Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
WDR78	79819	broad.mit.edu	37	1	67313167	67313167	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67313167C>T	uc001dcx.2	-	8	1347	c.1291G>A	c.(1291-1293)GAA>AAA	p.E431K	WDR78_uc001dcy.2_Missense_Mutation_p.E431K|WDR78_uc009waw.2_Missense_Mutation_p.E177K|WDR78_uc009wax.2_RNA	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1	431	Glu-rich.									ovary(2)	2						TTTTAAATACCTTTTAAAACA	0.199																0.096386	5.13234	18.696383	8	75	KEEP	---	---	---	---	5	5	41	38	-1	capture	Missense_Mutation	SNP	67313167	67313167	WDR78	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	17209	91
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254																0.034014	-25.149617	9.618965	5	142	KEEP	---	---	---	---	4	3	107	94	-1	capture	Missense_Mutation	SNP	145367767	145367767	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10100	91
FLG	2312	broad.mit.edu	37	1	152278655	152278655	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152278655C>T	uc001ezu.1	-	3	8743	c.8707G>A	c.(8707-8709)GAC>AAC	p.D2903N		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2903	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTCAGAGTCTTCTGAATGT	0.562												Ichthyosis				0.215652	297.299331	340.199781	124	451	KEEP	---	---	---	---	99	100	391	409	-1	capture	Missense_Mutation	SNP	152278655	152278655	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	5867	91
OR2W3	343171	broad.mit.edu	37	1	248059605	248059605	+	Silent	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248059605C>T	uc001idp.1	+	3	986	c.717C>T	c.(715-717)GGC>GGT	p.G239G	OR2W3_uc010pzb.1_Silent_p.G239G	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGGCCTTCGGCACCTGCGGCT	0.522																0.444444	300.150679	300.806387	108	135	KEEP	---	---	---	---	53	67	82	73	-1	capture	Silent	SNP	248059605	248059605	OR2W3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	10937	91
GYLTL1B	120071	broad.mit.edu	37	11	45945056	45945056	+	Silent	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45945056T>C	uc001nbv.1	+	3	429	c.318T>C	c.(316-318)CAT>CAC	p.H106H	GYLTL1B_uc001nbw.1_Silent_p.H75H|GYLTL1B_uc001nbx.1_Silent_p.H106H|GYLTL1B_uc001nby.1_5'Flank	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	106	Lumenal (Potential).				muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		GTGCGGGGCATAACTCCAGCC	0.627																0.717949	103.118326	104.786236	28	11	KEEP	---	---	---	---	13	20	7	7	-1	capture	Silent	SNP	45945056	45945056	GYLTL1B	11	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	6836	91
AMBRA1	55626	broad.mit.edu	37	11	46568697	46568697	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46568697C>A	uc010rgu.1	-	4	704	c.344G>T	c.(343-345)TGC>TTC	p.C115F	AMBRA1_uc009ylc.1_Missense_Mutation_p.C115F|AMBRA1_uc001ncu.1_Missense_Mutation_p.C115F|AMBRA1_uc001ncv.2_Missense_Mutation_p.C115F|AMBRA1_uc001ncw.2_Missense_Mutation_p.C115F|AMBRA1_uc001ncx.2_Missense_Mutation_p.C115F	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated	115	WD 2.				autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CCCATCTAGGCAGCCAGAAGC	0.408																0.770833	249.396133	255.850175	74	22	KEEP	---	---	---	---	38	44	10	13	0.536585365854	capture	Missense_Mutation	SNP	46568697	46568697	AMBRA1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	565	91
DDB2	1643	broad.mit.edu	37	11	47254492	47254492	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47254492C>T	uc001neb.2	+	4	779	c.584C>T	c.(583-585)GCC>GTC	p.A195V	DDB2_uc001nec.2_RNA|DDB2_uc009yli.1_Missense_Mutation_p.A131V|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Missense_Mutation_p.A59V|DDB2_uc001neh.2_RNA	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2	195	WD 2.				nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						CGAGTTTTTGCCAGCTCAGAC	0.453					171	Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				0.02	-44.859323	6.806357	4	196	KEEP	---	---	---	---	5	1	117	109	-1	capture	Missense_Mutation	SNP	47254492	47254492	DDB2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4283	91
INTS5	80789	broad.mit.edu	37	11	62416142	62416142	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62416142C>A	uc001nud.2	-	2	1463	c.1410G>T	c.(1408-1410)TTG>TTT	p.L470F	GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	470					snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						AAAAGGGCACCAAGCGGGGAG	0.592																0.734177	189.579425	193.490378	58	21	KEEP	---	---	---	---	30	32	9	15	0.516129032258	capture	Missense_Mutation	SNP	62416142	62416142	INTS5	11	C	A	A	A	1	0	0	0	0	1	0	0	0	272	21	4	4	7704	91
KCNK4	50801	broad.mit.edu	37	11	64064379	64064379	+	Silent	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64064379G>A	uc001nzj.1	+	3	542	c.219G>A	c.(217-219)GCG>GCA	p.A73A	KCNK4_uc009ypl.1_Missense_Mutation_p.R7Q|KCNK4_uc001nzk.1_Missense_Mutation_p.R7Q|KCNK4_uc010rnk.1_5'UTR|KCNK4_uc001nzl.1_Missense_Mutation_p.R7Q|KCNK4_uc001nzm.3_RNA|KCNK4_uc001nzn.1_Silent_p.A73A|KCNK4_uc001nzo.2_Silent_p.A73A|KCNK4_uc001nzp.1_5'UTR	NM_033310	NP_201567	Q9NYG8	KCNK4_HUMAN	TRAAK	73						integral to membrane	potassium channel activity|voltage-gated ion channel activity				0						GAGGGGGTGCGGACCCAGAAA	0.617																0.357143	69.556018	70.813935	25	45	KEEP	---	---	---	---	13	13	22	27	-1	capture	Silent	SNP	64064379	64064379	KCNK4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7990	91
IRAK3	11213	broad.mit.edu	37	12	66597538	66597538	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:66597538T>C	uc001sth.2	+	2	283	c.181T>C	c.(181-183)TAT>CAT	p.Y61H	IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3	61	Death.				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		TATTGAAAAGTATGTAGACCA	0.398					206											0.525424	233.763702	233.830621	62	56	KEEP	---	---	---	---	46	21	34	28	-1	capture	Missense_Mutation	SNP	66597538	66597538	IRAK3	12	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	7747	91
STK24	8428	broad.mit.edu	37	13	99127230	99127230	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99127230C>T	uc001vnm.1	-	5	713	c.478G>A	c.(478-480)GCC>ACC	p.A160T	STK24_uc001vnn.1_Missense_Mutation_p.A148T|STK24_uc010tim.1_Missense_Mutation_p.A129T	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a	160	Protein kinase.				cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			AGGACGTTGGCCGCTGCAAAA	0.627																0.078125	-1.872746	9.779201	5	59	KEEP	---	---	---	---	1	5	44	36	-1	capture	Missense_Mutation	SNP	99127230	99127230	STK24	13	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15183	91
POTEG	404785	broad.mit.edu	37	14	19566050	19566050	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19566050T>C	uc001vuz.1	+	6	1146	c.1094T>C	c.(1093-1095)ATG>ACG	p.M365T	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA|uc001vvb.2_Intron	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	365				M -> I (in Ref. 1; AAS58868).						ovary(1)	1						GAAAAACAGATGCTAAAAGTC	0.229																0.040609	-27.662907	17.173817	8	189	KEEP	---	---	---	---	3	7	109	119	-1	capture	Missense_Mutation	SNP	19566050	19566050	POTEG	14	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	12167	91
NFATC4	4776	broad.mit.edu	37	14	24838971	24838971	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24838971C>T	uc001wpc.2	+	2	688	c.367C>T	c.(367-369)CCC>TCC	p.P123S	NFATC4_uc010tok.1_Missense_Mutation_p.P186S|NFATC4_uc010tol.1_Missense_Mutation_p.P186S|NFATC4_uc010alr.2_Missense_Mutation_p.P186S|NFATC4_uc010als.2_Missense_Mutation_p.P136S|NFATC4_uc010tom.1_Missense_Mutation_p.P136S|NFATC4_uc010ton.1_Missense_Mutation_p.P136S|NFATC4_uc010too.1_Missense_Mutation_p.P136S|NFATC4_uc010alt.2_Missense_Mutation_p.P155S|NFATC4_uc010top.1_Missense_Mutation_p.P155S|NFATC4_uc010toq.1_Missense_Mutation_p.P155S|NFATC4_uc010alu.2_Intron|NFATC4_uc010tor.1_Missense_Mutation_p.P123S|NFATC4_uc010tos.1_Missense_Mutation_p.P53S|NFATC4_uc010tot.1_Missense_Mutation_p.P111S|NFATC4_uc010tou.1_Missense_Mutation_p.P53S|NFATC4_uc010tov.1_Missense_Mutation_p.P111S|NFATC4_uc010tow.1_Missense_Mutation_p.P53S|NFATC4_uc010alv.2_Missense_Mutation_p.P111S|NFATC4_uc010tox.1_Missense_Mutation_p.P53S	NM_004554	NP_004545	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells,	123	Pro-rich.				cell differentiation|inflammatory response|transcription from RNA polymerase II promoter	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(265;0.018)		CTCCATCTCTCCCACGCCGGA	0.577																0.5	21.044702	21.044702	7	7	KEEP	---	---	---	---	4	5	4	5	-1	capture	Missense_Mutation	SNP	24838971	24838971	NFATC4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	10272	91
MLH3	27030	broad.mit.edu	37	14	75514227	75514227	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75514227G>C	uc001xrd.1	-	2	2348	c.2132C>G	c.(2131-2133)TCT>TGT	p.S711C	MLH3_uc001xre.1_Missense_Mutation_p.S711C|MLH3_uc010tuy.1_RNA	NM_001040108	NP_001035197	Q9UHC1	MLH3_HUMAN	mutL homolog 3 isoform 1	711					mismatch repair|reciprocal meiotic recombination	chiasma|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|mismatched DNA binding|protein binding|satellite DNA binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GGATGTATCAGATAATATGCA	0.363											MMR					0.461017	498.182722	498.572338	136	159	KEEP	---	---	---	---	58	93	76	98	-1	capture	Missense_Mutation	SNP	75514227	75514227	MLH3	14	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	9530	91
PKD1L2	114780	broad.mit.edu	37	16	81134885	81134885	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81134885G>A	uc002fgh.1	-	45	7223	c.7223C>T	c.(7222-7224)TCG>TTG	p.S2408L	PKD1L2_uc002fgf.1_Missense_Mutation_p.S208L|PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	2408	Extracellular (Potential).|Interaction with GNAS and GNAI1.				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CCCTTCCTCCGACAGCTGCAA	0.443																0.536585	70.551328	70.598888	22	19	KEEP	---	---	---	---	9	18	7	17	-1	capture	Missense_Mutation	SNP	81134885	81134885	PKD1L2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11868	91
TP53	7157	broad.mit.edu	37	17	7578524	7578524	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578524G>C	uc002gim.2	-	5	600	c.406C>G	c.(406-408)CAA>GAA	p.Q136E	TP53_uc002gig.1_Missense_Mutation_p.Q136E|TP53_uc002gih.2_Missense_Mutation_p.Q136E|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Q4E|TP53_uc010cng.1_Missense_Mutation_p.Q4E|TP53_uc002gii.1_Missense_Mutation_p.Q4E|TP53_uc010cnh.1_Missense_Mutation_p.Q136E|TP53_uc010cni.1_Missense_Mutation_p.Q136E|TP53_uc002gij.2_Missense_Mutation_p.Q136E|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Q43E|TP53_uc002gio.2_Missense_Mutation_p.Q4E|TP53_uc010vug.1_Missense_Mutation_p.Q97E	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	136	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> E (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Q136*(28)|p.0?(7)|p.Q136H(5)|p.Q136Q(4)|p.Q136P(3)|p.Q136E(3)|p.N131fs*27(2)|p.Q136fs*13(2)|p.Q136R(2)|p.Q136fs*34(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.Q136K(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.Q136_K139delQLAK(1)|p.C135_Q136insX(1)|p.C135_Q136insXXXXXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTGGCCAGTTGGCAAAACATC	0.562	Pancreas(47;798 1329 9957 10801)		111	p.Q136*(CAOV3-Tumor)|p.Q136fs(K562-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.859375	177.056843	185.028574	55	9	KEEP	---	---	---	---	31	35	5	4	-1	capture	Missense_Mutation	SNP	7578524	7578524	TP53	17	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	16264	91
AMAC1	146861	broad.mit.edu	37	17	33520927	33520927	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33520927G>A	uc002hjd.2	-	1	486	c.400C>T	c.(400-402)CGC>TGC	p.R134C		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	134	DUF6 1.					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		GAACCTTTGCGAACAGTGGCA	0.607																0.411458	234.730092	236.032621	79	113	KEEP	---	---	---	---	59	66	72	98	-1	capture	Missense_Mutation	SNP	33520927	33520927	AMAC1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	559	91
SPATA20	64847	broad.mit.edu	37	17	48626428	48626428	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48626428C>T	uc002irf.2	+	5	634	c.493C>T	c.(493-495)CCC>TCC	p.P165S	SPATA20_uc002irc.2_5'UTR|SPATA20_uc002ire.2_Missense_Mutation_p.P121S|SPATA20_uc002ird.2_Missense_Mutation_p.P181S|SPATA20_uc010wmv.1_Missense_Mutation_p.P191S|SPATA20_uc002irg.2_RNA	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	165					cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CGGGGGCTGGCCCATGAATGT	0.657																0.0625	-2.69091	6.861506	3	45	KEEP	---	---	---	---	0	3	27	33	-1	capture	Missense_Mutation	SNP	48626428	48626428	SPATA20	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14898	91
TYK2	7297	broad.mit.edu	37	19	10473108	10473108	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10473108G>A	uc002moc.3	-	11	1879	c.1501C>T	c.(1501-1503)CGG>TGG	p.R501W	TYK2_uc010dxe.2_Missense_Mutation_p.R316W|TYK2_uc002mod.2_Missense_Mutation_p.R501W	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	501	SH2; atypical.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TTTCGGAGCCGCAAGCTCTGC	0.597					414											0.130435	3.707746	6.765108	3	20	KEEP	---	---	---	---	2	1	7	20	-1	capture	Missense_Mutation	SNP	10473108	10473108	TYK2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	16692	91
ZNF181	339318	broad.mit.edu	37	19	35232200	35232200	+	Missense_Mutation	SNP	T	G	G	rs143797666		TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35232200T>G	uc002nvu.3	+	4	1377	c.914T>G	c.(913-915)GTC>GGC	p.V305G	ZNF181_uc010xsa.1_Missense_Mutation_p.V304G|ZNF181_uc010xsb.1_Missense_Mutation_p.V304G|ZNF181_uc010xsc.1_Missense_Mutation_p.V240G	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	305	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTTAGCCATGTCTCATCACTT	0.413																0.016043	-43.032058	6.558374	3	184	KEEP	---	---	---	---	2	2	91	104	-1	capture	Missense_Mutation	SNP	35232200	35232200	ZNF181	19	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	17629	91
C2orf55	343990	broad.mit.edu	37	2	99438353	99438353	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99438353T>C	uc002szf.1	-	7	2677	c.2383A>G	c.(2383-2385)ACG>GCG	p.T795A		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	795	Pro-rich.										0						TTCTCCGCCGTCCTGGGCTCC	0.721																0.366667	35.414204	35.884183	11	19	KEEP	---	---	---	---	7	9	9	14	-1	capture	Missense_Mutation	SNP	99438353	99438353	C2orf55	2	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	2156	91
ST6GAL2	84620	broad.mit.edu	37	2	107460277	107460277	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107460277G>A	uc002tdq.2	-	2	276	c.157C>T	c.(157-159)CCG>TCG	p.P53S	ST6GAL2_uc002tdr.2_Missense_Mutation_p.P53S|ST6GAL2_uc002tds.3_Missense_Mutation_p.P53S	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	53	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						CCCTGCACCGGCAGGAGCCTC	0.682																0.081633	-0.13282	8.596054	4	45	KEEP	---	---	---	---	3	1	36	28	-1	capture	Missense_Mutation	SNP	107460277	107460277	ST6GAL2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15112	91
RIF1	55183	broad.mit.edu	37	2	152322631	152322631	+	Silent	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152322631T>C	uc002txm.2	+	30	6727	c.6597T>C	c.(6595-6597)AAT>AAC	p.N2199N	RIF1_uc002txl.2_Silent_p.N2199N|RIF1_uc002txn.2_Silent_p.N2199N|RIF1_uc002txo.2_Silent_p.N2199N|RIF1_uc002txp.2_RNA	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	2199	Interaction with condensed chromosomes in telophase.				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CACCTGTTAATAAGGTAAGGG	0.398					950											0.415385	295.062251	296.275695	81	114	KEEP	---	---	---	---	45	46	66	68	-1	capture	Silent	SNP	152322631	152322631	RIF1	2	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	13251	91
IDH1	3417	broad.mit.edu	37	2	209113112	209113112	+	Missense_Mutation	SNP	C	T	T	rs121913500		TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209113112C>T	uc002vcs.2	-	4	641	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.2_Missense_Mutation_p.R132H|IDH1_uc002vcu.2_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(2023)|p.R132C(344)|p.R132?(210)|p.R132G(117)|p.R132S(79)|p.R132L(58)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		ATAAGCATGACGACCTATGAT	0.393	Pancreas(158;264 1958 3300 35450 36047)				134	Mis		gliobastoma 								0.464789	197.435862	197.589134	66	76	KEEP	---	---	---	---	36	35	45	40	-1	capture	Missense_Mutation	SNP	209113112	209113112	IDH1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7419	91
RUFY4	285180	broad.mit.edu	37	2	218940356	218940356	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:218940356G>A	uc002vgw.2	+	10	2466	c.622G>A	c.(622-624)GCA>ACA	p.A208T	RUFY4_uc002vgy.1_RNA|RUFY4_uc010fvl.1_Missense_Mutation_p.A208T	NM_198483	NP_940885	Q6ZNE9	RUFY4_HUMAN	RUN and FYVE domain containing 4	381							metal ion binding			pancreas(1)	1		Renal(207;0.0915)		Epithelial(149;4.11e-06)|all cancers(144;0.000519)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TCAGGGACACGCAACAAAGGA	0.622																0.433333	79.14204	79.374275	26	34	KEEP	---	---	---	---	9	20	18	20	-1	capture	Missense_Mutation	SNP	218940356	218940356	RUFY4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13633	91
CHRND	1144	broad.mit.edu	37	2	233392979	233392979	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233392979C>A	uc002vsw.2	+	4	255	c.251C>A	c.(250-252)ACA>AAA	p.T84K	CHRND_uc010zmg.1_Missense_Mutation_p.T69K|CHRND_uc010fyc.2_5'UTR|CHRND_uc010zmh.1_5'UTR	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta	84	Extracellular (Potential).				muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)		CAGGGCTGGACAGACAACCGG	0.577																0.493333	121.971882	121.974811	37	38	KEEP	---	---	---	---	21	20	22	22	0.487804878049	capture	Missense_Mutation	SNP	233392979	233392979	CHRND	2	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	3359	91
FARP2	9855	broad.mit.edu	37	2	242423744	242423744	+	Silent	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242423744C>T	uc002wbi.1	+	21	2536	c.2419C>T	c.(2419-2421)CTG>TTG	p.L807L		NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	807	PH 1.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CCAAGGCATGCTGGTGAGTGG	0.587																0.041237	-13.289397	8.672837	4	93	KEEP	---	---	---	---	2	2	50	65	-1	capture	Silent	SNP	242423744	242423744	FARP2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	5623	91
CDH4	1002	broad.mit.edu	37	20	60504710	60504710	+	Silent	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60504710C>T	uc002ybn.1	+	13	2063	c.2049C>T	c.(2047-2049)GCC>GCT	p.A683A	CDH4_uc002ybp.1_Silent_p.A609A	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	683	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACCTGGAGGCCGGGATGTATG	0.547																0.08547	4.920846	25.248032	10	107	KEEP	---	---	---	---	7	5	71	58	-1	capture	Silent	SNP	60504710	60504710	CDH4	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3083	91
C21orf29	54084	broad.mit.edu	37	21	45987844	45987845	+	Missense_Mutation	DNP	CC	AG	AG			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45987844_45987845CC>AG	uc002zfe.1	-	2	193_194	c.127_128GG>CT	c.(127-129)GGC>CTC	p.G43L	C21orf29_uc010gpv.1_5'UTR	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	43					cell adhesion	extracellular region	structural molecule activity				0						GCTTGTGGCGCCATCAGAAGGG	0.604																0.077922	0.720944	14.717321	6	71	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	45987844	45987845	C21orf29	21	CC	AG	AG	AG	1	0	0	0	0	1	0	0	0	338	26	4	4	2105	91
KRTAP12-4	386684	broad.mit.edu	37	21	46074201	46074201	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46074201C>T	uc002zfs.1	-	1	376	c.331G>A	c.(331-333)GGC>AGC	p.G111S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198698	NP_941971	P60329	KR124_HUMAN	keratin associated protein 12-4	111						keratin filament				ovary(1)	1						GCTCAGCAGCCAGTGGGGGTG	0.622																0.462687	96.821497	96.902181	31	36	KEEP	---	---	---	---	14	24	20	25	-1	capture	Missense_Mutation	SNP	46074201	46074201	KRTAP12-4	21	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	8441	91
DLEC1	9940	broad.mit.edu	37	3	38151764	38151764	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38151764G>C	uc003cho.1	+	23	3456	c.3435G>C	c.(3433-3435)AAG>AAC	p.K1145N	DLEC1_uc003chp.1_Missense_Mutation_p.K1145N|DLEC1_uc010hgv.1_Missense_Mutation_p.K1148N|DLEC1_uc003chr.1_Missense_Mutation_p.K251N|DLEC1_uc010hgx.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	1145					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TGAGCAAAAAGACCAGCCTGT	0.542																0.052632	-13.733234	6.397851	5	90	KEEP	---	---	---	---	3	8	79	71	-1	capture	Missense_Mutation	SNP	38151764	38151764	DLEC1	3	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	4510	91
CCR3	1232	broad.mit.edu	37	3	46307517	46307517	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:46307517G>A	uc003cpg.1	+	4	1411	c.868G>A	c.(868-870)GCC>ACC	p.A290T	CCR3_uc003cpi.1_Missense_Mutation_p.A290T|CCR3_uc003cpj.1_Missense_Mutation_p.A290T|CCR3_uc003cpk.1_Missense_Mutation_p.A311T|CCR3_uc010hjb.1_Missense_Mutation_p.A308T|CCR3_uc003cpl.1_Missense_Mutation_p.A323T	NM_178329	NP_847899	P51677	CCR3_HUMAN	CC chemokine receptor 3 isoform 1	290	Helical; Name=7; (Potential).				cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		AGAGGTGATCGCCTACTCCCA	0.522					19											0.044444	-20.060611	9.9217	6	129	KEEP	---	---	---	---	2	4	62	76	-1	capture	Missense_Mutation	SNP	46307517	46307517	CCR3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2913	91
DNAH1	25981	broad.mit.edu	37	3	52417902	52417902	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52417902G>A	uc011bef.1	+	52	8438	c.8177G>A	c.(8176-8178)CGT>CAT	p.R2726H	DNAH1_uc003ddv.2_5'Flank	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2726	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTCCGAGCTCGTCTGAGGCAG	0.587																0.139535	8.719884	14.118748	6	37	KEEP	---	---	---	---	3	3	39	7	-1	capture	Missense_Mutation	SNP	52417902	52417902	DNAH1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4555	91
PPP2R3A	5523	broad.mit.edu	37	3	135721982	135721982	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:135721982G>A	uc003eqv.1	+	2	2207	c.1642G>A	c.(1642-1644)GGT>AGT	p.G548S	PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	548					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						TCAGTTGACCGGTCAGACCCT	0.398																0.351351	156.661577	159.54352	52	96	KEEP	---	---	---	---	29	24	45	52	-1	capture	Missense_Mutation	SNP	135721982	135721982	PPP2R3A	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12289	91
PIK3CA	5290	broad.mit.edu	37	3	178936083	178936083	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936083A>T	uc003fjk.2	+	10	1782	c.1625A>T	c.(1624-1626)GAA>GTA	p.E542V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CCTCTCTCTGAAATCACTGAG	0.333	Colon(199;1504 1750 3362 26421 31210 32040)		57		621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.351852	51.707396	52.753326	19	35	KEEP	---	---	---	---	12	10	17	23	-1	capture	Missense_Mutation	SNP	178936083	178936083	PIK3CA	3	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	11816	91
LEPREL1	55214	broad.mit.edu	37	3	189681756	189681756	+	Silent	SNP	A	G	G			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189681756A>G	uc011bsk.1	-	14	2413	c.2025T>C	c.(2023-2025)TAT>TAC	p.Y675Y	LEPREL1_uc003fsg.2_Silent_p.Y494Y	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a	675					collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCAATTCTCTATAAAGTGGGT	0.483																0.490476	382.371768	382.389252	103	107	KEEP	---	---	---	---	55	62	69	53	-1	capture	Silent	SNP	189681756	189681756	LEPREL1	3	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	8650	91
ADAMTS16	170690	broad.mit.edu	37	5	5239938	5239938	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5239938G>A	uc003jdl.2	+	16	2561	c.2423G>A	c.(2422-2424)CGG>CAG	p.R808Q	ADAMTS16_uc003jdk.1_Missense_Mutation_p.R808Q	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	808	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TGGCCCGGCCGGTACAAATTT	0.512																0.018957	-48.46423	6.415613	4	207	KEEP	---	---	---	---	4	1	102	124	-1	capture	Missense_Mutation	SNP	5239938	5239938	ADAMTS16	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	261	91
SKP2	6502	broad.mit.edu	37	5	36171807	36171807	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36171807C>A	uc003jkc.1	+	7	1055	c.873C>A	c.(871-873)AGC>AGA	p.S291R	SKP2_uc011cou.1_Missense_Mutation_p.S77R|SKP2_uc003jkd.2_Missense_Mutation_p.S291R	NM_005983	NP_005974	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2 isoform 1	291	LRR 6.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|G1/S transition of mitotic cell cycle|S phase of mitotic cell cycle	nucleoplasm|SCF ubiquitin ligase complex	protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGAATCTTAGCGGCTACAGAA	0.463					161											0.016667	-56.898035	6.50499	4	236	KEEP	---	---	---	---	3	1	124	128	0.25	capture	Missense_Mutation	SNP	36171807	36171807	SKP2	5	C	A	A	A	1	0	0	0	0	1	0	0	0	350	27	4	4	14255	91
HCN1	348980	broad.mit.edu	37	5	45695974	45695974	+	Silent	SNP	G	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45695974G>C	uc003jok.2	-	1	247	c.222C>G	c.(220-222)GGC>GGG	p.G74G		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	74	Cytoplasmic (Potential).|Gly-rich.					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CCGGCTCCTcgccgccgccgc	0.423																0.375	10.823234	10.932916	3	5	KEEP	---	---	---	---	8	4	2	4	-1	capture	Silent	SNP	45695974	45695974	HCN1	5	G	C	C	C	1	0	0	0	0	0	0	0	1	483	38	4	4	6922	91
MAP3K1	4214	broad.mit.edu	37	5	56177898	56177898	+	Silent	SNP	A	G	G			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56177898A>G	uc003jqw.3	+	14	3372	c.2871A>G	c.(2869-2871)CAA>CAG	p.Q957Q		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	957					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAATGGTTCAAACAAAAGGCA	0.398					201											0.44375	263.912089	264.352121	71	89	KEEP	---	---	---	---	33	42	34	58	-1	capture	Silent	SNP	56177898	56177898	MAP3K1	5	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	9157	91
ELOVL7	79993	broad.mit.edu	37	5	60053463	60053463	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:60053463C>T	uc003jsi.3	-	8	709	c.509G>A	c.(508-510)GGA>GAA	p.G170E	ELOVL7_uc011cqo.1_Missense_Mutation_p.G83E|ELOVL7_uc010iwk.2_Missense_Mutation_p.G170E|ELOVL7_uc003jsj.3_Missense_Mutation_p.G157E	NM_024930	NP_079206	A1L3X0	ELOV7_HUMAN	elongation of very long chain fatty acids-like	170					fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0		Lung NSC(810;2.56e-06)|Prostate(74;0.0115)|Breast(144;0.0244)|Ovarian(174;0.0481)				ATGGAATGTTCCCAAACCACC	0.378																0.430769	86.190131	86.461778	28	37	KEEP	---	---	---	---	12	20	24	18	-1	capture	Missense_Mutation	SNP	60053463	60053463	ELOVL7	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	5034	91
KCNK16	83795	broad.mit.edu	37	6	39285601	39285601	+	Silent	SNP	G	A	A	rs79043904		TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39285601G>A	uc003ooq.2	-	3	470	c.456C>T	c.(454-456)GCC>GCT	p.A152A	KCNK16_uc003oor.3_Silent_p.A152A|KCNK16_uc010jwy.2_Silent_p.A152A|KCNK16_uc011dtz.1_Silent_p.A152A	NM_032115	NP_115491	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	152	Cytoplasmic (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(1)	3						TTTCAATGGCGGCCAGATGGG	0.552																0.736842	48.759278	49.724159	14	5	KEEP	---	---	---	---	8	9	7	7	-1	capture	Silent	SNP	39285601	39285601	KCNK16	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7985	91
AVL9	23080	broad.mit.edu	37	7	32598232	32598232	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:32598232T>C	uc003tcv.1	+	9	817	c.671T>C	c.(670-672)CTT>CCT	p.L224P	AVL9_uc011kai.1_Missense_Mutation_p.L224P|AVL9_uc010kwj.1_Missense_Mutation_p.L65P	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	224	Helical; (Potential).					integral to membrane					0						GTGTTATCCCTTTTTCCAGGT	0.328																0.018433	-47.304666	9.352929	4	213	KEEP	---	---	---	---	2	3	121	125	-1	capture	Missense_Mutation	SNP	32598232	32598232	AVL9	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	1218	91
ABCB4	5244	broad.mit.edu	37	7	87069034	87069034	+	Silent	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87069034C>T	uc003uiv.1	-	14	1756	c.1680G>A	c.(1678-1680)ACG>ACA	p.T560T	ABCB4_uc003uiw.1_Silent_p.T560T|ABCB4_uc003uix.1_Silent_p.T560T	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	560	ABC transporter 1.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					CCAATGCTGACGTGGCCTCAT	0.537																0.420765	219.982421	220.996602	77	106	KEEP	---	---	---	---	51	38	61	57	-1	capture	Silent	SNP	87069034	87069034	ABCB4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	43	91
ABCB1	5243	broad.mit.edu	37	7	87133728	87133728	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87133728C>T	uc003uiz.1	-	29	4092	c.3674G>A	c.(3673-3675)CGC>CAC	p.R1225H	ABCB1_uc011khc.1_Missense_Mutation_p.R1161H	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	1225	Cytoplasmic (Potential).|ABC transporter 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AATGCAGGTGCGGCCTTCTCT	0.453																0.036765	-21.233986	10.388518	5	131	KEEP	---	---	---	---	3	5	84	73	-1	capture	Missense_Mutation	SNP	87133728	87133728	ABCB1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	40	91
LRRC6	23639	broad.mit.edu	37	8	133584685	133584685	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133584685A>T	uc003ytk.2	-	12	1344	c.1270T>A	c.(1270-1272)TCA>ACA	p.S424T	LRRC6_uc003ytl.2_RNA	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6	424						cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TCAGGGAATGAGTGCTTGCTA	0.373																0.100358	20.779596	65.290397	28	251	KEEP	---	---	---	---	17	14	134	153	-1	capture	Missense_Mutation	SNP	133584685	133584685	LRRC6	8	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	8931	91
NDRG1	10397	broad.mit.edu	37	8	134258899	134258899	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134258899C>T	uc003yuh.2	-	13	1401	c.815G>A	c.(814-816)TGC>TAC	p.C272Y	NDRG1_uc003yue.1_5'Flank|NDRG1_uc003yuf.1_Missense_Mutation_p.C83Y|NDRG1_uc003yug.2_Missense_Mutation_p.C272Y|NDRG1_uc010mee.2_Missense_Mutation_p.C191Y|NDRG1_uc010mef.2_Missense_Mutation_p.C206Y|NDRG1_uc011ljh.1_Missense_Mutation_p.C100Y|NDRG1_uc011lji.1_Missense_Mutation_p.C19Y	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	272					cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TTTTGAGTTGCACTCCACCTG	0.473																0.461538	245.267767	245.503555	84	98	KEEP	---	---	---	---	52	51	62	56	-1	capture	Missense_Mutation	SNP	134258899	134258899	NDRG1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	10158	91
RASEF	158158	broad.mit.edu	37	9	85615141	85615141	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:85615141T>C	uc004amo.1	-	12	1927	c.1666A>G	c.(1666-1668)AGT>GGT	p.S556G		NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	556					protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						ATGAGGAAACTAGACTTCCCC	0.458																0.449275	343.977825	344.437405	93	114	KEEP	---	---	---	---	55	49	61	63	-1	capture	Missense_Mutation	SNP	85615141	85615141	RASEF	9	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	12963	91
CDKL5	6792	broad.mit.edu	37	X	18597977	18597977	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18597977G>A	uc004cym.2	+	6	545	c.292G>A	c.(292-294)GAA>AAA	p.E98K	CDKL5_uc004cyn.2_Missense_Mutation_p.E98K	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	98	Protein kinase.				neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					GAATATGCTCGAATTGCTGGA	0.328					244											0.656863	222.650355	224.866537	67	35	KEEP	---	---	---	---	36	39	15	21	-1	capture	Missense_Mutation	SNP	18597977	18597977	CDKL5	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3127	91
ZNF81	347344	broad.mit.edu	37	X	47775519	47775519	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47775519C>A	uc010nhy.1	+	6	1842	c.1474C>A	c.(1474-1476)CAT>AAT	p.H492N		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	492	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)				TAAGAGAATTCATACAGGAGA	0.413																0.188889	33.815343	41.973683	17	73	KEEP	---	---	---	---	7	10	46	37	0.588235294118	capture	Missense_Mutation	SNP	47775519	47775519	ZNF81	23	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	18050	91
SPEN	23013	broad.mit.edu	37	1	16255142	16255143	+	Frame_Shift_Del	DEL	GA	-	-			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16255142_16255143delGA	uc001axk.1	+	11	2611_2612	c.2407_2408delGA	c.(2407-2409)GAGfs	p.E803fs	SPEN_uc010obp.1_Frame_Shift_Del_p.E762fs	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	803	Arg-rich.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAGAGAGTGGAGAGAGAGAGA	0.431					551											0.03			7	199		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	16255142	16255143	SPEN	1	GA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	14930	91
ATRX	546	broad.mit.edu	37	X	76909633	76909636	+	Frame_Shift_Del	DEL	TTTC	-	-			TCGA-06-2570-01	TCGA-06-2570-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76909633_76909636delTTTC	uc004ecp.3	-	14	4501_4504	c.4269_4272delGAAA	c.(4267-4272)AAGAAAfs	p.K1423fs	ATRX_uc004ecq.3_Frame_Shift_Del_p.K1385fs|ATRX_uc004eco.3_Frame_Shift_Del_p.K1208fs|ATRX_uc004ecr.2_Frame_Shift_Del_p.K1355fs	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1423_1424					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TACGTCGCCTTTTCTTTTTCTGTT	0.328					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.74			81	29		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	76909633	76909636	ATRX	23	TTTC	-	-	-	1	0	1	0	1	0	0	0	0	829	64	5	5	1199	91
