Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PI4KB	5298	broad.mit.edu	37	1	151265387	151265387	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151265387G>A	uc001ext.2	-	12	2807	c.2392C>T	c.(2392-2394)CGG>TGG	p.R798W	PI4KB_uc001exr.2_Missense_Mutation_p.R810W|PI4KB_uc001exs.2_Missense_Mutation_p.R783W|PI4KB_uc001exu.2_Missense_Mutation_p.R783W|PI4KB_uc010pcw.1_Missense_Mutation_p.R466W	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	798					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTGATAGACCGCATACTGCCA	0.577	Colon(154;765 1838 9854 28443 37492)				342											0.037975	-11.601689	6.597543	3	76	KEEP	---	---	---	---	1	2	44	45	-1	capture	Missense_Mutation	SNP	151265387	151265387	PI4KB	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	11777	24
DUSP27	92235	broad.mit.edu	37	1	167097496	167097496	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167097496G>A	uc001geb.1	+	5	3128	c.3128G>A	c.(3127-3129)CGC>CAC	p.R1043H		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1043					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						TACTTCTTCCGCCGGACCCCA	0.587																0.071429	-3.482673	9.77027	5	65	KEEP	---	---	---	---	2	3	44	30	-1	capture	Missense_Mutation	SNP	167097496	167097496	DUSP27	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4779	24
TNN	63923	broad.mit.edu	37	1	175097757	175097757	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:175097757G>A	uc001gkl.1	+	15	3318	c.3205G>A	c.(3205-3207)GAC>AAC	p.D1069N		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	1069	Fibrinogen C-terminal.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACACCCTTCGGACTGCAGTCA	0.547					470											0.294521	112.27557	117.78738	43	103	KEEP	---	---	---	---	29	22	48	73	-1	capture	Missense_Mutation	SNP	175097757	175097757	TNN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	16206	24
CFHR5	81494	broad.mit.edu	37	1	196964976	196964976	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196964976C>G	uc001gts.3	+	5	865	c.737C>G	c.(736-738)CCT>CGT	p.P246R		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	246	Sushi 4.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						ATAAACGGGCCTAAGAAAATA	0.333																0.237288	36.318265	40.040427	14	45	KEEP	---	---	---	---	9	6	19	28	-1	capture	Missense_Mutation	SNP	196964976	196964976	CFHR5	1	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	3254	24
DDX59	83479	broad.mit.edu	37	1	200635187	200635187	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200635187G>A	uc009wzk.2	-	2	925	c.682C>T	c.(682-684)CCC>TCC	p.P228S	DDX59_uc010ppl.1_Missense_Mutation_p.P228S	NM_001031725	NP_001026895	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	228	Q motif.					intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding			ovary(2)|breast(1)|central_nervous_system(1)	4						ATTTGAATGGGAGTTGGCACC	0.458																0.315534	179.197505	185.434593	65	141	KEEP	---	---	---	---	41	31	88	75	-1	capture	Missense_Mutation	SNP	200635187	200635187	DDX59	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4334	24
PRKCQ	5588	broad.mit.edu	37	10	6470257	6470257	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:6470257G>A	uc001ijj.1	-	18	2108	c.2033C>T	c.(2032-2034)GCC>GTC	p.A678V	PRKCQ_uc009xim.1_Missense_Mutation_p.A615V|PRKCQ_uc001iji.1_Missense_Mutation_p.A711V|PRKCQ_uc009xin.1_Missense_Mutation_p.A642V|PRKCQ_uc010qax.1_Missense_Mutation_p.A553V	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta	678	AGC-kinase C-terminal.				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						TGCTCTGTCGGCAAATGACAG	0.458	Ovarian(50;572 1126 10530 25349 30594)				435											0.015576	-78.006722	7.421246	5	316	KEEP	---	---	---	---	2	4	166	204	-1	capture	Missense_Mutation	SNP	6470257	6470257	PRKCQ	10	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12411	24
SF1	7536	broad.mit.edu	37	11	64537812	64537812	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64537812C>T	uc001obb.1	-	4	682	c.305G>A	c.(304-306)CGC>CAC	p.R102H	SF1_uc010rnm.1_5'Flank|SF1_uc010rnn.1_Missense_Mutation_p.R76H|SF1_uc001oaz.1_Missense_Mutation_p.R227H|SF1_uc001oba.1_Missense_Mutation_p.R102H|SF1_uc001obc.1_Missense_Mutation_p.R102H|SF1_uc001obd.1_Missense_Mutation_p.R102H|SF1_uc001obe.1_5'UTR|SF1_uc010rno.1_5'UTR	NM_004630	NP_004621	Q15637	SF01_HUMAN	splicing factor 1 isoform 1	102					nuclear mRNA 3'-splice site recognition|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ribosome|spliceosomal complex	protein binding|RNA binding|transcription corepressor activity|zinc ion binding			ovary(1)|breast(1)|skin(1)	3						CAGCTTTTTGCGGGTGCGGAA	0.547																0.02451	-42.844417	8.307298	5	199	KEEP	---	---	---	---	1	4	106	116	-1	capture	Missense_Mutation	SNP	64537812	64537812	SF1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14038	24
KRT7	3855	broad.mit.edu	37	12	52639222	52639222	+	Silent	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52639222C>T	uc001saa.1	+	7	1138	c.1011C>T	c.(1009-1011)GCC>GCT	p.A337A	KRT7_uc009zmf.1_Intron	NM_005556	NP_005547	P08729	K2C7_HUMAN	keratin 7	337	Rod.|Coil 2.				cytoskeleton organization|DNA replication|interphase|interspecies interaction between organisms|regulation of translation	Golgi apparatus|keratin filament|nucleus	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.105)		CCGCCATTGCCGAGGCTGAGG	0.662																0.217391	25.824449	29.211993	10	36	KEEP	---	---	---	---	9	7	20	25	-1	capture	Silent	SNP	52639222	52639222	KRT7	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8403	24
HOXC11	3227	broad.mit.edu	37	12	54367422	54367422	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54367422A>C	uc001sem.2	+	1	513	c.397A>C	c.(397-399)ACC>CCC	p.T133P		NM_014212	NP_055027	O43248	HXC11_HUMAN	homeobox C11	133					endoderm development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCCGCACGCAACCCCCGCCGG	0.642					53	T	NUP98	AML								0.059459	-29.828524	8.661275	11	174	KEEP	---	---	---	---	35	18	134	112	-1	capture	Missense_Mutation	SNP	54367422	54367422	HOXC11	12	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	7235	24
MYO1A	4640	broad.mit.edu	37	12	57431824	57431824	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57431824C>T	uc001smw.3	-	18	2033	c.1790G>A	c.(1789-1791)CGA>CAA	p.R597Q	MYO1A_uc010sqz.1_Missense_Mutation_p.R435Q|MYO1A_uc009zpd.2_Missense_Mutation_p.R597Q	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	597	Myosin head-like.				sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						GAACTGACCTCGCTGCTGATG	0.592																0.323529	155.773926	160.469289	55	115	KEEP	---	---	---	---	33	31	68	69	-1	capture	Missense_Mutation	SNP	57431824	57431824	MYO1A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9978	24
KRT222	125113	broad.mit.edu	37	17	38812794	38812794	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38812794G>A	uc002hvc.2	-	6	813	c.748C>T	c.(748-750)CGA>TGA	p.R250*	KRT222_uc010wfk.1_RNA|KRT222_uc002hvb.2_Nonsense_Mutation_p.R210*	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN	truncated type I keratin KA21	250						intermediate filament	structural molecule activity			central_nervous_system(1)|skin(1)	2						AGATCAAATCGAAGAGAAACA	0.368																0.136	26.087566	42.130566	17	108	KEEP	---	---	---	---	11	7	49	69	-1	capture	Nonsense_Mutation	SNP	38812794	38812794	KRT222	17	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	8379	24
ACPT	93650	broad.mit.edu	37	19	51295399	51295399	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51295399G>A	uc002pta.1	+	5	520	c.520G>A	c.(520-522)GAG>AAG	p.E174K		NM_033068	NP_149059	Q9BZG2	PPAT_HUMAN	testicular acid phosphatase precursor	174	Extracellular (Potential).					integral to membrane	acid phosphatase activity				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CGAGGCCGCCGAGTACCAGGA	0.612																0.526316	30.250286	30.26172	10	9	KEEP	---	---	---	---	4	8	8	3	-1	capture	Missense_Mutation	SNP	51295399	51295399	ACPT	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	168	24
ZNF470	388566	broad.mit.edu	37	19	57089037	57089037	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57089037C>T	uc002qnl.3	+	6	1916	c.1240C>T	c.(1240-1242)CAG>TAG	p.Q414*	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	414	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AGGACTTATTCAGCATAAGAG	0.413																0.350649	150.397123	153.430463	54	100	KEEP	---	---	---	---	20	38	62	50	-1	capture	Nonsense_Mutation	SNP	57089037	57089037	ZNF470	19	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	17808	24
ZRANB3	84083	broad.mit.edu	37	2	135965224	135965224	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135965224G>T	uc002tum.2	-	19	2906	c.2789C>A	c.(2788-2790)TCT>TAT	p.S930Y	ZRANB3_uc002tuk.2_Missense_Mutation_p.S473Y|ZRANB3_uc002tul.2_Missense_Mutation_p.S928Y	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	930						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		TGAATCCCAAGAGTTCGCTTT	0.428																0.225225	168.035897	191.146047	75	258	KEEP	---	---	---	---	48	37	133	150	0.564705882353	capture	Missense_Mutation	SNP	135965224	135965224	ZRANB3	2	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	18100	24
PRKRA	8575	broad.mit.edu	37	2	179296970	179296970	+	Missense_Mutation	SNP	C	T	T	rs148050153		TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179296970C>T	uc002umf.2	-	8	997	c.796G>A	c.(796-798)GCC>ACC	p.A266T	PRKRA_uc002umc.2_Missense_Mutation_p.A98T|PRKRA_uc002umd.2_Missense_Mutation_p.A241T|PRKRA_uc002ume.2_Missense_Mutation_p.A255T|PRKRA_uc002umg.2_Missense_Mutation_p.A153T|uc002umb.1_Intron|PRKRA_uc002umh.1_RNA	NM_003690	NP_003681	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double	266	DRBM 3.|Sufficient for self-association and interaction with TARBP2.				immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			TGTCCATTGGCGCTCAGTTCA	0.418	Melanoma(200;68 3001 23825 48764)															0.130952	14.96718	26.092571	11	73	KEEP	---	---	---	---	7	11	45	40	-1	capture	Missense_Mutation	SNP	179296970	179296970	PRKRA	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12420	24
UMODL1	89766	broad.mit.edu	37	21	43519223	43519223	+	Silent	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43519223G>A	uc002zaf.1	+	7	1119	c.1119G>A	c.(1117-1119)CTG>CTA	p.L373L	UMODL1_uc002zad.1_Silent_p.L301L|UMODL1_uc002zae.1_Silent_p.L301L|UMODL1_uc002zag.1_Silent_p.L373L|UMODL1_uc010gow.1_Silent_p.L165L|UMODL1_uc002zai.1_Silent_p.L24L|UMODL1_uc010gox.1_RNA|UMODL1_uc010goy.1_Silent_p.L24L|UMODL1_uc002zaj.1_RNA|UMODL1_uc010goz.1_Silent_p.L118L	NM_001004416	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1 isoform 1 precursor	373	Extracellular (Potential).|Fibronectin type-III 1.					cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3						CTGGAGTGCTGTACAGGGTGA	0.612	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)															0.030303	-25.621428	6.339064	4	128	KEEP	---	---	---	---	3	1	66	69	-1	capture	Silent	SNP	43519223	43519223	UMODL1	21	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	16862	24
ITGB2	3689	broad.mit.edu	37	21	46330269	46330269	+	Missense_Mutation	SNP	G	A	A	rs148038936	by1000genomes	TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46330269G>A	uc002zgd.2	-	2	121	c.77C>T	c.(76-78)ACG>ATG	p.T26M	ITGB2_uc002zge.2_Missense_Mutation_p.T26M|ITGB2_uc002zgf.3_Missense_Mutation_p.T26M|ITGB2_uc011afl.1_Translation_Start_Site|ITGB2_uc010gpw.2_Missense_Mutation_p.T26M|ITGB2_uc002zgg.2_Missense_Mutation_p.T26M	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	26	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	CTTGAACTTCGTGCACTCCTG	0.657																0.051282	-8.760789	7.863563	4	74	KEEP	---	---	---	---	2	3	38	47	-1	capture	Missense_Mutation	SNP	46330269	46330269	ITGB2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7817	24
SLC35E4	339665	broad.mit.edu	37	22	31042730	31042730	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31042730G>T	uc003ais.1	+	2	1410	c.765G>T	c.(763-765)TGG>TGT	p.W255C	SLC35E4_uc003ait.2_Intron	NM_001001479	NP_001001479	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	255	Leu-rich.					integral to membrane					0						CTCGCCTCTGGGCCTGCATCC	0.677																0.324324	31.185537	32.199884	12	25	KEEP	---	---	---	---	5	7	18	11	0.416666666667	capture	Missense_Mutation	SNP	31042730	31042730	SLC35E4	22	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	14479	24
RAD54L2	23132	broad.mit.edu	37	3	51690054	51690054	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51690054C>T	uc011bdt.1	+	19	3219	c.3094C>T	c.(3094-3096)CCC>TCC	p.P1032S	RAD54L2_uc003dbh.2_Missense_Mutation_p.P621S|RAD54L2_uc011bdu.1_Missense_Mutation_p.P726S|RAD54L2_uc003dbj.2_Missense_Mutation_p.P358S	NM_015106	NP_055921	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2	1032						nucleus	ATP binding|DNA binding|helicase activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CACCCCCATCCCCATGATGCC	0.522																0.247706	132.526941	145.168177	54	164	KEEP	---	---	---	---	29	28	83	109	-1	capture	Missense_Mutation	SNP	51690054	51690054	RAD54L2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	12889	24
RAP2B	5912	broad.mit.edu	37	3	152880771	152880771	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:152880771C>T	uc003ezr.2	+	1	743	c.289C>T	c.(289-291)CGG>TGG	p.R97W		NM_002886	NP_002877	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family precursor	97					Rap protein signal transduction|regulation of protein tyrosine kinase activity	recycling endosome membrane	GTP binding|GTPase activity			lung(2)	2			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CAAGCCCATGCGGGACCAGAT	0.617																0.021858	-40.32181	6.369004	4	179	KEEP	---	---	---	---	2	2	98	108	-1	capture	Missense_Mutation	SNP	152880771	152880771	RAP2B	3	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12936	24
NLGN1	22871	broad.mit.edu	37	3	173998531	173998531	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:173998531G>C	uc003fio.1	+	7	2333	c.1910G>C	c.(1909-1911)AGA>ACA	p.R637T	NLGN1_uc003fip.1_Missense_Mutation_p.R637T	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	654	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ATCACTTTCAGACCTACGAGA	0.433																0.211429	100.283402	113.753092	37	138	KEEP	---	---	---	---	13	26	82	68	-1	capture	Missense_Mutation	SNP	173998531	173998531	NLGN1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	10368	24
ALB	213	broad.mit.edu	37	4	74274453	74274453	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74274453G>A	uc003hgs.3	+	4	486	c.413G>A	c.(412-414)CGA>CAA	p.R138Q	ALB_uc003hgw.3_Intron|ALB_uc011cbe.1_Intron|ALB_uc003hgt.3_Missense_Mutation_p.R138Q|ALB_uc010iii.2_Intron|ALB_uc003hgu.3_Intron|ALB_uc003hgv.3_Intron|ALB_uc011cbf.1_Missense_Mutation_p.R28Q|ALB_uc010iij.2_RNA|ALB_uc003hgx.3_5'Flank	NM_000477	NP_000468	P02768	ALBU_HUMAN	albumin preproprotein	138	Albumin 1.		R -> G (in Yanomama-2).		bile acid and bile salt transport|bile acid metabolic process|cellular response to starvation|hemolysis by symbiont of host erythrocytes|lipoprotein metabolic process|maintenance of mitochondrion location|negative regulation of apoptosis|platelet activation|platelet degranulation|sodium-independent organic anion transport|transmembrane transport	extracellular space|platelet alpha granule lumen|protein complex	antioxidant activity|chaperone binding|copper ion binding|DNA binding|drug binding|fatty acid binding|pyridoxal phosphate binding|toxin binding			ovary(3)|skin(3)	6	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)		Acenocoumarol(DB01418)|Acitretin(DB00459)|Alfentanil(DB00802)|Aluminium(DB01370)|Auranofin(DB00995)|Bismuth(DB01402)|Captopril(DB01197)|Carboplatin(DB00958)|Cefalotin(DB00456)|Cefazolin(DB01327)|Cefonicid(DB01328)|Cefoperazone(DB01329)|Chlorpheniramine(DB01114)|Chlorpromazine(DB00477)|Ciprofloxacin(DB00537)|Clonazepam(DB01068)|Cloxacillin(DB01147)|Cytarabine(DB00987)|Dantrolene(DB01219)|Diclofenac(DB00586)|Diflunisal(DB00861)|Digitoxin(DB01396)|Estrone(DB00655)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Flurbiprofen(DB00712)|Gadobenate Dimeglumine(DB00743)|Gatifloxacin(DB01044)|Gliclazide(DB01120)|Halothane(DB01159)|Human Serum Albumin(DB00062)|Hyaluronidase(DB00070)|Ibuprofen(DB01050)|Insulin-detemir(DB01307)|Insulin-glargine(DB01308)|Iodipamide(DB04711)|Ketoprofen(DB01009)|Levamisole(DB00848)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Mefenamic acid(DB00784)|Mephenytoin(DB00532)|Methotrexate(DB00563)|Nortriptyline(DB00540)|Oxazepam(DB00842)|Paclitaxel(DB01229)|Phenprocoumon(DB00946)|Probenecid(DB01032)|Propofol(DB00818)|Pyridoxine(DB00165)|Salicyclic acid(DB00936)|Saquinavir(DB01232)|Serum albumin(DB00096)|Serum albumin iodonated(DB00064)|Sodium lauryl sulfate(DB00815)|Sucralfate(DB00364)|Sulfamethizole(DB00576)|Sulindac(DB00605)|Suprofen(DB00870)|Testosterone(DB00624)|Xanthophyll(DB00137)	AACCTCCCCCGATTGGTGAGA	0.398																0.246154	40.466821	44.281005	16	49	KEEP	---	---	---	---	5	11	28	32	-1	capture	Missense_Mutation	SNP	74274453	74274453	ALB	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	486	24
PCDHB5	26167	broad.mit.edu	37	5	140516934	140516934	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140516934G>A	uc003liq.2	+	1	2135	c.1918G>A	c.(1918-1920)GTG>ATG	p.V640M		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	640	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACAGGCTGGTGGTGCTGGT	0.706																0.56338	119.39745	119.64459	40	31	KEEP	---	---	---	---	28	30	41	52	-1	capture	Missense_Mutation	SNP	140516934	140516934	PCDHB5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	11448	24
BRAF	673	broad.mit.edu	37	7	140453136	140453136	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140453136A>T	uc003vwc.3	-	15	1860	c.1799T>A	c.(1798-1800)GTG>GAG	p.V600E		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	600	Protein kinase.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.V600E(16892)|p.V600?(325)|p.V600K(176)|p.V600R(36)|p.V600M(25)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_V600insTT(3)|p.T599_R603>I(2)|p.T599_V600>IAL(2)|p.V600L(2)|p.T599_V600insT(2)|p.V600_W604del(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insDFGLAT(1)	KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	TCGAGATTTCACTGTAGCTAG	0.368	Colon(40;35 892 2973 5743 27438)	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61	p.V600E(G361-Tumor)|p.V600E(HT144-Tumor)|p.V600E(MDAMB361-Tumor)|p.V600E(COLO783-Tumor)|p.V600E(COLO201-Tumor)|p.V600E(8505C-Tumor)|p.V600E(COLO205-Tumor)|p.V600E(A673-Tumor)|p.V600E(WM88-Tumor)|p.V600E(LOXIMVI-Tumor)|p.V600D(WM2664-Tumor)|p.V600K(MDST8-Tumor)|p.V600E(HT29-Tumor)|p.V600E(CL34-Tumor)|p.V600E(COLO818-Tumor)|p.V600E(COLO741-Tumor)|p.V600E(LS411N-Tumor)|p.V600E(SKMEL28-Tumor)|p.V600E(NMCG1-Tumor)|p.V600E(MELHO-Tumor)|p.V600E(WM983B-Tumor)|p.V600E(OUMS23-Tumor)|p.V600E(NCIH854-Tumor)|p.V600E(IGR39-Tumor)|p.V600E(SKHEP1-Tumor)|p.V600E(COLO679-Tumor)|p.V600E(SKMEL5-Tumor)|p.V600E(UACC257-Tumor)|p.V600E(HS695T-Tumor)|p.V600E(A375-Tumor)|p.V600E(MALME3M-Tumor)|p.V600E(AM38-Tumor)|p.V600E(SIGM5-Tumor)|p.V600E(DBTRG05MG-Tumor)|p.V600E(8305C-Tumor)|p.V600E(SKMEL24-Tumor)|p.V600E(WM793-Tumor)|p.V600E(BCPAP-Tumor)|p.V600D(WM115-Tumor)|p.V600E(SNUC5-Tumor)|p.V600E(GCT-Tumor)|p.V600E(ES2-Tumor)|p.V600E(SW1417-Tumor)|p.V600E(MDAMB435S-Tumor)|p.V600E(HS294T-Tumor)|p.V600E(DU4475-Tumor)|p.V600E(C32-Tumor)|p.V600E(A101D-Tumor)|p.V600E(COLO829-Tumor)|p.V600E(SKMEL3-Tumor)|p.V600E(SKMEL1-Tumor)|p.V600E(WM1799-Tumor)|p.V600E(RKO-Tumor)|p.V600E(IGR37-Tumor)|p.V600E(K029AX-Tumor)|p.V600E(JHOM2B-Tumor)|p.V600E(SH4-Tumor)	451	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				0.369318	200.633566	203.273546	65	111	KEEP	---	---	---	---	40	33	64	65	-1	capture	Missense_Mutation	SNP	140453136	140453136	BRAF	7	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	1484	24
NFIB	4781	broad.mit.edu	37	9	14150145	14150145	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:14150145T>C	uc003zle.2	-	5	1240	c.805A>G	c.(805-807)AGC>GGC	p.S269G	NFIB_uc003zld.2_Missense_Mutation_p.S17G|NFIB_uc003zlf.2_Missense_Mutation_p.S269G|NFIB_uc011lmo.1_Missense_Mutation_p.S269G	NM_005596	NP_005587	O00712	NFIB_HUMAN	nuclear factor I/B	269					anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		TTTCAGTACCTGCTTGGTGGA	0.328	Esophageal Squamous(132;921 1730 14828 40753 46471)					T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								0.580796	849.95101	852.380356	248	179	KEEP	---	---	---	---	137	147	88	113	-1	capture	Missense_Mutation	SNP	14150145	14150145	NFIB	9	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	10278	24
FLJ46321	389763	broad.mit.edu	37	9	84609194	84609194	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:84609194A>G	uc004amn.2	+	4	3856	c.3809A>G	c.(3808-3810)CAG>CGG	p.Q1270R		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1270						integral to membrane					0						GCACAGAAGCAGGAGCCCAGG	0.537																0.206897	96.105691	109.955359	36	138	KEEP	---	---	---	---	11	25	77	66	-1	capture	Missense_Mutation	SNP	84609194	84609194	FLJ46321	9	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5876	24
TNC	3371	broad.mit.edu	37	9	117844148	117844148	+	Silent	SNP	C	T	T			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117844148C>T	uc004bjj.3	-	6	2669	c.2307G>A	c.(2305-2307)CGG>CGA	p.R769R	TNC_uc010mvf.2_Silent_p.R769R	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	769	Fibronectin type-III 2.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GACCAGTTTGCCGGTAAGAGG	0.522																0.026846	-30.43442	6.425094	4	145	KEEP	---	---	---	---	0	4	90	75	-1	capture	Silent	SNP	117844148	117844148	TNC	9	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	16153	24
SFRS2IP	9169	broad.mit.edu	37	12	46320707	46320708	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:46320707_46320708delTC	uc001rox.2	-	11	3063_3064	c.2776_2777delGA	c.(2776-2778)GAAfs	p.E926fs	SFRS2IP_uc001row.2_Frame_Shift_Del_p.E611fs|SFRS2IP_uc001roy.1_Frame_Shift_Del_p.E1000fs	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	926	Arg-rich.				spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		GGTTCTCCTTTCTCTCTCTCTC	0.446																0.01			7	460		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	46320707	46320708	SFRS2IP	12	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	14070	24
SELPLG	6404	broad.mit.edu	37	12	109017957	109017957	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109017957delC	uc001tni.2	-	2	287	c.127delG	c.(127-129)GCCfs	p.A43fs	SELPLG_uc001tnh.2_Frame_Shift_Del_p.A43fs|SELPLG_uc010sxe.1_Frame_Shift_Del_p.A59fs	NM_003006	NP_002997	Q14242	SELPL_HUMAN	selectin P ligand	43	Extracellular (Potential).				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0						TATTCGGTGGCCTGTCTCCGG	0.582																0.31			65	143		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	109017957	109017957	SELPLG	12	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	13913	24
FOXG1	2290	broad.mit.edu	37	14	29236962	29236988	+	In_Frame_Del	DEL	GGGCGAGGGCGGCAAGGACGGGGAGGG	-	-	rs148157138	byFrequency	TCGA-06-0151-01	TCGA-06-0151-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:29236962_29236988delGGGCGAGGGCGGCAAGGACGGGGAGGG	uc001wqe.2	+	1	676_702	c.477_503delGGGCGAGGGCGGCAAGGACGGGGAGGG	c.(475-504)GCGGGCGAGGGCGGCAAGGACGGGGAGGGG>GCG	p.GEGGKDGEG160del		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	160_168	Gly-rich.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		agaagggggcgggcgagggcggcaaggacggggaggggggcaaggag	0.401																0.62			8	5		---	---	---	---						capture_indel	In_Frame_Del	DEL	29236962	29236988	FOXG1	14	GGGCGAGGGCGGCAAGGACGGGGAGGG	-	-	-	1	0	1	0	1	0	0	0	0	496	39	5	5	5951	24
