Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF1	65121	broad.mit.edu	37	1	12854545	12854545	+	Missense_Mutation	SNP	G	A	A	rs1063779	byFrequency	TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12854545G>A	uc001auj.1	+	3	872	c.769G>A	c.(769-771)GCC>ACC	p.A257T		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	257											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACGGTTAGTTGCCAAATTCAG	0.453																0.048485	-21.115175	14.63297	8	157	KEEP	---	---	---	---	17	16	68	91	-1	capture	Missense_Mutation	SNP	12854545	12854545	PRAMEF1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	12326	48
LDLRAD2	401944	broad.mit.edu	37	1	22142439	22142439	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22142439C>T	uc001bfg.1	+	3	702	c.515C>T	c.(514-516)CCT>CTT	p.P172L		NM_001013693	NP_001013715	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain	172	Extracellular (Potential).|LDL-receptor class A.					integral to membrane	receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		GCCTCAGGACCTTGTGGTGCC	0.627																0.4	136.85631	137.823713	44	66	KEEP	---	---	---	---	23	28	33	44	-1	capture	Missense_Mutation	SNP	22142439	22142439	LDLRAD2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8626	48
GBP7	388646	broad.mit.edu	37	1	89618461	89618461	+	Splice_Site	SNP	C	G	G			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89618461C>G	uc001dna.2	-	4	458	c.319_splice	c.e4-1	p.S107_splice	GBP2_uc001dmy.1_5'Flank	NM_207398	NP_997281	Q8N8V2	GBP7_HUMAN	guanylate binding protein 4-like							integral to membrane	GTP binding|GTPase activity			ovary(1)|skin(1)	2		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		TAGGGTCACTCTAGTGTTAAA	0.294																0.06	-3.419374	6.706035	3	47	KEEP	---	---	---	---	1	4	36	33	-1	capture	Splice_Site	SNP	89618461	89618461	GBP7	1	C	G	G	G	1	0	0	0	0	0	0	1	0	416	32	5	4	6219	48
HAO2	51179	broad.mit.edu	37	1	119923209	119923209	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:119923209G>A	uc001ehq.1	+	2	207	c.-145G>A	c.(-147--143)CAGTG>CAATG		HAO2_uc001ehr.1_Intron	NM_001005783	NP_001005783	Q9NYQ3	HAOX2_HUMAN	hydroxyacid oxidase 2						fatty acid alpha-oxidation	peroxisome	(S)-2-hydroxy-acid oxidase activity			ovary(2)|skin(2)	4	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.0155)|LUSC - Lung squamous cell carcinoma(189;0.0856)		TGGTGAGGCAGTGAAAATCCA	0.478																0.409091	29.674655	29.832404	9	13	KEEP	---	---	---	---	5	4	5	8	-1	capture	Translation_Start_Site	SNP	119923209	119923209	HAO2	1	G	A	A	A	1	0	0	0	0	0	0	0	0	456	36	2	2	6879	48
HSD3B2	3284	broad.mit.edu	37	1	119985601	119985601	+	Silent	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:119985601C>T	uc001ehu.2	+	4	550	c.408C>T	c.(406-408)ACC>ACT	p.T136T				P26439	3BHS2_HUMAN	RecName: Full=3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2; AltName: Full=3-beta-HSD II; Includes:   RecName: Full=3-beta-hydroxy-Delta(5)-steroid dehydrogenase;            EC=1.1.1.145;   AltName: Full=3-beta-hydroxy-5-ene steroid dehydrogenase;   AltName: Full=Progesterone reductase; Includes:   RecName: Full=Steroid Delta-isomerase;            EC=5.3.3.1;   AltName: Full=Delta-5-3-ketosteroid isomerase;	Error:Variant_position_missing_in_P26439_after_alignment					androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	TCATCCACACCGCCTGTATCA	0.507																0.416667	46.918505	47.136849	15	21	KEEP	---	---	---	---	6	13	19	12	-1	capture	Silent	SNP	119985601	119985601	HSD3B2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	287	23	1	1	7316	48
FAM63A	55793	broad.mit.edu	37	1	150974995	150974995	+	Silent	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150974995C>T	uc001ewf.2	-	3	1783	c.99G>A	c.(97-99)GAG>GAA	p.E33E	FAM63A_uc001ewc.2_Intron|FAM63A_uc010pcm.1_Intron|FAM63A_uc001ewd.2_Intron|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Silent_p.E81E|FAM63A_uc001ewg.2_Silent_p.E33E	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1	33							protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCTGAGGGTGCTCATCTGGGC	0.577																0.221649	197.714703	225.422861	86	302	KEEP	---	---	---	---	43	58	166	186	-1	capture	Silent	SNP	150974995	150974995	FAM63A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	5544	48
FLG	2312	broad.mit.edu	37	1	152284473	152284473	+	Silent	SNP	A	G	G			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152284473A>G	uc001ezu.1	-	3	2925	c.2889T>C	c.(2887-2889)TCT>TCC	p.S963S	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	963	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGCAGACCCAGACCACCTCT	0.582												Ichthyosis				0.452763	806.44142	807.535945	254	307	KEEP	---	---	---	---	146	139	181	168	-1	capture	Silent	SNP	152284473	152284473	FLG	1	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	5867	48
DPT	1805	broad.mit.edu	37	1	168698174	168698174	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168698174G>A	uc001gfp.2	-	1	255	c.239C>T	c.(238-240)ACG>ATG	p.T80M		NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor	80	2 X 53-55 AA tandem repeats.|1-2.|3 X 6 AA repeats of D-R-[EQ]-W-[NQK]- [FY].				cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					GCTCTGTGGCGTGGGCATGCA	0.607																0.448276	304.21412	304.761923	104	128	KEEP	---	---	---	---	59	69	64	84	-1	capture	Missense_Mutation	SNP	168698174	168698174	DPT	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4694	48
YOD1	55432	broad.mit.edu	37	1	207222900	207222900	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207222900C>T	uc001hfe.1	-	2	559	c.512G>A	c.(511-513)GGA>GAA	p.G171E	PFKFB2_uc010psc.1_5'UTR|YOD1_uc001hff.1_Missense_Mutation_p.G127E	NM_018566	NP_061036	Q5VVQ6	OTU1_HUMAN	YOD1 OTU deubiquinating enzyme 1 homolog	171	OTU.				cellular amino acid metabolic process|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein K48-linked deubiquitination|protein K63-linked deubiquitination	intracellular	protein binding|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1	Prostate(682;0.19)					CAAGACTCCTCCTTCGACGAC	0.483																0.442105	127.235789	127.513528	42	53	KEEP	---	---	---	---	19	23	28	27	-1	capture	Missense_Mutation	SNP	207222900	207222900	YOD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17369	48
PTER	9317	broad.mit.edu	37	10	16528558	16528558	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:16528558C>T	uc001iog.1	+	4	847	c.640C>T	c.(640-642)CGA>TGA	p.R214*	PTER_uc001ioh.1_Nonsense_Mutation_p.R214*|PTER_uc001ioi.1_Nonsense_Mutation_p.R214*|PTER_uc009xjp.1_Nonsense_Mutation_p.R214*	NM_030664	NP_109589	Q96BW5	PTER_HUMAN	phosphotriesterase related	214					catabolic process		hydrolase activity, acting on ester bonds|zinc ion binding			ovary(2)	2						TCAGATTATCCGAATATTGCA	0.478	Ovarian(2;46 150 15648 38137 47908)															0.066667	-4.22605	13.294934	6	84	KEEP	---	---	---	---	4	2	47	51	-1	capture	Nonsense_Mutation	SNP	16528558	16528558	PTER	10	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	12634	48
P2RX3	5024	broad.mit.edu	37	11	57106069	57106069	+	Silent	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57106069G>A	uc001nju.2	+	1	121	c.45G>A	c.(43-45)TCG>TCA	p.S15S	SSRP1_uc001njt.2_5'Flank	NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3	15	Cytoplasmic (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						CCACCAAGTCGGTGGTTGTGA	0.532																0.398792	408.484176	411.432564	132	199	KEEP	---	---	---	---	67	78	109	111	-1	capture	Silent	SNP	57106069	57106069	P2RX3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11245	48
FOLR4	390243	broad.mit.edu	37	11	94040372	94040372	+	Silent	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94040372G>A	uc010rud.1	+	3	369	c.369G>A	c.(367-369)CCG>CCA	p.P123P		NM_001080486	NP_001073955	A6ND01	FOLR4_HUMAN	folate receptor 4 (delta) homolog	130						extracellular region	folic acid binding|receptor activity			ovary(1)	1						TGAATGTGCCGCTGTGCCAGG	0.542																0.375	24.468251	24.797731	9	15	KEEP	---	---	---	---	3	8	14	3	-1	capture	Silent	SNP	94040372	94040372	FOLR4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5928	48
MMP3	4314	broad.mit.edu	37	11	102709963	102709963	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102709963C>T	uc001phj.1	-	7	1012	c.947G>A	c.(946-948)CGC>CAC	p.R316H		NM_002422	NP_002413	P08254	MMP3_HUMAN	matrix metalloproteinase 3 preproprotein	316	Hemopexin-like 1.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding	p.R316C(1)		lung(1)|kidney(1)	2		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)|Simvastatin(DB00641)	GAGGGATTTGCGCCAAAAGTG	0.403																0.277311	85.524347	90.834823	33	86	KEEP	---	---	---	---	15	22	38	62	-1	capture	Missense_Mutation	SNP	102709963	102709963	MMP3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9578	48
TRIM29	23650	broad.mit.edu	37	11	120008271	120008271	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120008271C>T	uc001pwz.2	-	1	593	c.469G>A	c.(469-471)GAC>AAC	p.D157N	TRIM29_uc001pxa.2_RNA	NM_012101	NP_036233	Q14134	TRI29_HUMAN	tripartite motif protein TRIM29	157					transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		AGGCCCGTGTCGGCCCGGGGG	0.642																0.430233	211.339984	212.064655	74	98	KEEP	---	---	---	---	46	44	66	50	-1	capture	Missense_Mutation	SNP	120008271	120008271	TRIM29	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16386	48
IQSEC3	440073	broad.mit.edu	37	12	274924	274924	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:274924C>A	uc001qhw.1	+	8	1936	c.1930C>A	c.(1930-1932)CCG>ACG	p.P644T	IQSEC3_uc001qhu.1_Missense_Mutation_p.P644T	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	947	PH.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity	p.P644T(1)		central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		ACTGGTGACCCCGCTCTCGGG	0.607																0.404762	95.625553	96.293348	34	50	KEEP	---	---	---	---	14	25	21	36	0.641025641026	capture	Missense_Mutation	SNP	274924	274924	IQSEC3	12	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	7742	48
ZNF705A	440077	broad.mit.edu	37	12	8328517	8328517	+	Silent	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8328517C>T	uc001qud.1	+	4	369	c.297C>T	c.(295-297)GAC>GAT	p.D99D		NM_001004328	NP_001004328	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	99					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				Kidney(36;0.0877)		CCAGAAAAGACGCATCCACCA	0.343																0.023346	-55.079553	9.917235	6	251	KEEP	---	---	---	---	2	5	166	191	-1	capture	Silent	SNP	8328517	8328517	ZNF705A	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17985	48
CYP27B1	1594	broad.mit.edu	37	12	58158830	58158830	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58158830G>A	uc001spz.1	-	4	906	c.754C>T	c.(754-756)CGC>TGC	p.R252C	CYP27B1_uc001sqa.1_Missense_Mutation_p.R17C|CYP27B1_uc001sqb.1_Missense_Mutation_p.P132L|CYP27B1_uc001sqc.1_Missense_Mutation_p.P132L	NM_000785	NP_000776	O15528	CP27B_HUMAN	cytochrome P450, family 27, subfamily B,	252					bone mineralization|calcium ion homeostasis|calcium ion transport|decidualization|G1 to G0 transition|hormone biosynthetic process|negative regulation of calcidiol 1-monooxygenase activity|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of keratinocyte differentiation|positive regulation of vitamin D 24-hydroxylase activity|positive regulation of vitamin D receptor signaling pathway|regulation of bone mineralization|response to estrogen stimulus|response to interferon-gamma|response to lipopolysaccharide|response to tumor necrosis factor|response to vitamin D|vitamin D biosynthetic process|xenobiotic metabolic process	mitochondrial outer membrane	calcidiol 1-monooxygenase activity|electron carrier activity|heme binding	p.R252C(1)		central_nervous_system(3)	3	all_cancers(7;8.09e-80)|Lung NSC(6;2.26e-27)|all_lung(6;1.99e-25)|all_epithelial(6;3.62e-18)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;1.97e-113)|all cancers(5;1.54e-78)|BRCA - Breast invasive adenocarcinoma(9;0.0294)		Calcidiol(DB00146)|Calcitriol(DB00136)|Ergocalciferol(DB00153)	CGGCAGAGGCGGCCCCAGGGC	0.607					101									OREG0021953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.404494	109.203081	109.906153	36	53	KEEP	---	---	---	---	16	29	32	35	-1	capture	Missense_Mutation	SNP	58158830	58158830	CYP27B1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4119	48
AMDHD1	144193	broad.mit.edu	37	12	96348739	96348739	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96348739G>A	uc001tel.1	+	3	401	c.295G>A	c.(295-297)GAA>AAA	p.E99K	AMDHD1_uc009zth.1_Intron	NM_152435	NP_689648	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	99					histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1						AAGAGTTCACGAATTTGCAAT	0.358																0.039216	-15.592768	7.786153	4	98	KEEP	---	---	---	---	2	2	58	58	-1	capture	Missense_Mutation	SNP	96348739	96348739	AMDHD1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	567	48
GLT8D2	83468	broad.mit.edu	37	12	104390580	104390580	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104390580G>A	uc001tkh.1	-	8	939	c.533C>T	c.(532-534)GCG>GTG	p.A178V	GLT8D2_uc001tki.1_Missense_Mutation_p.A178V	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	178	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						GAAAGCCGCCGCGTGGCCCAG	0.483																0.385621	165.307259	167.054846	59	94	KEEP	---	---	---	---	34	37	45	65	-1	capture	Missense_Mutation	SNP	104390580	104390580	GLT8D2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6406	48
RFX4	5992	broad.mit.edu	37	12	107126727	107126727	+	Silent	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107126727G>A	uc001tlr.2	+	15	1563	c.1497G>A	c.(1495-1497)TTG>TTA	p.L499L	RFX4_uc001tls.2_Silent_p.L508L|RFX4_uc001tlt.2_Silent_p.L508L|RFX4_uc001tlv.2_Silent_p.L405L	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	499					transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						AGATCATCTTGACAGAGGCTG	0.458																0.462585	195.188027	195.366202	68	79	KEEP	---	---	---	---	51	41	73	63	-1	capture	Silent	SNP	107126727	107126727	RFX4	12	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	13160	48
MMP17	4326	broad.mit.edu	37	12	132322758	132322758	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132322758G>A	uc001ujc.1	+	2	277	c.178G>A	c.(178-180)GGT>AGT	p.G60S	MMP17_uc001ujd.1_5'UTR	NM_016155	NP_057239	Q9ULZ9	MMP17_HUMAN	matrix metalloproteinase 17 preproprotein	60					proteolysis	anchored to membrane|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)		AAGCAGGTTCGGTTACCTGCC	0.647																0.403846	65.76463	66.185044	21	31	KEEP	---	---	---	---	6	16	15	19	-1	capture	Missense_Mutation	SNP	132322758	132322758	MMP17	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9568	48
TMTC4	84899	broad.mit.edu	37	13	101315357	101315357	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:101315357G>A	uc001vou.2	-	4	516	c.356C>T	c.(355-357)TCT>TTT	p.S119F	TMTC4_uc001vot.2_Missense_Mutation_p.S138F|TMTC4_uc010tja.1_Intron	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	119	Helical; (Potential).					integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CATGAGGACAGAGATGCCACT	0.602																0.346667	152.411439	155.544542	52	98	KEEP	---	---	---	---	30	31	55	62	-1	capture	Missense_Mutation	SNP	101315357	101315357	TMTC4	13	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	16146	48
SYT16	83851	broad.mit.edu	37	14	62547795	62547795	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62547795G>A	uc001xfu.1	+	4	1434	c.1237G>A	c.(1237-1239)GTC>ATC	p.V413I	SYT16_uc010tsd.1_3'UTR|SYT16_uc010tse.1_5'UTR	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	413	C2 1.									central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GCCCAACCCCGTCTTCAGGGA	0.582																0.444444	59.894102	60.015091	20	25	KEEP	---	---	---	---	13	10	18	14	-1	capture	Missense_Mutation	SNP	62547795	62547795	SYT16	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15360	48
RTL1	388015	broad.mit.edu	37	14	101349286	101349286	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:101349286C>T	uc010txj.1	-	1	1899	c.1840G>A	c.(1840-1842)GCG>ACG	p.A614T	uc001yig.3_5'Flank|MIR127_hsa-mir-127|MI0000472_5'Flank|MIR432_hsa-mir-432|MI0003133_5'Flank|uc010txk.1_5'Flank|MIR136_hsa-mir-136|MI0000475_5'Flank	NM_001134888	NP_001128360	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	614										pancreas(1)	1						TCCCAAGGCGCGGTGGAGGGA	0.552																0.45122	103.155105	103.326233	37	45	KEEP	---	---	---	---	18	25	17	31	-1	capture	Missense_Mutation	SNP	101349286	101349286	RTL1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13616	48
CKMT1A	548596	broad.mit.edu	37	15	43991229	43991229	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43991229G>A	uc001zsn.2	+	10	1588	c.1196G>A	c.(1195-1197)CGT>CAT	p.R399H	CKMT1A_uc010uea.1_Missense_Mutation_p.R430H|CKMT1A_uc001zso.3_Missense_Mutation_p.R399H	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor	399	Phosphagen kinase C-terminal.				creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TGTGAACGGCGTCTGGAGAGA	0.493																0.470874	283.44336	283.596433	97	109	KEEP	---	---	---	---	51	63	103	62	-1	capture	Missense_Mutation	SNP	43991229	43991229	CKMT1A	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3414	48
TMOD3	29766	broad.mit.edu	37	15	52155124	52155124	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52155124C>A	uc002abm.2	+	2	262	c.43C>A	c.(43-45)CTT>ATT	p.L15I		NM_014547	NP_055362	Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)	15						cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		GTACAAAGACCTTGATGAAGA	0.443	Colon(122;1837 2251 18387 22826)															0.447552	192.271468	192.615488	64	79	KEEP	---	---	---	---	37	36	52	37	0.493150684932	capture	Missense_Mutation	SNP	52155124	52155124	TMOD3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16118	48
OR1A1	8383	broad.mit.edu	37	17	3119408	3119408	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3119408G>A	uc010vrc.1	+	1	494	c.494G>A	c.(493-495)AGT>AAT	p.S165N		NM_014565	NP_055380	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CTCACAGCTAGTCTGTCCTTC	0.483																0.028249	-33.686406	9.709244	5	172	KEEP	---	---	---	---	4	3	90	94	-1	capture	Missense_Mutation	SNP	3119408	3119408	OR1A1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10853	48
MYOCD	93649	broad.mit.edu	37	17	12649324	12649324	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:12649324T>G	uc002gnn.2	+	9	1359	c.1060T>G	c.(1060-1062)TCT>GCT	p.S354A	MYOCD_uc002gno.2_Missense_Mutation_p.S354A|MYOCD_uc002gnp.1_Missense_Mutation_p.S258A|MYOCD_uc002gnq.2_Missense_Mutation_p.S73A	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	354					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AAACAGTTTTTCTGGACAAAC	0.408																0.483986	508.602369	508.664527	136	145	KEEP	---	---	---	---	63	85	87	70	-1	capture	Missense_Mutation	SNP	12649324	12649324	MYOCD	17	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	9997	48
NCOR1	9611	broad.mit.edu	37	17	15967451	15967451	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:15967451G>A	uc002gpo.2	-	35	5392	c.5152C>T	c.(5152-5154)CGG>TGG	p.R1718W	NCOR1_uc002gpn.2_Missense_Mutation_p.R1734W|NCOR1_uc002gpm.2_Missense_Mutation_p.R238W|NCOR1_uc010vwb.1_Missense_Mutation_p.R302W|NCOR1_uc010coy.2_Missense_Mutation_p.R626W|NCOR1_uc010vwc.1_Missense_Mutation_p.R528W	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1718	Interaction with ETO.|Interaction with C1D (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		tcccgctcccgttcccgttcc	0.383																0.413223	143.241241	144.032738	50	71	KEEP	---	---	---	---	24	30	40	39	-1	capture	Missense_Mutation	SNP	15967451	15967451	NCOR1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	10142	48
ABI3	51225	broad.mit.edu	37	17	47297600	47297600	+	Silent	SNP	C	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47297600C>A	uc002iop.1	+	6	1212	c.714C>A	c.(712-714)CCC>CCA	p.P238P	ABI3_uc002ioq.1_Silent_p.P232P	NM_016428	NP_057512	Q9P2A4	ABI3_HUMAN	NESH protein isoform 1	238	Pro-rich.				cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CACCTCTCCCCAGCTCCTTGG	0.701													HNSCC(55;0.14)			0.5	30.148936	30.148936	10	10	KEEP	---	---	---	---	6	7	10	7	0.538461538462	capture	Silent	SNP	47297600	47297600	ABI3	17	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	90	48
MRPS7	51081	broad.mit.edu	37	17	73258761	73258761	+	Silent	SNP	A	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73258761A>T	uc002jnm.3	+	2	500	c.267A>T	c.(265-267)CCA>CCT	p.P89P	GGA3_uc002jni.1_5'Flank|GGA3_uc002jnj.1_5'Flank|GGA3_uc010wrw.1_5'Flank|GGA3_uc002jnk.1_5'Flank|GGA3_uc010wrx.1_5'Flank|GGA3_uc010wry.1_5'Flank|GGA3_uc010wrz.1_5'Flank|MRPS7_uc002jnl.2_Silent_p.P89P|MRPS7_uc002jnn.3_Silent_p.P118P	NM_015971	NP_057055	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7 precursor	89					translation	cytosolic small ribosomal subunit|mitochondrion	protein binding|RNA binding|structural constituent of ribosome			central_nervous_system(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			TTGAAGACCCAGTCATCAGGT	0.473																0.04902	-24.831826	19.258866	10	194	KEEP	---	---	---	---	7	4	95	114	-1	capture	Silent	SNP	73258761	73258761	MRPS7	17	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	9758	48
SETBP1	26040	broad.mit.edu	37	18	42530935	42530935	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:42530935C>T	uc010dni.2	+	4	1926	c.1630C>T	c.(1630-1632)CGA>TGA	p.R544*		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	544						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CACCATGCTTCGAGAGGCAGT	0.507												Schinzel-Giedion_syndrome				0.382353	340.929865	344.633178	117	189	KEEP	---	---	---	---	67	80	130	129	-1	capture	Nonsense_Mutation	SNP	42530935	42530935	SETBP1	18	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	14022	48
MUC16	94025	broad.mit.edu	37	19	8976821	8976821	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8976821G>A	uc002mkp.2	-	73	42449	c.42245C>T	c.(42244-42246)ACC>ATC	p.T14082I	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.T882I|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	14112	SEA 14.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATTGGAGATGGTGAAGTTGAG	0.567																0.285714	71.442625	75.493277	28	70	KEEP	---	---	---	---	14	14	31	46	-1	capture	Missense_Mutation	SNP	8976821	8976821	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9883	48
PODNL1	79883	broad.mit.edu	37	19	14046600	14046600	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14046600G>A	uc002mxr.2	-	5	723	c.449C>T	c.(448-450)GCG>GTG	p.A150V	PODNL1_uc010xni.1_Missense_Mutation_p.A68V|PODNL1_uc010xnj.1_Missense_Mutation_p.A148V|PODNL1_uc002mxs.2_Intron	NM_024825	NP_079101	Q6PEZ8	PONL1_HUMAN	podocan-like 1 isoform 1	150	Leu-rich.|LRR 4.					proteinaceous extracellular matrix				central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			AGCCAGATCCGCGACACGGAG	0.667																0.37037	55.994969	56.78856	20	34	KEEP	---	---	---	---	10	10	22	21	-1	capture	Missense_Mutation	SNP	14046600	14046600	PODNL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12082	48
NCAN	1463	broad.mit.edu	37	19	19351439	19351439	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19351439G>A	uc002nlz.2	+	12	3536	c.3437G>A	c.(3436-3438)GGC>GAC	p.G1146D	NCAN_uc002nma.2_5'UTR	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1146	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			ACGTGGATCGGCCTGAACGAC	0.632																0.023121	-37.362406	6.463554	4	169	KEEP	---	---	---	---	3	1	109	107	-1	capture	Missense_Mutation	SNP	19351439	19351439	NCAN	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10111	48
ZNF254	9534	broad.mit.edu	37	19	24310730	24310730	+	Missense_Mutation	SNP	C	G	G	rs144271497		TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:24310730C>G	uc002nru.2	+	4	2062	c.1928C>G	c.(1927-1929)TCG>TGG	p.S643W	ZNF254_uc010xrk.1_Missense_Mutation_p.S558W	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	643					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AATCGGTCCTCGCACCTCACC	0.378																0.245487	217.072087	233.40392	68	209	KEEP	---	---	---	---	37	44	125	133	-1	capture	Missense_Mutation	SNP	24310730	24310730	ZNF254	19	C	G	G	G	1	0	0	0	0	1	0	0	0	403	31	4	4	17678	48
SIGLEC10	89790	broad.mit.edu	37	19	51919181	51919181	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51919181T>C	uc002pwo.2	-	5	1611	c.995A>G	c.(994-996)CAG>CGG	p.Q332R	SIGLEC10_uc002pwp.2_Missense_Mutation_p.Q274R|SIGLEC10_uc002pwq.2_Missense_Mutation_p.Q274R|SIGLEC10_uc002pwr.2_Missense_Mutation_p.Q332R|SIGLEC10_uc010ycy.1_Intron|SIGLEC10_uc010ycz.1_Missense_Mutation_p.Q284R|SIGLEC10_uc010eow.2_Missense_Mutation_p.Q144R|SIGLEC10_uc002pws.1_Intron	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	332	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGCTCGCTGCTGGGAGCCAAG	0.682																0.167442	52.647067	75.459157	36	179	KEEP	---	---	---	---	28	35	115	129	-1	capture	Missense_Mutation	SNP	51919181	51919181	SIGLEC10	19	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	14199	48
LILRB5	10990	broad.mit.edu	37	19	54759940	54759940	+	Silent	SNP	C	T	T	rs144716655		TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54759940C>T	uc002qex.2	-	4	732	c.621G>A	c.(619-621)TCG>TCA	p.S207S	LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Silent_p.S198S|LILRB5_uc002qey.2_Silent_p.S207S|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_Intron|LILRB5_uc010yes.1_RNA	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	207	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CACTGGGGTTCGACCACACCT	0.522																0.26738	127.745724	136.900894	50	137	KEEP	---	---	---	---	32	26	78	82	-1	capture	Silent	SNP	54759940	54759940	LILRB5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	8714	48
KIR2DL4	3805	broad.mit.edu	37	19	55325326	55325326	+	Silent	SNP	G	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55325326G>T	uc010yfm.1	+	10	934	c.894G>T	c.(892-894)GTG>GTT	p.V298V	KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_Silent_p.V315V|KIR2DL4_uc002qhg.2_Silent_p.V263V|KIR2DL4_uc002qhi.2_3'UTR|KIR2DL4_uc002qhh.2_Silent_p.V168V|KIR2DL4_uc002qhj.2_Silent_p.V246V|KIR2DL4_uc002qhf.2_Silent_p.V151V|KIR2DL4_uc010esd.2_3'UTR|KIR2DL4_uc010ese.2_RNA|KIR3DL1_uc010yfn.1_5'Flank|KIR3DL1_uc010esf.2_5'Flank|KIR3DL1_uc002qhk.3_5'Flank|KIR3DL1_uc010yfo.1_5'Flank|KIR3DL1_uc002qhl.3_5'Flank	NM_002255	NP_002246	Q99706	KI2L4_HUMAN	killer cell immunoglobulin-like receptor, two	298	Cytoplasmic (Potential).		Missing (in allele KIR2DL4*0501).		cellular defense response|regulation of immune response	integral to plasma membrane	protein binding|transmembrane receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0192)		CTCAGGAGGTGACATACGCAC	0.473																0.28877	133.858367	141.348698	54	133	KEEP	---	---	---	---	65	74	165	168	0.467625899281	capture	Silent	SNP	55325326	55325326	KIR2DL4	19	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	8240	48
NLRP13	126204	broad.mit.edu	37	19	56424570	56424570	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56424570G>A	uc010ygg.1	-	5	638	c.613C>T	c.(613-615)CGT>TGT	p.R205C		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	205							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GATGTATTACGGATATATACG	0.498																0.237687	286.008085	315.353743	111	356	KEEP	---	---	---	---	62	62	206	184	-1	capture	Missense_Mutation	SNP	56424570	56424570	NLRP13	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10382	48
RAD51AP2	729475	broad.mit.edu	37	2	17699042	17699042	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:17699042G>T	uc002rcl.1	-	1	665	c.641C>A	c.(640-642)GCT>GAT	p.A214D	RAD51AP2_uc010exn.1_Missense_Mutation_p.A205D	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	214										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AACACTGTTAGCTTTACATCT	0.313																0.33871	117.805817	120.661071	42	82	KEEP	---	---	---	---	23	23	33	57	0.5	capture	Missense_Mutation	SNP	17699042	17699042	RAD51AP2	2	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	12882	48
REG1B	5968	broad.mit.edu	37	2	79314050	79314050	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:79314050T>C	uc002sny.2	-	3	183	c.71A>G	c.(70-72)GAG>GGG	p.E24G	REG1B_uc010ffv.1_Missense_Mutation_p.E24G|REG1B_uc010ffw.2_Missense_Mutation_p.E24G	NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	24					cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						TGTCTGGGACTCCTGGCCTGG	0.488																0.323276	237.149937	243.579462	75	157	KEEP	---	---	---	---	51	61	84	103	-1	capture	Missense_Mutation	SNP	79314050	79314050	REG1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	13106	48
DPP10	57628	broad.mit.edu	37	2	116573266	116573266	+	Silent	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116573266G>A	uc002tla.1	+	21	2368	c.1911G>A	c.(1909-1911)CTG>CTA	p.L637L	DPP10_uc002tlb.1_Silent_p.L587L|DPP10_uc002tlc.1_Silent_p.L633L|DPP10_uc002tle.2_Silent_p.L641L|DPP10_uc002tlf.1_Silent_p.L630L	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	637	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGCTGAAACTGCCTTACATTG	0.279																0.461538	70.292264	70.359541	24	28	KEEP	---	---	---	---	15	14	14	19	-1	capture	Silent	SNP	116573266	116573266	DPP10	2	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	4682	48
LRP2	4036	broad.mit.edu	37	2	170058265	170058265	+	Silent	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170058265G>A	uc002ues.2	-	44	8538	c.8325C>T	c.(8323-8325)TGC>TGT	p.C2775C		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2775	Extracellular (Potential).|LDL-receptor class A 17.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CCCTGAACAGGCACCCTGCCT	0.498					2055											0.030534	-25.291493	6.356914	4	127	KEEP	---	---	---	---	2	2	66	79	-1	capture	Silent	SNP	170058265	170058265	LRP2	2	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	8872	48
UGT1A1	54658	broad.mit.edu	37	2	234668958	234668958	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234668958C>T	uc002vvb.2	+	1	40	c.25C>T	c.(25-27)CGC>TGC	p.R9C	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron|UGT1A9_uc002vva.2_Intron|UGT1A1_uc010znc.1_Missense_Mutation_p.R9C	NM_000463	NP_000454	P22309	UD11_HUMAN	UDP glycosyltransferase 1 family, polypeptide A1	9					bilirubin conjugation|digestion|estrogen metabolic process|flavone metabolic process|heme catabolic process	endoplasmic reticulum membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding|steroid binding			central_nervous_system(1)|skin(1)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Adenine(DB00173)|Diclofenac(DB00586)|Estradiol(DB00783)|Ezetimibe(DB00973)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Rifampin(DB01045)|Troglitazone(DB00197)	CCAGGGCGGACGCCCACTTGT	0.567														OREG0003837	type=REGULATORY REGION|Gene=UGT1A1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.423077	62.444802	62.712154	22	30	KEEP	---	---	---	---	10	13	16	18	-1	capture	Missense_Mutation	SNP	234668958	234668958	UGT1A1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16826	48
L3MBTL	26013	broad.mit.edu	37	20	42168804	42168804	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42168804T>A	uc010zwh.1	+	20	2167	c.2121T>A	c.(2119-2121)GAT>GAA	p.D707E	L3MBTL_uc002xkl.2_Missense_Mutation_p.D639E|L3MBTL_uc002xkm.2_Missense_Mutation_p.D639E|L3MBTL_uc010ggl.2_Missense_Mutation_p.D644E|L3MBTL_uc002xkn.1_Missense_Mutation_p.D398E|L3MBTL_uc002xko.2_Missense_Mutation_p.D291E|L3MBTL_uc002xkp.2_Missense_Mutation_p.D27E|SGK2_uc002xkq.1_5'UTR	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	639					chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCACGCCCGATGTCGTGCACC	0.612																0.372727	126.253153	127.815691	41	69	KEEP	---	---	---	---	26	18	44	41	-1	capture	Missense_Mutation	SNP	42168804	42168804	L3MBTL	20	T	A	A	A	1	0	0	0	0	1	0	0	0	660	51	4	4	8511	48
ITSN1	6453	broad.mit.edu	37	21	35174748	35174748	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35174748G>A	uc002yta.1	+	20	2587	c.2319G>A	c.(2317-2319)TGG>TGA	p.W773*	DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Intron|ITSN1_uc002ysz.2_Intron|ITSN1_uc010gmg.2_Intron|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Nonsense_Mutation_p.W773*|ITSN1_uc010gmi.2_Nonsense_Mutation_p.W736*|ITSN1_uc010gmj.2_Intron|ITSN1_uc002ysy.2_Intron|ITSN1_uc002ysx.2_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytc.1_Intron|ITSN1_uc002ytd.2_Intron|ITSN1_uc010gmk.2_Nonsense_Mutation_p.W736*|ITSN1_uc010gml.2_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron|ITSN1_uc002yte.2_Nonsense_Mutation_p.W707*|ITSN1_uc002ytf.1_RNA	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	773	SH3 1.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						AAGGGGAATGGGTAAGTGTTG	0.378																0.387363	448.345338	452.373518	141	223	KEEP	---	---	---	---	90	80	132	140	-1	capture	Nonsense_Mutation	SNP	35174748	35174748	ITSN1	21	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	7849	48
TAB1	10454	broad.mit.edu	37	22	39822903	39822903	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39822903A>G	uc003axt.2	+	9	1166	c.1117A>G	c.(1117-1119)AGC>GGC	p.S373G	TAB1_uc003axr.2_Missense_Mutation_p.S449G|TAB1_uc011aok.1_Missense_Mutation_p.S207G|TAB1_uc003axu.1_Missense_Mutation_p.S373G	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7	373					activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						GGGCGAAATGAGCCAGCCCAC	0.667					336											0.028302	-19.371374	6.60564	3	103	KEEP	---	---	---	---	3	1	53	67	-1	capture	Missense_Mutation	SNP	39822903	39822903	TAB1	22	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	15383	48
SETD2	29072	broad.mit.edu	37	3	47058654	47058654	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47058654C>T	uc003cqs.2	-	21	7677	c.7624G>A	c.(7624-7626)GAG>AAG	p.E2542K	SETD2_uc003cqv.2_Missense_Mutation_p.E2609K|SETD2_uc003cqr.2_Missense_Mutation_p.E141K	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2542	Interaction with POLR2A.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTAATGTACTCCTTGGTTTTG	0.473						N|F|S|Mis		clear cell renal carcinoma								0.510345	233.352901	233.366536	74	71	KEEP	---	---	---	---	30	50	35	45	-1	capture	Missense_Mutation	SNP	47058654	47058654	SETD2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	14024	48
UGT2B4	7363	broad.mit.edu	37	4	70361046	70361046	+	Silent	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70361046G>A	uc003hek.3	-	1	581	c.534C>T	c.(532-534)TAC>TAT	p.Y178Y	UGT2B4_uc011cap.1_Silent_p.Y42Y|UGT2B4_uc003hel.3_Silent_p.Y178Y	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	178					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						TTTCAATTGCGTAGCCAGGAG	0.453																0.445378	155.056867	155.366501	53	66	KEEP	---	---	---	---	29	30	34	38	-1	capture	Silent	SNP	70361046	70361046	UGT2B4	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16843	48
ADH7	131	broad.mit.edu	37	4	100349278	100349278	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100349278G>A	uc003huv.1	-	4	448	c.349C>T	c.(349-351)CGC>TGC	p.R117C		NM_000673	NP_000664	P40394	ADH7_HUMAN	class IV alcohol dehydrogenase, mu or sigma	117					ethanol oxidation|fatty acid omega-oxidation|response to bacterium|response to ethanol|xenobiotic metabolic process	cytosol|soluble fraction	alcohol dehydrogenase activity, zinc-dependent|aldehyde oxidase activity|ethanol binding|receptor antagonist activity|retinol binding|retinol dehydrogenase activity			lung(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)	NADH(DB00157)	TCTGGGTTGCGACAAGCATTG	0.343																0.44898	270.676639	271.121011	88	108	KEEP	---	---	---	---	51	53	59	70	-1	capture	Missense_Mutation	SNP	100349278	100349278	ADH7	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	313	48
COL25A1	84570	broad.mit.edu	37	4	109780829	109780829	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:109780829G>C	uc003hze.1	-	23	1834	c.1303C>G	c.(1303-1305)CTC>GTC	p.L435V	COL25A1_uc003hzg.2_Missense_Mutation_p.L435V|COL25A1_uc003hzd.2_RNA|COL25A1_uc003hzf.2_Missense_Mutation_p.L201V	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1	435	Extracellular (Potential).					collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		GCTTCGTGGAGGTTGCCGTTG	0.493																0.288136	51.050133	53.425051	17	42	KEEP	---	---	---	---	11	15	31	32	-1	capture	Missense_Mutation	SNP	109780829	109780829	COL25A1	4	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	3649	48
CARD6	84674	broad.mit.edu	37	5	40852581	40852581	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40852581A>G	uc003jmg.2	+	3	1222	c.1147A>G	c.(1147-1149)ATG>GTG	p.M383V		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	383					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						TTGTGCCACCATGCTGTGTTC	0.458																0.353659	92.564497	94.106658	29	53	KEEP	---	---	---	---	17	18	26	34	-1	capture	Missense_Mutation	SNP	40852581	40852581	CARD6	5	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	2626	48
HEATR7B2	133558	broad.mit.edu	37	5	41061746	41061746	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41061746G>A	uc003jmj.3	-	6	1031	c.541C>T	c.(541-543)CGA>TGA	p.R181*		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	181							binding			ovary(6)|central_nervous_system(2)	8						TCAGACAGTCGGTTGGCATCC	0.483																0.443182	366.453248	367.19329	117	147	KEEP	---	---	---	---	69	58	77	81	-1	capture	Nonsense_Mutation	SNP	41061746	41061746	HEATR7B2	5	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	6961	48
HCN1	348980	broad.mit.edu	37	5	45267351	45267351	+	Silent	SNP	A	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45267351A>T	uc003jok.2	-	7	1648	c.1623T>A	c.(1621-1623)ATT>ATA	p.I541I		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	541	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TCAGCAGGCAAATCTCTATAA	0.403																0.420635	147.425205	148.123245	53	73	KEEP	---	---	---	---	28	34	41	44	-1	capture	Silent	SNP	45267351	45267351	HCN1	5	A	T	T	T	1	0	0	0	0	0	0	0	1	8	1	4	4	6922	48
LYSMD3	116068	broad.mit.edu	37	5	89814725	89814725	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89814725G>A	uc003kjr.2	-	3	980	c.832C>T	c.(832-834)CCA>TCA	p.P278S	LYSMD3_uc010jaz.1_Silent_p.C119C|LYSMD3_uc003kjs.1_3'UTR	NM_198273	NP_938014	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain	278	Cytoplasmic (Potential).				cell wall macromolecule catabolic process	integral to membrane					0		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		CCTTTAGTTGGCACAATTCCA	0.388																0.027473	-38.289635	6.819662	5	177	KEEP	---	---	---	---	5	1	101	94	-1	capture	Missense_Mutation	SNP	89814725	89814725	LYSMD3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9041	48
BRD8	10902	broad.mit.edu	37	5	137502312	137502312	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137502312G>A	uc003lcf.1	-	10	947	c.892C>T	c.(892-894)CCA>TCA	p.P298S	BRD8_uc003lcc.1_Intron|BRD8_uc011cyl.1_Missense_Mutation_p.P77S|BRD8_uc003lcg.2_Missense_Mutation_p.P371S|BRD8_uc003lci.2_Intron|BRD8_uc003lch.2_Intron|BRD8_uc011cym.1_Missense_Mutation_p.P282S|BRD8_uc010jer.1_Intron|BRD8_uc011cyn.1_Missense_Mutation_p.P257S	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	298					cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ACAGGGGGTGGCACAAGTTTA	0.537																0.054545	-4.910059	6.578617	3	52	KEEP	---	---	---	---	4	0	29	26	-1	capture	Missense_Mutation	SNP	137502312	137502312	BRD8	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1494	48
PCDHGB3	56102	broad.mit.edu	37	5	140751057	140751057	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140751057G>A	uc003ljw.1	+	1	1096	c.1096G>A	c.(1096-1098)GTT>ATT	p.V366I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.V366I|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	366	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGACTGCCGTTGCCCTGAT	0.408																0.441176	45.021087	45.123442	15	19	KEEP	---	---	---	---	11	7	10	11	-1	capture	Missense_Mutation	SNP	140751057	140751057	PCDHGB3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11467	48
SLIT3	6586	broad.mit.edu	37	5	168180912	168180912	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168180912C>T	uc003mab.2	-	17	2206	c.1786G>A	c.(1786-1788)GTG>ATG	p.V596M	SLIT3_uc010jjg.2_Missense_Mutation_p.V596M	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	596	LRR 14.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGCCCGTGCACGGTCTCCAGC	0.617	Ovarian(29;311 847 10864 17279 24903)															0.451613	83.597317	83.722805	28	34	KEEP	---	---	---	---	9	22	20	18	-1	capture	Missense_Mutation	SNP	168180912	168180912	SLIT3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14633	48
GRM6	2916	broad.mit.edu	37	5	178413868	178413868	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178413868C>G	uc003mjr.2	-	7	1650	c.1471G>C	c.(1471-1473)GGC>CGC	p.G491R	GRM6_uc003mjq.2_5'Flank|GRM6_uc010jla.1_Missense_Mutation_p.G74R|GRM6_uc003mjs.1_Missense_Mutation_p.G111R	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	491	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GCCCACTGGCCCACTGCCTGG	0.642																0.513514	56.62097	56.623715	19	18	KEEP	---	---	---	---	10	11	16	6	-1	capture	Missense_Mutation	SNP	178413868	178413868	GRM6	5	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	6734	48
OR14J1	442191	broad.mit.edu	37	6	29274611	29274611	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29274611G>A	uc011dln.1	+	1	145	c.145G>A	c.(145-147)GTG>ATG	p.V49M		NM_030946	NP_112208	Q9UGF5	O14J1_HUMAN	olfactory receptor, family 5, subfamily U member	49	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CATCATTACCGTGGACCGTCG	0.468																0.384279	251.948408	254.635754	88	141	KEEP	---	---	---	---	43	54	73	78	-1	capture	Missense_Mutation	SNP	29274611	29274611	OR14J1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10852	48
CLIC5	53405	broad.mit.edu	37	6	45917082	45917082	+	Silent	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:45917082C>T	uc003oxv.3	-	3	793	c.687G>A	c.(685-687)ACG>ACA	p.T229T	CLIC5_uc003oxu.3_Silent_p.T70T|CLIC5_uc003oxx.2_Silent_p.T70T	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a	229					female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2						AGGGCGGGTGCGTGCCGGGGG	0.547																0.4375	276.597999	277.363493	98	126	KEEP	---	---	---	---	48	64	79	73	-1	capture	Silent	SNP	45917082	45917082	CLIC5	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3494	48
COL19A1	1310	broad.mit.edu	37	6	70642699	70642699	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:70642699T>A	uc003pfc.1	+	7	808	c.691T>A	c.(691-693)TAC>AAC	p.Y231N	COL19A1_uc010kam.1_Missense_Mutation_p.Y127N	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	231	TSP N-terminal.				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						ACTTAAAATCTACTGCAGTGC	0.303																0.382979	52.438069	53.002699	18	29	KEEP	---	---	---	---	12	9	17	17	-1	capture	Missense_Mutation	SNP	70642699	70642699	COL19A1	6	T	A	A	A	1	0	0	0	0	1	0	0	0	689	53	4	4	3641	48
KCNQ5	56479	broad.mit.edu	37	6	73904675	73904675	+	Silent	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:73904675C>T	uc003pgk.2	+	14	2684	c.2337C>T	c.(2335-2337)GAC>GAT	p.D779D	KCNQ5_uc011dyh.1_Silent_p.D798D|KCNQ5_uc011dyi.1_Silent_p.D789D|KCNQ5_uc010kat.2_Silent_p.D770D|KCNQ5_uc011dyj.1_Silent_p.D669D|KCNQ5_uc011dyk.1_Silent_p.D529D	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	779					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		GCATTTCTGACGTCACCACCT	0.512	GBM(142;1375 1859 14391 23261 44706)															0.420455	108.6623	109.147493	37	51	KEEP	---	---	---	---	21	21	26	28	-1	capture	Silent	SNP	73904675	73904675	KCNQ5	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8008	48
RSPH10B2	728194	broad.mit.edu	37	7	5967958	5967958	+	Silent	SNP	G	C	C			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5967958G>C	uc003sph.1	-	20	2572	c.2301C>G	c.(2299-2301)GTC>GTG	p.V767V	RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Silent_p.V767V|RSPH10B2_uc011jwk.1_Missense_Mutation_p.S389C	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B	767										ovary(1)|pancreas(1)|skin(1)	3						TCACAAAGAAGACGTACATAT	0.438																0.137615	260.88681	371.662152	120	752	KEEP	---	---	---	---	65	64	461	410	-1	capture	Silent	SNP	5967958	5967958	RSPH10B2	7	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	13596	48
HDAC9	9734	broad.mit.edu	37	7	18868807	18868807	+	Silent	SNP	C	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:18868807C>A	uc003suh.2	+	17	2378	c.2337C>A	c.(2335-2337)CCC>CCA	p.P779P	HDAC9_uc003sue.2_Silent_p.P779P|HDAC9_uc011jyd.1_Silent_p.P779P|HDAC9_uc003sui.2_Silent_p.P782P|HDAC9_uc003suj.2_Silent_p.P738P|HDAC9_uc003suk.2_Silent_p.P27P|HDAC9_uc003sua.1_Silent_p.P757P	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	779	Histone deacetylase.				B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	TTGTGAGGCCCCCTGGCCATC	0.537																0.267206	161.849867	173.934712	66	181	KEEP	---	---	---	---	39	37	121	101	0.486842105263	capture	Silent	SNP	18868807	18868807	HDAC9	7	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	6941	48
STARD3NL	83930	broad.mit.edu	37	7	38247143	38247143	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38247143C>A	uc003tfr.2	+	2	186	c.38C>A	c.(37-39)ACC>AAC	p.T13N	STARD3NL_uc003tfs.2_Missense_Mutation_p.T13N|STARD3NL_uc003tft.2_Missense_Mutation_p.T13N	NM_032016	NP_114405	O95772	MENTO_HUMAN	MLN64 N-terminal homolog	13	Cytoplasmic (Potential).					integral to membrane|late endosome membrane				ovary(1)	1						AACGCTCTCACCGGGAGCCAG	0.512																0.28777	116.541116	122.156474	40	99	KEEP	---	---	---	---	23	19	42	72	0.452380952381	capture	Missense_Mutation	SNP	38247143	38247143	STARD3NL	7	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	15148	48
EGFR	1956	broad.mit.edu	37	7	55221782	55221782	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221782C>T	uc003tqk.2	+	7	1072	c.826C>T	c.(826-828)CAG>TAG	p.Q276*	EGFR_uc003tqh.2_Nonsense_Mutation_p.Q276*|EGFR_uc003tqi.2_Nonsense_Mutation_p.Q276*|EGFR_uc003tqj.2_Nonsense_Mutation_p.Q276*|EGFR_uc010kzg.1_Nonsense_Mutation_p.Q231*|EGFR_uc011kco.1_Nonsense_Mutation_p.Q223*|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	276	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CACCACGTACCAGATGGATGT	0.592			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.027981	-157.193375	44.652034	23	799	KEEP	---	---	---	---	13	15	450	513	-1	capture	Nonsense_Mutation	SNP	55221782	55221782	EGFR	7	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	4922	48
COL1A2	1278	broad.mit.edu	37	7	94040216	94040216	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94040216C>T	uc003ung.1	+	22	1684	c.1213C>T	c.(1213-1215)CGT>TGT	p.R405C	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	405					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TCCTGGTTCTCGTGGTCTTCC	0.448													HNSCC(75;0.22)			0.25	124.87973	136.015553	49	147	KEEP	---	---	---	---	25	33	94	82	-1	capture	Missense_Mutation	SNP	94040216	94040216	COL1A2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3643	48
REPIN1	29803	broad.mit.edu	37	7	150069659	150069659	+	Silent	SNP	C	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150069659C>A	uc010lpq.1	+	4	1818	c.1329C>A	c.(1327-1329)GGC>GGA	p.G443G	REPIN1_uc003whd.2_Silent_p.G432G|REPIN1_uc010lpr.1_Silent_p.G500G|REPIN1_uc003whc.2_Silent_p.G443G|REPIN1_uc003whe.2_Silent_p.G443G	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	443	C2H2-type 11.				DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCTCCCAGGGCAGCCATCTGG	0.716																0.35	19.91862	20.315815	7	13	KEEP	---	---	---	---	3	6	6	10	0.666666666667	capture	Silent	SNP	150069659	150069659	REPIN1	7	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	13122	48
CSMD1	64478	broad.mit.edu	37	8	3889525	3889525	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:3889525C>T	uc011kwk.1	-	4	902	c.512G>A	c.(511-513)TGC>TAC	p.C171Y		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	171	Extracellular (Potential).|Sushi 1.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCCAGGGAGGCAGCTGTACCG	0.512																0.561983	192.788741	193.19053	68	53	KEEP	---	---	---	---	39	36	29	32	-1	capture	Missense_Mutation	SNP	3889525	3889525	CSMD1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	3909	48
OPRK1	4986	broad.mit.edu	37	8	54163342	54163342	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:54163342G>A	uc003xrh.1	-	1	631	c.256C>T	c.(256-258)CGA>TGA	p.R86*	OPRK1_uc003xri.1_Nonsense_Mutation_p.R86*|OPRK1_uc010lyc.1_5'UTR	NM_000912	NP_000903	P41145	OPRK_HUMAN	opioid receptor, kappa 1	86	Cytoplasmic (Potential).				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)	CGCGCTCACCGGATGATCACG	0.687																0.490566	83.750276	83.75431	26	27	KEEP	---	---	---	---	9	19	16	15	-1	capture	Nonsense_Mutation	SNP	54163342	54163342	OPRK1	8	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	10789	48
CHD7	55636	broad.mit.edu	37	8	61769443	61769443	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:61769443G>A	uc003xue.2	+	34	8081	c.7604G>A	c.(7603-7605)AGT>AAT	p.S2535N		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2535					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ACGTCATTGAGTGCAGTAAGT	0.542																0.058824	-9.54079	11.263631	6	96	KEEP	---	---	---	---	0	7	52	57	-1	capture	Missense_Mutation	SNP	61769443	61769443	CHD7	8	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	3296	48
UBAP2	55833	broad.mit.edu	37	9	33923830	33923830	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33923830C>T	uc003ztq.1	-	24	2872	c.2759G>A	c.(2758-2760)GGC>GAC	p.G920D	UBAP2_uc011loc.1_Missense_Mutation_p.G829D|UBAP2_uc011lod.1_Missense_Mutation_p.G653D|UBAP2_uc011loe.1_Missense_Mutation_p.G675D|UBAP2_uc011lof.1_Missense_Mutation_p.G845D|UBAP2_uc003ztn.1_Missense_Mutation_p.G159D|UBAP2_uc003zto.1_Missense_Mutation_p.G159D|UBAP2_uc003ztp.1_Missense_Mutation_p.G159D	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2	920										ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		ACTGGGCATGCCTGTGTAGTA	0.567																0.030075	-25.009974	7.220505	4	129	KEEP	---	---	---	---	2	2	76	70	-1	capture	Missense_Mutation	SNP	33923830	33923830	UBAP2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16719	48
GABBR2	9568	broad.mit.edu	37	9	101148021	101148021	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:101148021G>C	uc004ays.2	-	11	1719	c.1563C>G	c.(1561-1563)AAC>AAG	p.N521K		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	521	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	GGATGATAAGGTTGTTCATGT	0.388																0.486486	202.250328	202.267871	54	57	KEEP	---	---	---	---	24	40	23	39	-1	capture	Missense_Mutation	SNP	101148021	101148021	GABBR2	9	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	6098	48
TLR4	7099	broad.mit.edu	37	9	120475663	120475663	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:120475663G>C	uc004bjz.2	+	3	1548	c.1257G>C	c.(1255-1257)TTG>TTC	p.L419F	TLR4_uc004bka.2_Missense_Mutation_p.L379F|TLR4_uc004bkb.2_Missense_Mutation_p.L219F	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	419	LRR 12.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						CAAACTTCTTGGGCTTAGAAC	0.373					157											0.380952	208.963309	211.050516	64	104	KEEP	---	---	---	---	37	32	60	60	-1	capture	Missense_Mutation	SNP	120475663	120475663	TLR4	9	G	C	C	C	1	0	0	0	0	1	0	0	0	607	47	4	4	15838	48
MAGEB1	4112	broad.mit.edu	37	X	30268639	30268639	+	Missense_Mutation	SNP	G	A	A	rs113819941		TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30268639G>A	uc004dcc.2	+	4	349	c.29G>A	c.(28-30)CGT>CAT	p.R10H	MAGEB1_uc004dcd.2_Missense_Mutation_p.R10H|MAGEB1_uc004dce.2_Missense_Mutation_p.R10H	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	10											0						AGTAAGCTCCGTGCTCGTGAG	0.587																0.952381	68.567977	71.090561	20	1	KEEP	---	---	---	---	12	11	0	1	-1	capture	Missense_Mutation	SNP	30268639	30268639	MAGEB1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9086	48
CXorf22	170063	broad.mit.edu	37	X	35970005	35970005	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35970005T>A	uc004ddj.2	+	6	1030	c.971T>A	c.(970-972)ATT>AAT	p.I324N	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	324										large_intestine(1)|lung(1)|ovary(1)	3						ACTACTATCATTATCTCCTGT	0.289																0.851852	164.58693	171.005696	46	8	KEEP	---	---	---	---	19	32	3	5	-1	capture	Missense_Mutation	SNP	35970005	35970005	CXorf22	23	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	4062	48
RPL5	6125	broad.mit.edu	37	1	93299200	93299201	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93299200_93299201delAG	uc001doz.2	+	3	250_251	c.172_173delAG	c.(172-174)AGAfs	p.R58fs	FAM69A_uc001dpc.2_Intron|RPL5_uc001dpa.2_RNA|RPL5_uc001dpb.2_Frame_Shift_Del_p.R8fs|RPL5_uc001dpd.2_5'Flank	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5	58					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		TGTGACAAACAGAGATATCATT	0.371																0.29			23	56		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	93299200	93299201	RPL5	1	AG	-	-	-	1	0	1	0	1	0	0	0	0	88	7	5	5	13489	48
RNMTL1	55178	broad.mit.edu	37	17	685869	685880	+	In_Frame_Del	DEL	CCAGCACCTGGG	-	-			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:685869_685880delCCAGCACCTGGG	uc002frw.2	+	1	357_368	c.251_262delCCAGCACCTGGG	c.(250-264)CCCAGCACCTGGGAA>CAA	p.84_88PSTWE>Q	GLOD4_uc002fru.2_5'Flank|GLOD4_uc010vqc.1_5'Flank|GLOD4_uc002frv.2_5'Flank	NM_018146	NP_060616	Q9HC36	RMTL1_HUMAN	RNA methyltransferase like 1	84_88					RNA processing		protein binding|RNA binding|RNA methyltransferase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		TCCCGCGCTCCCAGCACCTGGGAAGAGTCTGG	0.608																0.24			11	35		---	---	---	---						capture_indel	In_Frame_Del	DEL	685869	685880	RNMTL1	17	CCAGCACCTGGG	-	-	-	1	0	1	0	1	0	0	0	0	286	22	5	5	13399	48
KRT24	192666	broad.mit.edu	37	17	38859722	38859722	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0211-01	TCGA-06-0211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38859722delC	uc002hvd.2	-	1	281	c.224delG	c.(223-225)GGTfs	p.G75fs		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	75	Head.|Gly-rich.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				CCCAAAACCACCCCCTACTGA	0.612	GBM(61;380 1051 14702 23642 31441)															0.45			77	96		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	38859722	38859722	KRT24	17	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	8381	48
