Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CYP4B1	1580	broad.mit.edu	37	1	47278284	47278284	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47278284C>T	uc001cqm.3	+	4	568	c.484C>T	c.(484-486)CGT>TGT	p.R162C	CYP4B1_uc009vyl.1_Translation_Start_Site|CYP4B1_uc001cqn.3_Missense_Mutation_p.R162C|CYP4B1_uc009vym.2_Missense_Mutation_p.R147C|CYP4B1_uc010omk.1_Translation_Start_Site|CYP4B1_uc010oml.1_Translation_Start_Site	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	162					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					TGAGTCTACACGTATCATGCT	0.567																0.098214	6.343028	24.436506	11	101	KEEP	---	---	---	---	8	4	68	48	-1	capture	Missense_Mutation	SNP	47278284	47278284	CYP4B1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4145	97
HRNR	388697	broad.mit.edu	37	1	152187706	152187706	+	Silent	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152187706G>A	uc001ezt.1	-	3	6475	c.6399C>T	c.(6397-6399)TAC>TAT	p.Y2133Y		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2133					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGTGTTGTCCGTAGCCAGAGG	0.567																0.032949	-111.727781	32.836363	20	587	KEEP	---	---	---	---	16	18	449	516	-1	capture	Silent	SNP	152187706	152187706	HRNR	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7284	97
S100A8	6279	broad.mit.edu	37	1	153362715	153362715	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153362715T>C	uc001fbs.2	-	3	201	c.146A>G	c.(145-147)AAG>AGG	p.K49R		NM_002964	NP_002955	P05109	S10A8_HUMAN	S100 calcium-binding protein A8	49	EF-hand 2.				chemotaxis	cytoplasm|cytoskeleton|plasma membrane	calcium ion binding|protein binding				0	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCTGCACCCTTTTTCTGTCA	0.507																0.012146	-60.876617	6.393737	3	244	KEEP	---	---	---	---	5	0	125	144	-1	capture	Missense_Mutation	SNP	153362715	153362715	S100A8	1	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	13678	97
KCNK18	338567	broad.mit.edu	37	10	118969028	118969028	+	Missense_Mutation	SNP	G	A	A	rs141958329		TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118969028G>A	uc010qsr.1	+	3	373	c.373G>A	c.(373-375)GTC>ATC	p.V125I		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	125						integral to membrane|plasma membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;0.19)		all cancers(201;0.0211)		CATCTACCCCGTCACCAGGCT	0.507																0.568862	283.182524	283.866481	95	72	KEEP	---	---	---	---	60	64	50	57	-1	capture	Missense_Mutation	SNP	118969028	118969028	KCNK18	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7987	97
ZNF215	7762	broad.mit.edu	37	11	6964441	6964441	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6964441G>A	uc001mey.2	+	5	1199	c.611G>A	c.(610-612)CGT>CAT	p.R204H	ZNF215_uc010raw.1_Intron|ZNF215_uc010rax.1_Intron|ZNF215_uc001mez.1_Missense_Mutation_p.R204H	NM_013250	NP_037382	Q9UL58	ZN215_HUMAN	zinc finger protein 215	204	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		AATTCATTGCGTAAAGGTGGT	0.418																0.29798	160.761397	167.977426	59	139	KEEP	---	---	---	---	31	35	72	83	-1	capture	Missense_Mutation	SNP	6964441	6964441	ZNF215	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17651	97
OLFML1	283298	broad.mit.edu	37	11	7509544	7509544	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7509544C>T	uc001mfi.2	+	2	668	c.316C>T	c.(316-318)CGA>TGA	p.R106*	uc001mff.1_Intron|OLFML1_uc001mfh.1_Nonsense_Mutation_p.R106*|OLFML1_uc010raz.1_Intron|OLFML1_uc010rba.1_Nonsense_Mutation_p.R106*	NM_198474	NP_940876	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1 precursor	106	Potential.					extracellular region				ovary(2)	2				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		ACAATACCTTCGAGAGGCTGA	0.478																0.373333	82.392087	83.444435	28	47	KEEP	---	---	---	---	12	17	19	34	-1	capture	Nonsense_Mutation	SNP	7509544	7509544	OLFML1	11	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	10761	97
OR4P4	81300	broad.mit.edu	37	11	55406751	55406751	+	Silent	SNP	G	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55406751G>T	uc010rij.1	+	1	918	c.918G>T	c.(916-918)CTG>CTT	p.L306L		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AAATACTCCTGAAAAGAAATC	0.398																0.333333	54.078218	55.555146	20	40	KEEP	---	---	---	---	10	11	20	22	0.47619047619	capture	Silent	SNP	55406751	55406751	OR4P4	11	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	10984	97
LRRC55	219527	broad.mit.edu	37	11	56950136	56950136	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56950136C>T	uc001njl.1	+	1	916	c.769C>T	c.(769-771)CGG>TGG	p.R257W		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	227	LRRCT.					integral to membrane					0						GCTGCGAAACCGGATCCAGCG	0.617																0.298507	107.348357	112.21089	40	94	KEEP	---	---	---	---	18	23	63	41	-1	capture	Missense_Mutation	SNP	56950136	56950136	LRRC55	11	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	8926	97
LRP5	4041	broad.mit.edu	37	11	68206026	68206026	+	Silent	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68206026G>A	uc001ont.2	+	20	4299	c.4224G>A	c.(4222-4224)CAG>CAA	p.Q1408Q	LRP5_uc009ysg.2_Silent_p.Q818Q	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	1408	Cytoplasmic (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						TTGTGTGCCAGCGCGTGGTGT	0.652																0.232877	39.23395	44.006091	17	56	KEEP	---	---	---	---	4	14	34	24	-1	capture	Silent	SNP	68206026	68206026	LRP5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	8876	97
KDELC2	143888	broad.mit.edu	37	11	108350192	108350192	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108350192C>T	uc001pkj.2	-	6	1195	c.1129G>A	c.(1129-1131)GTG>ATG	p.V377M	KDELC2_uc001pki.2_Missense_Mutation_p.V321M	NM_153705	NP_714916	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2 precursor	377						endoplasmic reticulum lumen				ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TAAGCAGCCACGGTCCCATCC	0.408																0.3375	79.039612	80.889074	27	53	KEEP	---	---	---	---	16	15	22	34	-1	capture	Missense_Mutation	SNP	108350192	108350192	KDELC2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8040	97
DIAPH3	81624	broad.mit.edu	37	13	60545255	60545256	+	Missense_Mutation	DNP	GA	AT	AT			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:60545255_60545256GA>AT	uc001vht.2	-	16	1908_1909	c.1689_1690TC>AT	c.(1687-1692)CCTCCC>CCATCC	p.P564S	DIAPH3_uc001vhu.2_Missense_Mutation_p.P301S|DIAPH3_uc001vhv.2_Missense_Mutation_p.P142S	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	564	FH1.|Pro-rich.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TCTTTAGAGGGAGGCAAAGGAA	0.495																0.380952	22.994269	23.255575	8	13	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	60545255	60545256	DIAPH3	13	GA	AT	AT	AT	1	0	0	0	0	1	0	0	0	533	41	2	2	4478	97
SLITRK1	114798	broad.mit.edu	37	13	84455310	84455310	+	Silent	SNP	C	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:84455310C>A	uc001vlk.2	-	1	1219	c.333G>T	c.(331-333)CTG>CTT	p.L111L		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	111	Extracellular (Potential).|LRR 3.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TGTTGATGTGCAGCCTTTTCA	0.433																0.242991	64.829698	71.251067	26	81	KEEP	---	---	---	---	13	13	38	48	0.5	capture	Silent	SNP	84455310	84455310	SLITRK1	13	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	14634	97
SLC39A9	55334	broad.mit.edu	37	14	69920026	69920026	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69920026G>A	uc001xle.2	+	4	1152	c.472G>A	c.(472-474)GCT>ACT	p.A158T	SLC39A9_uc010aqx.2_Intron|SLC39A9_uc001xlf.3_Missense_Mutation_p.A158T|SLC39A9_uc001xlg.3_RNA	NM_018375	NP_060845	Q9NUM3	S39A9_HUMAN	solute carrier family 39 (zinc transporter),	158	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)		CCATGCTGCAGGTAGGGTTGG	0.463																0.327869	125.687094	128.87795	40	82	KEEP	---	---	---	---	16	24	41	47	-1	capture	Missense_Mutation	SNP	69920026	69920026	SLC39A9	14	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	14517	97
KRT13	3860	broad.mit.edu	37	17	39659673	39659673	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39659673G>A	uc002hwu.1	-	3	664	c.601C>T	c.(601-603)CGC>TGC	p.R201C	KRT13_uc002hwv.1_Missense_Mutation_p.R201C|KRT13_uc002hww.2_Missense_Mutation_p.R94C|KRT13_uc010wfr.1_Missense_Mutation_p.R94C|KRT13_uc010cxo.2_Missense_Mutation_p.R201C|KRT13_uc002hwx.1_Missense_Mutation_p.R189C	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	201	Coil 1B.|Rod.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				ACGCTCTGGCGCAGGGCCAGC	0.483																0.423423	135.802024	136.370858	47	64	KEEP	---	---	---	---	24	27	39	29	-1	capture	Missense_Mutation	SNP	39659673	39659673	KRT13	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8370	97
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513675T>C	uc010dln.2	-	10	1973	c.1519A>G	c.(1519-1521)AAA>GAA	p.K507E	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	507	Potential.									skin(3)	3						GAATTCATTTTCTTTTCAGCC	0.284																0.027586	-27.93253	7.789157	4	141	KEEP	---	---	---	---	4	1	89	76	-1	capture	Missense_Mutation	SNP	14513675	14513675	POTEC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	12164	97
CNDP2	55748	broad.mit.edu	37	18	72178127	72178127	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72178127C>T	uc002llm.1	+	6	698	c.536C>T	c.(535-537)GCC>GTC	p.A179V	CNDP2_uc002lln.1_Missense_Mutation_p.A95V|CNDP2_uc010dqs.2_Missense_Mutation_p.A15V	NM_018235	NP_060705	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2	179						cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity			ovary(2)|skin(1)	3		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		CTGATTTTTGCCCGGAAAGAC	0.527																0.02454	-34.132865	6.765955	4	159	KEEP	---	---	---	---	1	3	93	88	-1	capture	Missense_Mutation	SNP	72178127	72178127	CNDP2	18	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3559	97
ATG4D	84971	broad.mit.edu	37	19	10657548	10657548	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10657548C>T	uc002mov.2	+	4	647	c.527C>T	c.(526-528)CCC>CTC	p.P176L	ATG4D_uc010xlg.1_Missense_Mutation_p.P199L|ATG4D_uc010xlh.1_Missense_Mutation_p.P113L|ATG4D_uc010dxh.2_RNA|ATG4D_uc010dxi.2_Intron|ATG4D_uc010dxj.2_Intron	NM_032885	NP_116274	Q86TL0	ATG4D_HUMAN	APG4 autophagy 4 homolog D	176					autophagy|protein transport	cytoplasm	cysteine-type endopeptidase activity				0			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GGCCTGGGCCCCCCTGAGCTG	0.657																0.230769	27.975255	31.428214	12	40	KEEP	---	---	---	---	6	6	21	24	-1	capture	Missense_Mutation	SNP	10657548	10657548	ATG4D	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	1090	97
NWD1	284434	broad.mit.edu	37	19	16883984	16883984	+	Missense_Mutation	SNP	G	A	A	rs139109286	by1000genomes	TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16883984G>A	uc002neu.3	+	11	2880	c.2458G>A	c.(2458-2460)GCC>ACC	p.A820T	NWD1_uc002net.3_Missense_Mutation_p.A685T|NWD1_uc002nev.3_Missense_Mutation_p.A614T			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;	820							ATP binding			skin(3)|ovary(2)|pancreas(2)	7						CCATTTCTTCGCCACCTCACA	0.577																0.254054	114.136159	124.294381	47	138	KEEP	---	---	---	---	23	29	79	78	-1	capture	Missense_Mutation	SNP	16883984	16883984	NWD1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10688	97
MEGF8	1954	broad.mit.edu	37	19	42879827	42879827	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42879827G>A	uc002otl.3	+	41	7872	c.7237G>A	c.(7237-7239)GTG>ATG	p.V2413M	MEGF8_uc002otm.3_Missense_Mutation_p.V2021M|MEGF8_uc002otn.3_Missense_Mutation_p.V74M	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2480	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				CCTCTTTGGCGTGCAGCCCAA	0.637																0.466667	20.023286	20.037791	7	8	KEEP	---	---	---	---	6	3	5	3	-1	capture	Missense_Mutation	SNP	42879827	42879827	MEGF8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9376	97
ZNF665	79788	broad.mit.edu	37	19	53668521	53668521	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53668521C>T	uc010eqm.1	-	4	1322	c.1222G>A	c.(1222-1224)GTC>ATC	p.V408I		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	343	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		AAAACCTTGACGCATTCATTA	0.398																0.277487	143.300756	151.805408	53	138	KEEP	---	---	---	---	23	31	89	54	-1	capture	Missense_Mutation	SNP	53668521	53668521	ZNF665	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17951	97
CYTIP	9595	broad.mit.edu	37	2	158300464	158300464	+	Silent	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158300464C>T	uc002tzj.1	-	1	141	c.69G>A	c.(67-69)GCG>GCA	p.A23A	CYTIP_uc010zcl.1_Intron	NM_004288	NP_004279	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	23					regulation of cell adhesion	cell cortex|early endosome	protein binding			ovary(1)|kidney(1)|skin(1)	3						AAGAGCTATACGCTGGCCCAG	0.512																0.335616	135.927905	139.419509	49	97	KEEP	---	---	---	---	32	26	56	51	-1	capture	Silent	SNP	158300464	158300464	CYTIP	2	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4166	97
SGOL2	151246	broad.mit.edu	37	2	201434569	201434569	+	Silent	SNP	A	G	G			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201434569A>G	uc002uvw.2	+	6	770	c.657A>G	c.(655-657)TTA>TTG	p.L219L	SGOL2_uc002uvv.3_Silent_p.L219L|SGOL2_uc010zhd.1_Silent_p.L219L|SGOL2_uc010zhe.1_Silent_p.L219L	NM_152524	NP_689737	Q562F6	SGOL2_HUMAN	shugoshin-like 2 isoform 1	219					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol|mitotic cohesin complex	protein binding			ovary(2)|skin(2)	4						TATATGGTTTAGATGATTCAG	0.303																0.363636	224.556916	227.43453	64	112	KEEP	---	---	---	---	27	41	50	76	-1	capture	Silent	SNP	201434569	201434569	SGOL2	2	A	G	G	G	1	0	0	0	0	0	0	0	1	193	15	3	3	14110	97
COL4A3	1285	broad.mit.edu	37	2	228118844	228118844	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228118844A>G	uc002vom.1	+	14	944	c.782A>G	c.(781-783)AAG>AGG	p.K261R	COL4A3_uc002von.1_Missense_Mutation_p.K261R|COL4A3_uc002voo.1_Missense_Mutation_p.K261R|COL4A3_uc002vop.1_Missense_Mutation_p.K261R|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	261	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AAGGGGGAAAAGGGAGACAAG	0.433																0.021898	-27.896359	7.06654	3	134	KEEP	---	---	---	---	4	0	92	63	-1	capture	Missense_Mutation	SNP	228118844	228118844	COL4A3	2	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	3656	97
SPHKAP	80309	broad.mit.edu	37	2	228884217	228884217	+	Silent	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228884217G>A	uc002vpq.2	-	7	1400	c.1353C>T	c.(1351-1353)GTC>GTT	p.V451V	SPHKAP_uc002vpp.2_Silent_p.V451V|SPHKAP_uc010zlx.1_Silent_p.V451V	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	451						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCTGAACAACGACGATTTTGG	0.507																0.338129	130.777148	134.000352	47	92	KEEP	---	---	---	---	27	24	50	57	-1	capture	Silent	SNP	228884217	228884217	SPHKAP	2	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14940	97
HCK	3055	broad.mit.edu	37	20	30674471	30674471	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30674471G>A	uc002wxh.2	+	9	1047	c.876G>A	c.(874-876)ATG>ATA	p.M292I	HCK_uc010gdy.2_Missense_Mutation_p.M271I|HCK_uc002wxi.2_Missense_Mutation_p.M270I	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	292	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TGAAGACGATGAAGCCAGGGA	0.577					262											0.254902	30.646597	33.429758	13	38	KEEP	---	---	---	---	3	12	19	22	-1	capture	Missense_Mutation	SNP	30674471	30674471	HCK	20	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	6920	97
PPARA	5465	broad.mit.edu	37	22	46594404	46594404	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46594404G>A	uc003bgw.1	+	4	390	c.124G>A	c.(124-126)GGC>AGC	p.G42S	PPARA_uc003bgx.1_Missense_Mutation_p.G42S|PPARA_uc010hab.1_Missense_Mutation_p.G42S|PPARA_uc003bgy.1_RNA|PPARA_uc003bgz.1_RNA|PPARA_uc003bha.2_Missense_Mutation_p.G42S|PPARA_uc003bhb.1_Missense_Mutation_p.G42S|PPARA_uc010hac.1_5'UTR	NM_005036	NP_005027	Q07869	PPARA_HUMAN	peroxisome proliferative activated receptor,	42					fatty acid metabolic process|fatty acid transport|negative regulation of appetite|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fatty acid beta-oxidation|regulation of cellular ketone metabolic process by positive regulation of transcription from an RNA polymerase II promoter|regulation of glycolysis by positive regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|ligand-regulated transcription factor activity|lipid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|ubiquitin conjugating enzyme binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Simvastatin(DB00641)	GCAATCCATCGGCGAGGATAG	0.527					164											0.319527	163.097929	167.984953	54	115	KEEP	---	---	---	---	28	32	64	62	-1	capture	Missense_Mutation	SNP	46594404	46594404	PPARA	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12198	97
DPPA4	55211	broad.mit.edu	37	3	109050752	109050752	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:109050752C>T	uc003dxq.3	-	3	360	c.305G>A	c.(304-306)TGG>TAG	p.W102*	DPPA4_uc011bho.1_Nonsense_Mutation_p.W102*|DPPA4_uc011bhp.1_Nonsense_Mutation_p.W102*	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	102						nucleus	protein binding			upper_aerodigestive_tract(1)	1						TTGTTGGCACCAGGCCCGCAG	0.532																0.402062	237.797203	239.428015	78	116	KEEP	---	---	---	---	38	44	69	61	-1	capture	Nonsense_Mutation	SNP	109050752	109050752	DPPA4	3	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	4691	97
FNDC3B	64778	broad.mit.edu	37	3	172096080	172096080	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172096080G>A	uc003fhy.2	+	24	3201	c.3029G>A	c.(3028-3030)GGA>GAA	p.G1010E	FNDC3B_uc003fhz.3_Missense_Mutation_p.G1010E	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	1010	Fibronectin type-III 8.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ATCTACAGAGGACCCAGCCAC	0.448																0.375	96.787719	97.981101	33	55	KEEP	---	---	---	---	20	19	36	25	-1	capture	Missense_Mutation	SNP	172096080	172096080	FNDC3B	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5914	97
CPZ	8532	broad.mit.edu	37	4	8621243	8621243	+	Missense_Mutation	SNP	C	T	T	rs143690050		TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8621243C>T	uc003glm.2	+	11	1984	c.1858C>T	c.(1858-1860)CGG>TGG	p.R620W	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_Missense_Mutation_p.R483W|CPZ_uc003glo.2_Missense_Mutation_p.R609W|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	620					proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						CGACCCGCTCCGGGCGCGCAG	0.667																0.365385	56.215636	57.04248	19	33	KEEP	---	---	---	---	12	11	17	23	-1	capture	Missense_Mutation	SNP	8621243	8621243	CPZ	4	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	3804	97
ADH1C	126	broad.mit.edu	37	4	100268910	100268910	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100268910G>A	uc003huu.2	-	2	197	c.112C>T	c.(112-114)CGC>TGC	p.R38C		NM_000669	NP_000660	P00326	ADH1G_HUMAN	class I alcohol dehydrogenase, gamma subunit	38					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Fomepizole(DB01213)|NADH(DB00157)	ACCTTAATGCGAACTTCATGA	0.338												Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				0.05	-8.865841	8.317149	4	76	KEEP	---	---	---	---	2	3	42	35	-1	capture	Missense_Mutation	SNP	100268910	100268910	ADH1C	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	309	97
DCHS2	54798	broad.mit.edu	37	4	155249289	155249289	+	Missense_Mutation	SNP	G	A	A	rs111557030	byFrequency	TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155249289G>A	uc003inw.2	-	12	2609	c.2609C>T	c.(2608-2610)CCT>CTT	p.P870L	DCHS2_uc003inx.2_Missense_Mutation_p.P1325L	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	870	Cadherin 7.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCCTTCATCAGGATCCTTTGC	0.348																0.027778	-34.995786	9.278763	5	175	KEEP	---	---	---	---	2	3	102	88	-1	capture	Missense_Mutation	SNP	155249289	155249289	DCHS2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4247	97
ADAMTS16	170690	broad.mit.edu	37	5	5146447	5146447	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5146447C>T	uc003jdl.2	+	3	518	c.380C>T	c.(379-381)ACG>ATG	p.T127M	ADAMTS16_uc003jdk.1_Missense_Mutation_p.T127M|ADAMTS16_uc003jdj.1_Missense_Mutation_p.T127M	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	127					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ATTGTGCAGACGTTGGGAAAG	0.522																0.384615	196.103663	198.228388	70	112	KEEP	---	---	---	---	37	41	52	66	-1	capture	Missense_Mutation	SNP	5146447	5146447	ADAMTS16	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	261	97
ADAMTS16	170690	broad.mit.edu	37	5	5190212	5190212	+	Silent	SNP	T	C	C			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5190212T>C	uc003jdl.2	+	7	1314	c.1176T>C	c.(1174-1176)TGT>TGC	p.C392C	ADAMTS16_uc003jdk.1_Silent_p.C392C|ADAMTS16_uc003jdj.1_Silent_p.C392C	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	392	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TGGATATATGTTCCTGGAAGA	0.527																0.313869	144.380157	148.601127	43	94	KEEP	---	---	---	---	27	19	52	52	-1	capture	Silent	SNP	5190212	5190212	ADAMTS16	5	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	261	97
RASGRF2	5924	broad.mit.edu	37	5	80408515	80408515	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:80408515C>T	uc003kha.1	+	14	1925	c.1925C>T	c.(1924-1926)GCC>GTC	p.A642V	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	642	N-terminal Ras-GEF.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ATCCGTTATGCCAGCGTGGAG	0.483				p.A642G(NCIH510-Tumor)	847											0.014535	-84.30489	7.863986	5	339	KEEP	---	---	---	---	2	4	191	185	-1	capture	Missense_Mutation	SNP	80408515	80408515	RASGRF2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12968	97
PCDHGB2	56103	broad.mit.edu	37	5	140741338	140741338	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140741338G>A	uc003ljs.1	+	1	1636	c.1636G>A	c.(1636-1638)GTG>ATG	p.V546M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGA5_uc003lju.1_5'Flank|PCDHGB2_uc011dar.1_Missense_Mutation_p.V546M|PCDHGA5_uc011das.1_5'Flank	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	546	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCGCCAACGTGAGCCTGCG	0.682																0.432432	96.19932	96.491326	32	42	KEEP	---	---	---	---	20	15	28	16	-1	capture	Missense_Mutation	SNP	140741338	140741338	PCDHGB2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11466	97
TIMD4	91937	broad.mit.edu	37	5	156346519	156346519	+	Silent	SNP	G	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156346519G>T	uc003lwh.2	-	9	1143	c.1086C>A	c.(1084-1086)CTC>CTA	p.L362L	TIMD4_uc010jii.2_Silent_p.L334L|TIMD4_uc003lwg.2_Silent_p.L64L	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	362	Cytoplasmic (Potential).					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCACGTCATTGAGGACATTTT	0.438																0.066038	-6.163819	14.549841	7	99	KEEP	---	---	---	---	5	3	63	47	0.625	capture	Silent	SNP	156346519	156346519	TIMD4	5	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	15788	97
GABRA6	2559	broad.mit.edu	37	5	161116076	161116076	+	Missense_Mutation	SNP	C	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161116076C>A	uc003lyu.2	+	4	685	c.347C>A	c.(346-348)ACC>AAC	p.T116N	GABRA6_uc003lyv.2_5'Flank	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	116	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ACGCCTGACACCTTTTTCAGA	0.418													TCGA Ovarian(5;0.080)			0.25	88.535198	96.713826	36	108	KEEP	---	---	---	---	17	19	58	55	0.527777777778	capture	Missense_Mutation	SNP	161116076	161116076	GABRA6	5	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	6107	97
TMEM63B	55362	broad.mit.edu	37	6	44107303	44107303	+	Silent	SNP	C	T	T	rs145356402		TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44107303C>T	uc003owr.2	+	7	571	c.507C>T	c.(505-507)TCC>TCT	p.S169S	TMEM63B_uc003owq.1_Silent_p.S169S|TMEM63B_uc010jyy.1_Silent_p.S72S|TMEM63B_uc003ows.2_Silent_p.S72S|TMEM63B_uc010jyz.2_5'Flank	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	169	Helical; (Potential).					integral to membrane	nucleotide binding|protein binding	p.S169S(1)		pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			GCGTCCTCTCCGTAGGCATCG	0.627																0.46875	143.773244	143.854192	45	51	KEEP	---	---	---	---	21	26	33	22	-1	capture	Silent	SNP	44107303	44107303	TMEM63B	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16074	97
VNN2	8875	broad.mit.edu	37	6	133078573	133078573	+	Missense_Mutation	SNP	G	A	A	rs149351884		TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:133078573G>A	uc003qdt.2	-	2	337	c.326C>T	c.(325-327)CCG>CTG	p.P109L	VNN2_uc003qds.2_5'UTR|VNN2_uc010kgb.2_Missense_Mutation_p.P109L|VNN2_uc003qdv.2_Missense_Mutation_p.P56L	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	109	CN hydrolase.				cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		GTCTTGACACGGAATCCAGTT	0.418																0.416667	177.295092	178.096609	55	77	KEEP	---	---	---	---	35	28	47	36	-1	capture	Missense_Mutation	SNP	133078573	133078573	VNN2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17065	97
GRM3	2913	broad.mit.edu	37	7	86468833	86468833	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86468833G>A	uc003uid.2	+	4	3102	c.2003G>A	c.(2002-2004)CGC>CAC	p.R668H	GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Missense_Mutation_p.R540H|GRM3_uc010leh.2_Missense_Mutation_p.R260H	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	668	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	TGCATTGCCCGCATCTTCGAT	0.537	GBM(52;969 1098 3139 52280)															0.016502	-72.108579	8.039553	5	298	KEEP	---	---	---	---	2	4	169	146	-1	capture	Missense_Mutation	SNP	86468833	86468833	GRM3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6731	97
ZKSCAN5	23660	broad.mit.edu	37	7	99123821	99123821	+	Silent	SNP	G	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99123821G>T	uc003uqv.2	+	6	1282	c.1158G>T	c.(1156-1158)CGG>CGT	p.R386R	ZKSCAN5_uc010lfx.2_Silent_p.R386R|ZKSCAN5_uc003uqw.2_Silent_p.R386R|ZKSCAN5_uc003uqx.2_Silent_p.R313R|ZKSCAN5_uc003uqy.2_Silent_p.R122R	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	386	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					ACAATCAGCGGGTGCACCTCA	0.537																0.052632	-29.019797	27.186724	14	252	KEEP	---	---	---	---	6	8	121	156	0.428571428571	capture	Silent	SNP	99123821	99123821	ZKSCAN5	7	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	17570	97
KEL	3792	broad.mit.edu	37	7	142658590	142658590	+	Splice_Site	SNP	T	C	C			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142658590T>C	uc003wcb.2	-	3	292	c.82_splice	c.e3-1	p.S28_splice		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					TGGAGTGCTCTGTGGGAGGAA	0.552																0.272727	7.519829	8.032226	3	8	KEEP	---	---	---	---	0	4	6	10	-1	capture	Splice_Site	SNP	142658590	142658590	KEL	7	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	8064	97
DLC1	10395	broad.mit.edu	37	8	12956045	12956045	+	Silent	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:12956045C>T	uc003wwm.2	-	10	3474	c.3030G>A	c.(3028-3030)CGG>CGA	p.R1010R	DLC1_uc003wwk.1_Silent_p.R573R|DLC1_uc003wwl.1_Silent_p.R607R|DLC1_uc011kxx.1_Silent_p.R499R	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	1010					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TGAGGCTTGGCCGATGTGAGC	0.463					739											0.038462	-16.361814	7.554555	4	100	KEEP	---	---	---	---	3	1	49	54	-1	capture	Silent	SNP	12956045	12956045	DLC1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	4508	97
TUSC3	7991	broad.mit.edu	37	8	15519787	15519787	+	Silent	SNP	T	G	G			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:15519787T>G	uc003wwt.2	+	5	900	c.690T>G	c.(688-690)GGT>GGG	p.G230G	TUSC3_uc003wwr.2_Silent_p.G230G|TUSC3_uc003wws.2_Silent_p.G230G|TUSC3_uc003wwu.2_Silent_p.G230G|TUSC3_uc003wwv.2_Silent_p.G230G|TUSC3_uc003www.2_Silent_p.G230G|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Silent_p.G230G	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	230	Helical; (Potential).				cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		ACAAGACTGGTTGGGCCATGG	0.368																0.334495	319.815068	326.770467	96	191	KEEP	---	---	---	---	56	55	114	113	-1	capture	Silent	SNP	15519787	15519787	TUSC3	8	T	G	G	G	1	0	0	0	0	0	0	0	1	769	60	4	4	16660	97
SFTPC	6440	broad.mit.edu	37	8	22020183	22020183	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22020183G>A	uc003xax.3	+	2	297	c.139G>A	c.(139-141)GTC>ATC	p.V47I	SFTPC_uc003xaw.3_Missense_Mutation_p.V96I|SFTPC_uc011kza.1_Missense_Mutation_p.V47I|SFTPC_uc003xaz.2_Missense_Mutation_p.V47I|SFTPC_uc003xay.3_Missense_Mutation_p.V47I|BMP1_uc011kzb.1_5'Flank|BMP1_uc003xba.2_5'Flank|BMP1_uc003xbb.2_5'Flank|BMP1_uc003xbe.2_5'Flank|BMP1_uc003xbc.2_5'Flank|BMP1_uc003xbd.2_5'Flank|BMP1_uc003xbf.2_5'Flank|BMP1_uc003xbg.2_5'Flank|BMP1_uc011kzc.1_5'Flank|BMP1_uc003xbh.2_5'Flank|BMP1_uc003xbi.2_5'Flank	NM_003018	NP_003009	P11686	PSPC_HUMAN	surfactant protein C precursor	47					respiratory gaseous exchange	extracellular space					0				Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GGTCCTCATCGTCGTGGTGAT	0.597																0.346821	167.272183	170.844117	60	113	KEEP	---	---	---	---	33	34	60	69	-1	capture	Missense_Mutation	SNP	22020183	22020183	SFTPC	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14085	97
PHYHIP	9796	broad.mit.edu	37	8	22079267	22079267	+	Missense_Mutation	SNP	C	G	G			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22079267C>G	uc003xbk.3	-	6	1286	c.592G>C	c.(592-594)GAC>CAC	p.D198H	PHYHIP_uc003xbj.3_Missense_Mutation_p.D198H	NM_001099335	NP_001092805	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	198											0				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		TAGGGGGAGTCCTGCGGGGGC	0.627																0.375	29.969165	30.298392	9	15	KEEP	---	---	---	---	10	2	11	4	-1	capture	Missense_Mutation	SNP	22079267	22079267	PHYHIP	8	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	11769	97
PCMTD1	115294	broad.mit.edu	37	8	52733107	52733107	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52733107T>C	uc003xqx.3	-	6	1219	c.878A>G	c.(877-879)AAT>AGT	p.N293S	PCMTD1_uc011ldm.1_Missense_Mutation_p.N163S|PCMTD1_uc003xqw.3_Missense_Mutation_p.N293S|PCMTD1_uc011ldn.1_Missense_Mutation_p.N105S|PCMTD1_uc010lya.2_Missense_Mutation_p.N217S	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	293						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				AATAAGCTGATTACCCACAAA	0.318																0.045139	-35.86897	27.836111	13	275	KEEP	---	---	---	---	9	11	219	218	-1	capture	Missense_Mutation	SNP	52733107	52733107	PCMTD1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11489	97
KCNB2	9312	broad.mit.edu	37	8	73848231	73848231	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73848231C>T	uc003xzb.2	+	3	1229	c.641C>T	c.(640-642)ACG>ATG	p.T214M		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	214					regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			TCTCTCAATACGCTGCCGGAG	0.478																0.4	251.646836	253.572451	88	132	KEEP	---	---	---	---	46	49	64	76	-1	capture	Missense_Mutation	SNP	73848231	73848231	KCNB2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7935	97
CNKSR2	22866	broad.mit.edu	37	X	21508621	21508621	+	Silent	SNP	G	T	T			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21508621G>T	uc004czx.1	+	6	642	c.606G>T	c.(604-606)TCG>TCT	p.S202S	CNKSR2_uc004czw.2_Silent_p.S202S|CNKSR2_uc011mjn.1_Silent_p.S202S|CNKSR2_uc011mjo.1_Silent_p.S202S	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	202					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						TATCCCTGTCGTCAGATCCTC	0.398																0.064516	-3.21848	15.104277	6	87	KEEP	---	---	---	---	3	3	57	39	0.5	capture	Silent	SNP	21508621	21508621	CNKSR2	23	G	T	T	T	1	0	0	0	0	0	0	0	1	509	40	4	4	3572	97
USP2	9099	broad.mit.edu	37	11	119229846	119229846	+	Splice_Site	DEL	T	-	-			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119229846delT	uc001pwm.3	-	6	1357	c.1062_splice	c.e6-1	p.N354_splice	USP2_uc001pwl.3_Splice_Site_p.N145_splice|USP2_uc001pwn.3_Splice_Site_p.N111_splice	NM_004205	NP_004196	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2 isoform a						cell cycle|muscle organ development|negative regulation of transcription from RNA polymerase II promoter|positive regulation of mitotic cell cycle|protein deubiquitination|protein stabilization|ubiquitin-dependent protein catabolic process	nucleus|perinuclear region of cytoplasm	cyclin binding|cysteine-type endopeptidase activity|metal ion binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity			ovary(2)|urinary_tract(1)|skin(1)	4		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		TCCTGCTGACTGAACCCAAAG	0.527																0.34			23	44		---	---	---	---						capture_indel	Splice_Site	DEL	119229846	119229846	USP2	11	T	-	-	-	1	0	1	0	1	0	0	1	0	715	55	5	5	16933	97
TCF12	6938	broad.mit.edu	37	15	57524624	57524624	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:57524624delG	uc002aec.2	+	10	1105	c.821delG	c.(820-822)CGCfs	p.R274fs	TCF12_uc010ugm.1_Frame_Shift_Del_p.R326fs|TCF12_uc010ugn.1_Frame_Shift_Del_p.R270fs|TCF12_uc002aea.2_Frame_Shift_Del_p.R274fs|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Frame_Shift_Del_p.R274fs|TCF12_uc002aed.2_Frame_Shift_Del_p.R274fs|TCF12_uc002aee.2_Frame_Shift_Del_p.R104fs|TCF12_uc010bft.2_Frame_Shift_Del_p.R104fs|TCF12_uc010ugo.1_Intron	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b	274					immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		TCACATGACCGCTTGGTAGGC	0.443				p.R274H(CCK81-Tumor)	335	T	TEC	extraskeletal myxoid chondrosarcoma								0.19			46	198		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	57524624	57524624	TCF12	15	G	-	-	-	1	0	1	0	1	0	0	0	0	494	38	5	5	15573	97
SYCP2	10388	broad.mit.edu	37	20	58467047	58467047	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:58467047delT	uc002yaz.2	-	23	2501	c.2362delA	c.(2362-2364)ATGfs	p.M788fs		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	788					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AAGCTCACCATTTTTTTTTGT	0.323																0.05			7	144		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	58467047	58467047	SYCP2	20	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	15320	97
LRBA	987	broad.mit.edu	37	4	151791721	151791725	+	Frame_Shift_Del	DEL	TTATG	-	-			TCGA-06-5414-01	TCGA-06-5414-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:151791721_151791725delTTATG	uc010ipj.2	-	20	2875_2879	c.2401_2405delCATAA	c.(2401-2406)CATAAAfs	p.H801fs	LRBA_uc003ilu.3_Frame_Shift_Del_p.H801fs	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	801_802						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					TGGATGCTGTTTATGTATCACCTGA	0.312																0.28			65	164		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	151791721	151791725	LRBA	4	TTATG	-	-	-	1	0	1	0	1	0	0	0	0	832	64	5	5	8847	97
