Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SMPDL3B	27293	broad.mit.edu	37	1	28285085	28285085	+	Silent	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28285085G>A	uc001bpg.2	+	8	1295	c.1104G>A	c.(1102-1104)CCG>CCA	p.P368P	SMPDL3B_uc010ofq.1_Silent_p.P162P|SMPDL3B_uc010ofr.1_Silent_p.P320P|XKR8_uc001bph.1_5'Flank	NM_014474	NP_055289	Q92485	ASM3B_HUMAN	acid sphingomyelinase-like phosphodiesterase 3B	368					sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity			ovary(3)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		ATGGGGTGCCGGACGCCAGCG	0.617																0.150685	40.671858	57.727662	22	124	KEEP	---	---	---	---	6	17	51	76	-1	capture	Silent	SNP	28285085	28285085	SMPDL3B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14701	75
BRDT	676	broad.mit.edu	37	1	92479806	92479806	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92479806C>A	uc001dok.3	+	19	3168	c.2819C>A	c.(2818-2820)ACA>AAA	p.T940K	BRDT_uc001dol.3_Missense_Mutation_p.T940K|BRDT_uc010osz.1_Missense_Mutation_p.T944K|BRDT_uc009wdf.2_Missense_Mutation_p.T867K|BRDT_uc010ota.1_Missense_Mutation_p.T894K|BRDT_uc010otb.1_Missense_Mutation_p.T894K|BRDT_uc001dom.3_Missense_Mutation_p.T940K	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	940					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		GACATTATGACAATGTTTGAA	0.269					576											0.408163	63.390998	63.752101	20	29	KEEP	---	---	---	---	8	14	17	15	0.636363636364	capture	Missense_Mutation	SNP	92479806	92479806	BRDT	1	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	1496	75
COL11A1	1301	broad.mit.edu	37	1	103345386	103345386	+	Silent	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:103345386A>G	uc001dul.2	-	66	5445	c.5127T>C	c.(5125-5127)AAT>AAC	p.N1709N	COL11A1_uc001duk.2_Silent_p.N905N|COL11A1_uc001dum.2_Silent_p.N1721N|COL11A1_uc001dun.2_Silent_p.N1670N|COL11A1_uc009weh.2_Silent_p.N1593N	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1709	Fibrillar collagen NC1.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGTAGGTGAAATTTTGCCGAG	0.423																0.18797	58.902098	71.02055	25	108	KEEP	---	---	---	---	15	14	59	62	-1	capture	Silent	SNP	103345386	103345386	COL11A1	1	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	3632	75
SLC6A17	388662	broad.mit.edu	37	1	110740739	110740739	+	Silent	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110740739A>G	uc009wfq.2	+	12	2318	c.1857A>G	c.(1855-1857)GCA>GCG	p.A619A		NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	619	Helical; Name=12; (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GGGCCATGGCACTCCTGATCA	0.657																0.328125	60.66433	62.335077	21	43	KEEP	---	---	---	---	9	13	29	19	-1	capture	Silent	SNP	110740739	110740739	SLC6A17	1	A	G	G	G	1	0	0	0	0	0	0	0	1	67	6	3	3	14572	75
NCF2	4688	broad.mit.edu	37	1	183542320	183542320	+	Silent	SNP	C	T	T	rs147657171		TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183542320C>T	uc001gqj.3	-	5	884	c.609G>A	c.(607-609)ACG>ACA	p.T203T	NCF2_uc010pod.1_Silent_p.T158T|NCF2_uc010poe.1_Intron|NCF2_uc001gqk.3_Silent_p.T203T	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	203					cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						TCCCACCTACCGTCGCCTTGC	0.572																0.376667	344.890777	348.898431	113	187	KEEP	---	---	---	---	54	69	100	113	-1	capture	Silent	SNP	183542320	183542320	NCF2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10124	75
GALNT2	2590	broad.mit.edu	37	1	230314000	230314000	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:230314000G>C	uc010pwa.1	+	2	235	c.163G>C	c.(163-165)GAC>CAC	p.D55H	GALNT2_uc010pvy.1_Missense_Mutation_p.D17H|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	55	Lumenal (Potential).				immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				TAAAAAGAAAGACCTTCATCA	0.473																0.376471	106.578652	107.717433	32	53	KEEP	---	---	---	---	9	26	26	33	-1	capture	Missense_Mutation	SNP	230314000	230314000	GALNT2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	6153	75
LGALS8	3964	broad.mit.edu	37	1	236704996	236704996	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236704996A>G	uc001hxz.1	+	7	889	c.508A>G	c.(508-510)ATA>GTA	p.I170V	LGALS8_uc001hxw.1_Missense_Mutation_p.I170V|LGALS8_uc001hxy.1_Missense_Mutation_p.I170V|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.I170V|LGALS8_uc001hyb.1_Missense_Mutation_p.I170V|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	170						cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACTGACAGAGATAAGTAGAGA	0.303																0.440678	87.043282	87.223984	26	33	KEEP	---	---	---	---	11	23	16	24	-1	capture	Missense_Mutation	SNP	236704996	236704996	LGALS8	1	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	8667	75
VN1R5	317705	broad.mit.edu	37	1	247419512	247419512	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247419512A>G	uc010pyu.1	+	2	139	c.139A>G	c.(139-141)ATC>GTC	p.I47V		NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	vomeronasal 1 receptor 5	47	Cytoplasmic (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	OV - Ovarian serous cystadenocarcinoma(106;0.00854)			TACCATATAAATCTTCTTTTA	0.353	GBM(98;63 1399 4825 21305 33017)															0.392562	317.58422	320.025958	95	147	KEEP	---	---	---	---	50	51	94	72	-1	capture	Missense_Mutation	SNP	247419512	247419512	VN1R5	1	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17063	75
CALML5	51806	broad.mit.edu	37	10	5541186	5541186	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:5541186C>T	uc001iic.2	-	1	348	c.216G>A	c.(214-216)GCG>GCA	p.A72A		NM_017422	NP_059118	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	72	EF-hand 2.				epidermis development|signal transduction		calcium ion binding|protein binding				0						CCTTCTTCGCCGCCGTCAGGA	0.662	GBM(149;1055 3356 43077)															0.318182	18.918469	19.564274	7	15	KEEP	---	---	---	---	27	18	9	15	-1	capture	Silent	SNP	5541186	5541186	CALML5	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2565	75
SORCS3	22986	broad.mit.edu	37	10	106899184	106899184	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:106899184C>T	uc001kyi.1	+	8	1469	c.1242C>T	c.(1240-1242)TAC>TAT	p.Y414Y		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	414	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCAGCTACTACGTGTCTTATC	0.488	NSCLC(116;1497 1690 7108 13108 14106)															0.55303	240.188361	240.511557	73	59	KEEP	---	---	---	---	32	49	31	36	-1	capture	Silent	SNP	106899184	106899184	SORCS3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14824	75
SPRYD5	84767	broad.mit.edu	37	11	55653041	55653041	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55653041C>T	uc010rip.1	+	2	229	c.137C>T	c.(136-138)ACG>ATG	p.T46M	SPRYD5_uc010riq.1_5'Flank	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	46	RING-type.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TGGCAAGACACGGCAGTTCTT	0.493																0.315068	66.003054	68.221662	23	50	KEEP	---	---	---	---	10	16	24	29	-1	capture	Missense_Mutation	SNP	55653041	55653041	SPRYD5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15003	75
MEN1	4221	broad.mit.edu	37	11	64575418	64575418	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64575418C>T	uc001obj.2	-	3	687	c.614G>A	c.(613-615)GGC>GAC	p.G205D	MEN1_uc001obk.2_Missense_Mutation_p.G205D|MEN1_uc001obl.2_Intron|MEN1_uc001obm.2_Missense_Mutation_p.G200D|MEN1_uc001obn.2_Missense_Mutation_p.G205D|MEN1_uc001obo.2_Missense_Mutation_p.G205D|MEN1_uc001obp.2_Missense_Mutation_p.G200D|MEN1_uc001obq.2_Missense_Mutation_p.G205D|MEN1_uc001obr.2_Missense_Mutation_p.G205D	NM_130800	NP_570712	O00255	MEN1_HUMAN	menin isoform 1	205					DNA repair|histone lysine methylation|MAPKKK cascade|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|negative regulation of JNK cascade|negative regulation of osteoblast differentiation|negative regulation of protein phosphorylation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of telomerase activity|negative regulation of transcription from RNA polymerase II promoter|osteoblast development|positive regulation of protein binding|positive regulation of transforming growth factor beta receptor signaling pathway|response to gamma radiation|response to UV|transcription, DNA-dependent	chromatin|cleavage furrow|cytosol|histone methyltransferase complex|nuclear matrix|soluble fraction	double-stranded DNA binding|four-way junction DNA binding|protein binding, bridging|protein N-terminus binding|R-SMAD binding|transcription regulatory region DNA binding|Y-form DNA binding			parathyroid(105)|pancreas(64)|gastrointestinal_tract_(site_indeterminate)(15)|small_intestine(13)|lung(9)|pituitary(7)|NS(7)|adrenal_gland(5)|soft_tissue(4)|central_nervous_system(4)|thymus(2)|stomach(1)|retroperitoneum(1)|skin(1)	238						GTTGCCCTTGCCGTGCCAGGT	0.627	Esophageal Squamous(1;83 158 15500 18603 18803 29295)				75	D|Mis|N|F|S		parathyroid tumors|Pancreatic neuroendocrine tumors	parathyroid adenoma|pituitary adenoma|pancreatic islet cell|carcinoid			Hyperparathyroidism_Familial_Isolated|Multiple_Endocrine_Neoplasia_type_1				0.034783	-18.887612	8.173262	4	111	KEEP	---	---	---	---	1	3	78	56	-1	capture	Missense_Mutation	SNP	64575418	64575418	MEN1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9385	75
CCDC81	60494	broad.mit.edu	37	11	86123501	86123501	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:86123501A>G	uc001pbx.1	+	11	1719	c.1291A>G	c.(1291-1293)AGT>GGT	p.S431G	CCDC81_uc001pbw.1_Missense_Mutation_p.S341G|CCDC81_uc010rtq.1_Missense_Mutation_p.S214G|CCDC81_uc001pby.1_Missense_Mutation_p.S166G	NM_001156474	NP_001149946	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81 isoform 1	431										skin(1)	1		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				ATATTCCCGGAGTCTCCTGAA	0.418																0.392638	216.762765	218.408513	64	99	KEEP	---	---	---	---	31	41	45	64	-1	capture	Missense_Mutation	SNP	86123501	86123501	CCDC81	11	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	2829	75
GLI1	2735	broad.mit.edu	37	12	57863263	57863263	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57863263C>T	uc001snx.2	+	11	1436	c.1358C>T	c.(1357-1359)TCC>TTC	p.S453F	GLI1_uc009zpq.2_Missense_Mutation_p.S325F	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	453					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			AGTGACCACTCCCCGGCAGGG	0.602	Pancreas(157;841 1936 10503 41495 50368)				277											0.346154	101.064274	103.239563	36	68	KEEP	---	---	---	---	15	24	42	49	-1	capture	Missense_Mutation	SNP	57863263	57863263	GLI1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6373	75
CAND1	55832	broad.mit.edu	37	12	67691247	67691247	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:67691247G>T	uc001stn.2	+	5	989	c.552G>T	c.(550-552)TTG>TTT	p.L184F	CAND1_uc001sto.2_5'Flank	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	184	HEAT 5.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTCCCCAGTTGACCAGCCCTA	0.368																0.390879	343.509773	346.718165	120	187	KEEP	---	---	---	---	73	60	88	125	0.548872180451	capture	Missense_Mutation	SNP	67691247	67691247	CAND1	12	G	T	T	T	1	0	0	0	0	1	0	0	0	581	45	4	4	2591	75
MGAT4C	25834	broad.mit.edu	37	12	86374059	86374059	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:86374059G>A	uc001tai.3	-	8	1695	c.445C>T	c.(445-447)CGT>TGT	p.R149C	MGAT4C_uc001tal.3_Missense_Mutation_p.R149C|MGAT4C_uc001taj.3_Missense_Mutation_p.R149C|MGAT4C_uc001tak.3_Missense_Mutation_p.R149C|MGAT4C_uc010sum.1_Missense_Mutation_p.R173C|MGAT4C_uc001tah.3_Missense_Mutation_p.R149C	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	149	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						ATGGCATCACGCCAGGAAGAA	0.398																0.364162	177.675004	180.484319	63	110	KEEP	---	---	---	---	34	32	59	61	-1	capture	Missense_Mutation	SNP	86374059	86374059	MGAT4C	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9459	75
C12orf63	374467	broad.mit.edu	37	12	97087577	97087577	+	Silent	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:97087577A>G	uc001tet.1	+	12	1695	c.1617A>G	c.(1615-1617)AGA>AGG	p.R539R		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	539										skin(6)|ovary(1)	7						TAGAAGCAAGAATCCTCAAGG	0.308																0.350877	134.870733	137.104938	40	74	KEEP	---	---	---	---	19	26	51	29	-1	capture	Silent	SNP	97087577	97087577	C12orf63	12	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	1692	75
RIMBP2	23504	broad.mit.edu	37	12	130926697	130926697	+	Silent	SNP	C	T	T	rs149109982		TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130926697C>T	uc001uil.2	-	8	1313	c.1149G>A	c.(1147-1149)ACG>ACA	p.T383T	RIMBP2_uc001uim.2_Silent_p.T291T|RIMBP2_uc001uin.1_Silent_p.T42T	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	383						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCACCAGCAGCGTGCACTGCA	0.637																0.513761	170.116555	170.135435	56	53	KEEP	---	---	---	---	23	35	18	37	-1	capture	Silent	SNP	130926697	130926697	RIMBP2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13255	75
MTUS2	23281	broad.mit.edu	37	13	29600822	29600822	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29600822G>T	uc001usl.3	+	1	2075	c.2017G>T	c.(2017-2019)GTT>TTT	p.V673F		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	663	Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						CGCCTCGCTGGTTCCAGTGGG	0.587					344											0.287356	69.603809	73.094656	25	62	KEEP	---	---	---	---	13	12	34	31	0.52	capture	Missense_Mutation	SNP	29600822	29600822	MTUS2	13	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	9876	75
BRCA2	675	broad.mit.edu	37	13	32911000	32911000	+	Silent	SNP	T	C	C			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:32911000T>C	uc001uub.1	+	11	2735	c.2508T>C	c.(2506-2508)CCT>CCC	p.P836P		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	836	Interaction with NPM1.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGTTGCCACCTGAAAAATACA	0.308	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)				677	D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			0.034188	-19.006979	8.642084	4	113	KEEP	---	---	---	---	1	4	49	79	-1	capture	Silent	SNP	32911000	32911000	BRCA2	13	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	1487	75
ARL11	115761	broad.mit.edu	37	13	50204952	50204952	+	Silent	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:50204952G>A	uc001vdf.1	+	2	515	c.369G>A	c.(367-369)AAG>AAA	p.K123K		NM_138450	NP_612459	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	123	GTP (By similarity).				small GTPase mediated signal transduction	intracellular	GTP binding|protein binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		TGGCCAACAAGCAGGAGGCAC	0.602																0.392638	184.694318	186.328808	64	99	KEEP	---	---	---	---	27	39	38	68	-1	capture	Silent	SNP	50204952	50204952	ARL11	13	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	920	75
PROZ	8858	broad.mit.edu	37	13	113812987	113812987	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113812987G>A	uc001vta.1	+	1	20	c.13G>A	c.(13-15)GTC>ATC	p.V5I	PROZ_uc010agr.1_Missense_Mutation_p.V5I	NM_003891	NP_003882	P22891	PROZ_HUMAN	protein Z, vitamin K-dependent plasma	5					blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)	GGCAGGCTGCGTCCCACTGCT	0.657																0.37931	28.212577	28.584746	11	18	KEEP	---	---	---	---	10	3	13	7	-1	capture	Missense_Mutation	SNP	113812987	113812987	PROZ	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12458	75
PPP4R4	57718	broad.mit.edu	37	14	94703972	94703972	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94703972C>T	uc001ycs.1	+	8	956	c.802C>T	c.(802-804)CGA>TGA	p.R268*		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	268	HEAT 2.					cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						CAGCAGTGTACGACTTGCAGC	0.358																0.345679	239.324189	244.435121	84	159	KEEP	---	---	---	---	39	53	95	78	-1	capture	Nonsense_Mutation	SNP	94703972	94703972	PPP4R4	14	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12306	75
AQR	9716	broad.mit.edu	37	15	35166951	35166951	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35166951A>G	uc001ziv.2	-	29	3533	c.3352T>C	c.(3352-3354)TCT>CCT	p.S1118P		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	1118						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GTGAAGAGAGACTGCTCCATG	0.428																0.240437	127.112525	138.360192	44	139	KEEP	---	---	---	---	22	39	64	84	-1	capture	Missense_Mutation	SNP	35166951	35166951	AQR	15	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	828	75
KIAA1024	23251	broad.mit.edu	37	15	79750063	79750063	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79750063T>C	uc002bew.1	+	2	1649	c.1574T>C	c.(1573-1575)CTT>CCT	p.L525P	KIAA1024_uc010unk.1_Missense_Mutation_p.L525P	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	525						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						TTCCGATTTCTTGATGACATG	0.502																0.327273	118.264349	121.173878	36	74	KEEP	---	---	---	---	17	22	27	52	-1	capture	Missense_Mutation	SNP	79750063	79750063	KIAA1024	15	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	8127	75
SLC7A5	8140	broad.mit.edu	37	16	87873313	87873313	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:87873313C>A	uc002fkm.2	-	5	1006	c.934G>T	c.(934-936)GCC>TCC	p.A312S		NM_003486	NP_003477	Q01650	LAT1_HUMAN	solute carrier family 7 (cationic amino acid	312					blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding				0				BRCA - Breast invasive adenocarcinoma(80;0.049)		CTCACCACGGCCACGGCCTCG	0.652																0.490909	80.929354	80.933066	27	28	KEEP	---	---	---	---	15	21	17	26	0.583333333333	capture	Missense_Mutation	SNP	87873313	87873313	SLC7A5	16	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	14592	75
PLSCR3	57048	broad.mit.edu	37	17	7296587	7296587	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7296587C>T	uc002ggm.1	-	5	592	c.383G>A	c.(382-384)CGT>CAT	p.R128H	PLSCR3_uc002ggl.2_Missense_Mutation_p.R128H|PLSCR3_uc002ggq.1_Intron|PLSCR3_uc002ggn.1_Missense_Mutation_p.R128H|PLSCR3_uc002ggo.1_Missense_Mutation_p.R128H|PLSCR3_uc002ggp.1_Intron|PLSCR3_uc002ggr.1_Missense_Mutation_p.R128H|PLSCR3_uc010cmg.1_Missense_Mutation_p.R128H	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3	128	Cytoplasmic (By similarity).				phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				ACAGCACAGACGGGCGCAGCA	0.716																0.25	11.164142	12.30153	5	15	KEEP	---	---	---	---	5	3	11	20	-1	capture	Missense_Mutation	SNP	7296587	7296587	PLSCR3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12014	75
KRT15	3866	broad.mit.edu	37	17	39673161	39673161	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39673161G>A	uc002hwy.2	-	3	828	c.637C>T	c.(637-639)CGC>TGC	p.R213C	KRT15_uc002hwz.2_Missense_Mutation_p.R115C|KRT15_uc002hxa.2_Missense_Mutation_p.R48C|KRT15_uc002hxb.1_Missense_Mutation_p.R48C	NM_002275	NP_002266	P19012	K1C15_HUMAN	keratin 15	213	Rod.|Coil 1B.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000286)				AGGACTCGGCGCAAGCCGTTG	0.592																0.036364	-18.766635	6.861829	4	106	KEEP	---	---	---	---	8	4	53	70	-1	capture	Missense_Mutation	SNP	39673161	39673161	KRT15	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8372	75
PITPNC1	26207	broad.mit.edu	37	17	65528973	65528973	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65528973G>A	uc002jgc.2	+	2	451	c.104G>A	c.(103-105)CGG>CAG	p.R35Q	PITPNC1_uc002jgb.2_Missense_Mutation_p.R35Q	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,	35					signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			CAGAGTGACCGGGGAGAAGGG	0.532																0.235294	20.785127	22.962121	8	26	KEEP	---	---	---	---	3	5	14	14	-1	capture	Missense_Mutation	SNP	65528973	65528973	PITPNC1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11852	75
ELAVL1	1994	broad.mit.edu	37	19	8028639	8028639	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8028639G>A	uc002mjb.2	-	6	876	c.709C>T	c.(709-711)CCA>TCA	p.P237S		NM_001419	NP_001410	Q15717	ELAV1_HUMAN	ELAV-like 1	237					3'-UTR-mediated mRNA stabilization|multicellular organismal development	cytoplasm|nucleoplasm	identical protein binding|mRNA binding|nucleotide binding				0						GCGTTTCCTGGCACGTTGACG	0.632					113											0.258621	75.394382	81.518807	30	86	KEEP	---	---	---	---	15	22	46	50	-1	capture	Missense_Mutation	SNP	8028639	8028639	ELAVL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5004	75
PDE4A	5141	broad.mit.edu	37	19	10574494	10574494	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10574494C>T	uc002moj.2	+	14	1877	c.1769C>T	c.(1768-1770)GCC>GTC	p.A590V	PDE4A_uc002mok.2_Missense_Mutation_p.A564V|PDE4A_uc002mol.2_Missense_Mutation_p.A529V|PDE4A_uc002mom.2_Missense_Mutation_p.A351V|PDE4A_uc002mon.2_Missense_Mutation_p.A45V|PDE4A_uc002moo.2_Missense_Mutation_p.A256V	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	590	Catalytic.				signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	GTGCACTGTGCCGACCTCAGC	0.617																0.025	-42.784855	7.262263	5	195	KEEP	---	---	---	---	1	4	94	108	-1	capture	Missense_Mutation	SNP	10574494	10574494	PDE4A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11542	75
ZNF91	7644	broad.mit.edu	37	19	23542219	23542219	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23542219G>A	uc002nre.2	-	4	3675	c.3562C>T	c.(3562-3564)CCC>TCC	p.P1188S	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.P1156S	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	1188						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				tagagaaggggtttcactgtg	0.010																0.235294	19.781371	21.961159	8	26	KEEP	---	---	---	---	2	6	15	11	-1	capture	Missense_Mutation	SNP	23542219	23542219	ZNF91	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	18076	75
CYP2A13	1553	broad.mit.edu	37	19	41597726	41597726	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41597726C>T	uc002opt.2	+	5	753	c.744C>T	c.(742-744)ATC>ATT	p.I248I		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	248					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	AGGACTTCATCGCCAAGAAGG	0.557																0.025773	-39.196544	9.110369	5	189	KEEP	---	---	---	---	3	4	87	118	-1	capture	Silent	SNP	41597726	41597726	CYP2A13	19	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	4121	75
CEACAM3	1084	broad.mit.edu	37	19	42301736	42301736	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42301736G>A	uc002orn.1	+	2	356	c.280G>A	c.(280-282)GCA>ACA	p.A94T	CEACAM3_uc010eia.1_Missense_Mutation_p.A94T|CEACAM3_uc002oro.1_RNA	NM_001815	NP_001806	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion	94	Ig-like V-type.|Extracellular (Potential).					integral to membrane				skin(1)	1						CCCAGGGGCCGCATACAGCGG	0.463																0.019763	-113.799581	17.068902	10	496	KEEP	---	---	---	---	8	3	250	289	-1	capture	Missense_Mutation	SNP	42301736	42301736	CEACAM3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3162	75
PPP1R12C	54776	broad.mit.edu	37	19	55624065	55624065	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55624065C>T	uc002qix.2	-	2	436	c.420G>A	c.(418-420)GTG>GTA	p.V140V	PPP1R12C_uc010yfs.1_Silent_p.V66V|PPP1R12C_uc002qiy.2_Silent_p.V140V	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	140	ANK 2.					cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		AGGAGGCGGCCACGTGCAGTG	0.667																0.245283	99.210551	108.564369	39	120	KEEP	---	---	---	---	19	29	77	73	-1	capture	Silent	SNP	55624065	55624065	PPP1R12C	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	12257	75
FAM136A	84908	broad.mit.edu	37	2	70524589	70524589	+	Silent	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70524589G>A	uc002sgq.3	-	3	326	c.249C>T	c.(247-249)ACC>ACT	p.T83T	FAM136A_uc010fdp.2_RNA	NM_032822	NP_116211	Q96C01	F136A_HUMAN	hypothetical protein LOC84908	83						mitochondrion	protein binding				0						TGCAATGCATGGTGCACCGGG	0.403																0.042654	-29.615998	17.756128	9	202	KEEP	---	---	---	---	6	5	119	104	-1	capture	Silent	SNP	70524589	70524589	FAM136A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	5404	75
TEKT4	150483	broad.mit.edu	37	2	95537709	95537709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:95537709G>A	uc002stw.1	+	1	478	c.385G>A	c.(385-387)GCC>ACC	p.A129T	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	129	Potential.				cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						GCTGGAGCGCGCCCTGGACGC	0.657																0.32	16.581615	17.306648	8	17	KEEP	---	---	---	---	2	7	7	13	-1	capture	Missense_Mutation	SNP	95537709	95537709	TEKT4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15640	75
SCN1A	6323	broad.mit.edu	37	2	166847871	166847871	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166847871T>A	uc010zcz.1	-	26	5899	c.5881A>T	c.(5881-5883)AAA>TAA	p.K1961*		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1972						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AGATCAGTTTTTTCTGTAATA	0.363																0.342857	122.532674	125.646354	48	92	KEEP	---	---	---	---	24	29	54	43	-1	capture	Nonsense_Mutation	SNP	166847871	166847871	SCN1A	2	T	A	A	A	1	0	0	0	0	0	1	0	0	832	64	5	4	13807	75
OSBPL6	114880	broad.mit.edu	37	2	179253861	179253861	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179253861G>A	uc002ulx.2	+	21	2660	c.2282G>A	c.(2281-2283)TGC>TAC	p.C761Y	OSBPL6_uc002uly.2_Missense_Mutation_p.C786Y|OSBPL6_uc010zfe.1_Missense_Mutation_p.C730Y|OSBPL6_uc002ulz.2_Missense_Mutation_p.C725Y|OSBPL6_uc002uma.2_Missense_Mutation_p.C765Y	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	761					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GTTTGCATTTGCAAACTCACA	0.333																0.303571	91.60351	95.462477	34	78	KEEP	---	---	---	---	19	18	47	37	-1	capture	Missense_Mutation	SNP	179253861	179253861	OSBPL6	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	11185	75
TTN	7273	broad.mit.edu	37	2	179634524	179634524	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179634524C>A	uc010zfg.1	-	37	9008	c.8784G>T	c.(8782-8784)AAG>AAT	p.K2928N	TTN_uc010zfh.1_Missense_Mutation_p.K2882N|TTN_uc010zfi.1_Missense_Mutation_p.K2882N|TTN_uc010zfj.1_Missense_Mutation_p.K2882N|TTN_uc002unb.2_Missense_Mutation_p.K2928N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2928							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACAACTATCTTGAACTTTT	0.458					8722											0.320988	352.589391	364.127356	130	275	KEEP	---	---	---	---	78	78	173	155	0.5	capture	Missense_Mutation	SNP	179634524	179634524	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	16617	75
ZSWIM2	151112	broad.mit.edu	37	2	187692829	187692829	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:187692829C>G	uc002upu.1	-	9	1824	c.1784G>C	c.(1783-1785)AGT>ACT	p.S595T		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	595					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			CATACAGTTACTATACCTTTT	0.338																0.405172	160.804041	161.715549	47	69	KEEP	---	---	---	---	17	31	39	32	-1	capture	Missense_Mutation	SNP	187692829	187692829	ZSWIM2	2	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	18117	75
FAM126B	285172	broad.mit.edu	37	2	201846441	201846441	+	Missense_Mutation	SNP	C	T	T	rs138872845		TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201846441C>T	uc002uws.3	-	12	1333	c.1145G>A	c.(1144-1146)CGT>CAT	p.R382H	FAM126B_uc002uwu.2_Missense_Mutation_p.R356H|FAM126B_uc002uwv.2_Missense_Mutation_p.R382H	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	382						intracellular				ovary(1)	1						CTTGGCTGAACGCCCAGTTGC	0.493																0.336207	107.789007	110.542226	39	77	KEEP	---	---	---	---	20	24	41	39	-1	capture	Missense_Mutation	SNP	201846441	201846441	FAM126B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5384	75
CHRNG	1146	broad.mit.edu	37	2	233405386	233405386	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233405386C>T	uc002vsx.1	+	4	336	c.315C>T	c.(313-315)ACC>ACT	p.T105T	CHRNG_uc010fyd.2_Silent_p.T105T|CHRNG_uc010fye.1_Silent_p.T105T	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	105	Extracellular (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		TGCCGTCCACCATGGTGTGGC	0.652																0.275	28.005666	29.830692	11	29	KEEP	---	---	---	---	10	9	19	21	-1	capture	Silent	SNP	233405386	233405386	CHRNG	2	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3361	75
PREX1	57580	broad.mit.edu	37	20	47309262	47309262	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47309262C>T	uc002xtw.1	-	8	1007	c.984G>A	c.(982-984)AGG>AGA	p.R328R		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	328	PH.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGATTCGACCCCTGAAGATGT	0.458																0.191111	102.890318	122.954406	43	182	KEEP	---	---	---	---	22	22	109	93	-1	capture	Silent	SNP	47309262	47309262	PREX1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	12372	75
TPTE	7179	broad.mit.edu	37	21	10906987	10906987	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10906987C>A	uc002yip.1	-	24	1942	c.1574G>T	c.(1573-1575)AGA>ATA	p.R525I	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.R507I|TPTE_uc002yir.1_Missense_Mutation_p.R487I|TPTE_uc010gkv.1_Missense_Mutation_p.R387I	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	525	C2 tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGGATAAATTCTCCGTGCTTT	0.358																0.149254	32.203516	48.024743	20	114	KEEP	---	---	---	---	9	11	51	73	0.55	capture	Missense_Mutation	SNP	10906987	10906987	TPTE	21	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	16313	75
B3GALT5	10317	broad.mit.edu	37	21	41033203	41033203	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:41033203T>G	uc002yyb.1	+	5	1309	c.717T>G	c.(715-717)ATT>ATG	p.I239M	B3GALT5_uc002yye.2_Missense_Mutation_p.I239M|B3GALT5_uc002yyi.1_Missense_Mutation_p.I239M|B3GALT5_uc002yyj.1_Missense_Mutation_p.I239M|B3GALT5_uc002yyk.1_Missense_Mutation_p.I239M|B3GALT5_uc002yyl.1_Missense_Mutation_p.I239M|B3GALT5_uc002yym.1_Missense_Mutation_p.I239M	NM_033173	NP_149363	Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta	239	Lumenal (Potential).				protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)				TCCCATACATTAAACTGGAAG	0.562																0.34728	273.167931	278.081603	83	156	KEEP	---	---	---	---	40	49	82	88	-1	capture	Missense_Mutation	SNP	41033203	41033203	B3GALT5	21	T	G	G	G	1	0	0	0	0	1	0	0	0	783	61	4	4	1240	75
GTSE1	51512	broad.mit.edu	37	22	46708130	46708130	+	Silent	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46708130G>A	uc011aqy.1	+	5	1067	c.855G>A	c.(853-855)CCG>CCA	p.P285P	GTSE1_uc011aqz.1_Silent_p.P132P	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	266					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		AACCTGCCCCGGGTGCTGTCA	0.577	GBM(153;542 1915 12487 29016 50495)				471											0.461538	97.04909	97.132125	30	35	KEEP	---	---	---	---	22	21	22	24	-1	capture	Silent	SNP	46708130	46708130	GTSE1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6814	75
ITPR1	3708	broad.mit.edu	37	3	4716846	4716846	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:4716846G>A	uc003bqa.2	+	23	3041	c.2693G>A	c.(2692-2694)TGT>TAT	p.C898Y	ITPR1_uc010hca.1_Missense_Mutation_p.C883Y|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Missense_Mutation_p.C883Y	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	898	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		ATATTGGACTGTGTACATGTG	0.393					2114											0.370787	93.747404	95.054828	33	56	KEEP	---	---	---	---	17	22	34	31	-1	capture	Missense_Mutation	SNP	4716846	4716846	ITPR1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	7843	75
SRGAP3	9901	broad.mit.edu	37	3	9034619	9034619	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9034619C>T	uc003brf.1	-	20	3205	c.2529G>A	c.(2527-2529)TCG>TCA	p.S843S	SRGAP3_uc003brg.1_Silent_p.S819S	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	843					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		AGCCGTAATCCGAGATGTGCT	0.557						T	RAF1	pilocytic astrocytoma								0.055172	-14.006692	16.20667	8	137	KEEP	---	---	---	---	4	5	61	89	-1	capture	Silent	SNP	9034619	9034619	SRGAP3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15039	75
SLC6A6	6533	broad.mit.edu	37	3	14509599	14509599	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14509599C>A	uc010heg.2	+	16	1266	c.975C>A	c.(973-975)GAC>GAA	p.D325E	SLC6A6_uc003byq.2_Missense_Mutation_p.D325E|SLC6A6_uc003byr.2_Intron	NM_001134367	NP_001127839	P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter	325					cellular amino acid metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity|taurine:sodium symporter activity			ovary(1)	1						AACTTAGGGACTGTATGCTGC	0.453														OREG0015421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.379592	284.903587	288.024062	93	152	KEEP	---	---	---	---	56	53	89	87	0.48623853211	capture	Missense_Mutation	SNP	14509599	14509599	SLC6A6	3	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	14580	75
ADCY5	111	broad.mit.edu	37	3	123003491	123003491	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123003491C>A	uc003egh.1	-	21	3750	c.3750G>T	c.(3748-3750)ATG>ATT	p.M1250I	ADCY5_uc003egg.1_Missense_Mutation_p.M908I	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	1250	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		GGAAGTAGGTCATCATCTCGC	0.607																0.067961	-17.280314	42.422647	21	288	KEEP	---	---	---	---	14	9	148	158	0.391304347826	capture	Missense_Mutation	SNP	123003491	123003491	ADCY5	3	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	297	75
ATP2C1	27032	broad.mit.edu	37	3	130672707	130672707	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:130672707A>G	uc003enl.2	+	9	796	c.574A>G	c.(574-576)ACA>GCA	p.T192A	ATP2C1_uc011blg.1_Missense_Mutation_p.T226A|ATP2C1_uc011blh.1_Missense_Mutation_p.T187A|ATP2C1_uc011bli.1_Missense_Mutation_p.T226A|ATP2C1_uc003enk.2_Missense_Mutation_p.T176A|ATP2C1_uc003enm.2_Missense_Mutation_p.T192A|ATP2C1_uc003enn.2_Missense_Mutation_p.T176A|ATP2C1_uc003eno.2_Missense_Mutation_p.T192A|ATP2C1_uc003enp.2_Missense_Mutation_p.T192A|ATP2C1_uc003enq.2_Missense_Mutation_p.T192A|ATP2C1_uc003enr.2_Missense_Mutation_p.T192A|ATP2C1_uc003ens.2_Missense_Mutation_p.T192A|ATP2C1_uc003ent.2_Missense_Mutation_p.T192A	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	192	Cytoplasmic (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	GACAGGTGAGACAACGCCTTG	0.438	Esophageal Squamous(99;456 1443 27647 34099 42636)											Hailey-Hailey_disease				0.359116	204.630961	207.790711	65	116	KEEP	---	---	---	---	30	39	56	71	-1	capture	Missense_Mutation	SNP	130672707	130672707	ATP2C1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	1134	75
AADACL2	344752	broad.mit.edu	37	3	151475174	151475174	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151475174C>T	uc003ezc.2	+	5	1118	c.998C>T	c.(997-999)ACC>ATC	p.T333I	AADACL2_uc010hvn.2_Missense_Mutation_p.T120I	NM_207365	NP_997248	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2 precursor	333						extracellular region|integral to membrane	carboxylesterase activity				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTGCCACTAACCTATATTCTT	0.378																0.328413	254.690113	261.76066	89	182	KEEP	---	---	---	---	46	51	91	104	-1	capture	Missense_Mutation	SNP	151475174	151475174	AADACL2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	11	75
PIK3CA	5290	broad.mit.edu	37	3	178928081	178928081	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178928081A>C	uc003fjk.2	+	8	1516	c.1359A>C	c.(1357-1359)GAA>GAC	p.E453D		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	453	C2 PI3K-type.		E -> Q (in cancer; shows an increase in lipid kinase activity; may disrupt the interaction of the C2 PI3K-type domain with the iSH2 region of the p85 regulatory subunit).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E453K(5)|p.E453A(1)|p.P449_L455del(1)|p.G451_L456>V(1)|p.E453del(1)|p.E453Q(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			ATGGATTAGAAGATTTGCTGA	0.348	Colon(199;1504 1750 3362 26421 31210 32040)		57		621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.196429	69.24723	83.717416	33	135	KEEP	---	---	---	---	25	13	73	77	-1	capture	Missense_Mutation	SNP	178928081	178928081	PIK3CA	3	A	C	C	C	1	0	0	0	0	1	0	0	0	37	3	4	4	11816	75
FBN2	2201	broad.mit.edu	37	5	127728897	127728897	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127728897C>T	uc003kuu.2	-	10	1835	c.1396G>A	c.(1396-1398)GGC>AGC	p.G466S	FBN2_uc003kuv.2_Missense_Mutation_p.G433S	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	466					bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGAGAAAAGCCATTGCCTCCA	0.587					1552											0.377551	205.514579	208.08795	74	122	KEEP	---	---	---	---	40	41	61	73	-1	capture	Missense_Mutation	SNP	127728897	127728897	FBN2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5649	75
PCDHB3	56132	broad.mit.edu	37	5	140481943	140481943	+	Silent	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140481943G>A	uc003lio.2	+	1	1710	c.1710G>A	c.(1708-1710)GCG>GCA	p.A570A	uc003lin.2_5'Flank	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	570	Extracellular (Potential).|Cadherin 6.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGGCTCCGCGCCCTGCACCG	0.711																0.326531	79.089296	81.694034	32	66	KEEP	---	---	---	---	26	18	54	54	-1	capture	Silent	SNP	140481943	140481943	PCDHB3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11446	75
PCDHB8	56128	broad.mit.edu	37	5	140558277	140558277	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140558277C>T	uc011dai.1	+	1	848	c.662C>T	c.(661-663)CCG>CTG	p.P221L	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	221	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCTCTCCGCCCAGATCT	0.522																0.061611	-17.104791	25.271722	13	198	KEEP	---	---	---	---	10	16	121	127	-1	capture	Missense_Mutation	SNP	140558277	140558277	PCDHB8	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11451	75
PCDHB13	56123	broad.mit.edu	37	5	140594357	140594357	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140594357C>T	uc003lja.1	+	1	849	c.662C>T	c.(661-663)CCG>CTG	p.P221L		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	221	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding	p.P221L(1)		skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGCTCTCCGCCCAGATCT	0.532																0.116162	27.682169	56.398518	23	175	KEEP	---	---	---	---	21	14	103	117	-1	capture	Missense_Mutation	SNP	140594357	140594357	PCDHB13	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11441	75
PCDHGA9	56107	broad.mit.edu	37	5	140782948	140782948	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140782948C>T	uc003lkh.1	+	1	429	c.429C>T	c.(427-429)AAC>AAT	p.N143N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Silent_p.N143N	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	143	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAAAAATTAACGAAATCGCGG	0.473																0.381579	169.1321	170.994338	58	94	KEEP	---	---	---	---	32	31	46	59	-1	capture	Silent	SNP	140782948	140782948	PCDHGA9	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11464	75
AFAP1L1	134265	broad.mit.edu	37	5	148687124	148687124	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148687124G>A	uc003lqh.2	+	7	826	c.695G>A	c.(694-696)CGT>CAT	p.R232H	AFAP1L1_uc003lqg.3_Missense_Mutation_p.R232H|AFAP1L1_uc010jgy.2_Missense_Mutation_p.R232H	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	232	PH 1.						protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGAAAAAGCGTTTCGGGCAG	0.627																0.293333	57.718599	60.587234	22	53	KEEP	---	---	---	---	7	17	25	38	-1	capture	Missense_Mutation	SNP	148687124	148687124	AFAP1L1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	354	75
FAT2	2196	broad.mit.edu	37	5	150901299	150901299	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150901299C>T	uc003lue.3	-	18	10868	c.10855G>A	c.(10855-10857)GTG>ATG	p.V3619M	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.V312M	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	3619	Cadherin 32.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACATGCCACACGTACACATGG	0.627																0.095238	5.671811	22.936924	10	95	KEEP	---	---	---	---	5	6	53	60	-1	capture	Missense_Mutation	SNP	150901299	150901299	FAT2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5636	75
MDN1	23195	broad.mit.edu	37	6	90387330	90387330	+	Silent	SNP	G	A	A	rs116003199	by1000genomes	TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90387330G>A	uc003pnn.1	-	76	12614	c.12498C>T	c.(12496-12498)AGC>AGT	p.S4166S		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	4166					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGGACAATGCGCTCTGGAGAT	0.423																0.338129	126.272048	129.497663	47	92	KEEP	---	---	---	---	24	28	43	52	-1	capture	Silent	SNP	90387330	90387330	MDN1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	9328	75
ASCC3	10973	broad.mit.edu	37	6	101248186	101248186	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:101248186G>A	uc003pqk.2	-	6	1446	c.1117C>T	c.(1117-1119)CGG>TGG	p.R373W	ASCC3_uc011eai.1_Missense_Mutation_p.R275W|ASCC3_uc003pql.2_Missense_Mutation_p.R373W	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	373					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTTTGTATCCGCAATTCCTTA	0.348																0.031447	-29.630541	8.582498	5	154	KEEP	---	---	---	---	4	1	91	83	-1	capture	Missense_Mutation	SNP	101248186	101248186	ASCC3	6	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	1024	75
TMEM200A	114801	broad.mit.edu	37	6	130762663	130762663	+	Missense_Mutation	SNP	G	A	A	rs140251464		TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:130762663G>A	uc003qca.2	+	3	1967	c.1096G>A	c.(1096-1098)GGA>AGA	p.G366R	TMEM200A_uc010kfh.2_Missense_Mutation_p.G366R|TMEM200A_uc010kfi.2_Missense_Mutation_p.G366R|TMEM200A_uc003qcb.2_Missense_Mutation_p.G366R	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	366	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		TATGGCTCTCGGACCTGGGGC	0.522				p.G366R(SKUT1-Tumor)	66											0.359223	114.502993	116.276177	37	66	KEEP	---	---	---	---	23	20	39	40	-1	capture	Missense_Mutation	SNP	130762663	130762663	TMEM200A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16006	75
KEL	3792	broad.mit.edu	37	7	142649600	142649600	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142649600G>T	uc003wcb.2	-	10	1409	c.1199C>A	c.(1198-1200)CCC>CAC	p.P400H		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	400	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					CCTCACCATGGGTGGTTGCTC	0.552																0.238318	122.016458	135.403272	51	163	KEEP	---	---	---	---	26	29	86	100	0.472727272727	capture	Missense_Mutation	SNP	142649600	142649600	KEL	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	8064	75
ABP1	26	broad.mit.edu	37	7	150558187	150558187	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150558187G>A	uc003why.1	+	6	6364	c.2146G>A	c.(2146-2148)GTG>ATG	p.V716M	ABP1_uc003whz.1_Missense_Mutation_p.V716M|ABP1_uc003wia.1_Missense_Mutation_p.V735M	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	716					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	CACTGTGATCGTGTGGCCTCG	0.602	Pancreas(195;1227 3054 24912 28503)															0.260417	126.463058	136.440554	50	142	KEEP	---	---	---	---	20	33	73	83	-1	capture	Missense_Mutation	SNP	150558187	150558187	ABP1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	98	75
DOCK5	80005	broad.mit.edu	37	8	25225732	25225732	+	Silent	SNP	C	T	T			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25225732C>T	uc003xeg.2	+	32	3386	c.3249C>T	c.(3247-3249)ATC>ATT	p.I1083I	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Silent_p.I797I|DOCK5_uc003xei.2_Silent_p.I653I|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1083						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAAAGGAAATCGGCTTTAGAA	0.413	Pancreas(145;34 1887 3271 10937 30165)															0.28125	24.861372	26.237513	9	23	KEEP	---	---	---	---	4	8	17	8	-1	capture	Silent	SNP	25225732	25225732	DOCK5	8	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	4646	75
AFF2	2334	broad.mit.edu	37	X	148072810	148072810	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148072810G>A	uc004fcp.2	+	21	4363	c.3884G>A	c.(3883-3885)CGC>CAC	p.R1295H	AFF2_uc004fcq.2_Missense_Mutation_p.R1285H|AFF2_uc004fcr.2_Missense_Mutation_p.R1256H|AFF2_uc011mxb.1_Missense_Mutation_p.R1260H|AFF2_uc004fcs.2_Missense_Mutation_p.R1260H|AFF2_uc011mxc.1_Missense_Mutation_p.R936H	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	1295					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					AATCTTGTCCGCTACGTTCGC	0.527																0.699454	422.257654	428.758432	128	55	KEEP	---	---	---	---	66	72	29	29	-1	capture	Missense_Mutation	SNP	148072810	148072810	AFF2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	357	75
SLC35E4	339665	broad.mit.edu	37	22	31032455	31032455	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31032455delG	uc003ais.1	+	1	663	c.18delG	c.(16-18)CCGfs	p.P6fs	SLC35E4_uc003ait.2_5'UTR	NM_001001479	NP_001001479	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	6						integral to membrane					0						GCTGCCCGCCGGAGCACCATG	0.701																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	31032455	31032455	SLC35E4	22	G	-	-	-	1	0	1	0	1	0	0	0	0	496	39	5	5	14479	75
PIK3CA	5290	broad.mit.edu	37	3	178928087	178928101	+	In_Frame_Del	DEL	GCTGAACCCTATTGG	-	-			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178928087_178928101delGCTGAACCCTATTGG	uc003fjk.2	+	8	1522_1536	c.1365_1379delGCTGAACCCTATTGG	c.(1363-1380)TTGCTGAACCCTATTGGT>TTT	p.455_460LLNPIG>F		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	455_460	C2 PI3K-type.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.N457K(1)|p.G451_L456>V(1)|p.P449_L455del(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TAGAAGATTTGCTGAACCCTATTGGTGTTACTGGA	0.330	Colon(199;1504 1750 3362 26421 31210 32040)		57		621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.15			28	159		---	---	---	---						capture_indel	In_Frame_Del	DEL	178928087	178928101	PIK3CA	3	GCTGAACCCTATTGG	-	-	-	1	0	1	0	1	0	0	0	0	594	46	5	5	11816	75
NAP1L5	266812	broad.mit.edu	37	4	89618484	89618486	+	In_Frame_Del	DEL	TCC	-	-			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89618484_89618486delTCC	uc003hrx.2	-	1	538_540	c.420_422delGGA	c.(418-423)GAGGAA>GAA	p.140_141EE>E	HERC3_uc003hrw.1_Intron|HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_153757	NP_715638	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	140_141	Glu-rich.				nucleosome assembly	nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		gtactcctcttcctcctcctcct	0.369																0.03			8	223		---	---	---	---						capture_indel	In_Frame_Del	DEL	89618484	89618486	NAP1L5	4	TCC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	10068	75
EGFR	1956	broad.mit.edu	37	7	55249010	55249011	+	In_Frame_Ins	INS	-	ACAACCCCC	ACAACCCCC			TCGA-06-0879-01	TCGA-06-0879-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55249010_55249011insACAACCCCC	uc003tqk.2	+	20	2554_2555	c.2308_2309insACAACCCCC	c.(2308-2310)GAC>GACAACCCCCAC	p.773_774insNPH	EGFR_uc010kzg.1_In_Frame_Ins_p.728_729insNPH|EGFR_uc011kco.1_In_Frame_Ins_p.720_721insNPH|uc003tqo.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	773_774	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.H773_V774insNPH(12)|p.V769_D770insASV(12)|p.P772_H773insPR(11)|p.H773R(9)|p.H773_V774insPH(3)|p.H773_V774insH(3)|p.P772_H773insYNP(2)|p.P772_H773insX(2)|p.D770>GY(2)|p.H773Y(2)|p.V769_D770insMASVD(2)|p.V769_D770insGVV(2)|p.H773_V774insGH(1)|p.V769_D770insCV(1)|p.H773_V774insG(1)|p.D770N(1)|p.H773_V774insGNPH(1)|p.D770fs*61(1)|p.D770_P772>ASVDNR(1)|p.H773L(1)|p.V769_D770insGSV(1)|p.V769_D770insDNV(1)|p.P772_H773insDHP(1)|p.P772_H773insTHP(1)|p.P772_H773insDNP(1)|p.H773>NPY(1)|p.P772_H773insQV(1)|p.D770_N771insDG(1)|p.H773_V774>LM(1)|p.D770_N771>AGG(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGCCAGCGTGGACAACCCCCAC	0.649			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.06			26	387		---	---	---	---						capture_indel	In_Frame_Ins	INS	55249010	55249011	EGFR	7	-	ACAACCCCC	ACAACCCCC	ACAACCCCC	1	0	1	1	0	0	0	0	0	533	41	5	5	4922	75
