|p.A138T(4)|p.A138fs*11(3)|p.N131fs*27(2)|p.A138fs*31(1)|p.L137_W146del10(1)|p.K139fs*4(1)|p.F134_T140>S(1)|p.V73fs*9(1)|p.L137_A138insX(1)|p.K132_A138delKMFCQLA(1)|p.A138_V143delAKTCPV(1)|p.A138del(1)|p.A138_P142delAKTCP(1)|p.C135_A138delCQLA(1)|p.Q136_K139delQLAK(1)|p.A138A(1)|p.C135_T140delCQLAKT(1)|p.A138S(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGGTCTTGGCCAGTTGGCAA	0.567	Pancreas(47;798 1329 9957 10801)		111	p.A138P(RL-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.3	23.162796	24.23529	9	21	KEEP	---	---	---	---	7	3	10	13	-1	capture	Missense_Mutation	SNP	7578518	7578518	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16264	286
ABI3	51225	broad.mit.edu	37	17	47297534	47297534	+	Silent	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47297534C>T	uc002iop.1	+	6	1146	c.648C>T	c.(646-648)AGC>AGT	p.S216S	ABI3_uc002ioq.1_Silent_p.S210S	NM_016428	NP_057512	Q9P2A4	ABI3_HUMAN	NESH protein isoform 1	216					cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			TGTTCAGCAGCGCCGAAGGTG	0.692													HNSCC(55;0.14)			0.243902	22.729926	25.18062	10	31	KEEP	---	---	---	---	7	5	26	11	-1	capture	Silent	SNP	47297534	47297534	ABI3	17	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	90	286
DNAH17	8632	broad.mit.edu	37	17	76459049	76459049	+	Silent	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76459049G>A	uc010dhp.1	-	2	273	c.51C>T	c.(49-51)CCC>CCT	p.P17P	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GAAAGGTTTTGGGTGTGGTGT	0.522																0.2	39.296051	46.832068	18	72	KEEP	---	---	---	---	14	8	36	44	-1	capture	Silent	SNP	76459049	76459049	DNAH17	17	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	4558	286
TBCD	6904	broad.mit.edu	37	17	80858560	80858560	+	Silent	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80858560G>A	uc002kfz.2	+	18	1813	c.1683G>A	c.(1681-1683)CAG>CAA	p.Q561Q	TBCD_uc002kfx.1_Silent_p.Q544Q|TBCD_uc002kfy.1_Silent_p.Q561Q|TBCD_uc002kgb.1_5'UTR	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	561	HEAT 2.				'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AGTACACGCAGCCAATGATAG	0.318																0.26506	58.310092	62.452116	22	61	KEEP	---	---	---	---	12	15	34	43	-1	capture	Silent	SNP	80858560	80858560	TBCD	17	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	15520	286
ICAM1	3383	broad.mit.edu	37	19	10395175	10395175	+	Missense_Mutation	SNP	C	T	T	rs141326678		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10395175C>T	uc002mnq.2	+	5	1341	c.1022C>T	c.(1021-1023)ACG>ATG	p.T341M	ICAM1_uc010xle.1_Missense_Mutation_p.T119M|ICAM4_uc002mnr.1_5'Flank|ICAM4_uc002mns.1_5'Flank|ICAM4_uc002mnt.1_5'Flank	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	341	Ig-like C2-type 4.|Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	GCCAAGGTGACGCTGAATGGG	0.642					72											0.261905	48.911011	53.22215	22	62	KEEP	---	---	---	---	12	12	32	41	-1	capture	Missense_Mutation	SNP	10395175	10395175	ICAM1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7404	286
SCN1B	6324	broad.mit.edu	37	19	35523525	35523525	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35523525G>A	uc002nxp.2	+	2	325	c.134G>A	c.(133-135)CGC>CAC	p.R45H	SCN1B_uc002nxo.1_Missense_Mutation_p.R45H|SCN1B_uc010xsg.1_Missense_Mutation_p.R45H	NM_001037	NP_001028	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta	45	Extracellular (Potential).|Ig-like C2-type.				axon guidance|synaptic transmission	integral to membrane	voltage-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TCCTGCAAGCGCCGCAGCGAG	0.622																0.088435	1.790977	26.937059	13	134	KEEP	---	---	---	---	4	10	73	81	-1	capture	Missense_Mutation	SNP	35523525	35523525	SCN1B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13808	286
SPTBN4	57731	broad.mit.edu	37	19	41063199	41063199	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41063199C>T	uc002ony.2	+	26	5646	c.5560C>T	c.(5560-5562)CGG>TGG	p.R1854W	SPTBN4_uc002onx.2_Missense_Mutation_p.R1854W|SPTBN4_uc002onz.2_Missense_Mutation_p.R1854W|SPTBN4_uc010egx.2_Missense_Mutation_p.R597W|SPTBN4_uc002ooa.2_Missense_Mutation_p.R530W	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1854	Spectrin 16.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGAGGAGAAGCGGAGGCGGCT	0.647																0.173913	14.876093	19.490011	8	38	KEEP	---	---	---	---	2	7	25	19	-1	capture	Missense_Mutation	SNP	41063199	41063199	SPTBN4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15013	286
KLK6	5653	broad.mit.edu	37	19	51466671	51466671	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51466671C>T	uc002pui.2	-	5	592	c.332G>A	c.(331-333)CGC>CAC	p.R111H	KLK6_uc010eoj.2_Intron|KLK6_uc002puh.2_Missense_Mutation_p.R120H|KLK6_uc002puj.2_Missense_Mutation_p.R4H|KLK6_uc010ycn.1_Missense_Mutation_p.R4H|KLK6_uc002pul.2_Missense_Mutation_p.R111H|KLK6_uc002pum.2_Missense_Mutation_p.R4H	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A	111	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GCGTGCCAGGCGCAACAGCAT	0.617																0.464286	36.47029	36.501459	13	15	KEEP	---	---	---	---	6	7	6	13	-1	capture	Missense_Mutation	SNP	51466671	51466671	KLK6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8328	286
LILRA5	353514	broad.mit.edu	37	19	54822924	54822924	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54822924C>T	uc002qfe.2	-	5	592	c.472G>A	c.(472-474)GTG>ATG	p.V158M	LILRA5_uc002qff.2_Missense_Mutation_p.V146M|LILRA5_uc010yev.1_Missense_Mutation_p.V158M|LILRA5_uc010yew.1_Missense_Mutation_p.V146M|LILRA5_uc002qfh.1_Missense_Mutation_p.V146M|LILRA5_uc002qfg.1_Missense_Mutation_p.V158M	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	158	Extracellular (Potential).|Ig-like C2-type 2.				innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TGGAGGGTCACGTTCTCTCCT	0.572																0.271739	56.610559	60.952355	25	67	KEEP	---	---	---	---	20	5	32	39	-1	capture	Missense_Mutation	SNP	54822924	54822924	LILRA5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8708	286
GPAT2	150763	broad.mit.edu	37	2	96691751	96691751	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96691751C>T	uc002svf.2	-	12	1388	c.1165G>A	c.(1165-1167)GTC>ATC	p.V389I	GPAT2_uc002svd.2_Missense_Mutation_p.V202I|GPAT2_uc002sve.2_Missense_Mutation_p.V191I|GPAT2_uc002svg.2_Missense_Mutation_p.V262I|GPAT2_uc010yuh.1_Missense_Mutation_p.V318I|GPAT2_uc002svh.2_Missense_Mutation_p.V389I	NM_207328	NP_997211	Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2,	389					glycerol-3-phosphate metabolic process|phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity				0						CTGGCACTGACGATGTATTCC	0.612																0.318182	35.433539	36.727019	14	30	KEEP	---	---	---	---	7	7	18	14	-1	capture	Missense_Mutation	SNP	96691751	96691751	GPAT2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6523	286
TTN	7273	broad.mit.edu	37	2	179395245	179395245	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179395245C>A	uc010zfg.1	-	307	98617	c.98393G>T	c.(98392-98394)GGA>GTA	p.G32798V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G26493V|TTN_uc010zfi.1_Missense_Mutation_p.G26426V|TTN_uc010zfj.1_Missense_Mutation_p.G26301V|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33725							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAGACGTTCCACCTTCACC	0.363					8722											0.268519	66.223848	71.451533	29	79	KEEP	---	---	---	---	21	13	54	37	0.382352941176	capture	Missense_Mutation	SNP	179395245	179395245	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	16617	286
TTN	7273	broad.mit.edu	37	2	179485027	179485027	+	Silent	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179485027G>A	uc010zfg.1	-	197	38741	c.38517C>T	c.(38515-38517)GAC>GAT	p.D12839D	TTN_uc010zfh.1_Silent_p.D6534D|TTN_uc010zfi.1_Silent_p.D6467D|TTN_uc010zfj.1_Silent_p.D6342D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13766							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.D12839D(1)|p.D6342D(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAAGACAGCGTCATCGAACT	0.433					8722											0.251497	99.648266	108.967346	42	125	KEEP	---	---	---	---	28	17	75	80	-1	capture	Silent	SNP	179485027	179485027	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16617	286
SIRPB1	10326	broad.mit.edu	37	20	1552398	1552398	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1552398C>T	uc010gai.2	-	3	818	c.719G>A	c.(718-720)CGT>CAT	p.R240H	SIRPB1_uc002wfk.3_Intron	NM_006065	NP_006056	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1 isoform 1	240	Ig-like C1-type 1.|Extracellular (Potential).				cell junction assembly|cell surface receptor linked signaling pathway	integral to plasma membrane	protein binding			ovary(1)	1						GGCAGTCCCACGAAGAGGGTC	0.622																0.047059	-11.172603	7.412459	4	81	KEEP	---	---	---	---	2	2	49	47	-1	capture	Missense_Mutation	SNP	1552398	1552398	SIRPB1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14226	286
LIMK2	3985	broad.mit.edu	37	22	31658176	31658176	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31658176G>A	uc003akh.2	+	6	753	c.608G>A	c.(607-609)CGC>CAC	p.R203H	LIMK2_uc003akg.2_Missense_Mutation_p.R120H|LIMK2_uc003aki.2_Intron|LIMK2_uc003akj.2_Missense_Mutation_p.R182H|LIMK2_uc003akk.2_Missense_Mutation_p.R182H|LIMK2_uc011aln.1_Missense_Mutation_p.R120H	NM_005569	NP_005560	P53671	LIMK2_HUMAN	LIM domain kinase 2 isoform 2a	203	PDZ.					mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2						CCTGGGGACCGCATCCTGGAG	0.547					431											0.034188	-20.691567	6.852519	4	113	KEEP	---	---	---	---	2	2	75	60	-1	capture	Missense_Mutation	SNP	31658176	31658176	LIMK2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8722	286
MYL3	4634	broad.mit.edu	37	3	46901034	46901034	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46901034G>A	uc003cql.1	-	4	505	c.412C>T	c.(412-414)CGG>TGG	p.R138W		NM_000258	NP_000249	P08590	MYL3_HUMAN	slow skeletal ventricular myosin alkali light	138	EF-hand 2.				cardiac muscle contraction|muscle filament sliding|positive regulation of ATPase activity|regulation of striated muscle contraction|regulation of the force of heart contraction|ventricular cardiac muscle tissue morphogenesis	A band|cytosol|I band|muscle myosin complex	actin monomer binding|calcium ion binding|myosin II heavy chain binding|structural constituent of muscle				0				BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)		TCGAAGACCCGCAGCCCCTCC	0.572	Melanoma(166;130 1949 2249 18977 46142)															0.03252	-22.799957	6.562547	4	119	KEEP	---	---	---	---	2	2	75	58	-1	capture	Missense_Mutation	SNP	46901034	46901034	MYL3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	9958	286
PCOLCE2	26577	broad.mit.edu	37	3	142567280	142567280	+	Missense_Mutation	SNP	C	T	T	rs143959509		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142567280C>T	uc003evd.2	-	3	423	c.227G>A	c.(226-228)CGA>CAA	p.R76Q		NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	76	CUB 1.					extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)|skin(1)	3						GTCTATGAATCGGAAATTGAG	0.473																0.185185	29.188427	36.707768	15	66	KEEP	---	---	---	---	10	11	32	41	-1	capture	Missense_Mutation	SNP	142567280	142567280	PCOLCE2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11498	286
SGEF	26084	broad.mit.edu	37	3	153840688	153840688	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:153840688G>C	uc011bog.1	+	2	1118	c.907G>C	c.(907-909)GAT>CAT	p.D303H	uc003ezu.1_5'Flank|SGEF_uc011boh.1_Missense_Mutation_p.D303H	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	303					regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TAACGACGTGGATAGCCCAGG	0.597																0.45	31.573343	31.616834	9	11	KEEP	---	---	---	---	2	7	6	8	-1	capture	Missense_Mutation	SNP	153840688	153840688	SGEF	3	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	14098	286
UGT2A3	79799	broad.mit.edu	37	4	69817091	69817091	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69817091A>G	uc003hef.2	-	1	419	c.388T>C	c.(388-390)TAC>CAC	p.Y130H	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	130	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						GTCTGATTGTAGATAAAGCTC	0.383																0.144928	21.604315	29.972474	10	59	KEEP	---	---	---	---	4	7	39	25	-1	capture	Missense_Mutation	SNP	69817091	69817091	UGT2A3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	16837	286
ANXA3	306	broad.mit.edu	37	4	79503370	79503370	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79503370T>A	uc003hld.2	+	5	548	c.238T>A	c.(238-240)TTT>ATT	p.F80I	ANXA3_uc003hle.2_Missense_Mutation_p.F41I|ANXA3_uc010ijk.2_Missense_Mutation_p.F41I	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3	80	Annexin 1.				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						CTCTGGCCACTTTGAGCATCT	0.428	GBM(2;126 157 27790 28920 42492)															0.222222	40.620649	46.360929	18	63	KEEP	---	---	---	---	8	13	28	43	-1	capture	Missense_Mutation	SNP	79503370	79503370	ANXA3	4	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	713	286
ODZ3	55714	broad.mit.edu	37	4	183714569	183714569	+	Silent	SNP	T	C	C			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183714569T>C	uc003ivd.1	+	25	6781	c.6744T>C	c.(6742-6744)TTT>TTC	p.F2248F		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	2248	YD 22.|Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ACCTGCAGTTTTTTTATGCTG	0.438																0.277778	47.003481	49.401537	15	39	KEEP	---	---	---	---	5	13	18	24	-1	capture	Silent	SNP	183714569	183714569	ODZ3	4	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	10741	286
GPR98	84059	broad.mit.edu	37	5	89953946	89953946	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89953946G>A	uc003kju.2	+	21	4699	c.4603G>A	c.(4603-4605)GAG>AAG	p.E1535K	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1535	Calx-beta 10.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGACAATGACGAGGAAGGAGA	0.358																0.224806	66.405181	75.384204	29	100	KEEP	---	---	---	---	22	11	50	60	-1	capture	Missense_Mutation	SNP	89953946	89953946	GPR98	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6654	286
STK10	6793	broad.mit.edu	37	5	171488225	171488225	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:171488225C>T	uc003mbo.1	-	14	2430	c.2130G>A	c.(2128-2130)ATG>ATA	p.M710I		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	710	Potential.						ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGAGCCTCTTCATGGCCAGCT	0.612					570											0.193103	52.51629	65.268628	28	117	KEEP	---	---	---	---	10	21	67	73	-1	capture	Missense_Mutation	SNP	171488225	171488225	STK10	5	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	15176	286
IMPG1	3617	broad.mit.edu	37	6	76715225	76715225	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76715225G>A	uc003pik.1	-	10	1044	c.914C>T	c.(913-915)ACG>ATG	p.T305M		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	305	SEA 1.				visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AAAGATGGCCGTAAGTTGCAT	0.448	Pancreas(37;839 1141 2599 26037)															0.276786	75.58032	80.601334	31	81	KEEP	---	---	---	---	19	15	46	53	-1	capture	Missense_Mutation	SNP	76715225	76715225	IMPG1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7651	286
ULBP1	80329	broad.mit.edu	37	6	150290460	150290460	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:150290460T>G	uc003qnp.2	+	3	632	c.589T>G	c.(589-591)TTT>GTT	p.F197V		NM_025218	NP_079494	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1 precursor	197	MHC class I alpha-2 like.				antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		GCTTGAAGAATTTTTGATGTA	0.423																0.3125	80.098999	83.116821	30	66	KEEP	---	---	---	---	18	15	38	43	-1	capture	Missense_Mutation	SNP	150290460	150290460	ULBP1	6	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	16854	286
KIF25	3834	broad.mit.edu	37	6	168443281	168443281	+	Silent	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168443281G>A	uc003qwk.1	+	8	1132	c.870G>A	c.(868-870)GCG>GCA	p.A290A	KIF25_uc003qwl.1_Intron	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1	290	Kinesin-motor.				microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGGAGATGGCGTGCATCAGCC	0.647																0.297872	69.962296	73.396416	28	66	KEEP	---	---	---	---	14	19	28	41	-1	capture	Silent	SNP	168443281	168443281	KIF25	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	8215	286
TFPI2	7980	broad.mit.edu	37	7	93516588	93516588	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93516588G>A	uc003umy.1	-	4	691	c.616C>T	c.(616-618)CGT>TGT	p.R206C	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Silent_p.N180N|TFPI2_uc003una.1_Missense_Mutation_p.R195C|TFPI2_uc003unb.1_Missense_Mutation_p.R212C|TFPI2_uc010lfg.1_Missense_Mutation_p.R82C	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	206	BPTI/Kunitz inhibitor 3.				blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			GCACATGCACGTTTGCAATCC	0.323																0.108911	8.92625	24.166505	11	90	KEEP	---	---	---	---	7	5	46	51	-1	capture	Missense_Mutation	SNP	93516588	93516588	TFPI2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15694	286
ZAN	7455	broad.mit.edu	37	7	100364654	100364654	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100364654C>T	uc003uwj.2	+	25	4799	c.4634C>T	c.(4633-4635)TCG>TTG	p.S1545L	ZAN_uc003uwk.2_Missense_Mutation_p.S1545L|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Missense_Mutation_p.S122L	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1545	Extracellular (Potential).|VWFD 2.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGCACAGCCTCGGGTGACCCC	0.607																0.117647	17.740708	39.733389	18	135	KEEP	---	---	---	---	10	9	81	74	-1	capture	Missense_Mutation	SNP	100364654	100364654	ZAN	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17394	286
REPIN1	29803	broad.mit.edu	37	7	150069247	150069247	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150069247A>G	uc010lpq.1	+	4	1406	c.917A>G	c.(916-918)AAC>AGC	p.N306S	REPIN1_uc003whd.2_Missense_Mutation_p.N295S|REPIN1_uc010lpr.1_Missense_Mutation_p.N363S|REPIN1_uc003whc.2_Missense_Mutation_p.N306S|REPIN1_uc003whe.2_Missense_Mutation_p.N306S	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	306	C2H2-type 8.				DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CACAAACCCAACCTGCTGTCT	0.672																0.195652	19.765152	23.725976	9	37	KEEP	---	---	---	---	4	6	25	25	-1	capture	Missense_Mutation	SNP	150069247	150069247	REPIN1	7	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	13122	286
ATP6V1C1	528	broad.mit.edu	37	8	104064965	104064965	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104064965A>C	uc003ykz.3	+	6	633	c.388A>C	c.(388-390)ACT>CCT	p.T130P	ATP6V1C1_uc010mbz.2_Missense_Mutation_p.T55P|ATP6V1C1_uc003yla.2_Missense_Mutation_p.T130P|ATP6V1C1_uc011lhl.1_Missense_Mutation_p.T55P	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	130					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			AAAGGGAGTAACTCAGATTGA	0.318																0.272	100.998745	106.854086	34	91	KEEP	---	---	---	---	15	25	53	48	-1	capture	Missense_Mutation	SNP	104064965	104064965	ATP6V1C1	8	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	1171	286
RXRA	6256	broad.mit.edu	37	9	137309042	137309042	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137309042G>T	uc004cfb.2	+	5	811	c.649G>T	c.(649-651)GAG>TAG	p.E217*	RXRA_uc004cfc.1_Nonsense_Mutation_p.E120*|RXRA_uc004cfd.1_5'UTR	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha	217	Hinge.				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)	GGACCGGAACGAGAATGAGGT	0.677					303											0.181818	20.219432	25.449298	10	45	KEEP	---	---	---	---	3	9	32	22	0.25	capture	Nonsense_Mutation	SNP	137309042	137309042	RXRA	9	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	13655	286
REN	5972	broad.mit.edu	37	1	204135375	204135377	+	In_Frame_Del	DEL	AGC	-	-	rs121917743;rs142739309		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204135375_204135377delAGC	uc001haq.2	-	1	89_91	c.45_47delGCT	c.(43-48)CTGCTC>CTC	p.15_16LL>L		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	15_16			L -> R (in HNFJ2; affects ER translocation and processing of nascent preprorenin, resulting in abolished prorenin and renin biosynthesis and secretion).		angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GGAGCCCCAGAGCAGCAGCAGCA	0.581																0.01			7	1387		---	---	---	---						capture_indel	In_Frame_Del	DEL	204135375	204135377	REN	1	AGC	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	13119	286
ARID4B	51742	broad.mit.edu	37	1	235377267	235377269	+	In_Frame_Del	DEL	TCT	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235377267_235377269delTCT	uc001hwq.2	-	17	2154_2156	c.1656_1658delAGA	c.(1654-1659)GAAGAG>GAG	p.552_553EE>E	ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_In_Frame_Del_p.233_234EE>E	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	552_553	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			atcttcatcctcttcttcttctt	0.246																0.01			19	1526		---	---	---	---						capture_indel	In_Frame_Del	DEL	235377267	235377269	ARID4B	1	TCT	-	-	-	1	0	1	0	1	0	0	0	0	702	54	5	5	913	286
PAK1	5058	broad.mit.edu	37	11	77069990	77069992	+	In_Frame_Del	DEL	CAT	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77069990_77069992delCAT	uc001oyh.3	-	6	1081_1083	c.548_550delATG	c.(547-552)GATGCT>GCT	p.D183del	PAK1_uc010rso.1_In_Frame_Del_p.D85del|PAK1_uc001oyg.3_In_Frame_Del_p.D183del|PAK1_uc001oyi.1_In_Frame_Del_p.D183del|PAK1_uc010rsn.1_5'UTR	NM_002576	NP_002567	Q13153	PAK1_HUMAN	p21-activated kinase 1 isoform 2	183	Interaction with CRIPAK.				apoptosis|axon guidance|cytoskeleton organization|ER-nucleus signaling pathway|positive regulation of JUN kinase activity|positive regulation of peptidyl-serine phosphorylation|protein autophosphorylation|T cell costimulation|T cell receptor signaling pathway	cytosol|focal adhesion|Golgi apparatus	ATP binding|collagen binding|protein binding|protein serine/threonine kinase activity			skin(2)|stomach(1)|lung(1)	4	all_cancers(14;1.75e-18)					GGTGGGGTAGcatcatcatcatc	0.429					735											0.06			8	118		---	---	---	---						capture_indel	In_Frame_Del	DEL	77069990	77069992	PAK1	11	CAT	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	11303	286
RB1	5925	broad.mit.edu	37	13	48919241	48919244	+	Frame_Shift_Del	DEL	AAAG	-	-	rs121913296		TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48919241_48919244delAAAG	uc001vcb.2	+	4	572_575	c.406_409delAAAG	c.(406-411)AAAGAAfs	p.K136fs	RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	136_137			E -> D (in RB; unilateral form).		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)|p.E137*(2)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TAACTTACTAAAAGAAATTGATAC	0.284			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.31			20	44		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	48919241	48919244	RB1	13	AAAG	-	-	-	1	0	1	0	1	0	0	0	0	13	1	5	5	12993	286
NQO1	1728	broad.mit.edu	37	16	69760486	69760487	+	Translation_Start_Site	DEL	TT	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:69760486_69760487delTT	uc002exp.2	-	1	47_48	c.-144_-143delAA	c.(-146--141)ATAAGA>ATGA		NQO1_uc010cfm.2_5'Flank|NQO1_uc002exq.2_Translation_Start_Site|NQO1_uc002exr.2_Translation_Start_Site|NQO1_uc010vll.1_Translation_Start_Site	NM_000903	NP_000894	P15559	NQO1_HUMAN	NAD(P)H menadione oxidoreductase 1,						nitric oxide biosynthetic process|regulation of cellular amino acid metabolic process|response to toxin|synaptic transmission, cholinergic|xenobiotic metabolic process	cytosol	coenzyme binding|cytochrome-b5 reductase activity|electron carrier activity|NAD(P)H dehydrogenase (quinone) activity				0					Dicumarol(DB00266)|Menadione(DB00170)	GCATTCTCTCTTATATATCCTG	0.644																0.38			5	8		---	---	---	---						capture_indel	Translation_Start_Site	DEL	69760486	69760487	NQO1	16	TT	-	-	-	1	0	1	0	1	0	0	0	0	716	56	5	5	10518	286
ALPP	250	broad.mit.edu	37	2	233243529	233243531	+	In_Frame_Del	DEL	TGC	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233243529_233243531delTGC	uc002vsq.2	+	1	182_184	c.17_19delTGC	c.(16-21)ATGCTG>ATG	p.L13del	ALPP_uc002vsr.2_5'Flank	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein	13						anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GGGCCCTGCAtgctgctgctgct	0.542																0.09			7	74		---	---	---	---						capture_indel	In_Frame_Del	DEL	233243529	233243531	ALPP	2	TGC	-	-	-	1	0	1	0	1	0	0	0	0	663	51	5	5	548	286
PIK3R1	5295	broad.mit.edu	37	5	67589590	67589591	+	In_Frame_Ins	INS	-	TAT	TAT			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589590_67589591insTAT	uc003jva.2	+	11	1913_1914	c.1353_1354insTAT	c.(1351-1356)insTAT	p.452_453insY	PIK3R1_uc003jvb.2_In_Frame_Ins_p.452_453insY|PIK3R1_uc003jvc.2_In_Frame_Ins_p.152_153insY|PIK3R1_uc003jvd.2_In_Frame_Ins_p.182_183insY|PIK3R1_uc003jve.2_In_Frame_Ins_p.131_132insY|PIK3R1_uc011crb.1_In_Frame_Ins_p.122_123insY	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	452_453					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.D434_Q475del(2)|p.H450_E451del(2)|p.G446_Y452>VI(1)|p.Y452_Q455>SGGSRIK(1)|p.?(1)|p.E451_Y452del(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	AATTACATGAATATAACACTCA	0.277					370	Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			0.25			27	80		---	---	---	---						capture_indel	In_Frame_Ins	INS	67589590	67589591	PIK3R1	5	-	TAT	TAT	TAT	1	0	1	1	0	0	0	0	0	50	4	5	5	11821	286
NFKBIL2	4796	broad.mit.edu	37	8	145654644	145654644	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145654644delC	uc011llg.1	-	26	4034	c.4019delG	c.(4018-4020)TGCfs	p.C1340fs	VPS28_uc003zcr.1_5'Flank|VPS28_uc003zcs.1_5'Flank|VPS28_uc003zct.1_5'Flank	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	1340	LRR 7.				cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GCGTCTGCTGCACAGCTGCAG	0.721																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	145654644	145654644	NFKBIL2	8	C	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	10289	286
NAA35	60560	broad.mit.edu	37	9	88576949	88576950	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:88576949_88576950delTC	uc004aoi.3	+	6	507_508	c.370_371delTC	c.(370-372)TCAfs	p.S124fs	NAA35_uc004aoj.3_Frame_Shift_Del_p.S124fs|NAA35_uc004aok.1_Frame_Shift_Del_p.S124fs	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein	124					smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						AGAAGGCCATTCACTGGCACAG	0.366																0.30			20	46		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	88576949	88576950	NAA35	9	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	10033	286
KDM6A	7403	broad.mit.edu	37	X	44923045	44923048	+	Frame_Shift_Del	DEL	CTAT	-	-			TCGA-76-6662-01	TCGA-76-6662-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:44923045_44923048delCTAT	uc004dge.3	+	16	2281_2284	c.1906_1909delCTAT	c.(1906-1911)CTATCTfs	p.L636fs	KDM6A_uc010nhk.2_Frame_Shift_Del_p.L602fs|KDM6A_uc011mkz.1_Frame_Shift_Del_p.L688fs|KDM6A_uc011mla.1_Frame_Shift_Del_p.L591fs|KDM6A_uc011mlb.1_Frame_Shift_Del_p.L643fs|KDM6A_uc011mlc.1_Frame_Shift_Del_p.L340fs|KDM6A_uc011mld.1_Frame_Shift_Del_p.L275fs	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	636_637					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						GAAAAACCAACTATCTAACTCCAC	0.446	Colon(129;1273 1667 15230 27352 52914)				372	D|N|F|S		renal|oesophageal SCC|MM								0.46			6	7		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	44923045	44923048	KDM6A	23	CTAT	-	-	-	1	0	1	0	1	0	0	0	0	259	20	5	5	8059	286
