Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ARHGEF10L	55160	broad.mit.edu	37	1	17942653	17942653	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:17942653C>T	uc001ban.2	+	9	950	c.791C>T	c.(790-792)GCC>GTC	p.A264V	ARHGEF10L_uc009vpe.1_Missense_Mutation_p.A225V|ARHGEF10L_uc001bao.2_Missense_Mutation_p.A225V|ARHGEF10L_uc001bap.2_Missense_Mutation_p.A225V|ARHGEF10L_uc010ocr.1_Missense_Mutation_p.A22V|ARHGEF10L_uc001baq.2_Missense_Mutation_p.A30V|ARHGEF10L_uc010ocs.1_5'Flank|ARHGEF10L_uc001bar.2_5'Flank	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	264					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		ACACGGATGGCCGTGATGCGC	0.637																0.020101	-45.040867	6.319556	4	195	KEEP	---	---	---	---	0	4	100	120	-1	capture	Missense_Mutation	SNP	17942653	17942653	ARHGEF10L	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	888	53
WDR65	149465	broad.mit.edu	37	1	43665064	43665064	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43665064T>A	uc001cip.1	+	9	1553	c.1432T>A	c.(1432-1434)TCC>ACC	p.S478T	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.S467T|WDR65_uc001ciq.1_Missense_Mutation_p.S478T	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	478	WD 7.									skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCTATAGTGTTCCTTTAGCAA	0.463																0.37247	256.814874	260.312621	92	155	KEEP	---	---	---	---	54	55	98	77	-1	capture	Missense_Mutation	SNP	43665064	43665064	WDR65	1	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	17197	53
COL24A1	255631	broad.mit.edu	37	1	86250051	86250051	+	Splice_Site	SNP	T	C	C			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86250051T>C	uc001dlj.2	-	49	4102	c.4060_splice	c.e49-1	p.G1354_splice	COL24A1_uc001dli.2_Splice_Site_p.G490_splice|COL24A1_uc010osd.1_Splice_Site_p.G654_splice|COL24A1_uc001dlk.2_Splice_Site|COL24A1_uc010ose.1_Splice_Site|COL24A1_uc010osf.1_Splice_Site	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTGTTCACCCTATGGGTAGAA	0.453																0.021127	-29.096485	7.319023	3	139	KEEP	---	---	---	---	3	0	72	74	-1	capture	Splice_Site	SNP	86250051	86250051	COL24A1	1	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	3648	53
FCRL1	115350	broad.mit.edu	37	1	157771270	157771270	+	Silent	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157771270G>A	uc001frg.2	-	6	1097	c.984C>T	c.(982-984)TAC>TAT	p.Y328Y	FCRL1_uc001frf.2_RNA|FCRL1_uc001frh.2_Silent_p.Y328Y|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	328	Helical; (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TTTTGAGGCCGTAGCAAAATA	0.433	GBM(54;482 1003 11223 30131 35730)															0.345455	107.207711	109.531691	38	72	KEEP	---	---	---	---	17	24	36	45	-1	capture	Silent	SNP	157771270	157771270	FCRL1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5740	53
F5	2153	broad.mit.edu	37	1	169487691	169487691	+	Missense_Mutation	SNP	G	A	A	rs118203910		TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169487691G>A	uc001ggg.1	-	23	6449	c.6304C>T	c.(6304-6306)CGT>TGT	p.R2102C		NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	2102	F5/8 type C 2.		R -> H (in THR-APCR).|R -> C (in FA5D; impairs both factor V secretion and activity).		cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	GCATTCAGACGGGCACGGAAG	0.488																0.376471	101.081998	102.219443	32	53	KEEP	---	---	---	---	8	28	31	32	-1	capture	Missense_Mutation	SNP	169487691	169487691	F5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5302	53
CAMSAP1L1	23271	broad.mit.edu	37	1	200818182	200818182	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200818182G>A	uc001gvl.2	+	12	2588	c.2318G>A	c.(2317-2319)CGT>CAT	p.R773H	CAMSAP1L1_uc001gvk.2_Missense_Mutation_p.R762H|CAMSAP1L1_uc001gvm.2_Missense_Mutation_p.R746H	NM_203459	NP_982284	Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein	773						cytoplasm|microtubule	protein binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GAAAAGAGGCGTGCTATAGAA	0.448																0.033333	-21.408041	7.10197	4	116	KEEP	---	---	---	---	2	2	57	66	-1	capture	Missense_Mutation	SNP	200818182	200818182	CAMSAP1L1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2588	53
APBB1IP	54518	broad.mit.edu	37	10	26825091	26825091	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26825091G>A	uc001iss.2	+	10	1310	c.989G>A	c.(988-990)CGC>CAC	p.R330H	APBB1IP_uc009xks.1_Missense_Mutation_p.R330H	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,	330	PH.				blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						TGGAAAAGGCGCTATTTTCTT	0.348					307											0.025271	-57.218732	11.978026	7	270	KEEP	---	---	---	---	2	6	153	140	-1	capture	Missense_Mutation	SNP	26825091	26825091	APBB1IP	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	753	53
HKDC1	80201	broad.mit.edu	37	10	71025477	71025477	+	Silent	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:71025477C>T	uc001jpf.3	+	17	2642	c.2509C>T	c.(2509-2511)CTG>TTG	p.L837L	HKDC1_uc010qje.1_Silent_p.L700L|HKDC1_uc009xqb.2_RNA	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	837					glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5						CGGTGCTGGCCTGGCCGCTAT	0.642																0.166667	2.727097	6.596308	6	30	KEEP	---	---	---	---	7	5	26	27	-1	capture	Silent	SNP	71025477	71025477	HKDC1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	7118	53
TLL2	7093	broad.mit.edu	37	10	98155083	98155083	+	Silent	SNP	C	T	T	rs151335014		TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98155083C>T	uc001kml.1	-	13	1813	c.1587G>A	c.(1585-1587)ACG>ACA	p.T529T	TLL2_uc009xvf.1_Silent_p.T507T	NM_012465	NP_036597	Q9Y6L7	TLL2_HUMAN	tolloid-like 2 precursor	529	CUB 2.				cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CACTCTCTTCCGTGGGGCCAT	0.527																0.397436	95.91264	96.629299	31	47	KEEP	---	---	---	---	23	17	24	33	-1	capture	Silent	SNP	98155083	98155083	TLL2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15831	53
OR52K2	119774	broad.mit.edu	37	11	4471261	4471261	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4471261C>A	uc001lyz.1	+	1	692	c.692C>A	c.(691-693)GCC>GAC	p.A231D		NM_001005172	NP_001005172	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K,	231	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTACTGCTTGCCTCTCAGGAG	0.463																0.044118	-29.346581	16.005761	9	195	KEEP	---	---	---	---	3	6	104	109	0.666666666667	capture	Missense_Mutation	SNP	4471261	4471261	OR52K2	11	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	11028	53
SLC22A11	55867	broad.mit.edu	37	11	64329818	64329818	+	Silent	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64329818G>A	uc001oai.2	+	4	1106	c.732G>A	c.(730-732)GCG>GCA	p.A244A	SLC22A11_uc001oah.1_Missense_Mutation_p.A210T|SLC22A11_uc001oaj.2_Silent_p.A244A|SLC22A11_uc009ypq.2_Silent_p.A244A|SLC22A11_uc001oak.1_Silent_p.A73A	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11	244	Helical; (Potential).				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	GCCAGGCGGCGCTGGGCGGCC	0.632																0.052083	-23.091108	17.725134	10	182	KEEP	---	---	---	---	8	4	111	103	-1	capture	Silent	SNP	64329818	64329818	SLC22A11	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14335	53
KRT1	3848	broad.mit.edu	37	12	53072470	53072470	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53072470G>T	uc001sau.1	-	2	721	c.662C>A	c.(661-663)TCC>TAC	p.S221Y	KRT1_uc001sav.1_Missense_Mutation_p.S221Y	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	221	Rod.|Linker 1.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						GGTTCTAGTGGAGGTATCTAC	0.468																0.433333	148.57476	149.041024	52	68	KEEP	---	---	---	---	31	33	39	36	0.484375	capture	Missense_Mutation	SNP	53072470	53072470	KRT1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	8367	53
SILV	6490	broad.mit.edu	37	12	56355103	56355103	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56355103T>C	uc001sip.2	-	3	363	c.332A>G	c.(331-333)AAT>AGT	p.N111S	SILV_uc001siq.2_Missense_Mutation_p.N111S|SILV_uc010spx.1_Intron|SILV_uc001sir.2_Missense_Mutation_p.N111S	NM_006928	NP_008859	P40967	PMEL_HUMAN	silver homolog	111					melanin biosynthetic process|melanosome organization	endoplasmic reticulum membrane|extracellular region|Golgi apparatus|integral to membrane|melanosome|multivesicular body membrane|plasma membrane	protein binding				0						GTACTCACCATTGATGATGGT	0.468																0.058252	-4.836116	16.228891	6	97	KEEP	---	---	---	---	4	3	51	57	-1	capture	Missense_Mutation	SNP	56355103	56355103	SILV	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14215	53
DAO	1610	broad.mit.edu	37	12	109278787	109278787	+	Missense_Mutation	SNP	G	A	A	rs142698254		TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109278787G>A	uc001tnr.3	+	2	158	c.5G>A	c.(4-6)CGT>CAT	p.R2H	DAO_uc001tnq.3_Missense_Mutation_p.R2H|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_RNA	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	2					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						GCTGCAATGCGTGTGGTGGTG	0.498																0.094737	4.024147	19.674995	9	86	KEEP	---	---	---	---	6	3	53	53	-1	capture	Missense_Mutation	SNP	109278787	109278787	DAO	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4190	53
MGA	23269	broad.mit.edu	37	15	42054376	42054376	+	Silent	SNP	A	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42054376A>G	uc010ucy.1	+	22	7741	c.7560A>G	c.(7558-7560)AAA>AAG	p.K2520K	MGA_uc010ucz.1_Silent_p.K2311K|MGA_uc010uda.1_Silent_p.K1136K	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2481						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		TTTATGCAAAACAGCAAGCAC	0.383					606											0.238095	30.028236	32.660245	10	32	KEEP	---	---	---	---	4	6	20	17	-1	capture	Silent	SNP	42054376	42054376	MGA	15	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	9452	53
KIAA0556	23247	broad.mit.edu	37	16	27640063	27640063	+	Silent	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27640063C>T	uc002dow.2	+	4	246	c.222C>T	c.(220-222)AAC>AAT	p.N74N		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	74										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						TCTATGTCAACGGTGCCAATT	0.517																0.031111	-42.04497	12.131521	7	218	KEEP	---	---	---	---	4	4	123	113	-1	capture	Silent	SNP	27640063	27640063	KIAA0556	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8105	53
SALL1	6299	broad.mit.edu	37	16	51173066	51173066	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:51173066G>A	uc010vgs.1	-	2	3098	c.3067C>T	c.(3067-3069)CAT>TAT	p.H1023Y	SALL1_uc010vgr.1_Missense_Mutation_p.H926Y|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	1023	C2H2-type 6.				adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCTTTGGTATGACTTCTATAG	0.408	GBM(103;1352 1446 1855 4775 8890)															0.343511	122.924956	125.763546	45	86	KEEP	---	---	---	---	28	20	40	52	-1	capture	Missense_Mutation	SNP	51173066	51173066	SALL1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	13702	53
PSMC5	5705	broad.mit.edu	37	17	61908445	61908445	+	Silent	SNP	A	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61908445A>G	uc002jcb.2	+	8	770	c.729A>G	c.(727-729)CCA>CCG	p.P243P	PSMC5_uc010ddy.2_Silent_p.P220P|PSMC5_uc010ddz.2_Silent_p.P164P|PSMC5_uc002jcc.2_Silent_p.P235P|PSMC5_uc002jcd.2_Silent_p.P235P	NM_002805	NP_002796	P62195	PRS8_HUMAN	proteasome 26S ATPase subunit 5	243					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of programmed cell death|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|thyrotropin-releasing hormone receptor binding|transcription cofactor activity|transcription factor binding			large_intestine(1)	1						AACATGCTCCATCTATCATCT	0.562																0.0375	-25.080809	11.962109	6	154	KEEP	---	---	---	---	2	5	100	86	-1	capture	Silent	SNP	61908445	61908445	PSMC5	17	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	12585	53
SLC25A19	60386	broad.mit.edu	37	17	73274326	73274326	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73274326C>T	uc002jns.3	-	4	1460	c.550G>A	c.(550-552)GCC>ACC	p.A184T	SLC25A19_uc010dge.2_Missense_Mutation_p.A127T|SLC25A19_uc002jnv.3_Missense_Mutation_p.A184T|SLC25A19_uc002jnu.3_Missense_Mutation_p.A184T|SLC25A19_uc002jnw.3_Missense_Mutation_p.A184T|SLC25A19_uc002jnt.3_Missense_Mutation_p.A184T	NM_021734	NP_068380	Q9HC21	TPC_HUMAN	solute carrier family 25, member 19	184	Solcar 2.|Helical; Name=4; (Potential).					integral to membrane|mitochondrial inner membrane	binding|deoxynucleotide transmembrane transporter activity			ovary(1)	1	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			GGGAAGATGGCGATCAAGGTG	0.562																0.027119	-59.489902	13.285081	8	287	KEEP	---	---	---	---	8	1	123	199	-1	capture	Missense_Mutation	SNP	73274326	73274326	SLC25A19	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14373	53
MUC16	94025	broad.mit.edu	37	19	9026313	9026313	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9026313C>A	uc002mkp.2	-	14	36877	c.36673G>T	c.(36673-36675)GCT>TCT	p.A12225S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12227	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGAGGGCCAGCAGCTATAGTG	0.438																0.026432	-45.664315	10.640006	6	221	KEEP	---	---	---	---	3	3	131	125	0.5	capture	Missense_Mutation	SNP	9026313	9026313	MUC16	19	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	9883	53
PPAN-P2RY11	692312	broad.mit.edu	37	19	10224939	10224939	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10224939C>T	uc002mna.2	+	13	1910	c.1910C>T	c.(1909-1911)CCG>CTG	p.P637L	PPAN-P2RY11_uc010xla.1_3'UTR|P2RY11_uc002mnc.2_Missense_Mutation_p.P217L	NM_001040664	NP_001035754	Q9NQ55	SSF1_HUMAN	PPAN-P2RY11 protein	Error:Variant_position_missing_in_Q9NQ55_after_alignment					RNA splicing	nucleolus	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			TGCGGCCTGCCGCTGCTGCTC	0.701																0.425	50.372068	50.567284	17	23	KEEP	---	---	---	---	18	18	28	36	-1	capture	Missense_Mutation	SNP	10224939	10224939	PPAN-P2RY11	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12190	53
HOMER3	9454	broad.mit.edu	37	19	19049592	19049592	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19049592T>C	uc002nku.2	-	2	769	c.116A>G	c.(115-117)TAT>TGT	p.Y39C	HOMER3_uc010eby.2_Missense_Mutation_p.Y39C|HOMER3_uc010ebz.2_Missense_Mutation_p.Y39C|HOMER3_uc002nkw.2_Missense_Mutation_p.Y39C|HOMER3_uc002nkv.2_Missense_Mutation_p.Y39C	NM_004838	NP_004829	Q9NSC5	HOME3_HUMAN	Homer, neuronal immediate early gene, 3 isoform	39	WH1.				metabotropic glutamate receptor signaling pathway|protein targeting	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	protein binding				0			Epithelial(12;0.0107)			ATCGTAGAAATAGGAGACAGT	0.562																0.25	9.324376	10.002595	3	9	KEEP	---	---	---	---	1	2	4	6	-1	capture	Missense_Mutation	SNP	19049592	19049592	HOMER3	19	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	7205	53
ZNF430	80264	broad.mit.edu	37	19	21240178	21240178	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21240178A>G	uc002npj.2	+	5	1174	c.1064A>G	c.(1063-1065)AAC>AGC	p.N355S	ZNF430_uc002npk.2_Missense_Mutation_p.N354S	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	355	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						AAAGCTTTTAACCAATCCTCA	0.388																0.013158	-54.88534	6.797551	3	225	KEEP	---	---	---	---	2	4	127	137	-1	capture	Missense_Mutation	SNP	21240178	21240178	ZNF430	19	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	17784	53
ZNF254	9534	broad.mit.edu	37	19	24310666	24310666	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:24310666A>G	uc002nru.2	+	4	1998	c.1864A>G	c.(1864-1866)AGA>GGA	p.R622G	ZNF254_uc010xrk.1_Missense_Mutation_p.R537G	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	622	C2H2-type 15.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TAAACATAAGAGAATTCATAC	0.383																0.596939	442.107907	443.717282	117	79	KEEP	---	---	---	---	56	77	41	42	-1	capture	Missense_Mutation	SNP	24310666	24310666	ZNF254	19	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	17678	53
MLL4	9757	broad.mit.edu	37	19	36212357	36212357	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36212357G>A	uc010eei.2	+	3	2108	c.2108G>A	c.(2107-2109)AGC>AAC	p.S703N		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	703	Pro-rich.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AACCACCTCAGCCTGCCTCGA	0.662																0.114286	4.38447	9.510515	4	31	KEEP	---	---	---	---	4	1	30	9	-1	capture	Missense_Mutation	SNP	36212357	36212357	MLL4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	9535	53
SIGLEC11	114132	broad.mit.edu	37	19	50461706	50461706	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50461706C>A	uc010ybh.1	-	8	1576	c.1485G>T	c.(1483-1485)GAG>GAT	p.E495D	SIGLEC11_uc010ybi.1_Intron	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	495	Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TGCTGTTCCCCTCCAGCAGCT	0.701																0.333333	18.017514	18.53437	7	14	KEEP	---	---	---	---	5	5	7	10	0.5	capture	Missense_Mutation	SNP	50461706	50461706	SIGLEC11	19	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	14200	53
ZNF665	79788	broad.mit.edu	37	19	53669083	53669083	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53669083G>C	uc010eqm.1	-	4	760	c.660C>G	c.(658-660)AAC>AAG	p.N220K		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	155	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		GGATTGTTAGGTTTGAACGAA	0.403																0.044776	-22.89976	21.64075	9	192	KEEP	---	---	---	---	6	3	96	116	-1	capture	Missense_Mutation	SNP	53669083	53669083	ZNF665	19	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	17951	53
USP34	9736	broad.mit.edu	37	2	61515873	61515873	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:61515873C>T	uc002sbe.2	-	34	4710	c.4688G>A	c.(4687-4689)GGC>GAC	p.G1563D		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	1563					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			CCTTGATTTGCCAGGCCAGGT	0.418																0.022857	-37.666821	6.740113	4	171	KEEP	---	---	---	---	3	2	107	89	-1	capture	Missense_Mutation	SNP	61515873	61515873	USP34	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16947	53
KDM3A	55818	broad.mit.edu	37	2	86702031	86702031	+	Silent	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:86702031G>A	uc002sri.3	+	12	2184	c.1857G>A	c.(1855-1857)AAG>AAA	p.K619K	KDM3A_uc010ytj.1_Silent_p.K619K|KDM3A_uc010ytk.1_Silent_p.K567K	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	619					androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						ACACAGCAAAGTACATCTTGG	0.408	NSCLC(96;1150 1523 6936 46253 49736)															0.069853	-6.106503	45.858936	19	253	KEEP	---	---	---	---	11	14	140	141	-1	capture	Silent	SNP	86702031	86702031	KDM3A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	8048	53
TTN	7273	broad.mit.edu	37	2	179414490	179414490	+	Silent	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179414490G>A	uc010zfg.1	-	287	84479	c.84255C>T	c.(84253-84255)ACC>ACT	p.T28085T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.T21780T|TTN_uc010zfi.1_Silent_p.T21713T|TTN_uc010zfj.1_Silent_p.T21588T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29012							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGATGTAGTGGGTTATGGGAG	0.448					8722											0.086614	5.072966	27.007977	11	116	KEEP	---	---	---	---	7	4	70	53	-1	capture	Silent	SNP	179414490	179414490	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	16617	53
IDH1	3417	broad.mit.edu	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	C	C	rs121913499		TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113113G>C	uc002vcs.2	-	4	640	c.394C>G	c.(394-396)CGT>GGT	p.R132G	IDH1_uc002vct.2_Missense_Mutation_p.R132G|IDH1_uc002vcu.2_Missense_Mutation_p.R132G	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398	Pancreas(158;264 1958 3300 35450 36047)			p.R132C(SNU1079-Tumor)|p.R132C(HT1080-Tumor)	134	Mis		gliobastoma 								0.344828	130.774892	133.236844	40	76	KEEP	---	---	---	---	18	25	38	43	-1	capture	Missense_Mutation	SNP	209113113	209113113	IDH1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	7419	53
DOCK10	55619	broad.mit.edu	37	2	225729691	225729691	+	Silent	SNP	C	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:225729691C>A	uc010fwz.1	-	12	1610	c.1371G>T	c.(1369-1371)GGG>GGT	p.G457G	DOCK10_uc002vob.2_Silent_p.G451G|DOCK10_uc002vod.1_Silent_p.G457G	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	457							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CCACAGAAGCCCCCAAGAGCA	0.458																0.028169	-55.462247	14.213334	8	276	KEEP	---	---	---	---	6	5	140	165	0.454545454545	capture	Silent	SNP	225729691	225729691	DOCK10	2	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	4641	53
NCOA3	8202	broad.mit.edu	37	20	46271028	46271028	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:46271028G>T	uc002xtk.2	+	17	3357	c.3152G>T	c.(3151-3153)AGA>ATA	p.R1051I	NCOA3_uc010ght.1_Missense_Mutation_p.R1046I|NCOA3_uc002xtl.2_Missense_Mutation_p.R1051I|NCOA3_uc002xtm.2_Missense_Mutation_p.R1051I|NCOA3_uc002xtn.2_Missense_Mutation_p.R1051I|NCOA3_uc010zyc.1_Missense_Mutation_p.R846I	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	1051	Interaction with CREBBP.				androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						AGTGACGAAAGAGCATTATTG	0.473					361											0.074324	-4.190273	23.346837	11	137	KEEP	---	---	---	---	7	4	63	84	0.636363636364	capture	Missense_Mutation	SNP	46271028	46271028	NCOA3	20	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	10137	53
PREX1	57580	broad.mit.edu	37	20	47266679	47266679	+	Silent	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47266679C>T	uc002xtw.1	-	24	2906	c.2883G>A	c.(2881-2883)CCG>CCA	p.P961P	PREX1_uc002xtv.1_Silent_p.P258P	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	961					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGCCACACAGCGGGTGGGGCT	0.592																0.056075	-18.754339	25.567831	12	202	KEEP	---	---	---	---	2	11	135	114	-1	capture	Silent	SNP	47266679	47266679	PREX1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12372	53
SETD2	29072	broad.mit.edu	37	3	47161747	47161747	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47161747C>T	uc003cqs.2	-	3	4432	c.4379G>A	c.(4378-4380)TGG>TAG	p.W1460*	SETD2_uc003cqv.2_Nonsense_Mutation_p.W1449*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1460					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ACATTCCTTCCATCGCTGTGG	0.448						N|F|S|Mis		clear cell renal carcinoma								0.032967	-31.308042	12.020191	6	176	KEEP	---	---	---	---	5	2	103	99	-1	capture	Nonsense_Mutation	SNP	47161747	47161747	SETD2	3	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	14024	53
CCDC51	79714	broad.mit.edu	37	3	48475178	48475178	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48475178C>T	uc003csz.2	-	3	537	c.416G>A	c.(415-417)CGT>CAT	p.R139H	CCDC51_uc003cta.2_Missense_Mutation_p.R30H|CCDC51_uc003ctb.2_Missense_Mutation_p.R30H|CCDC51_uc003ctc.2_Missense_Mutation_p.R139H|CCDC51_uc003ctd.2_Missense_Mutation_p.R30H	NM_024661	NP_078937	Q96ER9	CCD51_HUMAN	coiled-coil domain containing 51	139	Potential.					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCTGGAGACACGGTCCAAGCG	0.597																0.029197	-26.285951	7.069889	4	133	KEEP	---	---	---	---	2	2	79	85	-1	capture	Missense_Mutation	SNP	48475178	48475178	CCDC51	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2795	53
PDZRN3	23024	broad.mit.edu	37	3	73433731	73433731	+	Silent	SNP	G	A	A	rs142044798		TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:73433731G>A	uc003dpl.1	-	10	2082	c.1986C>T	c.(1984-1986)TAC>TAT	p.Y662Y	PDZRN3_uc011bgh.1_Silent_p.Y319Y|PDZRN3_uc010hoe.1_Silent_p.Y360Y|PDZRN3_uc011bgf.1_Silent_p.Y379Y|PDZRN3_uc011bgg.1_Silent_p.Y382Y	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	662							ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		AGTACAGGCCGTAAGGGGTGG	0.657																0.049505	-11.481635	10.249962	5	96	KEEP	---	---	---	---	3	2	62	56	-1	capture	Silent	SNP	73433731	73433731	PDZRN3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11612	53
GCET2	257144	broad.mit.edu	37	3	111842417	111842417	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111842417G>A	uc003dys.1	-	6	572	c.422C>T	c.(421-423)GCC>GTC	p.A141V	C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_Intron|GCET2_uc003dyt.1_Missense_Mutation_p.A75V	NM_152785	NP_689998	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform	141						mitochondrion					0						TGGGGATCGGGCATGCCTGGG	0.458																0.019608	-45.993485	6.869983	4	200	KEEP	---	---	---	---	2	5	101	114	-1	capture	Missense_Mutation	SNP	111842417	111842417	GCET2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6228	53
CCDC149	91050	broad.mit.edu	37	4	24838869	24838869	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:24838869C>T	uc011bxr.1	-	7	787	c.643G>A	c.(643-645)GCC>ACC	p.A215T	CCDC149_uc003grc.2_Missense_Mutation_p.A215T|CCDC149_uc003grb.2_RNA|CCDC149_uc003grd.2_Intron|CCDC149_uc003gre.2_Missense_Mutation_p.A160T|CCDC149_uc011bxq.1_Missense_Mutation_p.A88T	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1	215											0		Breast(46;0.173)				ATACACAGGGCGTCCACGTCA	0.582																0.430769	81.191182	81.462283	28	37	KEEP	---	---	---	---	20	10	24	20	-1	capture	Missense_Mutation	SNP	24838869	24838869	CCDC149	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2757	53
SLC4A4	8671	broad.mit.edu	37	4	72319251	72319251	+	Silent	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72319251G>A	uc003hfy.2	+	12	1479	c.1362G>A	c.(1360-1362)GCG>GCA	p.A454A	SLC4A4_uc010iic.2_Silent_p.A454A|SLC4A4_uc010iib.2_Silent_p.A454A|SLC4A4_uc003hfz.2_Silent_p.A454A|SLC4A4_uc003hgc.3_Silent_p.A410A|SLC4A4_uc010iid.2_Intron|SLC4A4_uc003hga.2_Silent_p.A332A|SLC4A4_uc003hgb.3_Silent_p.A410A	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	454	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			AGAGGAAAGCGCCATTTTTTG	0.343																0.05949	-27.58487	44.065607	21	332	KEEP	---	---	---	---	15	11	194	193	-1	capture	Silent	SNP	72319251	72319251	SLC4A4	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14548	53
SLCO6A1	133482	broad.mit.edu	37	5	101813473	101813473	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101813473T>C	uc003knn.2	-	3	881	c.709A>G	c.(709-711)ACT>GCT	p.T237A	SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Missense_Mutation_p.T237A|SLCO6A1_uc003knq.2_Intron	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	237	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		CCCTGCACAGTCTGCCCAAGG	0.393																0.438525	388.507526	389.308334	107	137	KEEP	---	---	---	---	60	59	82	75	-1	capture	Missense_Mutation	SNP	101813473	101813473	SLCO6A1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	14624	53
MGAT4B	11282	broad.mit.edu	37	5	179225986	179225986	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179225986T>G	uc003mks.2	-	11	1654	c.1285A>C	c.(1285-1287)ACC>CCC	p.T429P	MGAT4B_uc003mkp.2_Missense_Mutation_p.T283P|MGAT4B_uc003mkq.2_Missense_Mutation_p.H204P|MGAT4B_uc003mkr.2_Missense_Mutation_p.T444P|MIR1229_hsa-mir-1229|MI0006319_5'Flank	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	alpha-1,3-mannosyl-glycoprotein	429	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding				0	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGGCAGGGGTGAAGGCCCAG	0.627	GBM(13;414 434 4098 22176 23230)															0.086667	-20.447666	7.205111	13	137	KEEP	---	---	---	---	26	25	83	78	-1	capture	Missense_Mutation	SNP	179225986	179225986	MGAT4B	5	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	9458	53
ZFP57	346171	broad.mit.edu	37	6	29640903	29640903	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29640903A>G	uc011dlw.1	-	4	1136	c.985T>C	c.(985-987)TCC>CCC	p.S329P	ZFP57_uc003nnl.3_Missense_Mutation_p.S309P	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	245					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						GGTTCCTGGGACCTGGCCACT	0.562																0.358382	195.107736	198.160266	62	111	KEEP	---	---	---	---	43	24	59	64	-1	capture	Missense_Mutation	SNP	29640903	29640903	ZFP57	6	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	17531	53
RSPO3	84870	broad.mit.edu	37	6	127471594	127471594	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:127471594T>A	uc003qar.2	+	3	603	c.313T>A	c.(313-315)TGT>AGT	p.C105S	RSPO3_uc003qas.1_Missense_Mutation_p.C105S	NM_032784	NP_116173	Q9BXY4	RSPO3_HUMAN	R-spondin 3 precursor	105	FU 2.					extracellular region	heparin binding				0				GBM - Glioblastoma multiforme(226;0.0555)		CTGTGATACCTGTTTCAACAA	0.373																0.446043	200.73355	201.086085	62	77	KEEP	---	---	---	---	27	41	52	39	-1	capture	Missense_Mutation	SNP	127471594	127471594	RSPO3	6	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	13603	53
PLEKHG1	57480	broad.mit.edu	37	6	151151882	151151882	+	Silent	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151151882C>T	uc003qny.1	+	16	1947	c.1635C>T	c.(1633-1635)AGC>AGT	p.S545S	PLEKHG1_uc011eel.1_Silent_p.S585S|PLEKHG1_uc011eem.1_Silent_p.S604S|PLEKHG1_uc003qnz.2_Silent_p.S545S	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G	545					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TGTTTCCCAGCCGACGGTCCC	0.517																0.146341	19.941482	29.803275	12	70	KEEP	---	---	---	---	8	5	41	42	-1	capture	Silent	SNP	151151882	151151882	PLEKHG1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11971	53
WTAP	9589	broad.mit.edu	37	6	160157288	160157288	+	Splice_Site	SNP	A	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160157288A>T	uc003qsl.2	+	2	215	c.-7_splice	c.e2-2		WTAP_uc010kjx.2_Splice_Site|WTAP_uc003qsk.2_Splice_Site|WTAP_uc003qsm.1_Splice_Site|WTAP_uc003qsn.2_Splice_Site	NM_004906	NP_004897	Q15007	FL2D_HUMAN	Wilms' tumour 1-associating protein isoform 1						cell cycle|mRNA processing|RNA splicing	nuclear membrane|nucleolus					0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.75e-18)|BRCA - Breast invasive adenocarcinoma(81;5.93e-06)		TTTTTTTTTTAGGATTCAAGA	0.318																0.022727	-46.518316	9.332792	5	215	KEEP	---	---	---	---	1	4	165	99	-1	capture	Splice_Site	SNP	160157288	160157288	WTAP	6	A	T	T	T	1	0	0	0	0	0	0	1	0	195	15	5	4	17290	53
OR2A14	135941	broad.mit.edu	37	7	143826382	143826382	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143826382C>A	uc011kua.1	+	1	177	c.177C>A	c.(175-177)TAC>TAA	p.Y59*		NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					CACCCATGTACTTCTTCCTCT	0.478																0.035519	-59.444838	26.339963	13	353	KEEP	---	---	---	---	7	8	212	171	0.533333333333	capture	Nonsense_Mutation	SNP	143826382	143826382	OR2A14	7	C	A	A	A	1	0	0	0	0	0	1	0	0	259	20	5	4	10880	53
SCARA3	51435	broad.mit.edu	37	8	27516827	27516827	+	Silent	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27516827C>T	uc003xga.1	+	5	1281	c.1140C>T	c.(1138-1140)GAC>GAT	p.D380D	SCARA3_uc003xgb.1_Silent_p.D380D	NM_016240	NP_057324	Q6AZY7	SCAR3_HUMAN	scavenger receptor class A, member 3 isoform 1	380	Extracellular (Potential).				response to oxidative stress|UV protection	collagen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	scavenger receptor activity			skin(2)|ovary(1)|breast(1)	4		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)		ACCTGGATGACGTGCGGCTCT	0.557																0.044248	-15.910251	9.203813	5	108	KEEP	---	---	---	---	1	4	51	70	-1	capture	Silent	SNP	27516827	27516827	SCARA3	8	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13771	53
KCNU1	157855	broad.mit.edu	37	8	36663813	36663813	+	Silent	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:36663813G>A	uc010lvw.2	+	5	582	c.495G>A	c.(493-495)AAG>AAA	p.K165K	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	165	Helical; Name=Segment S3; (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		ACAAGATCAAGTTCTGGCTGG	0.358																0.407407	33.519389	33.721813	11	16	KEEP	---	---	---	---	6	7	6	12	-1	capture	Silent	SNP	36663813	36663813	KCNU1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	8015	53
ANGPT1	284	broad.mit.edu	37	8	108334165	108334165	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:108334165T>C	uc003ymn.2	-	4	1235	c.767A>G	c.(766-768)GAC>GGC	p.D256G	ANGPT1_uc011lhv.1_Missense_Mutation_p.D56G|ANGPT1_uc003ymo.2_Missense_Mutation_p.D256G|ANGPT1_uc003ymp.3_Missense_Mutation_p.D56G	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor	256	Potential.				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			GTGGACTGTGTCCATCAGCTC	0.388																0.058824	-9.317814	28.798238	11	176	KEEP	---	---	---	---	3	10	113	110	-1	capture	Missense_Mutation	SNP	108334165	108334165	ANGPT1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	607	53
TESK1	7016	broad.mit.edu	37	9	35606965	35606965	+	Silent	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35606965C>T	uc003zxa.2	+	4	858	c.522C>T	c.(520-522)CGC>CGT	p.R174R	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Missense_Mutation_p.A42V	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	174	Protein kinase.				cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TATTTCACCGCGACCTCACAT	0.567					56											0.351351	37.280501	37.994119	13	24	KEEP	---	---	---	---	6	7	16	13	-1	capture	Silent	SNP	35606965	35606965	TESK1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15652	53
TRPM3	80036	broad.mit.edu	37	9	73230918	73230918	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:73230918A>T	uc004aid.2	-	17	2640	c.2396T>A	c.(2395-2397)ATG>AAG	p.M799K	TRPM3_uc004ahu.2_Missense_Mutation_p.M629K|TRPM3_uc004ahv.2_Missense_Mutation_p.M601K|TRPM3_uc004ahw.2_Missense_Mutation_p.M671K|TRPM3_uc004ahx.2_Missense_Mutation_p.M658K|TRPM3_uc004ahy.2_Missense_Mutation_p.M661K|TRPM3_uc004ahz.2_Missense_Mutation_p.M648K|TRPM3_uc004aia.2_Missense_Mutation_p.M646K|TRPM3_uc004aib.2_Missense_Mutation_p.M636K|TRPM3_uc004aic.2_Missense_Mutation_p.M799K	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	824	Extracellular (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						GGCCTGAGACATATAGGGCAT	0.413																0.083333	2.92514	19.863271	8	88	KEEP	---	---	---	---	1	7	65	34	-1	capture	Missense_Mutation	SNP	73230918	73230918	TRPM3	9	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	16470	53
HSD17B10	3028	broad.mit.edu	37	X	53459205	53459205	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53459205C>T	uc004dsl.1	-	3	378	c.347G>A	c.(346-348)CGA>CAA	p.R116Q	HSD17B10_uc004dsm.1_Missense_Mutation_p.R116Q	NM_004493	NP_004484	Q99714	HCD2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 10	116					branched chain family amino acid catabolic process|lipid metabolic process|tRNA processing	mitochondrial matrix|plasma membrane	3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity|3-hydroxyacyl-CoA dehydrogenase activity|cholate 7-alpha-dehydrogenase activity				0					NADH(DB00157)	ATCAAGAACTCGCTGGAAGTC	0.507																0.619048	42.879177	43.139958	13	8	KEEP	---	---	---	---	10	3	5	3	-1	capture	Missense_Mutation	SNP	53459205	53459205	HSD17B10	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7304	53
ATRX	546	broad.mit.edu	37	X	76944376	76944376	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76944376G>A	uc004ecp.3	-	7	761	c.529C>T	c.(529-531)CAG>TAG	p.Q177*	ATRX_uc004ecq.3_Nonsense_Mutation_p.Q139*|ATRX_uc004eco.3_5'UTR|ATRX_uc004ecr.2_Nonsense_Mutation_p.Q138*|ATRX_uc010nlx.1_Nonsense_Mutation_p.Q177*|ATRX_uc010nly.1_Nonsense_Mutation_p.Q122*	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	177	ADD.|GATA-type; atypical.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TGATTGACCTGTTGTCCACAA	0.338					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.857143	215.591457	225.049185	66	11	KEEP	---	---	---	---	43	32	8	7	-1	capture	Nonsense_Mutation	SNP	76944376	76944376	ATRX	23	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	1199	53
USP35	57558	broad.mit.edu	37	11	77921415	77921416	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77921415_77921416insG	uc009yva.1	+	10	2760_2761	c.2514_2515insG	c.(2512-2517)GCTGGTfs	p.A838fs	USP35_uc001oze.2_Frame_Shift_Ins_p.A594fs|USP35_uc001ozc.2_Frame_Shift_Ins_p.A406fs|USP35_uc010rsp.1_Frame_Shift_Ins_p.A270fs|USP35_uc001ozd.2_Frame_Shift_Ins_p.A449fs|USP35_uc001ozf.2_Frame_Shift_Ins_p.A569fs	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	838_839					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			TGCCACTGGCTGGTGGCCGTGG	0.634																0.02			7	283		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	77921415	77921416	USP35	11	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	16948	53
TP53	7157	broad.mit.edu	37	17	7578512	7578513	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578512_7578513delTC	uc002gim.2	-	5	611_612	c.417_418delGA	c.(415-420)AAGACCfs	p.K139fs	TP53_uc002gig.1_Frame_Shift_Del_p.K139fs|TP53_uc002gih.2_Frame_Shift_Del_p.K139fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.K7fs|TP53_uc010cng.1_Frame_Shift_Del_p.K7fs|TP53_uc002gii.1_Frame_Shift_Del_p.K7fs|TP53_uc010cnh.1_Frame_Shift_Del_p.K139fs|TP53_uc010cni.1_Frame_Shift_Del_p.K139fs|TP53_uc002gij.2_Frame_Shift_Del_p.K139fs|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Frame_Shift_Del_p.K46fs|TP53_uc002gio.2_Frame_Shift_Del_p.K7fs|TP53_uc010vug.1_Frame_Shift_Del_p.K100fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	139_140	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> S (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).|T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.K139N(8)|p.K139K(7)|p.0?(7)|p.K139fs*31(4)|p.K139fs*9(3)|p.K139Q(2)|p.K139R(2)|p.K139E(2)|p.N131fs*27(2)|p.K139*(2)|p.K139T(1)|p.L137_W146del10(1)|p.K139fs*4(1)|p.F134_T140>S(1)|p.T140fs*9(1)|p.A138_V143delAKTCPV(1)|p.K139fs*11(1)|p.K139fs*10(1)|p.A138_P142delAKTCP(1)|p.T140fs*30(1)|p.Q136_K139delQLAK(1)|p.K139_C141>N(1)|p.C135_T140delCQLAKT(1)|p.K139fs*29(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACAGGGCAGGTCTTGGCCAGTT	0.564	Pancreas(47;798 1329 9957 10801)		111	p.K139fs(HCC1438-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.82			58	13		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	7578512	7578513	TP53	17	TC	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	16264	53
ADAMTS16	170690	broad.mit.edu	37	5	5182257	5182257	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5182257delC	uc003jdl.2	+	4	740	c.602delC	c.(601-603)TCCfs	p.S201fs	ADAMTS16_uc003jdk.1_Frame_Shift_Del_p.S201fs|ADAMTS16_uc003jdj.1_Frame_Shift_Del_p.S201fs	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	201					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						AGCTCGCCATCCCACGTACTG	0.567																0.30			41	97		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	5182257	5182257	ADAMTS16	5	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	261	53
LARP1	23367	broad.mit.edu	37	5	154169931	154169932	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-06-0221-01	TCGA-06-0221-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:154169931_154169932delGC	uc003lvp.2	+	2	912_913	c.483_484delGC	c.(481-486)CAGCGCfs	p.Q161fs	LARP1_uc003lvo.2_Frame_Shift_Del_p.Q84fs|LARP1_uc010jie.1_5'UTR	NM_033551	NP_291029	Q6PKG0	LARP1_HUMAN	la related protein isoform 2	161_162							protein binding|RNA binding			ovary(2)|pancreas(1)|skin(1)	4	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TTCCTAAACAGCGCAAAGGCAG	0.520																0.06			7	109		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	154169931	154169932	LARP1	5	GC	-	-	-	1	0	1	0	1	0	0	0	0	438	34	5	5	8548	53
