Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CLCN6	1185	broad.mit.edu	37	1	11897130	11897130	+	Missense_Mutation	SNP	G	C	C	rs137976806		TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11897130G>C	uc001ate.3	+	19	2168	c.2055G>C	c.(2053-2055)GAG>GAC	p.E685D	CLCN6_uc010oat.1_Missense_Mutation_p.E401D|CLCN6_uc010oau.1_Missense_Mutation_p.E663D	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	685	Cytoplasmic (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CATCCAGCGAGCTACGGAACA	0.622																0.2	39.510141	45.368436	14	56	KEEP	---	---	---	---	3	13	27	39	-1	capture	Missense_Mutation	SNP	11897130	11897130	CLCN6	1	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	3432	16
CSMD2	114784	broad.mit.edu	37	1	34035009	34035009	+	Missense_Mutation	SNP	T	C	C	rs143469891	byFrequency;by1000genomes	TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:34035009T>C	uc001bxn.1	-	53	8131	c.8102A>G	c.(8101-8103)AAT>AGT	p.N2701S	CSMD2_uc001bxm.1_Missense_Mutation_p.N2699S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2701	Sushi 17.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCAGAGCCCATTGGCCATGCA	0.547																0.207547	59.191638	67.590165	22	84	KEEP	---	---	---	---	12	13	42	57	-1	capture	Missense_Mutation	SNP	34035009	34035009	CSMD2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	3910	16
ZC3H12A	80149	broad.mit.edu	37	1	37948728	37948728	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37948728G>A	uc001cbb.3	+	6	1466	c.1316G>A	c.(1315-1317)GGC>GAC	p.G439D	ZC3H12A_uc001cbc.1_Missense_Mutation_p.G234D	NM_025079	NP_079355	Q5D1E8	ZC12A_HUMAN	zinc finger CCCH-type containing 12A	439					angiogenesis|apoptosis|cell differentiation	cytoplasm|nucleus|plasma membrane	endonuclease activity|metal ion binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGGACTCGGGCATTGGCTCC	0.662																0.058824	-3.816967	6.579044	3	48	KEEP	---	---	---	---	2	1	26	28	-1	capture	Missense_Mutation	SNP	37948728	37948728	ZC3H12A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17441	16
CACNA1E	777	broad.mit.edu	37	1	181700365	181700365	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:181700365C>A	uc001gow.2	+	19	2460	c.2295C>A	c.(2293-2295)CAC>CAA	p.H765Q	CACNA1E_uc009wxs.2_Intron|CACNA1E_uc001gox.1_5'Flank|CACNA1E_uc009wxt.2_5'Flank	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	765	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GCAGCAGCCACCTGTATGTGT	0.522																0.169811	18.345563	23.810262	9	44	KEEP	---	---	---	---	5	5	34	17	0.5	capture	Missense_Mutation	SNP	181700365	181700365	CACNA1E	1	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	2518	16
OR4C6	219432	broad.mit.edu	37	11	55433335	55433335	+	Silent	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55433335G>A	uc001nht.3	+	3	958	c.693G>A	c.(691-693)CGG>CGA	p.R231R	OR4C6_uc010rik.1_Silent_p.R231R	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						CTAAAGGGCGGCACAAAGCCC	0.507																0.025316	-48.214957	10.926263	6	231	KEEP	---	---	---	---	1	6	121	136	-1	capture	Silent	SNP	55433335	55433335	OR4C6	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	10956	16
HELB	92797	broad.mit.edu	37	12	66725048	66725048	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66725048G>T	uc001sti.2	+	12	2813	c.2785G>T	c.(2785-2787)GAG>TAG	p.E929*	HELB_uc010ssz.1_RNA|HELB_uc009zqt.1_RNA	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B	929					DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		GATTGCAGAGGAGTCTCAGCT	0.532																0.247934	72.289353	79.285597	30	91	KEEP	---	---	---	---	13	23	46	59	0.361111111111	capture	Nonsense_Mutation	SNP	66725048	66725048	HELB	12	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	6971	16
RB1	5925	broad.mit.edu	37	13	49039505	49039505	+	Splice_Site	SNP	G	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49039505G>T	uc001vcb.2	+	23	2655	c.2489_splice	c.e23+1	p.R830_splice		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAAGATCAAGGTGTGTGTTTT	0.358			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.274194	51.157509	53.999128	17	45	KEEP	---	---	---	---	12	7	30	19	0.631578947368	capture	Splice_Site	SNP	49039505	49039505	RB1	13	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	12993	16
ZSCAN29	146050	broad.mit.edu	37	15	43658653	43658653	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43658653G>A	uc001zrk.1	-	3	1024	c.877C>T	c.(877-879)CGG>TGG	p.R293W	ZSCAN29_uc001zrj.1_Missense_Mutation_p.R173W|ZSCAN29_uc010bdf.1_Missense_Mutation_p.R292W|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Intron|ZSCAN29_uc001zrm.2_Missense_Mutation_p.R292W	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	293					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		TCCAGGGTCCGGAGGAAGCCA	0.542																0.256198	79.052752	85.590619	31	90	KEEP	---	---	---	---	19	16	58	51	-1	capture	Missense_Mutation	SNP	43658653	43658653	ZSCAN29	15	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	18112	16
FANCI	55215	broad.mit.edu	37	15	89859689	89859689	+	Nonstop_Mutation	SNP	A	C	C			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89859689A>C	uc010bnp.1	+	38	4076	c.3986A>C	c.(3985-3987)TAA>TCA	p.*1329S	FANCI_uc002bnm.1_Nonstop_Mutation_p.*1269S|FANCI_uc002bnn.1_RNA|FANCI_uc002bnp.1_Nonstop_Mutation_p.*1089S|FANCI_uc002bnq.1_Nonstop_Mutation_p.*742S|POLG_uc002bns.3_3'UTR|POLG_uc002bnr.3_3'UTR	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I isoform	1329					cell cycle|DNA repair	nucleoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					AGGAAAAAATAAATGAAATGC	0.438					1164						Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				0.384615	36.745171	37.048263	10	16	KEEP	---	---	---	---	6	4	9	7	-1	capture	Nonstop_Mutation	SNP	89859689	89859689	FANCI	15	A	C	C	C	1	0	0	0	0	0	0	0	0	167	13	5	4	5615	16
CHST5	23563	broad.mit.edu	37	16	75563927	75563927	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75563927C>T	uc002fei.2	-	3	1751	c.356G>A	c.(355-357)CGC>CAC	p.R119H	CHST5_uc002fej.1_Missense_Mutation_p.R125H	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	119	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						AAAGATAGAGCGCATCAGGTC	0.617																0.256098	54.137931	58.560571	21	61	KEEP	---	---	---	---	9	12	33	36	-1	capture	Missense_Mutation	SNP	75563927	75563927	CHST5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3372	16
KARS	3735	broad.mit.edu	37	16	75670442	75670442	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:75670442C>G	uc002feq.2	-	4	440	c.392G>C	c.(391-393)AGG>ACG	p.R131T	KARS_uc002fer.2_Missense_Mutation_p.R159T|KARS_uc002fes.2_5'UTR|KARS_uc010cgz.2_5'UTR	NM_005548	NP_005539	Q15046	SYK_HUMAN	lysyl-tRNA synthetase isoform 2	131					interspecies interaction between organisms|lysyl-tRNA aminoacylation|tRNA processing	cytosol|extracellular region|mitochondrial matrix|nucleus|plasma membrane|soluble fraction	ATP binding|lysine-tRNA ligase activity|metal ion binding|tRNA binding			ovary(2)	2					L-Lysine(DB00123)	GGCATGGATCCTACCTAGAAA	0.403																0.23301	139.093982	152.535333	48	158	KEEP	---	---	---	---	28	24	73	93	-1	capture	Missense_Mutation	SNP	75670442	75670442	KARS	16	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	7903	16
TP53	7157	broad.mit.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578457C>T	uc002gim.2	-	5	667	c.473G>A	c.(472-474)CGC>CAC	p.R158H	TP53_uc002gig.1_Missense_Mutation_p.R158H|TP53_uc002gih.2_Missense_Mutation_p.R158H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26H|TP53_uc010cng.1_Missense_Mutation_p.R26H|TP53_uc002gii.1_Missense_Mutation_p.R26H|TP53_uc010cnh.1_Missense_Mutation_p.R158H|TP53_uc010cni.1_Missense_Mutation_p.R158H|TP53_uc002gij.2_Missense_Mutation_p.R158H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65H|TP53_uc002gio.2_Missense_Mutation_p.R26H|TP53_uc010vug.1_Missense_Mutation_p.R119H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R158H(58)|p.R158L(55)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R65L(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*21(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCCATGGCGCGGACGCGGGT	0.627	Pancreas(47;798 1329 9957 10801)		111	p.R158H(MOLT16-Tumor)|p.R158L(NCIH747-Tumor)|p.R158P(NCIH2110-Tumor)|p.R158L(NCIH661-Tumor)|p.R158L(NCIH441-Tumor)|p.R158H(ST486-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.303797	64.170053	66.884067	24	55	KEEP	---	---	---	---	15	15	27	31	-1	capture	Missense_Mutation	SNP	7578457	7578457	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	16
CYP4F2	8529	broad.mit.edu	37	19	15989675	15989675	+	Missense_Mutation	SNP	C	T	T	rs143677430	byFrequency	TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15989675C>T	uc002nbs.1	-	13	1519	c.1469G>A	c.(1468-1470)CGC>CAC	p.R490H	CYP4F2_uc010xot.1_Missense_Mutation_p.R341H	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,	490					leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						AGGCAGGACGCGGAAGCGCAG	0.672																0.089286	2.469217	11.974563	5	51	KEEP	---	---	---	---	4	3	33	32	-1	capture	Missense_Mutation	SNP	15989675	15989675	CYP4F2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4148	16
ZNF578	147660	broad.mit.edu	37	19	53014344	53014344	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53014344G>T	uc002pzp.3	+	6	954	c.710G>T	c.(709-711)GGC>GTC	p.G237V		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	12	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AATGAGACTGGCGAAGCCTTT	0.313																0.143885	34.001575	50.979824	20	119	KEEP	---	---	---	---	10	10	60	69	0.5	capture	Missense_Mutation	SNP	53014344	53014344	ZNF578	19	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	17889	16
LAIR1	3903	broad.mit.edu	37	19	54875933	54875933	+	Silent	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54875933G>A	uc002qfk.1	-	2	349	c.39C>T	c.(37-39)CTC>CTT	p.L13L	LAIR1_uc002qfl.1_Silent_p.L13L|LAIR1_uc002qfm.1_Silent_p.L13L|LAIR1_uc002qfn.1_Silent_p.L13L|LAIR1_uc010yex.1_Silent_p.L7L|LAIR1_uc002qfo.2_Intron	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like	13						integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		GGGCCAGGCAGAGCACTGGAA	0.617																0.25	59.0805	64.307424	23	69	KEEP	---	---	---	---	17	11	41	44	-1	capture	Silent	SNP	54875933	54875933	LAIR1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	418	33	2	2	8522	16
TTN	7273	broad.mit.edu	37	2	179458768	179458768	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179458768C>T	uc010zfg.1	-	246	50872	c.50648G>A	c.(50647-50649)CGT>CAT	p.R16883H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R10578H|TTN_uc010zfi.1_Missense_Mutation_p.R10511H|TTN_uc010zfj.1_Missense_Mutation_p.R10386H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17810							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAATCTGAACGTTTGGCCTT	0.418					8722											0.259804	140.483525	151.139411	53	151	KEEP	---	---	---	---	26	32	73	90	-1	capture	Missense_Mutation	SNP	179458768	179458768	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	16
SF3B1	23451	broad.mit.edu	37	2	198267698	198267698	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198267698C>T	uc002uue.2	-	13	1829	c.1781G>A	c.(1780-1782)CGA>CAA	p.R594Q		NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	594	HEAT 2.			R -> L (in Ref. 1; AAC97189).	nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AATGATCTCTCGGCCTTCCAC	0.338																0.076923	-0.004783	14.280268	6	72	KEEP	---	---	---	---	4	4	30	51	-1	capture	Missense_Mutation	SNP	198267698	198267698	SF3B1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14042	16
PTPRA	5786	broad.mit.edu	37	20	3003414	3003414	+	Missense_Mutation	SNP	G	A	A	rs117251752	by1000genomes	TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3003414G>A	uc010zqd.1	+	15	1758	c.1441G>A	c.(1441-1443)GTG>ATG	p.V481M	PTPRA_uc002whj.2_Missense_Mutation_p.V470M|PTPRA_uc002whk.2_Missense_Mutation_p.V461M|PTPRA_uc002whl.2_Missense_Mutation_p.V461M|PTPRA_uc002whm.2_Missense_Mutation_p.V237M|PTPRA_uc002whn.2_Missense_Mutation_p.V461M|PTPRA_uc002who.2_Missense_Mutation_p.V133M	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	470	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						GAAGGTGGACGTGTATGGCTT	0.577																0.247059	52.63485	57.58361	21	64	KEEP	---	---	---	---	11	10	31	36	-1	capture	Missense_Mutation	SNP	3003414	3003414	PTPRA	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12690	16
KIF16B	55614	broad.mit.edu	37	20	16496298	16496298	+	Silent	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16496298G>A	uc002wpg.1	-	4	401	c.243C>T	c.(241-243)ACC>ACT	p.T81T	KIF16B_uc010gch.1_Silent_p.T81T|KIF16B_uc010gci.1_Silent_p.T81T|KIF16B_uc010gcj.1_Silent_p.T81T	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	81	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CTGTGCCGAGGGTTTTGAAAA	0.373																0.115385	13.01998	24.382527	9	69	KEEP	---	---	---	---	4	6	42	30	-1	capture	Silent	SNP	16496298	16496298	KIF16B	20	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	8200	16
WFDC8	90199	broad.mit.edu	37	20	44181787	44181787	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44181787T>C	uc002xow.2	-	5	653	c.574A>G	c.(574-576)AGG>GGG	p.R192G	WFDC8_uc002xox.2_Missense_Mutation_p.R192G	NM_181510	NP_852611	Q8IUA0	WFDC8_HUMAN	WAP four-disulfide core domain 8 precursor	192	WAP 2.					extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				GTCCAGGCCCTGGCACAAACA	0.502																0.198529	71.249404	82.751057	27	109	KEEP	---	---	---	---	9	21	52	69	-1	capture	Missense_Mutation	SNP	44181787	44181787	WFDC8	20	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	17237	16
TPTE	7179	broad.mit.edu	37	21	10951271	10951271	+	Silent	SNP	T	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10951271T>A	uc002yip.1	-	10	809	c.441A>T	c.(439-441)GTA>GTT	p.V147V	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Silent_p.V129V|TPTE_uc002yir.1_Silent_p.V109V|TPTE_uc010gkv.1_Silent_p.V9V	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	147	Helical; (Potential).				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTTACCTTTCTACAAATACTC	0.229																0.12766	27.350086	46.407096	18	123	KEEP	---	---	---	---	8	11	58	72	-1	capture	Silent	SNP	10951271	10951271	TPTE	21	T	A	A	A	1	0	0	0	0	0	0	0	1	678	53	4	4	16313	16
PLCD1	5333	broad.mit.edu	37	3	38052749	38052749	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38052749G>A	uc003chn.2	-	5	870	c.746C>T	c.(745-747)GCG>GTG	p.A249V	PLCD1_uc003chm.2_Missense_Mutation_p.A270V	NM_006225	NP_006216	P51178	PLCD1_HUMAN	phospholipase C, delta 1 isoform 2	249					intracellular signal transduction|lipid catabolic process|phospholipid metabolic process	cytoplasm	calcium ion binding|GTPase activating protein binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GAGGGCCAGCGCAGGCCCTGC	0.687																0.051724	-5.798593	6.508301	3	55	KEEP	---	---	---	---	0	3	23	36	-1	capture	Missense_Mutation	SNP	38052749	38052749	PLCD1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11934	16
CX3CR1	1524	broad.mit.edu	37	3	39307436	39307436	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39307436C>T	uc003cjl.2	-	2	657	c.565G>A	c.(565-567)GTG>ATG	p.V189M		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	189	Extracellular (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TTGCGGAGCACGGGCCAGATT	0.483																0.20603	92.170446	108.115465	41	158	KEEP	---	---	---	---	20	23	81	91	-1	capture	Missense_Mutation	SNP	39307436	39307436	CX3CR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4035	16
CLEC3B	7123	broad.mit.edu	37	3	45077251	45077251	+	Silent	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45077251C>T	uc003cok.3	+	3	540	c.444C>T	c.(442-444)ACC>ACT	p.T148T	CLEC3B_uc003col.2_Silent_p.T106T	NM_003278	NP_003269	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	148	C-type lectin.				skeletal system development	extracellular space	protein binding|sugar binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGACATGACCGGCGCCCGCA	0.667	GBM(139;1487 3263 30871)															0.111111	4.402725	9.760377	4	32	KEEP	---	---	---	---	2	2	12	22	-1	capture	Silent	SNP	45077251	45077251	CLEC3B	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3476	16
ARMC8	25852	broad.mit.edu	37	3	137991889	137991889	+	Silent	SNP	A	G	G			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137991889A>G	uc003esa.1	+	18	1885	c.1518A>G	c.(1516-1518)TTA>TTG	p.L506L	TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Intron|TXNDC6_uc003ese.1_Intron|ARMC8_uc011bmf.1_Silent_p.L489L|ARMC8_uc011bmg.1_Silent_p.L453L|ARMC8_uc011bmh.1_Silent_p.L447L|ARMC8_uc003esb.1_Silent_p.L478L|ARMC8_uc003esc.1_Silent_p.L278L|ARMC8_uc003esf.1_Silent_p.L89L	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2	520	ARM 11.						binding				0						TCCGGTTATTATCAGATTCAG	0.368																0.213675	74.817976	83.670859	25	92	KEEP	---	---	---	---	14	11	46	54	-1	capture	Silent	SNP	137991889	137991889	ARMC8	3	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	950	16
TEC	7006	broad.mit.edu	37	4	48140944	48140944	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48140944C>T	uc003gxz.2	-	16	1722	c.1631G>A	c.(1630-1632)AGC>AAC	p.S544N		NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase	544	Protein kinase.				intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						ATCTGATTTGCTGCTGAAGCG	0.438					498											0.28	77.85035	82.206782	28	72	KEEP	---	---	---	---	12	18	37	39	-1	capture	Missense_Mutation	SNP	48140944	48140944	TEC	4	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	15627	16
KIAA0922	23240	broad.mit.edu	37	4	154517485	154517485	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:154517485G>A	uc003inm.3	+	20	2120	c.2068G>A	c.(2068-2070)GTA>ATA	p.V690I	KIAA0922_uc010ipp.2_Missense_Mutation_p.V691I|KIAA0922_uc010ipq.2_Missense_Mutation_p.V459I	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	690	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				AAGGGTTGGCGTAGTTTTCAC	0.423																0.207547	101.089592	117.882894	44	168	KEEP	---	---	---	---	21	26	88	85	-1	capture	Missense_Mutation	SNP	154517485	154517485	KIAA0922	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8123	16
CYP21A2	1589	broad.mit.edu	37	6	32006249	32006249	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32006249G>A	uc003nze.1	+	1	168	c.50G>A	c.(49-51)CGC>CAC	p.R17H	CYP21A2_uc003nzf.1_Missense_Mutation_p.R17H	NM_000500	NP_000491	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A,	16					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						GCTGGCGCCCGCCTGCTGTGG	0.542	Melanoma(174;1669 1998 3915 34700 46447)															0.571429	12.60096	12.632162	4	3	KEEP	---	---	---	---	1	4	1	4	-1	capture	Missense_Mutation	SNP	32006249	32006249	CYP21A2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4113	16
COL12A1	1303	broad.mit.edu	37	6	75797410	75797410	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:75797410G>A	uc003phs.2	-	65	9230	c.9064C>T	c.(9064-9066)CCC>TCC	p.P3022S	COL12A1_uc003pht.2_Missense_Mutation_p.P1858S	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	3022	Triple-helical region (COL1) with 2 imperfections.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						GGGCCAGGGGGACCTCTTGAA	0.522																0.252336	69.174755	75.134598	27	80	KEEP	---	---	---	---	20	10	48	47	-1	capture	Missense_Mutation	SNP	75797410	75797410	COL12A1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3634	16
MEST	4232	broad.mit.edu	37	7	130139717	130139717	+	Silent	SNP	T	A	A			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130139717T>A	uc003vqg.2	+	7	754	c.537T>A	c.(535-537)GGT>GGA	p.G179G	MEST_uc003vqc.2_Silent_p.G170G|MEST_uc003vqd.2_Silent_p.G170G|MEST_uc003vqf.2_Silent_p.G170G|MEST_uc011kph.1_Silent_p.G165G|MEST_uc010lmg.2_Silent_p.G179G	NM_002402	NP_002393	Q5EB52	MEST_HUMAN	mesoderm specific transcript isoform a	179					mesoderm development	endoplasmic reticulum membrane|integral to membrane	hydrolase activity|protein binding			ovary(2)	2	Melanoma(18;0.0435)					CTTCTACAGGTATCTTTCCTG	0.284	Colon(126;2182 2305 6517 35181)															0.180645	58.91529	73.769624	28	127	KEEP	---	---	---	---	16	17	77	63	-1	capture	Silent	SNP	130139717	130139717	MEST	7	T	A	A	A	1	0	0	0	0	0	0	0	1	730	57	4	4	9396	16
OR2F2	135948	broad.mit.edu	37	7	143632696	143632696	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143632696T>G	uc011ktv.1	+	1	371	c.371T>G	c.(370-372)GTG>GGG	p.V124G		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	124	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					GACCGCCATGTGGCTGTGTCT	0.562																0.10625	25.367887	49.987587	17	143	KEEP	---	---	---	---	13	9	91	83	-1	capture	Missense_Mutation	SNP	143632696	143632696	OR2F2	7	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	10901	16
FBXO32	114907	broad.mit.edu	37	8	124518764	124518764	+	Silent	SNP	C	T	T			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124518764C>T	uc003yqr.2	-	7	894	c.702G>A	c.(700-702)CTG>CTA	p.L234L	FBXO32_uc003yqq.2_Silent_p.L89L|FBXO32_uc010mdk.2_Silent_p.L141L	NM_058229	NP_478136	Q969P5	FBX32_HUMAN	F-box only protein 32 isoform 1	234	F-box.									skin(3)|breast(2)|lung(1)	6	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GCATGATGTTCAGTTGTAGGC	0.622																0.104762	7.222859	23.617881	11	94	KEEP	---	---	---	---	4	9	41	72	-1	capture	Silent	SNP	124518764	124518764	FBXO32	8	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	5688	16
TEK	7010	broad.mit.edu	37	9	27206739	27206739	+	Missense_Mutation	SNP	C	T	T	rs147231791	by1000genomes	TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27206739C>T	uc003zqi.3	+	15	2966	c.2524C>T	c.(2524-2526)CGC>TGC	p.R842C	TEK_uc011lno.1_Missense_Mutation_p.R799C|TEK_uc011lnp.1_Missense_Mutation_p.R694C|TEK_uc003zqj.1_Missense_Mutation_p.R776C	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	842	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TCTTAAGGCGCGCATCAAGAA	0.453					493											0.086957	1.267048	9.209635	4	42	KEEP	---	---	---	---	1	4	21	29	-1	capture	Missense_Mutation	SNP	27206739	27206739	TEK	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15636	16
FLJ46321	389763	broad.mit.edu	37	9	84607173	84607173	+	Silent	SNP	A	G	G			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:84607173A>G	uc004amn.2	+	4	1835	c.1788A>G	c.(1786-1788)CTA>CTG	p.L596L		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	596						integral to membrane					0						CTAGTCCTCTATTCCTGATTA	0.512																0.190141	73.145543	85.888098	27	115	KEEP	---	---	---	---	7	21	60	59	-1	capture	Silent	SNP	84607173	84607173	FLJ46321	9	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	5876	16
C14orf37	145407	broad.mit.edu	37	14	58605421	58605421	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0130-01	TCGA-06-0130-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:58605421delT	uc001xdc.2	-	2	767	c.656delA	c.(655-657)AATfs	p.N219fs	C14orf37_uc010tro.1_Frame_Shift_Del_p.N257fs|C14orf37_uc001xdd.2_Frame_Shift_Del_p.N219fs|C14orf37_uc001xde.2_Frame_Shift_Del_p.N219fs	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	219	Extracellular (Potential).					integral to membrane	binding				0						AGTCTTTGGATTGGTGGTTAG	0.448																0.25			42	126		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	58605421	58605421	C14orf37	14	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	1757	16
