Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6189059	6189059	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6189059G>A	uc001amb.1	-	23	3558	c.3458C>T	c.(3457-3459)TCG>TTG	p.S1153L	CHD5_uc001alz.1_Missense_Mutation_p.S10L|CHD5_uc001ama.1_RNA|CHD5_uc001amc.1_RNA|CHD5_uc009vlx.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1153	Helicase C-terminal.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding	p.S1153L(1)		central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCCTCCACCGAGGCCCGAGT	0.662					2304											0.237037	76.932343	85.463592	32	103	KEEP	---	---	---	---	22	19	61	58	-1	capture	Missense_Mutation	SNP	6189059	6189059	CHD5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3294	47
LCK	3932	broad.mit.edu	37	1	32741519	32741519	+	Silent	SNP	G	A	A	rs1126767	byFrequency	TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32741519G>A	uc001bux.2	+	7	624	c.486G>A	c.(484-486)TCG>TCA	p.S162S	LCK_uc001buy.2_Silent_p.S162S|LCK_uc001buz.2_Silent_p.S162S|LCK_uc010ohc.1_Silent_p.S206S|LCK_uc001bva.2_Silent_p.S220S	NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase	162	SH2.|Interaction with PTPRH.				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding	p.S162S(1)		lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	ATTCAGGATCGTTTTCACTGT	0.562					146	T	TRB@	T-ALL								0.259615	67.67557	73.119095	27	77	KEEP	---	---	---	---	12	19	53	35	-1	capture	Silent	SNP	32741519	32741519	LCK	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	8596	47
PRPF38A	84950	broad.mit.edu	37	1	52880488	52880488	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:52880488C>G	uc001ctv.3	+	8	1007	c.804C>G	c.(802-804)AGC>AGG	p.S268R	PRPF38A_uc001ctw.3_Missense_Mutation_p.A79G	NM_032864	NP_116253	Q8NAV1	PR38A_HUMAN	PRP38 pre-mRNA processing factor 38 (yeast)	268	Arg-rich.				mRNA processing|RNA splicing	spliceosomal complex					0						GTCACCGCAGCAGGTCCCGAG	0.527																0.186869	95.739459	113.946141	37	161	KEEP	---	---	---	---	21	26	96	103	-1	capture	Missense_Mutation	SNP	52880488	52880488	PRPF38A	1	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	12463	47
DNAJC6	9829	broad.mit.edu	37	1	65852503	65852503	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:65852503G>A	uc001dcd.1	+	8	997	c.833G>A	c.(832-834)CGT>CAT	p.R278H	DNAJC6_uc001dcc.1_Missense_Mutation_p.R309H|DNAJC6_uc010opc.1_Missense_Mutation_p.R265H|DNAJC6_uc001dce.1_Missense_Mutation_p.R335H	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	278	C2 tensin-type.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						AGAGAATATCGTGTCCAAGAT	0.438																0.198413	53.315228	63.974575	25	101	KEEP	---	---	---	---	9	21	53	60	-1	capture	Missense_Mutation	SNP	65852503	65852503	DNAJC6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4609	47
SLC6A17	388662	broad.mit.edu	37	1	110709512	110709512	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110709512G>A	uc009wfq.2	+	2	422	c.-39G>A	c.(-41--37)CTGTG>CTATG			NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17						alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CATCTTCTCTGTGTGCTGGGG	0.547																0.21875	15.206116	17.54002	7	25	KEEP	---	---	---	---	3	6	12	14	-1	capture	Translation_Start_Site	SNP	110709512	110709512	SLC6A17	1	G	A	A	A	1	0	0	0	0	0	0	0	0	612	48	2	2	14572	47
NBPF10	100132406	broad.mit.edu	37	1	145273265	145273265	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145273265G>A	uc001emp.3	+	3	489	c.-709G>A	c.(-711--707)TTGTG>TTATG		NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Missense_Mutation_p.C40Y|NOTCH2NL_uc001emm.3_Missense_Mutation_p.C40Y|NOTCH2NL_uc001emo.2_Missense_Mutation_p.C40Y|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GGTGGGACTTGTGTGGCCCAG	0.532																0.05042	-59.611882	42.415141	24	452	KEEP	---	---	---	---	19	17	354	342	-1	capture	Translation_Start_Site	SNP	145273265	145273265	NBPF10	1	G	A	A	A	1	0	0	0	0	0	0	0	0	624	48	2	2	10100	47
SPTA1	6708	broad.mit.edu	37	1	158618368	158618368	+	Silent	SNP	C	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158618368C>G	uc001fst.1	-	26	3844	c.3645G>C	c.(3643-3645)CTG>CTC	p.L1215L		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1215	Spectrin 12.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GAACACTGAACAGATCTGAGC	0.507																0.155556	83.30056	108.772933	35	190	KEEP	---	---	---	---	20	19	104	108	-1	capture	Silent	SNP	158618368	158618368	SPTA1	1	C	G	G	G	1	0	0	0	0	0	0	0	1	210	17	4	4	15008	47
SPTA1	6708	broad.mit.edu	37	1	158627401	158627401	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158627401G>A	uc001fst.1	-	19	2870	c.2671C>T	c.(2671-2673)CGA>TGA	p.R891*		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	891	Spectrin 9.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCATTTTGTCGCCTAGCAGCT	0.463																0.212625	131.827562	154.813887	64	237	KEEP	---	---	---	---	36	37	147	149	-1	capture	Nonsense_Mutation	SNP	158627401	158627401	SPTA1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	15008	47
F5	2153	broad.mit.edu	37	1	169512354	169512354	+	Splice_Site	SNP	T	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169512354T>G	uc001ggg.1	-	13	2121	c.1976_splice	c.e13-1	p.G659_splice		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TCCAAGTTCCTACAGAAGAGA	0.383																0.207317	46.035004	52.538333	17	65	KEEP	---	---	---	---	14	5	38	34	-1	capture	Splice_Site	SNP	169512354	169512354	F5	1	T	G	G	G	1	0	0	0	0	0	0	1	0	689	53	5	4	5302	47
TNN	63923	broad.mit.edu	37	1	175048687	175048687	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:175048687G>A	uc001gkl.1	+	3	741	c.628G>A	c.(628-630)GGC>AGC	p.G210S	TNN_uc010pmx.1_Missense_Mutation_p.G210S	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	210	EGF-like 2.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CAGCGGACACGGCGAGTGCGT	0.701					470											0.357143	13.072155	13.323301	5	9	KEEP	---	---	---	---	2	4	5	6	-1	capture	Missense_Mutation	SNP	175048687	175048687	TNN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16206	47
CAMSAP1L1	23271	broad.mit.edu	37	1	200784743	200784743	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200784743C>G	uc001gvl.2	+	4	886	c.616C>G	c.(616-618)CAC>GAC	p.H206D	CAMSAP1L1_uc001gvk.2_Missense_Mutation_p.H206D|CAMSAP1L1_uc001gvm.2_Missense_Mutation_p.H206D	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	206						cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GAAAGAACATCACACAGTTGA	0.269																0.275862	26.787176	28.098836	8	21	KEEP	---	---	---	---	1	9	14	13	-1	capture	Missense_Mutation	SNP	200784743	200784743	CAMSAP1L1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	2588	47
CD46	4179	broad.mit.edu	37	1	207930949	207930949	+	Silent	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207930949C>T	uc001hgc.2	+	3	507	c.351C>T	c.(349-351)TAC>TAT	p.Y117Y	CD46_uc001hgd.2_Silent_p.Y117Y|CD46_uc001hge.2_Silent_p.Y117Y|CD46_uc001hgf.2_Silent_p.Y117Y|CD46_uc001hgg.2_Silent_p.Y117Y|CD46_uc001hgh.2_Silent_p.Y117Y|CD46_uc001hgi.2_Silent_p.Y117Y|CD46_uc001hgj.2_Silent_p.Y117Y|CD46_uc001hgk.2_Silent_p.Y117Y|CD46_uc001hgl.2_Silent_p.Y117Y|CD46_uc001hgm.2_Silent_p.Y117Y|CD46_uc001hgn.2_Silent_p.Y117Y|CD46_uc001hgo.2_Silent_p.Y117Y|CD46_uc001hgp.2_Silent_p.Y117Y	NM_002389	NP_002380	P15529	MCP_HUMAN	CD46 antigen, complement regulatory protein	117	Extracellular (Potential).|Sushi 2.				complement activation, classical pathway|innate immune response|interspecies interaction between organisms|single fertilization	inner acrosomal membrane|integral to plasma membrane	protein binding|receptor activity			large_intestine(2)|lung(1)|central_nervous_system(1)	4						ATGGGACTTACGAGTTTGGTT	0.358																0.181818	15.672281	19.858474	8	36	KEEP	---	---	---	---	7	3	27	19	-1	capture	Silent	SNP	207930949	207930949	CD46	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2989	47
OR52R1	119695	broad.mit.edu	37	11	4824947	4824947	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4824947C>T	uc010qym.1	-	1	901	c.901G>A	c.(901-903)GTG>ATG	p.V301M		NM_001005177	NP_001005177	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAAATCATCACGTATGACATA	0.473																0.228571	53.14566	60.242611	24	81	KEEP	---	---	---	---	9	15	45	42	-1	capture	Missense_Mutation	SNP	4824947	4824947	OR52R1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11035	47
ARFGAP2	84364	broad.mit.edu	37	11	47196824	47196824	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47196824G>C	uc001ndt.2	-	4	320	c.305C>G	c.(304-306)GCC>GGC	p.A102G	ARFGAP2_uc010rha.1_5'Flank|ARFGAP2_uc010rhb.1_Missense_Mutation_p.A102G|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron|ARFGAP2_uc010rhd.1_Missense_Mutation_p.A102G|ARFGAP2_uc001ndv.1_3'UTR	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating	102	Required for interaction with coatomer.|Arf-GAP.				protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TTTGGTGTTGGCATCATTGGC	0.542																0.199346	149.680529	175.589055	61	245	KEEP	---	---	---	---	41	28	139	159	-1	capture	Missense_Mutation	SNP	47196824	47196824	ARFGAP2	11	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	843	47
OR9G9	504191	broad.mit.edu	37	11	56467865	56467865	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56467865T>A	uc010rjn.1	+	1	2	c.2T>A	c.(1-3)ATG>AAG	p.M1K		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	1	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTTACAGCCATGCAGAGGAGC	0.453																0.050633	-9.467878	7.465723	4	75	KEEP	---	---	---	---	6	5	50	41	-1	capture	Missense_Mutation	SNP	56467865	56467865	OR9G9	11	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	11156	47
MS4A1	931	broad.mit.edu	37	11	60233626	60233626	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60233626T>A	uc001npp.2	+	6	985	c.569T>A	c.(568-570)TTC>TAC	p.F190Y	MS4A1_uc001npq.2_Missense_Mutation_p.F190Y|MS4A1_uc009yna.2_Missense_Mutation_p.F190Y|MS4A1_uc009ymz.2_Missense_Mutation_p.F190Y|MS4A1_uc010rlc.1_Intron	NM_152866	NP_690605	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member	190	Helical; (Potential).				B cell activation|immune response	integral to plasma membrane				ovary(3)|lung(2)	5					Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)	CAATCTCTGTTCTTGGTAAGT	0.338																0.248619	103.088496	113.492726	45	136	KEEP	---	---	---	---	30	22	90	72	-1	capture	Missense_Mutation	SNP	60233626	60233626	MS4A1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	9764	47
NAALADL1	10004	broad.mit.edu	37	11	64822202	64822202	+	Silent	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64822202G>A	uc001ocn.2	-	5	628	c.612C>T	c.(610-612)AAC>AAT	p.N204N	NAALADL1_uc010rnw.1_Translation_Start_Site	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	204	Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						GCTTGGCAGCGTTCACAGCCT	0.597																0.057692	-9.438492	11.909227	6	98	KEEP	---	---	---	---	1	5	58	60	-1	capture	Silent	SNP	64822202	64822202	NAALADL1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10039	47
FLI1	2313	broad.mit.edu	37	11	128628186	128628186	+	Silent	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128628186C>T	uc010sbu.1	+	2	536	c.195C>T	c.(193-195)AAC>AAT	p.N65N	FLI1_uc010sbt.1_Translation_Start_Site|FLI1_uc010sbv.1_Silent_p.N32N|FLI1_uc009zci.2_Translation_Start_Site|FLI1_uc001qen.2_Silent_p.N32N	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	65					hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		TGAGGGTCAACGTCAAGCGGG	0.587				(639V-Tumor)	400	T	EWSR1	Ewing sarcoma								0.230769	21.153479	23.745167	9	30	KEEP	---	---	---	---	5	7	13	21	-1	capture	Silent	SNP	128628186	128628186	FLI1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5869	47
CPNE8	144402	broad.mit.edu	37	12	39124093	39124093	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:39124093C>T	uc001rls.1	-	11	874	c.790G>A	c.(790-792)GTA>ATA	p.V264I		NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII	264										pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				ACCTCATATACGTTGAATTGT	0.308																0.197674	37.122597	44.444779	17	69	KEEP	---	---	---	---	11	12	33	50	-1	capture	Missense_Mutation	SNP	39124093	39124093	CPNE8	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3783	47
RACGAP1	29127	broad.mit.edu	37	12	50388234	50388234	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50388234T>A	uc001rvt.2	-	13	1413	c.1103A>T	c.(1102-1104)CAT>CTT	p.H368L	RACGAP1_uc009zlm.1_Missense_Mutation_p.H368L|RACGAP1_uc001rvs.2_Missense_Mutation_p.H368L|RACGAP1_uc001rvu.2_Missense_Mutation_p.H368L	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	368	Rho-GAP.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						ATTTACACAATGCACAACAAT	0.378																0.030303	-23.612564	8.329203	4	128	KEEP	---	---	---	---	1	3	76	81	-1	capture	Missense_Mutation	SNP	50388234	50388234	RACGAP1	12	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	12872	47
GPR81	27198	broad.mit.edu	37	12	123214503	123214503	+	Silent	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123214503G>A	uc001ucz.2	-	1	627	c.384C>T	c.(382-384)TCC>TCT	p.S128S	GPR81_uc001ucw.1_RNA	NM_032554	NP_115943	Q9BXC0	HCAR1_HUMAN	G protein-coupled receptor 81	128	Cytoplasmic (Potential).				response to estradiol stimulus	integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.14e-05)|Epithelial(86;3.25e-05)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CCACCCGGGTGGAGATAGTGT	0.602																0.218274	103.315254	117.729547	43	154	KEEP	---	---	---	---	35	28	111	101	-1	capture	Silent	SNP	123214503	123214503	GPR81	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	6644	47
RNF17	56163	broad.mit.edu	37	13	25442748	25442748	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25442748C>T	uc001upr.2	+	31	4213	c.4172C>T	c.(4171-4173)TCG>TTG	p.S1391L	RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.S1387L|RNF17_uc001ups.2_Missense_Mutation_p.S1330L|RNF17_uc010aac.2_Missense_Mutation_p.S583L|RNF17_uc010aad.2_Missense_Mutation_p.S401L	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1391					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GAATTGCTTTCGGCTGAAACA	0.368																0.204678	72.821375	86.670592	35	136	KEEP	---	---	---	---	17	22	79	78	-1	capture	Missense_Mutation	SNP	25442748	25442748	RNF17	13	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13353	47
SERPINA3	12	broad.mit.edu	37	14	95090098	95090098	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95090098G>A	uc001ydp.2	+	5	1298	c.1219G>A	c.(1219-1221)GAC>AAC	p.D407N	SERPINA3_uc001ydo.3_Missense_Mutation_p.D432N|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.D407N|SERPINA3_uc001yds.2_Missense_Mutation_p.D407N|SERPINA3_uc010avg.2_Missense_Mutation_p.D407N	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	407					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity	p.D407N(1)		ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TGTCCCTACAGACACCCAGAA	0.493																0.151261	65.930071	93.672646	36	202	KEEP	---	---	---	---	17	23	105	131	-1	capture	Missense_Mutation	SNP	95090098	95090098	SERPINA3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	13983	47
KIF26A	26153	broad.mit.edu	37	14	104643009	104643009	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104643009G>A	uc001yos.3	+	12	3884	c.3884G>A	c.(3883-3885)CGC>CAC	p.R1295H		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1295					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		AGGGCGGCCCGCAGGCCAGAG	0.701																0.135135	6.347699	11.124399	5	32	KEEP	---	---	---	---	4	2	18	18	-1	capture	Missense_Mutation	SNP	104643009	104643009	KIF26A	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8216	47
HEXA	3073	broad.mit.edu	37	15	72645470	72645470	+	Missense_Mutation	SNP	C	T	T	rs121907957		TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:72645470C>T	uc002aun.3	-	5	716	c.509G>A	c.(508-510)CGG>CAG	p.R170Q	CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Missense_Mutation_p.R181Q|HEXA_uc002auo.3_Missense_Mutation_p.R33Q|HEXA_uc010bix.2_Missense_Mutation_p.R170Q|HEXA_uc010biy.2_Missense_Mutation_p.R33Q|HEXA_uc010uko.1_Intron|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	170			R -> W (in GM2G1; infantile).|R -> Q (in GM2G1; infantile; inactive or unstable protein).		cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						CAGCAAGCCCCGGTGAGGAAA	0.468																0.178571	30.178398	38.34385	15	69	KEEP	---	---	---	---	7	9	33	42	-1	capture	Missense_Mutation	SNP	72645470	72645470	HEXA	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6998	47
ADAMTS17	170691	broad.mit.edu	37	15	100692957	100692957	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:100692957T>C	uc002bvv.1	-	10	1412	c.1333A>G	c.(1333-1335)AGC>GGC	p.S445G	ADAMTS17_uc002bvx.1_Missense_Mutation_p.S202G	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	445	Peptidase M12B.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		AAGCAGGTGCTGACTTTTGAC	0.473																0.049383	-11.100199	6.618253	4	77	KEEP	---	---	---	---	3	1	54	39	-1	capture	Missense_Mutation	SNP	100692957	100692957	ADAMTS17	15	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	262	47
CDH1	999	broad.mit.edu	37	16	68856093	68856093	+	Missense_Mutation	SNP	C	T	T	rs121964878		TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:68856093C>T	uc002ewg.1	+	12	2025	c.1901C>T	c.(1900-1902)GCG>GTG	p.A634V	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.A573V	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	634	Cadherin 5.|Extracellular (Potential).		A -> V (found in a gastric cancer sample; cells exhibited decreased aggregation increased invasiveness and non-uniform migration in vitro compared to cells transfected with wild-type sequence).	ASA -> RVP (in Ref. 3; AAA61259).	adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.A634V(3)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACACACGGGGCGAGTGCCAAC	0.493					231	Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				0.178571	47.89136	61.50696	25	115	KEEP	---	---	---	---	18	11	67	79	-1	capture	Missense_Mutation	SNP	68856093	68856093	CDH1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3066	47
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	T	T	rs11540652		TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577538C>T	uc002gim.2	-	7	937	c.743G>A	c.(742-744)CGG>CAG	p.R248Q	TP53_uc002gig.1_Missense_Mutation_p.R248Q|TP53_uc002gih.2_Missense_Mutation_p.R248Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116Q|TP53_uc010cng.1_Missense_Mutation_p.R116Q|TP53_uc002gii.1_Missense_Mutation_p.R116Q|TP53_uc010cnh.1_Missense_Mutation_p.R248Q|TP53_uc010cni.1_Missense_Mutation_p.R248Q|TP53_uc002gij.2_Missense_Mutation_p.R248Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155Q|TP53_uc002gio.2_Missense_Mutation_p.R116Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GATGGGCCTCCGGTTCATGCC	0.572	Pancreas(47;798 1329 9957 10801)	R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	p.R248L(NCIH211-Tumor)|p.R248L(NB4-Tumor)|p.R248L(PC14-Tumor)|p.R248L(KYO1-Tumor)|p.R248L(PCM6-Tumor)|p.R248L(NUDHL1-Tumor)|p.R248L(BL41-Tumor)|p.R248Q(FADU-Tumor)|p.R248L(CI1-Tumor)|p.R248L(SW1463-Tumor)|p.R248L(COLO699-Tumor)|p.R248L(HS683-Tumor)|p.R248*(DB-Tumor)|p.R248L(HCC1143-Tumor)|p.R248L(NCIN87-Tumor)|p.R248A(SF126-Tumor)|p.R248L(PANC02.03-Tumor)|p.R248L(HEC1B-Tumor)|p.R248L(PECAPJ15-Tumor)|p.R248L(LNCAPCLONEFGC-Tumor)|p.R248L(NIHOVCAR3-Tumor)|p.R248L(NUDUL1-Tumor)|p.R248L(ONCODG1-Tumor)|p.R248L(RT112-Tumor)|p.R248L(SF295-Tumor)|p.R248L(P12ICHIKAWA-Tumor)|p.R248L(DND41-Tumor)|p.R248Q(SBC5-Tumor)|p.R248L(KOPN8-Tumor)|p.R248L(KASUMI1-Tumor)|p.R248L(EM2-Tumor)|p.R248L(SKUT1-Tumor)|p.R248L(NCCSTCK140-Tumor)|p.R248L(TE6-Tumor)|p.R248L(MOLM6-Tumor)|p.R248L(SEM-Tumor)|p.R248L(NAMALWA-Tumor)|p.R248L(CA46-Tumor)|p.R248L(639V-Tumor)|p.R248L(SKM1-Tumor)|p.R248Q(NCIH1573-Tumor)|p.R248Q(NCIH1618-Tumor)|p.R248L(HCC70-Tumor)|p.R248L(WSUDLCL2-Tumor)|p.R248L(HEC1A-Tumor)|p.R248L(KYSE150-Tumor)|p.R248L(HSC4-Tumor)|p.R248L(CL40-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.177966	45.901585	57.426972	21	97	KEEP	---	---	---	---	11	12	53	61	-1	capture	Missense_Mutation	SNP	7577538	7577538	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16264	47
NF1	4763	broad.mit.edu	37	17	29497003	29497003	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29497003C>T	uc002hgg.2	+	5	907	c.574C>T	c.(574-576)CGA>TGA	p.R192*	NF1_uc002hge.1_Nonsense_Mutation_p.R192*|NF1_uc002hgf.1_Nonsense_Mutation_p.R192*|NF1_uc002hgh.2_Nonsense_Mutation_p.R192*|NF1_uc010csn.1_Intron	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	192					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.R192*(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAAATTAAAACGACTCCTGAA	0.284				p.R192*(JHUEM1-Tumor)|p.R192*(KS1-Tumor)	847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.15942	19.880991	27.505422	11	58	KEEP	---	---	---	---	4	7	33	30	-1	capture	Nonsense_Mutation	SNP	29497003	29497003	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	6	1	10263	47
EVPL	2125	broad.mit.edu	37	17	74005931	74005931	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74005931G>A	uc002jqi.2	-	22	3583	c.3355C>T	c.(3355-3357)CGC>TGC	p.R1119C	EVPL_uc010wss.1_Missense_Mutation_p.R1141C|EVPL_uc010wst.1_Missense_Mutation_p.R589C	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1119	Central fibrous rod domain.|Potential.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TCTTCGATGCGAGCCTGTAGC	0.627																0.245614	66.654233	73.365882	28	86	KEEP	---	---	---	---	15	15	73	52	-1	capture	Missense_Mutation	SNP	74005931	74005931	EVPL	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5247	47
DSG2	1829	broad.mit.edu	37	18	29101206	29101206	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29101206C>T	uc002kwu.3	+	5	711	c.523C>T	c.(523-525)CAT>TAT	p.H175Y		NM_001943	NP_001934	Q14126	DSG2_HUMAN	desmoglein 2 preproprotein	175	Extracellular (Potential).|Cadherin 2.				cellular component disassembly involved in apoptosis|homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(2)|breast(1)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			GAGTGCAGCACGTAAGAGTCt	0.333																0.22807	27.446523	31.313999	13	44	KEEP	---	---	---	---	6	8	35	25	-1	capture	Missense_Mutation	SNP	29101206	29101206	DSG2	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4732	47
AP3D1	8943	broad.mit.edu	37	19	2110727	2110727	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2110727C>T	uc002luz.2	-	25	3191	c.2968G>A	c.(2968-2970)GTG>ATG	p.V990M	AP3D1_uc010dsv.2_Missense_Mutation_p.V80M|AP3D1_uc002luy.2_Missense_Mutation_p.V949M|AP3D1_uc002lva.2_Missense_Mutation_p.V1052M	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	990					eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAAAGGCACGGGGACGCCA	0.687																0.212121	15.205727	17.734965	7	26	KEEP	---	---	---	---	2	6	15	13	-1	capture	Missense_Mutation	SNP	2110727	2110727	AP3D1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	739	47
ACTL9	284382	broad.mit.edu	37	19	8807914	8807914	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8807914C>T	uc002mkl.2	-	1	1259	c.1138G>A	c.(1138-1140)GTA>ATA	p.V380I		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	380						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						CCGATCCATACGGAGAAATTC	0.662																0.284211	67.099264	71.063236	27	68	KEEP	---	---	---	---	15	14	39	48	-1	capture	Missense_Mutation	SNP	8807914	8807914	ACTL9	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	203	47
RYR1	6261	broad.mit.edu	37	19	38964245	38964245	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38964245G>A	uc002oit.2	+	28	4124	c.3994G>A	c.(3994-3996)GAA>AAA	p.E1332K	RYR1_uc002oiu.2_Missense_Mutation_p.E1332K	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1332	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CCCTGACTACGAAAACCTGCG	0.746																0.388889	20.320642	20.51542	7	11	KEEP	---	---	---	---	3	4	6	12	-1	capture	Missense_Mutation	SNP	38964245	38964245	RYR1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13660	47
RYR1	6261	broad.mit.edu	37	19	39076773	39076773	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39076773A>G	uc002oit.2	+	104	15041	c.14911A>G	c.(14911-14913)ACG>GCG	p.T4971A	RYR1_uc002oiu.2_Missense_Mutation_p.T4966A	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4971					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CTACTTTGATACGACACCGCA	0.557																0.177083	41.928996	51.34817	17	79	KEEP	---	---	---	---	11	8	47	55	-1	capture	Missense_Mutation	SNP	39076773	39076773	RYR1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	13660	47
CYP2F1	1572	broad.mit.edu	37	19	41630676	41630676	+	Silent	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41630676G>A	uc002opu.1	+	8	1073	c.1017G>A	c.(1015-1017)GCG>GCA	p.A339A	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Missense_Mutation_p.R320H|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	339					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						GGCTGCCGGCGCTGAAGGACC	0.672																0.166667	10.527923	14.320696	6	30	KEEP	---	---	---	---	2	5	15	24	-1	capture	Silent	SNP	41630676	41630676	CYP2F1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4131	47
CCDC155	147872	broad.mit.edu	37	19	49900952	49900952	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49900952G>T	uc002pnm.1	+	6	619	c.445G>T	c.(445-447)GGC>TGC	p.G149C	CCDC155_uc002pnl.1_Missense_Mutation_p.G149C|CCDC155_uc010emx.1_Missense_Mutation_p.G122C	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155	149						integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						GAGCTTCGGAGGCGAAGACCC	0.567																0.188679	103.18886	127.229157	50	215	KEEP	---	---	---	---	28	31	117	126	0.474576271186	capture	Missense_Mutation	SNP	49900952	49900952	CCDC155	19	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	2762	47
TMC4	147798	broad.mit.edu	37	19	54667515	54667515	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54667515C>A	uc010erf.2	-	8	1368	c.1236G>T	c.(1234-1236)AAG>AAT	p.K412N	TMC4_uc002qdn.2_Missense_Mutation_p.A103S|TMC4_uc002qdo.2_Missense_Mutation_p.K406N	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1	412	Helical; (Potential).					integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAGCAATGAGCTTGAACACGG	0.562														OREG0003641	type=REGULATORY REGION|Gene=AK124406|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.194175	83.00351	100.963717	40	166	KEEP	---	---	---	---	26	19	75	104	0.422222222222	capture	Missense_Mutation	SNP	54667515	54667515	TMC4	19	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	15872	47
SLC30A3	7781	broad.mit.edu	37	2	27481034	27481034	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27481034C>T	uc002rjk.2	-	3	605	c.419G>A	c.(418-420)CGT>CAT	p.R140H	SLC30A3_uc002rjj.2_5'UTR|SLC30A3_uc010ylh.1_Missense_Mutation_p.R135H	NM_003459	NP_003450	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter),	140	Cytoplasmic (Potential).				regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTACCTGAACGGTGCCAGCC	0.642																0.180672	83.196702	106.003107	43	195	KEEP	---	---	---	---	28	23	97	135	-1	capture	Missense_Mutation	SNP	27481034	27481034	SLC30A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14448	47
CTNNA2	1496	broad.mit.edu	37	2	79971613	79971613	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:79971613C>G	uc010ysh.1	+	2	208	c.203C>G	c.(202-204)ACT>AGT	p.T68S	CTNNA2_uc010yse.1_Missense_Mutation_p.T68S|CTNNA2_uc010ysf.1_Missense_Mutation_p.T68S|CTNNA2_uc010ysg.1_Missense_Mutation_p.T68S	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	68					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GAGCAAGCCACTCAGAATTTC	0.473					489											0.283019	46.102797	48.34382	15	38	KEEP	---	---	---	---	6	12	36	33	-1	capture	Missense_Mutation	SNP	79971613	79971613	CTNNA2	2	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	3976	47
PSD4	23550	broad.mit.edu	37	2	113942578	113942578	+	Silent	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113942578C>T	uc002tjc.2	+	3	1284	c.1101C>T	c.(1099-1101)GAC>GAT	p.D367D	PSD4_uc002tjd.2_Translation_Start_Site|PSD4_uc002tje.2_Silent_p.D366D|PSD4_uc002tjf.2_Translation_Start_Site	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	367					regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						cgtgtgtggacgaagcattga	0.219																0.182836	198.031337	248.666381	98	438	KEEP	---	---	---	---	50	58	249	219	-1	capture	Silent	SNP	113942578	113942578	PSD4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12544	47
BFSP1	631	broad.mit.edu	37	20	17489628	17489628	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17489628G>A	uc002wpo.2	-	5	680	c.641C>T	c.(640-642)ACG>ATG	p.T214M	BFSP1_uc002wpp.2_Missense_Mutation_p.T89M|BFSP1_uc010zrn.1_Missense_Mutation_p.T75M|BFSP1_uc010zro.1_Missense_Mutation_p.T75M	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	214	Rod.|Coil 2.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1						CTCCCGCTCCGTCAGGAGCTT	0.612																0.294118	25.239182	26.527554	10	24	KEEP	---	---	---	---	6	4	11	15	-1	capture	Missense_Mutation	SNP	17489628	17489628	BFSP1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1404	47
KRTAP10-6	386674	broad.mit.edu	37	21	46011400	46011400	+	Silent	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46011400G>A	uc002zfm.2	-	1	987	c.966C>T	c.(964-966)TCC>TCT	p.S322S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament					0						AGGCACCACAGGAGGGGACGG	0.692																0.025974	-30.024204	8.258003	4	150	KEEP	---	---	---	---	2	5	87	80	-1	capture	Silent	SNP	46011400	46011400	KRTAP10-6	21	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	8433	47
SEMA3F	6405	broad.mit.edu	37	3	50211752	50211752	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50211752G>T	uc003cyj.2	+	5	623	c.425G>T	c.(424-426)TGC>TTC	p.C142F	SEMA3F_uc003cyk.2_Missense_Mutation_p.C142F	NM_004186	NP_004177	Q13275	SEM3F_HUMAN	semaphorin 3F precursor	142	Sema.				axon guidance	extracellular space|membrane	chemorepellent activity|receptor activity			lung(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		AACCCCATGTGCACCTATGTG	0.662																0.176923	82.651187	108.202554	46	214	KEEP	---	---	---	---	26	30	108	132	0.464285714286	capture	Missense_Mutation	SNP	50211752	50211752	SEMA3F	3	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	13922	47
STAB1	23166	broad.mit.edu	37	3	52551965	52551965	+	Silent	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52551965C>T	uc003dej.2	+	45	4781	c.4707C>T	c.(4705-4707)TGC>TGT	p.C1569C	STAB1_uc003dek.1_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1569	Extracellular (Potential).|EGF-like 13.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CATGTACCTGCGACACAGCCC	0.602																0.192547	59.724077	73.945427	31	130	KEEP	---	---	---	---	16	15	63	73	-1	capture	Silent	SNP	52551965	52551965	STAB1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	15127	47
STXBP5L	9515	broad.mit.edu	37	3	120976020	120976020	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120976020C>T	uc003eec.3	+	17	1812	c.1672C>T	c.(1672-1674)CGA>TGA	p.R558*	STXBP5L_uc011bji.1_Nonsense_Mutation_p.R558*	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	558	WD 9.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		ATTAGAGGTACGACTTCAGTA	0.318																0.119718	18.567464	38.726581	17	125	KEEP	---	---	---	---	12	9	79	59	-1	capture	Nonsense_Mutation	SNP	120976020	120976020	STXBP5L	3	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	15247	47
HPS3	84343	broad.mit.edu	37	3	148868439	148868439	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148868439A>G	uc003ewu.1	+	6	1357	c.1217A>G	c.(1216-1218)GAG>GGG	p.E406G	HPS3_uc003ewt.1_Missense_Mutation_p.E406G|HPS3_uc011bnq.1_Missense_Mutation_p.E241G	NM_032383	NP_115759	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3 protein	406						cytoplasm				ovary(5)|large_intestine(1)	6			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GCTCGTGAGGAGGACCCGTAC	0.512												Hermansky-Pudlak_syndrome				0.016043	-43.079391	6.459421	3	184	KEEP	---	---	---	---	2	3	92	125	-1	capture	Missense_Mutation	SNP	148868439	148868439	HPS3	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	7265	47
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	Colon(199;1504 1750 3362 26421 31210 32040)	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	p.E545K(NCIH508-Tumor)|p.E545K(L363-Tumor)|p.E545K(KYSE510-Tumor)|p.E545K(MKN1-Tumor)|p.E545K(BFTC909-Tumor)|p.E545K(NCIH460-Tumor)|p.E545K(HCC202-Tumor)|p.E545K(KPL1-Tumor)|p.E545K(NCIH596-Tumor)|p.E545K(HUH28-Tumor)|p.E545K(MDAMB361-Tumor)|p.E545K(ESS1-Tumor)|p.E545K(TE5-Tumor)|p.E545K(HSC4-Tumor)|p.E545K(RERFLCSQ1-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.233333	16.307633	18.262033	7	23	KEEP	---	---	---	---	4	3	15	11	-1	capture	Missense_Mutation	SNP	178936091	178936091	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11816	47
BCL6	604	broad.mit.edu	37	3	187440292	187440292	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:187440292C>T	uc003frp.3	-	10	2532	c.2075G>A	c.(2074-2076)CGC>CAC	p.R692H	BCL6_uc011bsf.1_Missense_Mutation_p.R636H|BCL6_uc010hza.2_Missense_Mutation_p.R590H|BCL6_uc003frq.1_Missense_Mutation_p.R692H	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	692					negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GGCTGACACGCGGTATTGCAC	0.552					277	T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								0.030303	-33.371757	6.774709	5	160	KEEP	---	---	---	---	2	3	83	100	-1	capture	Missense_Mutation	SNP	187440292	187440292	BCL6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1365	47
CPZ	8532	broad.mit.edu	37	4	8605853	8605853	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8605853G>A	uc003glm.2	+	4	773	c.647G>A	c.(646-648)AGC>AAC	p.S216N	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.S79N|CPZ_uc003glo.2_Missense_Mutation_p.S205N|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	216					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						ATCGGGCGCAGCTTCGACGGC	0.687																0.352941	14.942802	15.267881	6	11	KEEP	---	---	---	---	2	4	10	9	-1	capture	Missense_Mutation	SNP	8605853	8605853	CPZ	4	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	3804	47
IL21	59067	broad.mit.edu	37	4	123542199	123542199	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123542199G>A	uc003ies.2	-	1	13	c.-32C>T	c.(-34--30)AACGA>AATGA		uc003iet.2_RNA|IL21_uc010int.2_Translation_Start_Site	NM_021803	NP_068575	Q9HBE4	IL21_HUMAN	interleukin 21						cell maturation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-17 production|positive regulation of T cell proliferation|signal transduction	extracellular space	cytokine activity|interleukin-2 receptor binding				0						CCTTGGTCTCGTTTTCACTTC	0.463																0.297872	73.45959	76.895029	28	66	KEEP	---	---	---	---	12	18	35	35	-1	capture	Translation_Start_Site	SNP	123542199	123542199	IL21	4	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	7593	47
PRDM9	56979	broad.mit.edu	37	5	23527680	23527680	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23527680G>T	uc003jgo.2	+	11	2665	c.2483G>T	c.(2482-2484)GGG>GTG	p.G828V		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	828					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						ACACACACAGGGGAGAAGCCC	0.582													HNSCC(3;0.000094)			0.125581	29.056033	58.534642	27	188	KEEP	---	---	---	---	18	21	132	128	0.461538461538	capture	Missense_Mutation	SNP	23527680	23527680	PRDM9	5	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12359	47
RGNEF	64283	broad.mit.edu	37	5	73090229	73090229	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73090229A>G	uc011csq.1	+	7	924	c.913A>G	c.(913-915)ATT>GTT	p.I305V	RGNEF_uc003kcx.2_Missense_Mutation_p.I305V|RGNEF_uc003kcy.1_Missense_Mutation_p.I305V|RGNEF_uc010izf.2_Missense_Mutation_p.I305V	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	305					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		TTTTGCAGAGATTAAGAATTC	0.398																0.25	11.892577	12.801301	4	12	KEEP	---	---	---	---	4	1	3	9	-1	capture	Missense_Mutation	SNP	73090229	73090229	RGNEF	5	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	13178	47
PCDHGB3	56102	broad.mit.edu	37	5	140750263	140750263	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140750263C>T	uc003ljw.1	+	1	302	c.302C>T	c.(301-303)ACG>ATG	p.T101M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc011dat.1_Missense_Mutation_p.T101M	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	101	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGAAGTCGACGTGTGTTCTG	0.433																0.224274	194.675065	221.158263	85	294	KEEP	---	---	---	---	55	39	155	184	-1	capture	Missense_Mutation	SNP	140750263	140750263	PCDHGB3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11467	47
KIF13A	63971	broad.mit.edu	37	6	17804730	17804730	+	Silent	SNP	G	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17804730G>T	uc003ncg.3	-	20	2421	c.2316C>A	c.(2314-2316)CTC>CTA	p.L772L	KIF13A_uc003ncf.2_Silent_p.L772L|KIF13A_uc003nch.3_Silent_p.L772L|KIF13A_uc003nci.3_Silent_p.L772L	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	772	Potential.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GTTTTCCGTAGAGTCTCTTTG	0.393																0.363636	10.996466	11.176647	4	7	KEEP	---	---	---	---	1	3	4	6	0.25	capture	Silent	SNP	17804730	17804730	KIF13A	6	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	8196	47
GFRAL	389400	broad.mit.edu	37	6	55198595	55198595	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55198595C>A	uc003pcm.1	+	3	255	c.169C>A	c.(169-171)CCC>ACC	p.P57T		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	57	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TCCAGGTGACCCCTGCAAGAT	0.353																0.03871	-24.472413	11.14797	6	149	KEEP	---	---	---	---	4	3	94	73	0.428571428571	capture	Missense_Mutation	SNP	55198595	55198595	GFRAL	6	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	6290	47
GFRAL	389400	broad.mit.edu	37	6	55198620	55198620	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:55198620A>G	uc003pcm.1	+	3	280	c.194A>G	c.(193-195)TAC>TGC	p.Y65C		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	65	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			AATTCATCATACTGTAACCTG	0.373																0.171233	60.872718	75.824675	25	121	KEEP	---	---	---	---	14	15	83	58	-1	capture	Missense_Mutation	SNP	55198620	55198620	GFRAL	6	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	6290	47
PRSS35	167681	broad.mit.edu	37	6	84234372	84234372	+	Silent	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84234372C>T	uc003pjz.2	+	2	1375	c.1212C>T	c.(1210-1212)CAC>CAT	p.H404H	PRSS35_uc010kbm.2_Silent_p.H404H	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	404	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TCTGGATTCACGGGAACGATG	0.512																0.303797	63.968731	66.683456	24	55	KEEP	---	---	---	---	13	15	28	35	-1	capture	Silent	SNP	84234372	84234372	PRSS35	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12519	47
THSD7A	221981	broad.mit.edu	37	7	11485827	11485827	+	Silent	SNP	T	A	A	rs79441692	by1000genomes	TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:11485827T>A	uc003ssf.3	-	13	3177	c.2925A>T	c.(2923-2925)CCA>CCT	p.P975P		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	975	TSP type-1 10.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CTTTTCCCTCTGGTAAAATAC	0.423													HNSCC(18;0.044)			0.177305	107.376328	135.038106	50	232	KEEP	---	---	---	---	25	34	117	137	-1	capture	Silent	SNP	11485827	11485827	THSD7A	7	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	15764	47
INHBA	3624	broad.mit.edu	37	7	41729399	41729399	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:41729399C>T	uc003thq.2	-	2	1365	c.1130G>A	c.(1129-1131)CGC>CAC	p.R377H	INHBA_uc003thr.2_Missense_Mutation_p.R377H	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	377				RMR -> AC (in Ref. 7; CAA51163).	cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						GCCCCGCATGCGGTAGTGGTT	0.547				p.R377H(NCIH727-Tumor)	102								TSP Lung(11;0.080)			0.114754	26.336825	62.021343	28	216	KEEP	---	---	---	---	14	18	122	133	-1	capture	Missense_Mutation	SNP	41729399	41729399	INHBA	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7664	47
GCK	2645	broad.mit.edu	37	7	44186119	44186119	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44186119G>C	uc003tkl.2	-	8	1432	c.962C>G	c.(961-963)TCC>TGC	p.S321C	GCK_uc003tkh.1_5'Flank|GCK_uc003tki.1_5'Flank|GCK_uc003tkj.1_Missense_Mutation_p.S320C|GCK_uc003tkk.1_Missense_Mutation_p.S322C	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1	321					cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						CAGCTGCTCGGAGGCCTCCCC	0.647					356											0.168367	77.380954	97.770893	33	163	KEEP	---	---	---	---	17	21	94	82	-1	capture	Missense_Mutation	SNP	44186119	44186119	GCK	7	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	6233	47
ADCY1	107	broad.mit.edu	37	7	45719321	45719321	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45719321C>G	uc003tne.3	+	11	1930	c.1912C>G	c.(1912-1914)CTG>GTG	p.L638V		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	638	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGTGGTCGTCCTGCTCCTGCT	0.577																0.145946	42.389651	64.70259	27	158	KEEP	---	---	---	---	17	13	82	95	-1	capture	Missense_Mutation	SNP	45719321	45719321	ADCY1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	292	47
WBSCR17	64409	broad.mit.edu	37	7	71175875	71175875	+	Missense_Mutation	SNP	G	A	A	rs143185553	byFrequency	TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71175875G>A	uc003tvy.2	+	10	1630	c.1630G>A	c.(1630-1632)GTC>ATC	p.V544I	WBSCR17_uc003tvz.2_Missense_Mutation_p.V243I	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	544	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CTGCGACAAGGTCAAGAGCAG	0.612																0.164384	19.489602	27.271427	12	61	KEEP	---	---	---	---	9	11	42	49	-1	capture	Missense_Mutation	SNP	71175875	71175875	WBSCR17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	17145	47
FKBP6	8468	broad.mit.edu	37	7	72754748	72754748	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72754748G>C	uc003tya.2	+	6	829	c.697G>C	c.(697-699)GAC>CAC	p.D233H	FKBP6_uc003twz.2_Missense_Mutation_p.D203H|FKBP6_uc011kew.1_Missense_Mutation_p.D228H|FKBP6_uc010lbe.1_RNA	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	233	TPR 2.				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				CCTGAAGCTAGACCGACCCAC	0.567																0.227273	115.506753	127.520591	40	136	KEEP	---	---	---	---	18	26	80	75	-1	capture	Missense_Mutation	SNP	72754748	72754748	FKBP6	7	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	5857	47
CCDC132	55610	broad.mit.edu	37	7	92886757	92886757	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92886757A>G	uc003umo.2	+	6	531	c.403A>G	c.(403-405)ATC>GTC	p.I135V	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.I105V|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Intron|CCDC132_uc003umn.2_Missense_Mutation_p.I135V	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	135											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			AGCTGCTGTTATCTGTACAAA	0.308																0.176471	23.246201	28.274103	9	42	KEEP	---	---	---	---	7	6	27	28	-1	capture	Missense_Mutation	SNP	92886757	92886757	CCDC132	7	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	2741	47
LRWD1	222229	broad.mit.edu	37	7	102106694	102106694	+	Silent	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:102106694C>T	uc003uzn.2	+	3	547	c.409C>T	c.(409-411)CTG>TTG	p.L137L	ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_5'UTR	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain	137					chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GGTGGAGAACCTGAATCGGGA	0.522																0.160714	55.710367	74.121395	27	141	KEEP	---	---	---	---	15	12	75	87	-1	capture	Silent	SNP	102106694	102106694	LRWD1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	8962	47
REPIN1	29803	broad.mit.edu	37	7	150069796	150069796	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150069796G>T	uc010lpq.1	+	4	1955	c.1466G>T	c.(1465-1467)TGC>TTC	p.C489F	REPIN1_uc003whd.2_Missense_Mutation_p.C478F|REPIN1_uc010lpr.1_Missense_Mutation_p.C546F|REPIN1_uc003whc.2_Missense_Mutation_p.C489F|REPIN1_uc003whe.2_Missense_Mutation_p.C489F	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	489	C2H2-type 13.				DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CCCTACGTCTGCCCCGACTGC	0.692																0.224	58.219551	66.989938	28	97	KEEP	---	---	---	---	12	20	72	62	0.375	capture	Missense_Mutation	SNP	150069796	150069796	REPIN1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	13122	47
PPP1R3B	79660	broad.mit.edu	37	8	8998667	8998667	+	Silent	SNP	C	T	T	rs138887555		TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:8998667C>T	uc003wsn.3	-	2	660	c.495G>A	c.(493-495)ACG>ACA	p.T165T	PPP1R3B_uc003wso.3_Silent_p.T164T	NM_024607	NP_078883	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	165	CBM21.				glycogen metabolic process					ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		AGGTGTCGAACGTCATCCTTA	0.502																0.192913	103.628623	125.991071	49	205	KEEP	---	---	---	---	34	20	126	112	-1	capture	Silent	SNP	8998667	8998667	PPP1R3B	8	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12273	47
IFNA10	3446	broad.mit.edu	37	9	21206859	21206859	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21206859G>A	uc003zoq.1	-	1	284	c.238C>T	c.(238-240)CTC>TTC	p.L80F	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	80					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		ATCTCATGGAGGACAGAGATG	0.483																0.057692	-3.621541	7.051955	3	49	KEEP	---	---	---	---	1	2	62	51	-1	capture	Missense_Mutation	SNP	21206859	21206859	IFNA10	9	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7457	47
IFNA10	3446	broad.mit.edu	37	9	21206861	21206861	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:21206861A>G	uc003zoq.1	-	1	282	c.236T>C	c.(235-237)GTC>GCC	p.V79A	IFNA14_uc003zoo.1_Intron	NM_002171	NP_002162	P01566	IFN10_HUMAN	interferon, alpha 10 precursor	79					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		CTCATGGAGGACAGAGATGGC	0.488																0.057692	-4.218685	6.460617	3	49	KEEP	---	---	---	---	1	2	60	49	-1	capture	Missense_Mutation	SNP	21206861	21206861	IFNA10	9	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	7457	47
ZNF483	158399	broad.mit.edu	37	9	114304228	114304228	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114304228C>G	uc004bff.2	+	6	1237	c.1013C>G	c.(1012-1014)CCC>CGC	p.P338R	ZNF483_uc004bfg.2_Intron	NM_133464	NP_597721	Q8TF39	ZN483_HUMAN	zinc finger protein 483 isoform a	338					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1						AGCAAGAAACCCTTCAGTTTT	0.413																0.269231	139.734968	148.455995	49	133	KEEP	---	---	---	---	32	24	76	73	-1	capture	Missense_Mutation	SNP	114304228	114304228	ZNF483	9	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	17815	47
REPS2	9185	broad.mit.edu	37	X	17157019	17157019	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:17157019C>T	uc004cxv.1	+	17	2020	c.1849C>T	c.(1849-1851)CGC>TGC	p.R617C	REPS2_uc004cxw.1_Missense_Mutation_p.R616C|REPS2_uc011miw.1_Missense_Mutation_p.R415C	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	617	Interaction with ASAP1 (By similarity).|Interaction with RALBP1.|Potential.				epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					AACTGCTATCCGCAAAAATAA	0.483																0.208333	24.022131	27.804626	10	38	KEEP	---	---	---	---	4	6	26	20	-1	capture	Missense_Mutation	SNP	17157019	17157019	REPS2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13124	47
CASK	8573	broad.mit.edu	37	X	41782236	41782236	+	Silent	SNP	G	A	A			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41782236G>A	uc004dfl.3	-	1	52	c.6C>T	c.(4-6)GCC>GCT	p.A2A	CASK_uc004dfm.3_Silent_p.A2A|CASK_uc004dfn.3_Silent_p.A2A	NM_003688	NP_003679	O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein	2					cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6						CGTCGTCGTCGGCCATGGTCC	0.642	NSCLC(42;104 1086 3090 27189 35040)				254											0.279661	88.824641	93.976356	33	85	KEEP	---	---	---	---	21	25	44	64	-1	capture	Silent	SNP	41782236	41782236	CASK	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2641	47
FGD1	2245	broad.mit.edu	37	X	54497806	54497806	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54497806G>T	uc004dtg.2	-	2	1156	c.422C>A	c.(421-423)ACT>AAT	p.T141N	FGD1_uc011moi.1_5'Flank	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	141	Pro-rich.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						AGGGGTTTCAGTCGGGGGACC	0.607																0.200957	98.626818	116.004135	42	167	KEEP	---	---	---	---	19	28	106	81	0.404255319149	capture	Missense_Mutation	SNP	54497806	54497806	FGD1	23	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	5778	47
ATP2B3	492	broad.mit.edu	37	X	152807349	152807349	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152807349C>T	uc004fht.1	+	3	755	c.629C>T	c.(628-630)GCG>GTG	p.A210V	ATP2B3_uc004fhs.1_Missense_Mutation_p.A210V	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	210	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCCGTGGCTGCGCTGGTGGTG	0.627																0.221774	127.306088	144.963981	55	193	KEEP	---	---	---	---	22	50	139	117	-1	capture	Missense_Mutation	SNP	152807349	152807349	ATP2B3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1132	47
LCAT	3931	broad.mit.edu	37	16	67973970	67973971	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0210-01	TCGA-06-0210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67973970_67973971insG	uc002euy.1	-	6	1170_1171	c.1159_1160insC	c.(1159-1161)CAGfs	p.Q387fs		NM_000229	NP_000220	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase precursor	387					cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|reverse cholesterol transport|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein A-I binding|phosphatidylcholine-sterol O-acyltransferase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		AGGCTGTGGCTGGCGGCCCTGC	0.629																0.03			7	258		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	67973970	67973971	LCAT	16	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	8578	47
