Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CEP152	22995	broad.mit.edu	37	15	49054838	49054838	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49054838T>C	uc001zwy.2	-	18	2346	c.2312A>G	c.(2311-2313)AAG>AGG	p.K771R	CEP152_uc001zwz.2_Missense_Mutation_p.K771R|CEP152_uc001zxa.1_Missense_Mutation_p.K678R	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	771	Potential.				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTGCCACTCCTTTTCAAGCTG	0.338																0.028302	-18.874313	7.104935	3	103	KEEP	---	---	---	---	3	1	104	93	-1	capture	Missense_Mutation	SNP	49054838	49054838	CEP152	15	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3216	30
ABCC1	4363	broad.mit.edu	37	16	16101808	16101808	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:16101808C>T	uc010bvi.2	+	2	359	c.184C>T	c.(184-186)CGA>TGA	p.R62*	ABCC1_uc010bvj.2_Nonsense_Mutation_p.R62*|ABCC1_uc010bvk.2_Nonsense_Mutation_p.R62*|ABCC1_uc010bvl.2_Nonsense_Mutation_p.R62*|ABCC1_uc010bvm.2_Nonsense_Mutation_p.R62*|ABCC1_uc002del.3_5'Flank	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	62	Cytoplasmic.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	CCGACATGACCGAGGCTACAT	0.537																0.017094	-55.108206	6.544194	4	230	KEEP	---	---	---	---	4	2	131	148	-1	capture	Nonsense_Mutation	SNP	16101808	16101808	ABCC1	16	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	49	30
B4GALT6	9331	broad.mit.edu	37	18	29225320	29225320	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29225320T>C	uc002kwz.3	-	4	766	c.469A>G	c.(469-471)AAG>GAG	p.K157E	B4GALT6_uc010dma.2_Missense_Mutation_p.K118E|B4GALT6_uc010dmb.2_Missense_Mutation_p.K157E	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6	157	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			TACCTCACCTTCCATCTGGGT	0.378																0.016575	-41.341796	6.502288	3	178	KEEP	---	---	---	---	1	3	107	95	-1	capture	Missense_Mutation	SNP	29225320	29225320	B4GALT6	18	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	1264	30
DVL3	1857	broad.mit.edu	37	3	183884692	183884692	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183884692G>A	uc003fms.2	+	11	1267	c.1127G>A	c.(1126-1128)GGC>GAC	p.G376D	DVL3_uc011bqw.1_Missense_Mutation_p.G359D|DVL3_uc003fmt.2_Missense_Mutation_p.G47D|DVL3_uc003fmu.2_Missense_Mutation_p.G208D	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3	376					canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CCTGCATACGGCATGAGCCCC	0.647																0.017241	-54.198747	6.845157	4	228	KEEP	---	---	---	---	3	1	102	151	-1	capture	Missense_Mutation	SNP	183884692	183884692	DVL3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4792	30
FAT4	79633	broad.mit.edu	37	4	126372195	126372195	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:126372195C>T	uc003ifj.3	+	9	10024	c.10024C>T	c.(10024-10026)CGA>TGA	p.R3342*	FAT4_uc011cgp.1_Nonsense_Mutation_p.R1640*|FAT4_uc003ifi.1_Nonsense_Mutation_p.R820*	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3342	Cadherin 32.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TGGTAATAGTCGAAAGAAGGG	0.408																0.02381	-53.077535	10.465886	6	246	KEEP	---	---	---	---	2	4	144	120	-1	capture	Nonsense_Mutation	SNP	126372195	126372195	FAT4	4	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	5638	30
CCDC110	256309	broad.mit.edu	37	4	186380647	186380647	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186380647C>T	uc003ixu.3	-	6	1170	c.1094G>A	c.(1093-1095)GGC>GAC	p.G365D	CCDC110_uc003ixv.3_Missense_Mutation_p.G328D|CCDC110_uc011ckt.1_Missense_Mutation_p.G365D	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	365						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		AATATTTTTGCCAGTGATGGG	0.323																0.01506	-81.238404	7.452193	5	327	KEEP	---	---	---	---	4	1	184	182	-1	capture	Missense_Mutation	SNP	186380647	186380647	CCDC110	4	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2721	30
POM121C	100101267	broad.mit.edu	37	7	75051383	75051383	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75051383C>T	uc003udk.3	-	13	3037	c.2152G>A	c.(2152-2154)GCC>ACC	p.A718T		NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like	960	Pore side (Potential).				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						GCTGGCTTGGCGGCCCCCGGT	0.662																0.090909	1.103058	6.66798	3	30	KEEP	---	---	---	---	3	0	25	22	-1	capture	Missense_Mutation	SNP	75051383	75051383	POM121C	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12142	30
PAX5	5079	broad.mit.edu	37	9	37020696	37020696	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0165-01	TCGA-06-0165-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37020696C>A	uc003zzo.1	-	2	597	c.149G>T	c.(148-150)AGG>ATG	p.R50M	PAX5_uc011lpw.1_Missense_Mutation_p.R50M|PAX5_uc011lpx.1_Missense_Mutation_p.R50M|PAX5_uc011lpy.1_Intron|PAX5_uc010mls.1_Missense_Mutation_p.R50M|PAX5_uc011lpz.1_Missense_Mutation_p.R50M|PAX5_uc011lqa.1_Intron|PAX5_uc010mlq.1_RNA|PAX5_uc011lqb.1_RNA|PAX5_uc010mlo.1_Missense_Mutation_p.R50M|PAX5_uc010mlp.1_Missense_Mutation_p.R50M|PAX5_uc011lqc.1_Missense_Mutation_p.R50M|PAX5_uc010mlr.1_Missense_Mutation_p.R50M|PAX5_uc011lqd.1_Missense_Mutation_p.R49M|PAX5_uc011lqe.1_Intron|PAX5_uc011lqf.1_Intron|PAX5_uc011lqg.1_Intron	NM_016734	NP_057953	Q02548	PAX5_HUMAN	paired box 5	50	Paired.				cell differentiation|humoral immune response|nervous system development|organ morphogenesis|spermatogenesis|transcription from RNA polymerase II promoter	nucleus	DNA binding	p.?(31)	PAX5/JAK2(18)	haematopoietic_and_lymphoid_tissue(142)|lung(3)|central_nervous_system(2)	147		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		GTCGCAGGGCCTGACACCTTG	0.542					323	T|Mis|D|F|S	IGH@|ETV6|PML|FOXP1|ZNF521|ELN	NHL|ALL|B-ALL								0.020408	-43.185284	7.33846	4	192	KEEP	---	---	---	---	2	2	109	111	0.5	capture	Missense_Mutation	SNP	37020696	37020696	PAX5	9	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	11385	30
