Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
EPHB2	2048	broad.mit.edu	37	1	23208926	23208926	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23208926G>A	uc009vqj.1	+	6	1523	c.1378G>A	c.(1378-1380)GAC>AAC	p.D460N	EPHB2_uc001bge.2_Missense_Mutation_p.D460N|EPHB2_uc001bgf.2_Missense_Mutation_p.D460N|EPHB2_uc010odu.1_Missense_Mutation_p.D460N	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	460	Fibronectin type-III 2.|Extracellular (Potential).				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GTCCCAGCCGGACCAGCCCAA	0.607					437							Hereditary_Prostate_Cancer				0.038095	-16.554873	7.637677	4	101	KEEP	---	---	---	---	2	2	63	58	-1	capture	Missense_Mutation	SNP	23208926	23208926	EPHB2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5130	22
AMPD2	271	broad.mit.edu	37	1	110171969	110171969	+	Silent	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110171969G>A	uc009wfh.1	+	15	2423	c.1881G>A	c.(1879-1881)GTG>GTA	p.V627V	AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Silent_p.V546V|AMPD2_uc001dyc.1_Silent_p.V627V|AMPD2_uc010ovr.1_Silent_p.V552V|AMPD2_uc001dyd.1_Silent_p.V508V|AMPD2_uc001dye.1_5'UTR	NM_004037	NP_004028	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2 (isoform L)	627					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|breast(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		TTGACAGCGTGGATGATGAGT	0.587																0.041322	-38.77641	16.049999	10	232	KEEP	---	---	---	---	8	3	135	119	-1	capture	Silent	SNP	110171969	110171969	AMPD2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	586	22
COPA	1314	broad.mit.edu	37	1	160268961	160268961	+	Silent	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160268961G>A	uc009wti.2	-	18	2155	c.1761C>T	c.(1759-1761)CCC>CCT	p.P587P	COPA_uc001fvv.3_Silent_p.P596P	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	587					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGAGTACCCGGGGACGACACT	0.463																0.038251	-27.938063	14.247356	7	176	KEEP	---	---	---	---	4	3	116	74	-1	capture	Silent	SNP	160268961	160268961	COPA	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	3692	22
EPHX1	2052	broad.mit.edu	37	1	226027691	226027691	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:226027691G>A	uc001hpk.2	+	6	964	c.884G>A	c.(883-885)AGG>AAG	p.R295K	EPHX1_uc001hpl.2_Missense_Mutation_p.R295K	NM_001136018	NP_001129490	P07099	HYEP_HUMAN	epoxide hydrolase 1	295					aromatic compound catabolic process|response to toxin	endoplasmic reticulum membrane|integral to membrane|microsome	cis-stilbene-oxide hydrolase activity|epoxide hydrolase activity			ovary(3)|lung(1)	4	Breast(184;0.197)					AGCCTGATGAGGGAGAGCGGC	0.607																0.026786	-21.380772	6.333338	3	109	KEEP	---	---	---	---	1	3	65	57	-1	capture	Missense_Mutation	SNP	226027691	226027691	EPHX1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	5134	22
LRRC18	474354	broad.mit.edu	37	10	50121549	50121549	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50121549G>A	uc001jhd.2	-	1	732	c.652C>T	c.(652-654)CGG>TGG	p.R218W	WDFY4_uc001jha.3_Intron|LRRC18_uc001jhe.1_Missense_Mutation_p.R218W	NM_001006939	NP_001006940	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	218						cytoplasm				ovary(1)|pancreas(1)	2						AGGTTGTCCCGGGCGTTTTGG	0.498																0.051948	-16.33204	16.377014	8	146	KEEP	---	---	---	---	7	2	94	60	-1	capture	Missense_Mutation	SNP	50121549	50121549	LRRC18	10	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8890	22
OR56B1	387748	broad.mit.edu	37	11	5758585	5758585	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5758585T>C	uc001mbt.1	+	1	839	c.839T>C	c.(838-840)ATT>ACT	p.I280T	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001005180	NP_001005180	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B,	280	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		GCTACTTTGATTCCAGTTCTA	0.428																0.042471	-61.596084	54.794466	22	496	KEEP	---	---	---	---	14	11	351	229	-1	capture	Missense_Mutation	SNP	5758585	5758585	OR56B1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11041	22
TRPC6	7225	broad.mit.edu	37	11	101323720	101323720	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101323720G>A	uc001pgk.3	-	13	3187	c.2762C>T	c.(2761-2763)TCC>TTC	p.S921F	TRPC6_uc009ywy.2_Missense_Mutation_p.S805F	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	921	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGGTTCCATGGATAATTTCTC	0.348	Colon(166;1315 1927 11094 12848 34731)															0.044177	-32.586052	22.789851	11	238	KEEP	---	---	---	---	8	4	163	115	-1	capture	Missense_Mutation	SNP	101323720	101323720	TRPC6	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16466	22
ITGA5	3678	broad.mit.edu	37	12	54793512	54793512	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54793512G>A	uc001sga.2	-	27	2826	c.2758C>T	c.(2758-2760)CGC>TGC	p.R920C		NM_002205	NP_002196	P08648	ITA5_HUMAN	integrin alpha 5 precursor	920	Extracellular (Potential).				angiogenesis|axon guidance|blood coagulation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|wound healing, spreading of epidermal cells	alphav-beta3 integrin-vitronectin complex|integrin complex|ruffle	platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			ovary(2)	2						AGCTCACAGCGCAGCCTGAAA	0.552				p.R920C(CORL88-Tumor)	322									OREG0021897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.022346	-38.743151	6.802592	4	175	KEEP	---	---	---	---	5	0	108	88	-1	capture	Missense_Mutation	SNP	54793512	54793512	ITGA5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7802	22
OR4K13	390433	broad.mit.edu	37	14	20502539	20502539	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20502539A>G	uc010tkz.1	-	1	379	c.379T>C	c.(379-381)TGC>CGC	p.C127R		NM_001004714	NP_001004714	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K,	127	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AGGGGTTTGCATATGGCAACA	0.478																0.043478	-17.460588	13.351025	6	132	KEEP	---	---	---	---	4	5	66	75	-1	capture	Missense_Mutation	SNP	20502539	20502539	OR4K13	14	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	10972	22
NID2	22795	broad.mit.edu	37	14	52535489	52535489	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:52535489A>G	uc001wzo.2	-	1	458	c.224T>C	c.(223-225)CTC>CCC	p.L75P	NID2_uc010tqs.1_Missense_Mutation_p.L75P|NID2_uc010tqt.1_Missense_Mutation_p.L75P|NID2_uc001wzp.2_Missense_Mutation_p.L75P	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	75						basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					ACTTACGTAGAGGTTGCTGAA	0.612																0.047619	-10.813968	12.060458	5	100	KEEP	---	---	---	---	1	4	64	46	-1	capture	Missense_Mutation	SNP	52535489	52535489	NID2	14	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10322	22
OTX2	5015	broad.mit.edu	37	14	57269073	57269073	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:57269073C>T	uc001xcp.2	-	3	421	c.250G>A	c.(250-252)GTA>ATA	p.V84I	OTX2_uc010aou.2_Missense_Mutation_p.V84I|OTX2_uc001xcq.2_Missense_Mutation_p.V92I	NM_172337	NP_758840	P32243	OTX2_HUMAN	orthodenticle homeobox 2 isoform b	84	Homeobox.				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding			ovary(1)	1	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TTAAACCATACCTTGGAAGGG	0.418																0.029703	-38.212973	10.848225	6	196	KEEP	---	---	---	---	4	3	134	94	-1	capture	Missense_Mutation	SNP	57269073	57269073	OTX2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	11225	22
TMEM229B	161145	broad.mit.edu	37	14	67940183	67940183	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:67940183G>A	uc001xjk.2	-	3	868	c.458C>T	c.(457-459)CCC>CTC	p.P153L	TMEM229B_uc001xjj.1_RNA	NM_182526	NP_872332	Q8NBD8	T229B_HUMAN	transmembrane protein 229B	153	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(1)	1						GGCGCCGCTGGGCTCCCCGGG	0.647																0.034483	-13.737457	6.76735	3	84	KEEP	---	---	---	---	2	2	57	40	-1	capture	Missense_Mutation	SNP	67940183	67940183	TMEM229B	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16031	22
KLC1	3831	broad.mit.edu	37	14	104135871	104135871	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104135871C>A	uc001yno.2	+	6	1129	c.821C>A	c.(820-822)GCA>GAA	p.A274E	KLC1_uc010tyd.1_Missense_Mutation_p.A433E|KLC1_uc010tye.1_Missense_Mutation_p.A270E|KLC1_uc001ynm.1_Missense_Mutation_p.A274E|KLC1_uc001ynn.1_Missense_Mutation_p.A268E|KLC1_uc010tyf.1_Missense_Mutation_p.A274E	NM_182923	NP_891553	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 2	274	TPR 2.				blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				TACAAAGATGCAGCTAACCTA	0.303																0.044025	-20.921246	14.482461	7	152	KEEP	---	---	---	---	5	4	98	75	0.444444444444	capture	Missense_Mutation	SNP	104135871	104135871	KLC1	14	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	8254	22
HDC	3067	broad.mit.edu	37	15	50534668	50534668	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50534668C>A	uc001zxz.2	-	12	1884	c.1778G>T	c.(1777-1779)AGT>ATT	p.S593I	HDC_uc001zxy.2_Missense_Mutation_p.S336I|HDC_uc010uff.1_Missense_Mutation_p.S560I	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	593					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CTTCTGAGCACTCACTGGCAC	0.532	GBM(95;1627 1936 6910 9570)															0.021021	-75.375897	10.222539	7	326	KEEP	---	---	---	---	6	2	183	185	0.25	capture	Missense_Mutation	SNP	50534668	50534668	HDC	15	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	6942	22
MESP2	145873	broad.mit.edu	37	15	90321328	90321328	+	Silent	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90321328G>A	uc002bon.2	+	2	957	c.957G>A	c.(955-957)TCG>TCA	p.S319S	MESP2_uc010uqa.1_Silent_p.S21S	NM_001039958	NP_001035047	Q0VG99	MESP2_HUMAN	mesoderm posterior 2 homolog	319					Notch signaling pathway	nucleus	DNA binding				0	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			CCTGTCTGTCGCTGGGAGCTC	0.597																0.052632	-7.457579	8.607647	4	72	KEEP	---	---	---	---	1	3	54	31	-1	capture	Silent	SNP	90321328	90321328	MESP2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9395	22
AP3S2	10239	broad.mit.edu	37	15	90451602	90451602	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90451602G>A	uc002bos.3	-	3	366	c.211C>T	c.(211-213)CGC>TGC	p.R71C	C15orf38_uc002bot.1_RNA|C15orf38_uc002bou.2_Missense_Mutation_p.R71C	NM_182616	NP_872422	P59780	AP3S2_HUMAN	hypothetical protein LOC348110	Error:Variant_position_missing_in_P59780_after_alignment					intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			AATTTACGGCGATGGATGTGA	0.567																0.038961	-11.342432	6.329553	3	74	KEEP	---	---	---	---	4	1	59	22	-1	capture	Missense_Mutation	SNP	90451602	90451602	AP3S2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	743	22
PLCG2	5336	broad.mit.edu	37	16	81944227	81944227	+	Silent	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81944227C>T	uc002fgt.2	+	18	1988	c.1836C>T	c.(1834-1836)GCC>GCT	p.A612A	PLCG2_uc010chg.1_Silent_p.A612A	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	612	SH2 1.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						GCATCTATGCCCTCATCCAGC	0.642					1880											0.040881	-43.658631	28.439075	13	305	KEEP	---	---	---	---	9	5	166	173	-1	capture	Silent	SNP	81944227	81944227	PLCG2	16	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	11939	22
DNAH2	146754	broad.mit.edu	37	17	7668816	7668816	+	Silent	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7668816C>T	uc002giu.1	+	20	3458	c.3444C>T	c.(3442-3444)GGC>GGT	p.G1148G		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1148	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAAGACAGGCCTGATCCACT	0.463																0.064	-7.861853	16.817421	8	117	KEEP	---	---	---	---	5	3	64	65	-1	capture	Silent	SNP	7668816	7668816	DNAH2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	4559	22
MYH4	4622	broad.mit.edu	37	17	10352234	10352234	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10352234G>A	uc002gmn.2	-	31	4423	c.4312C>T	c.(4312-4314)CGA>TGA	p.R1438*	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1438	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GCATTAGATCGTTCCACATCA	0.438																0.045455	-13.787683	10.459597	5	105	KEEP	---	---	---	---	1	5	63	52	-1	capture	Nonsense_Mutation	SNP	10352234	10352234	MYH4	17	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	9947	22
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513675T>C	uc010dln.2	-	10	1973	c.1519A>G	c.(1519-1521)AAA>GAA	p.K507E	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	507	Potential.									skin(3)	3						GAATTCATTTTCTTTTCAGCC	0.284																0.034188	-20.204677	7.470574	4	113	KEEP	---	---	---	---	1	4	56	73	-1	capture	Missense_Mutation	SNP	14513675	14513675	POTEC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	12164	22
CPAMD8	27151	broad.mit.edu	37	19	17122460	17122460	+	Silent	SNP	G	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17122460G>T	uc002nfb.2	-	4	548	c.516C>A	c.(514-516)GGC>GGA	p.G172G		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	125						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						AAGCGCCCCGGCCGTCCACGG	0.672					1067											0.061947	-16.22213	6.600899	7	106	KEEP	---	---	---	---	3	4	63	45	0.428571428571	capture	Silent	SNP	17122460	17122460	CPAMD8	19	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	3760	22
ZNF626	199777	broad.mit.edu	37	19	20807475	20807475	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:20807475C>G	uc002npb.1	-	4	1358	c.1208G>C	c.(1207-1209)GGC>GCC	p.G403A	ZNF626_uc002npc.1_Missense_Mutation_p.G327A	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	403	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						AAAAGCTTTGCCACATTCTTC	0.398																0.045455	-17.611779	16.384048	7	147	KEEP	---	---	---	---	5	2	99	63	-1	capture	Missense_Mutation	SNP	20807475	20807475	ZNF626	19	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	17928	22
PRODH2	58510	broad.mit.edu	37	19	36303630	36303630	+	Silent	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36303630G>A	uc002obx.1	-	2	324	c.306C>T	c.(304-306)GGC>GGT	p.G102G		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	102					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGAAGGCCCCGCCATCAAAGC	0.652																0.103448	5.108875	14.188821	6	52	KEEP	---	---	---	---	5	1	31	29	-1	capture	Silent	SNP	36303630	36303630	PRODH2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12445	22
PSG1	5669	broad.mit.edu	37	19	43376102	43376102	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43376102C>T	uc002ovb.2	-	3	664	c.526G>A	c.(526-528)GCA>ACA	p.A176T	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.A176T|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Missense_Mutation_p.A176T|PSG1_uc010eio.1_Missense_Mutation_p.A176T|PSG1_uc002oux.1_Missense_Mutation_p.A105T|PSG1_uc002ouy.1_Missense_Mutation_p.A176T|PSG1_uc002ouz.1_Missense_Mutation_p.A176T|PSG1_uc002ova.1_Intron|PSG1_uc002ovc.2_Intron|PSG1_uc002ovd.1_Missense_Mutation_p.A176T	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	176	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				AGGTAGCTTGCGTCTGGAGTC	0.527																0.054755	-31.852852	40.597047	19	328	KEEP	---	---	---	---	13	9	196	157	-1	capture	Missense_Mutation	SNP	43376102	43376102	PSG1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12548	22
ZNF8	7554	broad.mit.edu	37	19	58806753	58806753	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58806753G>A	uc002qry.1	+	4	1709	c.1579G>A	c.(1579-1581)GGA>AGA	p.G527R	ZNF8_uc002qrz.2_RNA	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8	527					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		CTCTGCAGGCGGAGCAAAGGC	0.557																0.054945	-14.891666	23.057615	10	172	KEEP	---	---	---	---	5	6	83	99	-1	capture	Missense_Mutation	SNP	58806753	58806753	ZNF8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	18043	22
BIRC6	57448	broad.mit.edu	37	2	32740406	32740406	+	Missense_Mutation	SNP	G	A	A	rs112352145		TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32740406G>A	uc010ezu.2	+	55	11052	c.10918G>A	c.(10918-10920)GCT>ACT	p.A3640T		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3640					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GAGGAGTCTGGCTAGTTTCTG	0.438	Pancreas(94;175 1509 16028 18060 45422)				1555											0.084507	0.893364	13.336168	6	65	KEEP	---	---	---	---	4	2	42	24	-1	capture	Missense_Mutation	SNP	32740406	32740406	BIRC6	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1426	22
RGPD4	285190	broad.mit.edu	37	2	108476261	108476261	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108476261C>T	uc010ywk.1	+	12	1800	c.1718C>T	c.(1717-1719)CCT>CTT	p.P573L	RGPD4_uc002tdu.2_5'UTR|RGPD4_uc010ywl.1_RNA	NM_182588	NP_872394	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	573					intracellular transport		binding			skin(2)	2						GGCCTTCAACCTGCTCTGCTT	0.328																0.086207	6.754548	26.879163	10	106	KEEP	---	---	---	---	8	8	139	140	-1	capture	Missense_Mutation	SNP	108476261	108476261	RGPD4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	13181	22
GCC2	9648	broad.mit.edu	37	2	109103046	109103046	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109103046C>T	uc002tec.2	+	16	4026	c.3872C>T	c.(3871-3873)ACG>ATG	p.T1291M	GCC2_uc002ted.2_Missense_Mutation_p.T1190M	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1291	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						CACCAGCGTACGCTAAGTGCA	0.502																0.039216	-14.88463	8.484353	4	98	KEEP	---	---	---	---	2	3	45	57	-1	capture	Missense_Mutation	SNP	109103046	109103046	GCC2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6226	22
ITGA4	3676	broad.mit.edu	37	2	182386969	182386969	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:182386969G>A	uc002unu.2	+	18	2737	c.1974G>A	c.(1972-1974)ATG>ATA	p.M658I	ITGA4_uc010frj.1_Missense_Mutation_p.M140I|ITGA4_uc002unv.2_5'UTR	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	658	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	AGACATTGATGTTGAATGTGT	0.333																0.033784	-27.166054	7.927243	5	143	KEEP	---	---	---	---	5	0	92	62	-1	capture	Missense_Mutation	SNP	182386969	182386969	ITGA4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	7801	22
VIL1	7429	broad.mit.edu	37	2	219301876	219301876	+	Silent	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219301876C>T	uc002via.2	+	17	2066	c.2001C>T	c.(1999-2001)AAC>AAT	p.N667N	VIL1_uc010zke.1_Silent_p.N356N|VIL1_uc002vib.2_Silent_p.N667N	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	667	Gelsolin-like 6.|Core.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACATGCCAACGAGGAGGAGA	0.572																0.024691	-33.428906	7.173852	4	158	KEEP	---	---	---	---	2	2	84	92	-1	capture	Silent	SNP	219301876	219301876	VIL1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17046	22
PAX3	5077	broad.mit.edu	37	2	223084911	223084911	+	Missense_Mutation	SNP	G	A	A	rs45607236		TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223084911G>A	uc010fwo.2	-	7	1487	c.1121C>T	c.(1120-1122)TCG>TTG	p.S374L	PAX3_uc002vmt.1_Missense_Mutation_p.S374L|PAX3_uc002vmy.1_Missense_Mutation_p.S373L|PAX3_uc002vmv.1_Missense_Mutation_p.S374L|PAX3_uc002vmw.1_Missense_Mutation_p.S374L|PAX3_uc002vmx.1_Missense_Mutation_p.S374L	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	374					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAGGGCCCCGACGGAGGCAC	0.552					141	T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						0.101695	4.906043	14.241871	6	53	KEEP	---	---	---	---	5	2	36	19	-1	capture	Missense_Mutation	SNP	223084911	223084911	PAX3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11383	22
C2orf57	165100	broad.mit.edu	37	2	232457869	232457869	+	Silent	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232457869C>T	uc002vrz.2	+	1	258	c.207C>T	c.(205-207)GAC>GAT	p.D69D		NM_152614	NP_689827	Q53QW1	CB057_HUMAN	hypothetical protein LOC165100	69										ovary(1)	1		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		GAGACAAAGACAAGAGTGCAG	0.532																0.046667	-20.211521	12.670592	7	143	KEEP	---	---	---	---	1	6	91	62	-1	capture	Silent	SNP	232457869	232457869	C2orf57	2	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	2158	22
GTSF1L	149699	broad.mit.edu	37	20	42355070	42355070	+	Missense_Mutation	SNP	C	T	T	rs143516837	byFrequency	TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42355070C>T	uc002xld.2	-	1	573	c.265G>A	c.(265-267)GAT>AAT	p.D89N	GTSF1L_uc002xlc.2_Missense_Mutation_p.D89N	NM_176791	NP_789761	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like isoform 1	89							metal ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGGGTGTCATCGTTCTGCTCT	0.517																0.051546	-9.602839	11.036884	5	92	KEEP	---	---	---	---	4	1	58	40	-1	capture	Missense_Mutation	SNP	42355070	42355070	GTSF1L	20	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6816	22
SPINLW1	57119	broad.mit.edu	37	20	44171338	44171338	+	Splice_Site	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44171338C>T	uc002xou.2	-	3	423	c.391_splice	c.e3+1	p.R131_splice	SPINLW1_uc010zxc.1_Splice_Site_p.Q131_splice|SPINLW1_uc002xot.2_Splice_Site_p.R115_splice|SPINLW1_uc002xov.1_3'UTR	NM_020398	NP_065131	O95925	EPPI_HUMAN	serine peptidase inhibitor-like, with Kunitz and							extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)				CTAGGACTTACGTTTATTCTT	0.507																0.063492	-7.795833	17.186422	8	118	KEEP	---	---	---	---	3	5	72	57	-1	capture	Splice_Site	SNP	44171338	44171338	SPINLW1	20	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	14959	22
COL6A2	1292	broad.mit.edu	37	21	47537831	47537831	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47537831G>A	uc002zia.1	+	12	1179	c.1097G>A	c.(1096-1098)CGA>CAA	p.R366Q	COL6A2_uc002zhy.1_Missense_Mutation_p.R366Q|COL6A2_uc002zhz.1_Missense_Mutation_p.R366Q|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	366	Triple-helical region.|Cell attachment site (Potential).				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCAGGGGAGCGAGGAGACCAA	0.682																0.107143	2.807013	7.092933	3	25	KEEP	---	---	---	---	3	1	17	13	-1	capture	Missense_Mutation	SNP	47537831	47537831	COL6A2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3665	22
EMID1	129080	broad.mit.edu	37	22	29621149	29621149	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29621149C>T	uc003aen.2	+	4	416	c.341C>T	c.(340-342)CCC>CTC	p.P114L	EMID1_uc003aem.2_Missense_Mutation_p.P116L|EMID1_uc003aeo.2_Missense_Mutation_p.P116L|EMID1_uc003aep.2_Missense_Mutation_p.P116L	NM_133455	NP_597712	Q96A84	EMID1_HUMAN	EMI domain containing 1	114						collagen					0						TCCTTGGAGCCCATGTGGTCG	0.637																0.023622	-25.619511	6.369313	3	124	KEEP	---	---	---	---	3	0	83	67	-1	capture	Missense_Mutation	SNP	29621149	29621149	EMID1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	5046	22
SFI1	9814	broad.mit.edu	37	22	31985517	31985517	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31985517C>T	uc003ale.2	+	15	1891	c.1498C>T	c.(1498-1500)CGC>TGC	p.R500C	SFI1_uc003ald.1_Missense_Mutation_p.R476C|SFI1_uc003alf.2_Missense_Mutation_p.R469C|SFI1_uc003alg.2_Missense_Mutation_p.R418C|SFI1_uc011alp.1_Missense_Mutation_p.R418C|SFI1_uc011alq.1_Missense_Mutation_p.R445C|SFI1_uc003alh.2_RNA|SFI1_uc010gwi.2_RNA	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	500					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						CTGGCGATGGCGCCACCAGGA	0.532																0.031646	-29.520602	8.406146	5	153	KEEP	---	---	---	---	5	1	104	76	-1	capture	Missense_Mutation	SNP	31985517	31985517	SFI1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14049	22
CCR8	1237	broad.mit.edu	37	3	39374277	39374277	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39374277C>T	uc010hhr.2	+	2	593	c.455C>T	c.(454-456)ACG>ATG	p.T152M	CCR8_uc003cjm.2_Missense_Mutation_p.T69M	NM_005201	NP_005192	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	152	Helical; Name=4; (Potential).				cell adhesion|chemotaxis|elevation of cytosolic calcium ion concentration|immune response	integral to plasma membrane	coreceptor activity			ovary(1)|lung(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		ATGGGCACAACGCTGTGCCTG	0.502																0.07732	-3.497089	31.949083	15	179	KEEP	---	---	---	---	10	7	111	97	-1	capture	Missense_Mutation	SNP	39374277	39374277	CCR8	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2918	22
CAMKV	79012	broad.mit.edu	37	3	49898275	49898275	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49898275T>C	uc003cxt.1	-	8	842	c.649A>G	c.(649-651)AAT>GAT	p.N217D	CAMKV_uc011bcy.1_Missense_Mutation_p.N142D|CAMKV_uc003cxv.1_Missense_Mutation_p.N189D|CAMKV_uc003cxw.1_Missense_Mutation_p.N49D|CAMKV_uc003cxx.1_Missense_Mutation_p.N49D|CAMKV_uc003cxu.2_Missense_Mutation_p.N217D|CAMKV_uc011bcz.1_Missense_Mutation_p.N180D|CAMKV_uc011bda.1_Missense_Mutation_p.N174D|CAMKV_uc011bdb.1_RNA	NM_024046	NP_076951	Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	217	Protein kinase.					cytoplasmic vesicle membrane|plasma membrane	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|large_intestine(2)|central_nervous_system(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		AAAGGTGGATTGCCTGAAAGC	0.512					82											0.035714	-27.899638	11.434558	6	162	KEEP	---	---	---	---	6	1	105	75	-1	capture	Missense_Mutation	SNP	49898275	49898275	CAMKV	3	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	2584	22
NSUN3	63899	broad.mit.edu	37	3	93813043	93813043	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:93813043G>C	uc003drl.1	+	4	642	c.526G>C	c.(526-528)GAA>CAA	p.E176Q		NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3	176							methyltransferase activity			skin(1)	1						GCAGACGTTGGAATCTTTCAT	0.368																0.04918	-5.428962	7.737724	3	58	KEEP	---	---	---	---	2	1	37	25	-1	capture	Missense_Mutation	SNP	93813043	93813043	NSUN3	3	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	10586	22
RBM47	54502	broad.mit.edu	37	4	40440502	40440502	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440502G>A	uc003gvc.2	-	4	1119	c.409C>T	c.(409-411)CGC>TGC	p.R137C	RBM47_uc003gvd.2_Missense_Mutation_p.R137C|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.R99C|RBM47_uc003gvg.1_Missense_Mutation_p.R137C	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	137	RRM 1.					nucleus	nucleotide binding|RNA binding			breast(3)	3						CGGCCCGGGCGGATCTCGTAG	0.622																0.081081	1.835929	15.025977	6	68	KEEP	---	---	---	---	4	2	38	32	-1	capture	Missense_Mutation	SNP	40440502	40440502	RBM47	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13036	22
KDR	3791	broad.mit.edu	37	4	55955885	55955885	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55955885C>T	uc003has.2	-	24	3579	c.3277G>A	c.(3277-3279)GTT>ATT	p.V1093I	KDR_uc003hat.1_Missense_Mutation_p.V1093I	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1093	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CACAGCAAAACACCAAAAGAC	0.433					1022	Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			0.037838	-29.941817	12.81979	7	178	KEEP	---	---	---	---	7	1	117	90	-1	capture	Missense_Mutation	SNP	55955885	55955885	KDR	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8061	22
BMP2K	55589	broad.mit.edu	37	4	79772148	79772148	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79772148G>A	uc003hlk.2	+	7	987	c.821G>A	c.(820-822)TGT>TAT	p.C274Y	BMP2K_uc010ijl.1_RNA|BMP2K_uc003hlj.2_Missense_Mutation_p.C274Y	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a	274	Protein kinase.					nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						GTTGCTATCTGTGATGGCAAC	0.363					318											0.033557	-26.663359	8.694412	5	144	KEEP	---	---	---	---	3	2	89	59	-1	capture	Missense_Mutation	SNP	79772148	79772148	BMP2K	4	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	1448	22
ENPEP	2028	broad.mit.edu	37	4	111397732	111397732	+	Silent	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111397732G>A	uc003iab.3	+	1	504	c.162G>A	c.(160-162)GCG>GCA	p.A54A		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	54	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	CGGGCACTGCGCCAGCTCCTT	0.647																0.037037	-28.715911	8.864815	6	156	KEEP	---	---	---	---	5	1	105	67	-1	capture	Silent	SNP	111397732	111397732	ENPEP	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5083	22
C4orf46	201725	broad.mit.edu	37	4	159590866	159590866	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159590866C>T	uc003iqa.2	-	2	490	c.241G>A	c.(241-243)GTG>ATG	p.V81M	C4orf46_uc010iqp.1_RNA|ETFDH_uc010iqq.2_5'Flank|ETFDH_uc003iqb.2_5'Flank|ETFDH_uc011cjg.1_5'Flank|ETFDH_uc010iqr.2_5'Flank	NM_001008393	NP_001008394	Q504U0	CD046_HUMAN	hypothetical protein LOC201725	81										skin(1)	1						AGTTCTTCCACTTGAGCTGAT	0.363																0.051546	-8.41192	12.234586	5	92	KEEP	---	---	---	---	2	3	53	54	-1	capture	Missense_Mutation	SNP	159590866	159590866	C4orf46	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	2252	22
HCN1	348980	broad.mit.edu	37	5	45695840	45695840	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45695840G>A	uc003jok.2	-	1	381	c.356C>T	c.(355-357)GCG>GTG	p.A119V		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	119	Involved in subunit assembly (By similarity).|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CTTTTCCACCGCCTTCTGGCT	0.602																0.042254	-9.500004	6.438814	3	68	KEEP	---	---	---	---	4	0	45	37	-1	capture	Missense_Mutation	SNP	45695840	45695840	HCN1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6922	22
TMEM161B	153396	broad.mit.edu	37	5	87516531	87516531	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:87516531G>C	uc003kjc.2	-	5	420	c.295C>G	c.(295-297)CAT>GAT	p.H99D	TMEM161B_uc011cty.1_Missense_Mutation_p.H88D|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctz.1_5'UTR|TMEM161B_uc011ctx.1_5'UTR	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	99						integral to membrane				skin(2)	2		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		GGAAAGTAATGCAATGCTGGa	0.294																0.085714	2.197897	8.285984	3	32	KEEP	---	---	---	---	0	3	63	53	-1	capture	Missense_Mutation	SNP	87516531	87516531	TMEM161B	5	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	15960	22
BRD8	10902	broad.mit.edu	37	5	137485483	137485483	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137485483C>T	uc003lcf.1	-	23	3179	c.3124G>A	c.(3124-3126)GAG>AAG	p.E1042K	BRD8_uc003lcc.1_Intron	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	1042					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGCTGAGCCTCCCCCTAGGAA	0.458																0.065217	-7.638069	19.454384	9	129	KEEP	---	---	---	---	6	6	100	53	-1	capture	Missense_Mutation	SNP	137485483	137485483	BRD8	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	1494	22
PCDHB14	56122	broad.mit.edu	37	5	140605384	140605384	+	Silent	SNP	G	A	A	rs147177582		TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140605384G>A	uc003ljb.2	+	1	2307	c.2307G>A	c.(2305-2307)CCG>CCA	p.P769P	PCDHB14_uc011dal.1_Silent_p.P616P	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	769	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCTGAAGCCGATTATCCCCA	0.448	Ovarian(141;50 1831 27899 33809 37648)															0.033784	-25.547743	9.504533	5	143	KEEP	---	---	---	---	5	3	80	75	-1	capture	Silent	SNP	140605384	140605384	PCDHB14	5	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11442	22
ARAP3	64411	broad.mit.edu	37	5	141035273	141035273	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141035273G>A	uc003llm.2	-	31	4103	c.4025C>T	c.(4024-4026)GCC>GTC	p.A1342V	ARAP3_uc003lll.2_Missense_Mutation_p.A293V|ARAP3_uc011dbe.1_Missense_Mutation_p.A1004V|ARAP3_uc003lln.2_Missense_Mutation_p.A1173V	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1342					cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						CTTCTGACGGGCAAGGTCAGA	0.592																0.046154	-7.831277	6.45471	3	62	KEEP	---	---	---	---	1	2	35	35	-1	capture	Missense_Mutation	SNP	141035273	141035273	ARAP3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	833	22
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592			8	p.A289V(HEC6-Tumor)|p.A289D(HS683-Tumor)|p.A289V(RL952-Tumor)	608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.040609	-29.351836	15.398245	8	189	KEEP	---	---	---	---	6	3	96	111	-1	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	22
TM7SF4	81501	broad.mit.edu	37	8	105361477	105361477	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105361477C>T	uc003ylx.1	+	2	746	c.697C>T	c.(697-699)CGA>TGA	p.R233*		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	233					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTCATGAAGCGATTTTTGGG	0.498																0.028571	-27.420311	6.833064	4	136	KEEP	---	---	---	---	2	2	91	57	-1	capture	Nonsense_Mutation	SNP	105361477	105361477	TM7SF4	8	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	15861	22
TG	7038	broad.mit.edu	37	8	134144071	134144071	+	Silent	SNP	G	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134144071G>A	uc003ytw.2	+	46	7919	c.7878G>A	c.(7876-7878)GCG>GCA	p.A2626A	TG_uc010mdw.2_Silent_p.A1385A|TG_uc011ljb.1_Silent_p.A995A|TG_uc011ljc.1_Silent_p.A759A	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2626					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGCTGCTGGCGGATGTTCAGT	0.458					1778											0.04	-10.431327	6.664218	3	72	KEEP	---	---	---	---	2	1	52	37	-1	capture	Silent	SNP	134144071	134144071	TG	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15698	22
DNAI1	27019	broad.mit.edu	37	9	34489407	34489407	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34489407T>A	uc003zum.2	+	5	541	c.348T>A	c.(346-348)GAT>GAA	p.D116E		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	116					cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		AAGACTCAGATGAAGGACGGC	0.527												Kartagener_syndrome				0.066667	-4.008915	28.101777	11	154	KEEP	---	---	---	---	6	5	94	90	-1	capture	Missense_Mutation	SNP	34489407	34489407	DNAI1	9	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	4565	22
ZNF462	58499	broad.mit.edu	37	9	109688130	109688130	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:109688130A>C	uc004bcz.2	+	3	2226	c.1937A>C	c.(1936-1938)GAC>GCC	p.D646A	ZNF462_uc010mto.2_Missense_Mutation_p.D494A|ZNF462_uc004bda.2_Missense_Mutation_p.D494A	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	646					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						AATGAGACAGACAGCCACCCC	0.463																0.014327	-85.03196	8.632835	5	344	KEEP	---	---	---	---	3	5	207	202	-1	capture	Missense_Mutation	SNP	109688130	109688130	ZNF462	9	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	17805	22
MTMR8	55613	broad.mit.edu	37	X	63569901	63569901	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:63569901A>C	uc004dvs.2	-	5	586	c.518T>G	c.(517-519)TTG>TGG	p.L173W	MTMR8_uc011mou.1_Missense_Mutation_p.L173W|MTMR8_uc004dvt.1_Missense_Mutation_p.L173W	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	173	Myotubularin phosphatase.					nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						CACCGTTCCCAAGGTAACAGA	0.343																0.078652	3.352867	19.494435	7	82	KEEP	---	---	---	---	7	2	50	55	-1	capture	Missense_Mutation	SNP	63569901	63569901	MTMR8	23	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	9859	22
DDX5	1655	broad.mit.edu	37	17	62500099	62500102	+	Splice_Site	DEL	ACAG	-	-			TCGA-06-0142-01	TCGA-06-0142-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62500099_62500102delACAG	uc002jek.2	-	4	688	c.441_splice	c.e4+1	p.S147_splice	DDX5_uc010deh.2_Splice_Site_p.S147_splice|DDX5_uc002jej.2_Splice_Site_p.S42_splice|DDX5_uc010wqa.1_Intron|DDX5_uc002jel.1_5'Flank	NM_004396	NP_004387	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5						cell growth|regulation of alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA helicase activity|transcription cofactor activity			ovary(2)|lung(1)	3	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCCAAACTTACAGACAATGTTTT	0.397	NSCLC(22;406 813 4871 19580 40307)					T	ETV4	prostate								0.03			7	242		---	---	---	---						capture_indel	Splice_Site	DEL	62500099	62500102	DDX5	17	ACAG	-	-	-	1	0	1	0	1	0	0	1	0	182	14	5	5	4325	22
