Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NOC2L	26155	broad.mit.edu	37	1	887446	887446	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:887446G>A	uc001abz.3	-	11	1324	c.1265C>T	c.(1264-1266)GCG>GTG	p.A422V	NOC2L_uc001aby.3_Missense_Mutation_p.A219V|NOC2L_uc009vjq.2_Missense_Mutation_p.A422V	NM_015658	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog	422						nucleolus	protein binding			ovary(1)|skin(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		GCTGGGGCCCGCAGTGCTCAG	0.592																0.676056	158.831568	160.794118	48	23	KEEP	---	---	---	---	22	30	9	15	-1	capture	Missense_Mutation	SNP	887446	887446	NOC2L	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10420	102
PRDM16	63976	broad.mit.edu	37	1	3328828	3328828	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3328828C>T	uc001akf.2	+	9	2147	c.2067C>T	c.(2065-2067)GCC>GCT	p.A689A	PRDM16_uc001akc.2_Silent_p.A689A|PRDM16_uc001akd.2_Silent_p.A689A|PRDM16_uc001ake.2_Silent_p.A689A|PRDM16_uc009vlh.2_Silent_p.A390A	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	689	Interaction with CTBP1 and CTBP2 (By similarity).				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CGGGCGCCGCCGGGGACTCCA	0.642					1161	T	EVI1	MDS|AML								0.775701	284.278625	291.756294	83	24	KEEP	---	---	---	---	45	55	11	15	-1	capture	Silent	SNP	3328828	3328828	PRDM16	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12353	102
GPR153	387509	broad.mit.edu	37	1	6314021	6314021	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6314021G>A	uc001amp.1	-	3	803	c.543C>T	c.(541-543)GGC>GGT	p.G181G		NM_207370	NP_997253	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	181	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		CCACGCTGCCGCCCACCAGCA	0.692																0.157895	10.929931	15.167251	6	32	KEEP	---	---	---	---	0	6	12	21	-1	capture	Silent	SNP	6314021	6314021	GPR153	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6593	102
DNAJC16	23341	broad.mit.edu	37	1	15870908	15870908	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15870908G>A	uc001aws.2	+	5	709	c.589G>A	c.(589-591)GTG>ATG	p.V197M	DNAJC16_uc001awr.1_Missense_Mutation_p.V197M|DNAJC16_uc001awt.2_Translation_Start_Site	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	197	Cytoplasmic (Potential).|Thioredoxin.				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		AGGAATTGGCGTGGTCCATGC	0.463																0.745455	138.598874	141.605828	41	14	KEEP	---	---	---	---	22	24	10	5	-1	capture	Missense_Mutation	SNP	15870908	15870908	DNAJC16	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4591	102
NUDC	10726	broad.mit.edu	37	1	27268025	27268025	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27268025C>T	uc001bng.1	+	3	353	c.237C>T	c.(235-237)GCC>GCT	p.A79A	NUDC_uc001bnh.1_Silent_p.A136A|NUDC_uc009vsq.1_Silent_p.A53A	NM_006600	NP_006591	Q9Y266	NUDC_HUMAN	nuclear distribution gene C homolog	79	Potential.				cell proliferation|cytokinesis|mitotic prometaphase|multicellular organismal development	cytosol|microtubule|nucleoplasm	protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		GGCAGGAGGCCGAGCGGCGGG	0.617																0.818182	88.346568	91.501587	27	6	KEEP	---	---	---	---	12	18	3	5	-1	capture	Silent	SNP	27268025	27268025	NUDC	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10628	102
EPS15	2060	broad.mit.edu	37	1	51829678	51829678	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:51829678C>T	uc001csq.1	-	23	2311	c.2219G>A	c.(2218-2220)CGT>CAT	p.R740H	EPS15_uc009vyz.1_Missense_Mutation_p.R606H|EPS15_uc001csp.3_Missense_Mutation_p.R426H	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	740	15 X 3 AA repeats of D-P-F.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						TGTGGCTGAACGAAAAGGATC	0.388					562	T	MLL	ALL								0.650794	137.793957	139.058629	41	22	KEEP	---	---	---	---	19	28	14	13	-1	capture	Missense_Mutation	SNP	51829678	51829678	EPS15	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5147	102
C1orf103	55791	broad.mit.edu	37	1	111490908	111490908	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111490908G>A	uc001eaa.2	-	4	2239	c.1983C>T	c.(1981-1983)ACC>ACT	p.T661T	C1orf103_uc001dzz.2_Silent_p.T125T|C1orf103_uc001eab.2_Silent_p.T125T|C1orf103_uc001eac.1_Silent_p.T124T	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	661					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		GTTGGGAACCGGTGACATTAG	0.368																0.029762	-30.267461	10.521854	5	163	KEEP	---	---	---	---	2	3	75	101	-1	capture	Silent	SNP	111490908	111490908	C1orf103	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1959	102
DENND2D	79961	broad.mit.edu	37	1	111730833	111730833	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111730833C>T	uc001eak.1	-	11	1459	c.1259G>A	c.(1258-1260)CGA>CAA	p.R420Q	DENND2D_uc001eal.1_Missense_Mutation_p.R417Q	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	420	dDENN.									ovary(1)	1		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		CTTCACAAATCGGCGGTTGGT	0.498																0.057471	-7.992313	9.887027	5	82	KEEP	---	---	---	---	1	4	41	53	-1	capture	Missense_Mutation	SNP	111730833	111730833	DENND2D	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4389	102
VANGL1	81839	broad.mit.edu	37	1	116226676	116226676	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:116226676G>A	uc001efv.1	+	6	1329	c.1058G>A	c.(1057-1059)CGA>CAA	p.R353Q	VANGL1_uc009wgy.1_Missense_Mutation_p.R351Q	NM_138959	NP_620409	Q8TAA9	VANG1_HUMAN	vang-like 1	353	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CATGAACGGCGAGTAAAGAAG	0.438																0.758065	157.511013	161.260553	47	15	KEEP	---	---	---	---	26	27	9	13	-1	capture	Missense_Mutation	SNP	116226676	116226676	VANGL1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17001	102
NOTCH2NL	388677	broad.mit.edu	37	1	145273241	145273241	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145273241A>G	uc001emn.3	+	3	465	c.95A>G	c.(94-96)AAC>AGC	p.N32S	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Missense_Mutation_p.N32S|NOTCH2NL_uc001emo.2_Missense_Mutation_p.N32S|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	32	EGF-like 2.				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						TGTGAGAAGAACCGCTGCCAG	0.532																0.018519	-48.896757	7.475999	4	212	KEEP	---	---	---	---	5	2	194	189	-1	capture	Missense_Mutation	SNP	145273241	145273241	NOTCH2NL	1	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	10456	102
CHD1L	9557	broad.mit.edu	37	1	146766154	146766154	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:146766154G>A	uc001epm.3	+	22	2633	c.2570G>A	c.(2569-2571)CGA>CAA	p.R857Q	uc001epp.2_Intron|CHD1L_uc001epn.3_Missense_Mutation_p.R744Q|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_RNA|CHD1L_uc009wjh.2_Missense_Mutation_p.R763Q|CHD1L_uc010ozp.1_Missense_Mutation_p.R576Q|CHD1L_uc001epo.3_Missense_Mutation_p.R653Q|CHD1L_uc009wji.2_Missense_Mutation_p.R576Q	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein	857	Macro.				chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					GGTACTGAGCGACTTATTCGG	0.423																0.055838	-18.567561	22.3285	11	186	KEEP	---	---	---	---	7	5	104	123	-1	capture	Missense_Mutation	SNP	146766154	146766154	CHD1L	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3290	102
INSRR	3645	broad.mit.edu	37	1	156823811	156823811	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156823811G>A	uc010pht.1	-	2	624	c.370C>T	c.(370-372)CGT>TGT	p.R124C	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|INSRR_uc009wsj.1_Missense_Mutation_p.R124C	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	124					protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCCACGTCACGCAGATGTGGC	0.622					299											0.74359	96.994508	99.096925	29	10	KEEP	---	---	---	---	10	21	6	6	-1	capture	Missense_Mutation	SNP	156823811	156823811	INSRR	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7697	102
CD84	8832	broad.mit.edu	37	1	160535290	160535290	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160535290C>T	uc001fwh.3	-	2	316	c.292G>A	c.(292-294)GAT>AAT	p.D98N	CD84_uc001fwf.3_Missense_Mutation_p.D98N|CD84_uc001fwg.3_Missense_Mutation_p.D98N|CD84_uc009wtn.2_Missense_Mutation_p.D98N|CD84_uc001fwi.3_Intron|CD84_uc001fwj.2_Missense_Mutation_p.D98N|CD84_uc001fwk.2_Missense_Mutation_p.D98N	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule	98	Extracellular (Potential).				blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ATCCTCAGATCGCTAATGACC	0.463																0.068493	-11.050278	31.313563	15	204	KEEP	---	---	---	---	9	7	108	112	-1	capture	Missense_Mutation	SNP	160535290	160535290	CD84	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3013	102
BLZF1	8548	broad.mit.edu	37	1	169347745	169347745	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169347745C>T	uc001gfx.1	+	4	1083	c.646C>T	c.(646-648)CGA>TGA	p.R216*	BLZF1_uc001gfy.2_Nonsense_Mutation_p.R216*|BLZF1_uc009wvp.1_Nonsense_Mutation_p.R193*	NM_003666	NP_003657	Q9H2G9	GO45_HUMAN	basic leucine zipper nuclear factor 1	216					cell proliferation|Golgi organization|Golgi to plasma membrane protein transport|regulation of cell growth|regulation of transcription from RNA polymerase II promoter	Golgi lumen|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding			skin(1)	1	all_hematologic(923;0.208)					TGATGTATGGCGAAGTAAATT	0.363																0.75	121.4243	124.155706	36	12	KEEP	---	---	---	---	11	27	5	7	-1	capture	Nonsense_Mutation	SNP	169347745	169347745	BLZF1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	1441	102
CENPF	1063	broad.mit.edu	37	1	214837072	214837072	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214837072C>T	uc001hkm.2	+	20	9454	c.9280C>T	c.(9280-9282)CGA>TGA	p.R3094*		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	3190					cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		CAAGCGAGGCCGACTTGTCCC	0.582	Colon(80;575 1284 11000 14801 43496)															0.777778	96.968873	99.50447	28	8	KEEP	---	---	---	---	12	20	7	3	-1	capture	Nonsense_Mutation	SNP	214837072	214837072	CENPF	1	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	3199	102
GNPAT	8443	broad.mit.edu	37	1	231401503	231401503	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:231401503C>T	uc001hup.3	+	6	948	c.742C>T	c.(742-744)CGC>TGC	p.R248C	GNPAT_uc009xfo.1_Missense_Mutation_p.R139C|GNPAT_uc009xfp.2_Missense_Mutation_p.R187C	NM_014236	NP_055051	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	248					ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity			ovary(3)|breast(1)	4	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				GACAAGAAGCCGCTCTGCCAA	0.378																0.755556	242.235152	247.588277	68	22	KEEP	---	---	---	---	30	46	10	15	-1	capture	Missense_Mutation	SNP	231401503	231401503	GNPAT	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6477	102
RYR2	6262	broad.mit.edu	37	1	237729890	237729890	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237729890G>A	uc001hyl.1	+	28	3358	c.3238G>A	c.(3238-3240)GGC>AGC	p.G1080S		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1080	Cytoplasmic (By similarity).|2.|B30.2/SPRY 2.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGTGTGCAGCGGCACCGGGGA	0.502																0.064935	-6.394842	8.846638	5	72	KEEP	---	---	---	---	4	1	39	35	-1	capture	Missense_Mutation	SNP	237729890	237729890	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13661	102
WDR64	128025	broad.mit.edu	37	1	241946599	241946599	+	Missense_Mutation	SNP	G	A	A	rs141496101	by1000genomes	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:241946599G>A	uc001hzf.1	+	12	1403	c.1250G>A	c.(1249-1251)CGT>CAT	p.R417H	WDR64_uc001hzg.1_Missense_Mutation_p.R330H	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	864										skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CTTTCCTGGCGTGCTCATTCT	0.373																0.797101	186.626346	192.269069	55	14	KEEP	---	---	---	---	37	27	11	5	-1	capture	Missense_Mutation	SNP	241946599	241946599	WDR64	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17196	102
MYO3A	53904	broad.mit.edu	37	10	26243811	26243811	+	Silent	SNP	C	T	T	rs139958275	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26243811C>T	uc001isn.2	+	4	537	c.177C>T	c.(175-177)GAC>GAT	p.D59D	MYO3A_uc009xko.1_Silent_p.D59D|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Silent_p.D59D|MYO3A_uc001ism.2_Silent_p.D59D	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	59	Protein kinase.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						AGGATATTGACGAAGAGATTG	0.313					781											0.708333	224.028061	227.757737	68	28	KEEP	---	---	---	---	44	30	10	18	-1	capture	Silent	SNP	26243811	26243811	MYO3A	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9986	102
HNRNPH3	3189	broad.mit.edu	37	10	70097039	70097039	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70097039C>T	uc001jnw.3	+	2	290	c.61C>T	c.(61-63)CGT>TGT	p.R21C	HNRNPH3_uc001jnx.3_Missense_Mutation_p.R21C|HNRNPH3_uc009xpu.2_5'UTR|HNRNPH3_uc010qiv.1_Missense_Mutation_p.R21C|HNRNPH3_uc001jny.3_5'Flank	NM_012207	NP_036339	P31942	HNRH3_HUMAN	heterogeneous nuclear ribonucleoprotein H3	21	RRM 1.				nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2						AGTACGACTTCGTGGACTACC	0.338																0.755396	360.74131	368.999345	105	34	KEEP	---	---	---	---	54	73	15	31	-1	capture	Missense_Mutation	SNP	70097039	70097039	HNRNPH3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7193	102
RGR	5995	broad.mit.edu	37	10	86008738	86008738	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:86008738G>A	uc001kdc.1	+	3	335	c.297G>A	c.(295-297)GCG>GCA	p.A99A	RGR_uc001kdb.1_Missense_Mutation_p.V87I|RGR_uc001kdd.1_Silent_p.A103A|RGR_uc001kde.1_Silent_p.A99A	NM_001012720	NP_001012738	P47804	RGR_HUMAN	retinal G-protein coupled receptor isoform 2	99	Helical; Name=3; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity|protein binding	p.A103A(1)		ovary(1)	1						TTGTGACAGCGTTGGCCAGCA	0.637	NSCLC(15;204 545 5889 6385 32445)															0.670213	205.753578	208.167931	63	31	KEEP	---	---	---	---	27	37	12	21	-1	capture	Silent	SNP	86008738	86008738	RGR	10	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	13183	102
PTEN	5728	broad.mit.edu	37	10	89717672	89717672	+	Nonsense_Mutation	SNP	C	T	T	rs121909219		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717672C>T	uc001kfb.2	+	8	1728	c.697C>T	c.(697-699)CGA>TGA	p.R233*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	233	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R233*(61)|p.R233fs*10(4)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R233fs*12(1)|p.R233fs*20(1)|p.R233fs*25(1)|p.R233fs*23(1)|p.R233R(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGACCCACACGACGGGAAGA	0.423		R233*(JHUEM1_ENDOMETRIUM)|R233*(SW1783_CENTRAL_NERVOUS_SYSTEM)|R233*(NCIH1155_LUNG)|R233*(SF295_CENTRAL_NERVOUS_SYSTEM)|R233*(HEC59_ENDOMETRIUM)	31	p.R233*(JHUEM1-Tumor)|p.R233*(SW1783-Tumor)|p.R233*(SF295-Tumor)|p.T232fs(P31FUJ-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.76	317.380933	325.091918	95	30	KEEP	---	---	---	---	50	58	17	17	-1	capture	Nonsense_Mutation	SNP	89717672	89717672	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	102
PLCE1	51196	broad.mit.edu	37	10	95995711	95995711	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:95995711C>T	uc001kjk.2	+	7	2888	c.2254C>T	c.(2254-2256)CGA>TGA	p.R752*	PLCE1_uc010qnx.1_Nonsense_Mutation_p.R752*|PLCE1_uc001kjm.2_Nonsense_Mutation_p.R444*	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	752	Ras-GEF.				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				TTTCTTACAACGAGTGGGACA	0.408																0.077778	-0.442898	15.962442	7	83	KEEP	---	---	---	---	4	5	47	46	-1	capture	Nonsense_Mutation	SNP	95995711	95995711	PLCE1	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11937	102
SORCS1	114815	broad.mit.edu	37	10	108923845	108923845	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:108923845G>T	uc001kym.2	-	1	448	c.440C>A	c.(439-441)CCG>CAG	p.P147Q	SORCS1_uc001kyl.2_Missense_Mutation_p.P147Q|SORCS1_uc009xxs.2_Missense_Mutation_p.P147Q|SORCS1_uc001kyn.1_Missense_Mutation_p.P147Q|SORCS1_uc001kyo.2_Missense_Mutation_p.P147Q	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a	147	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GGCTTTGTCCGGGTCCCGCTC	0.652																0.707865	218.463434	221.911039	63	26	KEEP	---	---	---	---	25	45	14	17	0.357142857143	capture	Missense_Mutation	SNP	108923845	108923845	SORCS1	10	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	14822	102
SEC23IP	11196	broad.mit.edu	37	10	121663608	121663608	+	Missense_Mutation	SNP	C	T	T	rs147722288	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:121663608C>T	uc001leu.1	+	4	992	c.920C>T	c.(919-921)CCG>CTG	p.P307L	SEC23IP_uc010qtc.1_Missense_Mutation_p.P96L	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	307	Interaction with SEC23A.				Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		CAGCCAGATCCGGAGAGCGTG	0.408																0.057692	-6.839363	14.503723	6	98	KEEP	---	---	---	---	8	0	61	51	-1	capture	Missense_Mutation	SNP	121663608	121663608	SEC23IP	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13886	102
CPXM2	119587	broad.mit.edu	37	10	125506288	125506288	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:125506288G>A	uc001lhk.1	-	14	2588	c.2263C>T	c.(2263-2265)CGT>TGT	p.R755C	CPXM2_uc001lhj.2_Intron	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	755					cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GGTCACCCACGCTGTCGTCTC	0.577																0.757009	264.633162	271.102968	81	26	KEEP	---	---	---	---	43	48	19	12	-1	capture	Missense_Mutation	SNP	125506288	125506288	CPXM2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3803	102
CPXM2	119587	broad.mit.edu	37	10	125622179	125622179	+	Missense_Mutation	SNP	G	A	A	rs146535848		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:125622179G>A	uc001lhk.1	-	3	789	c.464C>T	c.(463-465)ACG>ATG	p.T155M	CPXM2_uc001lhj.2_RNA	NM_198148	NP_937791	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	155	F5/8 type C.				cell adhesion|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GCGCTTCACCGTGGAGGCATG	0.507																0.710145	167.614702	170.362127	49	20	KEEP	---	---	---	---	34	31	14	12	-1	capture	Missense_Mutation	SNP	125622179	125622179	CPXM2	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3803	102
MRGPRE	116534	broad.mit.edu	37	11	3249728	3249728	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3249728G>A	uc001lxq.3	-	2	609	c.299C>T	c.(298-300)ACG>ATG	p.T100M		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	100	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAGCGCAGCGTTGCCAGGCT	0.662																0.741379	142.966802	146.058145	43	15	KEEP	---	---	---	---	21	24	6	9	-1	capture	Missense_Mutation	SNP	3249728	3249728	MRGPRE	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9674	102
SOX6	55553	broad.mit.edu	37	11	16036504	16036504	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:16036504C>T	uc001mme.2	-	13	1788	c.1755G>A	c.(1753-1755)CGG>CGA	p.R585R	SOX6_uc001mmd.2_Silent_p.R548R|SOX6_uc001mmf.2_Silent_p.R545R|SOX6_uc001mmg.2_Silent_p.R572R	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	572					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						CATCTTCTGGCCGAGTAAGGT	0.463																0.085714	0.704205	6.787963	3	32	KEEP	---	---	---	---	0	3	19	20	-1	capture	Silent	SNP	16036504	16036504	SOX6	11	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	14847	102
PLEKHA7	144100	broad.mit.edu	37	11	16847767	16847767	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:16847767C>T	uc001mmo.2	-	10	1258	c.1243G>A	c.(1243-1245)GCC>ACC	p.A415T	PLEKHA7_uc010rcu.1_Missense_Mutation_p.A415T|PLEKHA7_uc001mmn.2_Missense_Mutation_p.A123T	NM_175058	NP_778228	Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A	415					epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3						GGAGGAAAGGCCCGCTGGTAC	0.592																0.802817	741.541875	765.843213	228	56	KEEP	---	---	---	---	113	128	27	31	-1	capture	Missense_Mutation	SNP	16847767	16847767	PLEKHA7	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11964	102
NELL1	4745	broad.mit.edu	37	11	20959373	20959373	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20959373C>T	uc001mqe.2	+	10	1192	c.1039C>T	c.(1039-1041)CGG>TGG	p.R347W	NELL1_uc001mqf.2_Missense_Mutation_p.R347W|NELL1_uc009yid.2_Missense_Mutation_p.R375W|NELL1_uc010rdo.1_Missense_Mutation_p.R290W|NELL1_uc010rdp.1_Missense_Mutation_p.R107W	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	347	VWFC 2.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						AGAAGGCCAGCGGATTTTAAC	0.408																0.683168	226.708691	229.732233	69	32	KEEP	---	---	---	---	41	40	21	17	-1	capture	Missense_Mutation	SNP	20959373	20959373	NELL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	10240	102
GYLTL1B	120071	broad.mit.edu	37	11	45950278	45950278	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45950278G>A	uc001nbv.1	+	14	2159	c.2048G>A	c.(2047-2049)CGT>CAT	p.R683H	GYLTL1B_uc001nbw.1_Missense_Mutation_p.R652H|GYLTL1B_uc001nbx.1_Missense_Mutation_p.R683H|GYLTL1B_uc001nby.1_Missense_Mutation_p.R366H|GYLTL1B_uc001nbz.1_Missense_Mutation_p.V32M	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	683	Lumenal (Potential).				muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		CCCACCTATCGTGACTGCCTC	0.637																0.031746	-23.393206	6.819642	4	122	KEEP	---	---	---	---	1	3	53	86	-1	capture	Missense_Mutation	SNP	45950278	45950278	GYLTL1B	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6836	102
CHRM4	1132	broad.mit.edu	37	11	46406690	46406690	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46406690C>T	uc001nct.1	-	1	1418	c.1418G>A	c.(1417-1419)CGG>CAG	p.R473Q		NM_000741	NP_000732	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	473	Cytoplasmic (By similarity).				cell proliferation	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity				0				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)|Tropicamide(DB00809)	GCCGATGTTCCGATACTGGCA	0.602	Esophageal Squamous(171;1020 1936 4566 30205 42542)															0.780488	115.923405	118.895579	32	9	KEEP	---	---	---	---	18	16	3	7	-1	capture	Missense_Mutation	SNP	46406690	46406690	CHRM4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3344	102
P2RX3	5024	broad.mit.edu	37	11	57137380	57137380	+	Silent	SNP	C	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57137380C>A	uc001nju.2	+	12	1180	c.1104C>A	c.(1102-1104)ATC>ATA	p.I368I		NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3	368	Cytoplasmic (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						CGCTGAAAATCGCGGCTTTGA	0.547																0.961538	86.042588	88.579062	25	1	KEEP	---	---	---	---	13	19	0	1	0.59375	capture	Silent	SNP	57137380	57137380	P2RX3	11	C	A	A	A	1	0	0	0	0	0	0	0	1	395	31	4	4	11245	102
RASGRP2	10235	broad.mit.edu	37	11	64496457	64496457	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64496457C>T	uc009ypu.2	-	15	1876	c.1649G>A	c.(1648-1650)CGC>CAC	p.R550H	RASGRP2_uc001oat.2_Missense_Mutation_p.R452H|RASGRP2_uc001oau.2_Missense_Mutation_p.R405H|RASGRP2_uc009ypv.2_Missense_Mutation_p.R550H|RASGRP2_uc009ypw.2_Missense_Mutation_p.R550H	NM_001098671	NP_001092141	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2	550					platelet activation|Ras protein signal transduction|regulation of cell growth|regulation of small GTPase mediated signal transduction	cell junction|cytosol|ruffle membrane|synapse|synaptosome	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity				0						CTGGGCCCTGCGCCGACACTC	0.637																0.735294	85.491842	87.196166	25	9	KEEP	---	---	---	---	15	11	5	4	-1	capture	Missense_Mutation	SNP	64496457	64496457	RASGRP2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12970	102
INPPL1	3636	broad.mit.edu	37	11	71943788	71943788	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71943788C>T	uc001osf.2	+	15	1978	c.1831C>T	c.(1831-1833)CGC>TGC	p.R611C	INPPL1_uc001osg.2_Missense_Mutation_p.R369C	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	611					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						CCTCAACTACCGCCTGGACAT	0.612																0.625899	295.251378	297.185617	87	52	KEEP	---	---	---	---	43	52	29	29	-1	capture	Missense_Mutation	SNP	71943788	71943788	INPPL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7684	102
ATG16L2	89849	broad.mit.edu	37	11	72528883	72528883	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72528883C>T	uc001otd.2	+	3	341	c.301C>T	c.(301-303)CGG>TGG	p.R101W	ATG16L2_uc001otc.1_Missense_Mutation_p.R101W|ATG16L2_uc010rrf.1_Missense_Mutation_p.R101W|ATG16L2_uc001ote.2_5'UTR|ATG16L2_uc009ytj.1_Missense_Mutation_p.R101W	NM_033388	NP_203746	Q8NAA4	A16L2_HUMAN	ATG16 autophagy related 16-like 2	101					autophagy|protein transport	cytoplasm	protein binding				0			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			GGAGGGGCTCCGGCTGGTCTG	0.577																0.866667	136.159302	142.048563	39	6	KEEP	---	---	---	---	18	26	6	2	-1	capture	Missense_Mutation	SNP	72528883	72528883	ATG16L2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	1083	102
RNF26	79102	broad.mit.edu	37	11	119206097	119206097	+	Missense_Mutation	SNP	A	G	G			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119206097A>G	uc001pwh.2	+	1	861	c.265A>G	c.(265-267)AGC>GGC	p.S89G		NM_032015	NP_114404	Q9BY78	RNF26_HUMAN	ring finger protein 26	89	Leu-rich.						zinc ion binding			ovary(1)	1		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		TCTGCTGTATAGCTGCTGCTC	0.607																0.740586	659.097492	671.596573	177	62	KEEP	---	---	---	---	108	99	40	35	-1	capture	Missense_Mutation	SNP	119206097	119206097	RNF26	11	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	13378	102
TMEM136	219902	broad.mit.edu	37	11	120201174	120201174	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120201174C>T	uc001pxh.1	+	3	751	c.688C>T	c.(688-690)CGG>TGG	p.R230W	TMEM136_uc001pxg.2_Missense_Mutation_p.R133W|TMEM136_uc010rzm.1_Missense_Mutation_p.R111W|TMEM136_uc001pxj.2_Missense_Mutation_p.R252W|TMEM136_uc009zas.1_Missense_Mutation_p.R116W|TMEM136_uc001pxi.1_Missense_Mutation_p.R116W	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136	230						integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		GAGAAGCAGGCGGAGTGAGGA	0.493																0.381818	57.207329	57.863472	21	34	KEEP	---	---	---	---	13	10	15	26	-1	capture	Missense_Mutation	SNP	120201174	120201174	TMEM136	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15936	102
FOXRED1	55572	broad.mit.edu	37	11	126143242	126143242	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:126143242C>T	uc001qdi.2	+	4	476	c.429C>T	c.(427-429)GCC>GCT	p.A143A	FOXRED1_uc010sbn.1_5'UTR|FOXRED1_uc010sbo.1_RNA|FOXRED1_uc010sbp.1_5'UTR|FOXRED1_uc010sbq.1_Missense_Mutation_p.R12C|FOXRED1_uc001qdj.2_5'UTR|FOXRED1_uc010sbr.1_Silent_p.A129A|FOXRED1_uc001qdk.2_5'UTR	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing	143						integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		AGTACCTGGCCGTAGTCGATG	0.557																0.641667	264.906493	267.028394	77	43	KEEP	---	---	---	---	32	51	17	34	-1	capture	Silent	SNP	126143242	126143242	FOXRED1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5977	102
ADAMTS15	170689	broad.mit.edu	37	11	130343095	130343095	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130343095G>A	uc010scd.1	+	8	2232	c.2232G>A	c.(2230-2232)TCG>TCA	p.S744S		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	744	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		TCGTGGTGTCGGCGGTGGAGC	0.642																0.209677	60.314612	69.964811	26	98	KEEP	---	---	---	---	15	11	45	64	-1	capture	Silent	SNP	130343095	130343095	ADAMTS15	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	260	102
WBP11	51729	broad.mit.edu	37	12	14946750	14946750	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:14946750G>A	uc001rci.2	-	8	989	c.828C>T	c.(826-828)ACC>ACT	p.T276T		NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	276	Asp-rich.				mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2						CTGATTTGTCGGTGTCACTGT	0.433																0.090604	19.196553	69.558093	27	271	KEEP	---	---	---	---	14	18	136	168	-1	capture	Silent	SNP	14946750	14946750	WBP11	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17139	102
TXNRD1	7296	broad.mit.edu	37	12	104714974	104714974	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104714974C>T	uc010swk.1	+	10	1117	c.1095C>T	c.(1093-1095)GAC>GAT	p.D365D	TXNRD1_uc010swl.1_Silent_p.D215D|TXNRD1_uc010swm.1_Silent_p.D267D|TXNRD1_uc010swn.1_Silent_p.D215D|TXNRD1_uc010swo.1_Silent_p.D215D|TXNRD1_uc010swp.1_Silent_p.D177D|TXNRD1_uc010swq.1_Silent_p.D265D|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Silent_p.D281D	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	365				D -> N (in Ref. 3; AAC69621).	cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						TTGGTTTAGACGTCACTGTTA	0.448	Ovarian(139;555 1836 9186 9946 10884)															0.75	540.633879	552.912005	162	54	KEEP	---	---	---	---	90	88	35	27	-1	capture	Silent	SNP	104714974	104714974	TXNRD1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16689	102
ULK1	8408	broad.mit.edu	37	12	132397780	132397780	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132397780G>A	uc001uje.2	+	14	1402	c.1134G>A	c.(1132-1134)CCG>CCA	p.P378P		NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1	378	Interaction with GABARAP and GABARAPL2.				autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CCAAACCCCCGCCAGACAGCC	0.617					916											0.580645	55.118733	55.290283	18	13	KEEP	---	---	---	---	13	8	7	9	-1	capture	Silent	SNP	132397780	132397780	ULK1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16857	102
TPTE2	93492	broad.mit.edu	37	13	20067042	20067042	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:20067042G>A	uc001umd.2	-	4	278	c.67C>T	c.(67-69)CCA>TCA	p.P23S	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.P23S|TPTE2_uc001ume.2_Missense_Mutation_p.P23S|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	23						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CTTGTGTGTGGGCTAGAGGAT	0.353																0.503356	257.023429	257.024853	75	74	KEEP	---	---	---	---	30	52	39	41	-1	capture	Missense_Mutation	SNP	20067042	20067042	TPTE2	13	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16314	102
PARP4	143	broad.mit.edu	37	13	25023906	25023906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25023906C>T	uc001upl.2	-	25	3170	c.3064G>A	c.(3064-3066)GGA>AGA	p.G1022R		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1022	VWFA.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TCAAATACTCCGGCACCACAC	0.308																0.736842	204.637487	208.494519	56	20	KEEP	---	---	---	---	37	34	17	10	-1	capture	Missense_Mutation	SNP	25023906	25023906	PARP4	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11366	102
STARD13	90627	broad.mit.edu	37	13	33704214	33704214	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:33704214G>A	uc001uuw.2	-	5	726	c.600C>T	c.(598-600)AGC>AGT	p.S200S	STARD13_uc001uuu.2_Silent_p.S192S|STARD13_uc001uuv.2_Silent_p.S82S|STARD13_uc001uux.2_Silent_p.S165S|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Silent_p.S185S	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	200					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CACTGCTTTCGCTGTGAATGG	0.627																0.551724	47.884565	47.950427	16	13	KEEP	---	---	---	---	7	11	6	9	-1	capture	Silent	SNP	33704214	33704214	STARD13	13	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	15146	102
RB1	5925	broad.mit.edu	37	13	48947629	48947629	+	Splice_Site	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48947629G>A	uc001vcb.2	+	12	1381	c.1215_splice	c.e12+1	p.N405_splice	RB1_uc010act.1_Splice_Site_p.N106_splice	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(14)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTATTTTAACGTAAGCCATAT	0.264			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.736364	265.572509	271.112583	81	29	KEEP	---	---	---	---	37	53	11	21	-1	capture	Splice_Site	SNP	48947629	48947629	RB1	13	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	12993	102
TGDS	23483	broad.mit.edu	37	13	95233375	95233375	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95233375A>C	uc001vlw.2	-	6	646	c.525T>G	c.(523-525)TGT>TGG	p.C175W	TGDS_uc001vlx.2_RNA	NM_014305	NP_055120	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	175					cellular metabolic process		coenzyme binding|dTDP-glucose 4,6-dehydratase activity|protein binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					ACTGTACAAAACATTCAGCAG	0.318																0.567901	175.264372	175.590237	46	35	KEEP	---	---	---	---	28	31	16	28	-1	capture	Missense_Mutation	SNP	95233375	95233375	TGDS	13	A	C	C	C	1	0	0	0	0	1	0	0	0	24	2	4	4	15699	102
ABCC4	10257	broad.mit.edu	37	13	95673860	95673860	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95673860G>A	uc001vmd.3	-	31	4066	c.3947C>T	c.(3946-3948)TCG>TTG	p.S1316L	ABCC4_uc010afj.2_Missense_Mutation_p.S107L|ABCC4_uc010afk.2_Missense_Mutation_p.S1269L	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	1316					platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	AGTTAAGGTCGAGGGCTGTCC	0.383					1222											0.753086	211.716164	216.442634	61	20	KEEP	---	---	---	---	28	47	10	12	-1	capture	Missense_Mutation	SNP	95673860	95673860	ABCC4	13	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	55	102
COL4A2	1284	broad.mit.edu	37	13	111088642	111088642	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111088642C>T	uc001vqx.2	+	13	1042	c.753C>T	c.(751-753)AAC>AAT	p.N251N		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	251	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CGGGACCCAACGGGATTCCAT	0.463																0.803279	164.706977	169.932006	49	12	KEEP	---	---	---	---	31	25	5	9	-1	capture	Silent	SNP	111088642	111088642	COL4A2	13	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3655	102
ING1	3621	broad.mit.edu	37	13	111371669	111371669	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111371669C>T	uc001vri.2	+	2	1091	c.659C>T	c.(658-660)GCG>GTG	p.A220V	ING1_uc001vrf.2_Missense_Mutation_p.A33V|ING1_uc001vrg.2_Missense_Mutation_p.A8V|ING1_uc001vrh.2_Missense_Mutation_p.A77V	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D	220					cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GTGCAGCGCGCGCTGATCCGC	0.652					145											0.080808	-0.005051	17.660669	8	91	KEEP	---	---	---	---	5	4	42	57	-1	capture	Missense_Mutation	SNP	111371669	111371669	ING1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7658	102
ARHGEF7	8874	broad.mit.edu	37	13	111870210	111870210	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111870210G>A	uc001vrs.2	+	6	966	c.716G>A	c.(715-717)CGC>CAC	p.R239H	ARHGEF7_uc001vrr.2_Missense_Mutation_p.R218H|ARHGEF7_uc001vrt.2_Missense_Mutation_p.R189H|ARHGEF7_uc010tjn.1_RNA|ARHGEF7_uc001vru.1_Missense_Mutation_p.R61H|ARHGEF7_uc001vrv.3_Missense_Mutation_p.R61H|ARHGEF7_uc001vrw.3_Missense_Mutation_p.R61H|ARHGEF7_uc001vrx.3_Missense_Mutation_p.R61H|ARHGEF7_uc010tjo.1_Missense_Mutation_p.R136H	NM_001113511	NP_001106983	Q14155	ARHG7_HUMAN	PAK-interacting exchange factor beta isoform c	239	SH3.				apoptosis|epidermal growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			AACTACGTGCGCGAGGTCAAG	0.567					707											0.767442	104.480535	107.291366	33	10	KEEP	---	---	---	---	12	24	4	6	-1	capture	Missense_Mutation	SNP	111870210	111870210	ARHGEF7	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	904	102
SDCCAG1	9147	broad.mit.edu	37	14	50267402	50267402	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50267402G>A	uc001wxc.2	-	23	2176	c.2108C>T	c.(2107-2109)ACG>ATG	p.T703M	SDCCAG1_uc010anj.1_Missense_Mutation_p.T703M|SDCCAG1_uc001wwz.2_5'Flank|SDCCAG1_uc001wxa.2_Translation_Start_Site|SDCCAG1_uc010tqi.1_Missense_Mutation_p.T682M|SDCCAG1_uc001wxe.2_Missense_Mutation_p.T661M|SDCCAG1_uc001wxd.1_Missense_Mutation_p.T108M	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1	703						cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		ATCACTGCTCGTGTCACCTCC	0.413																0.762376	257.13198	263.506821	77	24	KEEP	---	---	---	---	38	45	15	10	-1	capture	Missense_Mutation	SNP	50267402	50267402	SDCCAG1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13850	102
BMP4	652	broad.mit.edu	37	14	54418835	54418835	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:54418835C>T	uc001xal.3	-	2	293	c.106G>A	c.(106-108)GCC>ACC	p.A36T	BMP4_uc010aoh.2_Missense_Mutation_p.A36T|BMP4_uc001xao.3_Missense_Mutation_p.A36T|BMP4_uc001xan.3_Missense_Mutation_p.A36T	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein	36					activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0						TGAATCTCGGCGACTTTTTTC	0.582					68											0.496063	190.3705	190.371433	63	64	KEEP	---	---	---	---	26	48	28	50	-1	capture	Missense_Mutation	SNP	54418835	54418835	BMP4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1450	102
PLEKHG3	26030	broad.mit.edu	37	14	65208866	65208866	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65208866G>A	uc001xho.1	+	16	2900	c.2631G>A	c.(2629-2631)CCG>CCA	p.P877P	PLEKHG3_uc001xhn.1_Silent_p.P821P|PLEKHG3_uc001xhp.2_Silent_p.P998P|PLEKHG3_uc010aqh.1_Silent_p.P419P|PLEKHG3_uc001xhq.1_Silent_p.P382P	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	877					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGCGCAGCCCGGCCCACCTGG	0.667																0.7375	201.764316	205.855659	59	21	KEEP	---	---	---	---	27	36	9	14	-1	capture	Silent	SNP	65208866	65208866	PLEKHG3	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11973	102
ADCK1	57143	broad.mit.edu	37	14	78390916	78390916	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:78390916G>A	uc001xui.2	+	8	1074	c.975G>A	c.(973-975)GCG>GCA	p.A325A	ADCK1_uc010tvo.1_RNA|ADCK1_uc001xuj.2_Silent_p.A257A|ADCK1_uc001xuk.1_Silent_p.A199A|ADCK1_uc001xul.2_Silent_p.A32A	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	332	Protein kinase.					extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		CGGGAAAGGCGGAGATTGTCC	0.557					200											0.194805	37.491232	44.171121	15	62	KEEP	---	---	---	---	7	8	31	39	-1	capture	Silent	SNP	78390916	78390916	ADCK1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	288	102
EML5	161436	broad.mit.edu	37	14	89160659	89160659	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:89160659C>T	uc001xxg.2	-	18	2717	c.2531G>A	c.(2530-2532)CGT>CAT	p.R844H	EML5_uc001xxh.1_Missense_Mutation_p.R21H	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	844	WD 13.					cytoplasm|microtubule				ovary(3)	3						ACCTGCTTTACGCCAAAATTT	0.259																0.5	6.349884	6.349884	2	2	KEEP	---	---	---	---	0	2	2	0	-1	capture	Missense_Mutation	SNP	89160659	89160659	EML5	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5055	102
RIN3	79890	broad.mit.edu	37	14	93119291	93119291	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:93119291C>T	uc001yap.2	+	6	2049	c.1897C>T	c.(1897-1899)CGC>TGC	p.R633C	RIN3_uc010auk.2_Missense_Mutation_p.R295C|RIN3_uc001yaq.2_Missense_Mutation_p.R558C|RIN3_uc001yar.1_Missense_Mutation_p.R295C|RIN3_uc001yas.1_Missense_Mutation_p.R295C	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	633	Interaction with RAB5B.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GATGATGGCGCGCCAGACCTC	0.597																0.836364	154.57779	160.487838	46	9	KEEP	---	---	---	---	24	24	5	6	-1	capture	Missense_Mutation	SNP	93119291	93119291	RIN3	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13265	102
SERPINA5	5104	broad.mit.edu	37	14	95058444	95058444	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95058444G>A	uc001ydm.2	+	6	1299	c.1089G>A	c.(1087-1089)GCG>GCA	p.A363A	SERPINA3_uc001ydo.3_5'UTR	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	363					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	CCAGAGCAGCGGCAGCCACGG	0.567																0.738035	990.3252	1010.651699	293	104	KEEP	---	---	---	---	155	173	61	52	-1	capture	Silent	SNP	95058444	95058444	SERPINA5	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13985	102
C14orf49	161176	broad.mit.edu	37	14	95922000	95922000	+	Missense_Mutation	SNP	G	A	A	rs143391386		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95922000G>A	uc001yei.3	-	5	866	c.851C>T	c.(850-852)GCG>GTG	p.A284V	C14orf49_uc010avi.2_Missense_Mutation_p.A284V|C14orf49_uc001yej.1_Missense_Mutation_p.A284V	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	284	Spectrin 1.|Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		AATGACACCCGCAGACTGCTC	0.567																0.042254	-33.414715	14.785118	9	204	KEEP	---	---	---	---	4	8	89	145	-1	capture	Missense_Mutation	SNP	95922000	95922000	C14orf49	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1762	102
CDC42BPB	9578	broad.mit.edu	37	14	103412980	103412980	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103412980C>T	uc001ymi.1	-	28	3805	c.3573G>A	c.(3571-3573)TCG>TCA	p.S1191S	CDC42BPB_uc001ymj.1_Silent_p.S293S	NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	1191	PH.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GAATGAGCAGCGAGCTGGTCT	0.488				p.S1191S(LNCAPCLONEFGC-Tumor)	1085											0.205882	33.318196	38.767609	14	54	KEEP	---	---	---	---	8	8	29	32	-1	capture	Silent	SNP	103412980	103412980	CDC42BPB	14	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3044	102
HERC2	8924	broad.mit.edu	37	15	28421858	28421858	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28421858C>T	uc001zbj.2	-	62	9595	c.9489G>A	c.(9487-9489)GCG>GCA	p.A3163A		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3163	RCC1 9.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCAGGGTCTGCGCGTCTCTAC	0.493					1580											0.02623	-61.618806	13.96761	8	297	KEEP	---	---	---	---	2	6	148	200	-1	capture	Silent	SNP	28421858	28421858	HERC2	15	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6984	102
SPTBN5	51332	broad.mit.edu	37	15	42151139	42151139	+	Silent	SNP	A	G	G			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42151139A>G	uc001zos.2	-	48	8256	c.7923T>C	c.(7921-7923)CAT>CAC	p.H2641H		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2676	Spectrin 23.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCTCCAGGCGATGGCGGCGGG	0.706																0.818182	65.564671	67.660198	18	4	KEEP	---	---	---	---	11	14	2	5	-1	capture	Silent	SNP	42151139	42151139	SPTBN5	15	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	15014	102
SLC27A2	11001	broad.mit.edu	37	15	50528151	50528151	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50528151G>A	uc001zxw.2	+	10	1953	c.1721G>A	c.(1720-1722)CGC>CAC	p.R574H	SLC27A2_uc010bes.2_Missense_Mutation_p.R521H|SLC27A2_uc001zxx.2_Missense_Mutation_p.R339H	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	574	Cytoplasmic (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		TTTAAACACCGCAAAATGACC	0.418																0.019048	-47.843326	6.721524	4	206	KEEP	---	---	---	---	5	0	114	117	-1	capture	Missense_Mutation	SNP	50528151	50528151	SLC27A2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14418	102
ARID3B	10620	broad.mit.edu	37	15	74888087	74888087	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74888087C>T	uc002aye.2	+	9	1859	c.1658C>T	c.(1657-1659)GCA>GTA	p.A553V	ARID3B_uc002ayd.2_Missense_Mutation_p.A552V|CLK3_uc002ayf.1_5'Flank	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B	553	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						ACCCCCAGCGCAGAGCCCTCC	0.522																0.557143	120.527227	120.725461	39	31	KEEP	---	---	---	---	25	29	22	36	-1	capture	Missense_Mutation	SNP	74888087	74888087	ARID3B	15	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	910	102
COMMD4	54939	broad.mit.edu	37	15	75631625	75631625	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75631625C>T	uc002azy.2	+	6	379	c.322C>T	c.(322-324)CGC>TGC	p.R108C	COMMD4_uc010umf.1_3'UTR|COMMD4_uc002azz.2_Silent_p.A90A|COMMD4_uc002baa.2_Missense_Mutation_p.R108C|COMMD4_uc010umg.1_3'UTR|COMMD4_uc010umh.1_RNA	NM_017828	NP_060298	Q9H0A8	COMD4_HUMAN	COMM domain containing 4	108						cytoplasm	protein binding				0						CAGCCTGTGCCGCTGTTATGA	0.612																0.057692	-4.116813	6.553057	3	49	KEEP	---	---	---	---	2	1	32	29	-1	capture	Missense_Mutation	SNP	75631625	75631625	COMMD4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3683	102
SIN3A	25942	broad.mit.edu	37	15	75722661	75722661	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75722661C>T	uc002bai.2	-	2	315	c.56G>A	c.(55-57)CGG>CAG	p.R19Q	SIN3A_uc002baj.2_Missense_Mutation_p.R19Q|SIN3A_uc010uml.1_Missense_Mutation_p.R19Q|SIN3A_uc002bak.3_Missense_Mutation_p.R19Q	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A	19					blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						GCCAGGGATCCGACGCTGCTG	0.577																0.641026	85.486413	86.17003	25	14	KEEP	---	---	---	---	11	16	6	12	-1	capture	Missense_Mutation	SNP	75722661	75722661	SIN3A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14218	102
WDR61	80349	broad.mit.edu	37	15	78578420	78578420	+	Missense_Mutation	SNP	C	T	T	rs148690647	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:78578420C>T	uc002bdn.2	-	9	788	c.712G>A	c.(712-714)GTT>ATT	p.V238I	WDR61_uc002bdo.2_Missense_Mutation_p.V238I	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61	238	WD 6.						protein binding			ovary(1)|skin(1)	2						CAGAATGCAACGTTCAGCACC	0.433																0.705882	78.41247	79.70322	24	10	KEEP	---	---	---	---	9	17	4	10	-1	capture	Missense_Mutation	SNP	78578420	78578420	WDR61	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17193	102
MESDC1	59274	broad.mit.edu	37	15	81295114	81295114	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81295114C>T	uc002bfz.2	+	1	1820	c.502C>T	c.(502-504)CGC>TGC	p.R168C		NM_022566	NP_072088	Q9H1K6	MESD1_HUMAN	mesoderm development candidate 1	168											0						CGCCGTGCTGCGCGCCACGCC	0.746																0.7	22.928398	23.285496	7	3	KEEP	---	---	---	---	3	4	2	1	-1	capture	Missense_Mutation	SNP	81295114	81295114	MESDC1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9393	102
WDR73	84942	broad.mit.edu	37	15	85189474	85189474	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85189474G>A	uc002bkw.2	-	6	474	c.458C>T	c.(457-459)GCG>GTG	p.A153V	WDR73_uc002bkv.2_RNA|WDR73_uc002bkx.2_RNA|WDR73_uc010upa.1_Missense_Mutation_p.A153V|uc002bky.1_3'UTR	NM_032856	NP_116245	Q6P4I2	WDR73_HUMAN	WD repeat domain 73	153											0						TCGGAGCCTCGCCCCATGGAG	0.582																0.74	118.240677	120.888458	37	13	KEEP	---	---	---	---	13	27	7	7	-1	capture	Missense_Mutation	SNP	85189474	85189474	WDR73	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17204	102
LRRK1	79705	broad.mit.edu	37	15	101567914	101567914	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101567914C>T	uc002bwr.2	+	19	2917	c.2598C>T	c.(2596-2598)GAC>GAT	p.D866D	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	866					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGGACGACGACGTGCAGTACC	0.667					1100											0.681818	49.431077	50.077708	15	7	KEEP	---	---	---	---	7	11	4	5	-1	capture	Silent	SNP	101567914	101567914	LRRK1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8947	102
HS3ST2	9956	broad.mit.edu	37	16	22926622	22926622	+	Silent	SNP	G	A	A	rs148264643		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:22926622G>A	uc002dli.2	+	2	915	c.843G>A	c.(841-843)CCG>CCA	p.P281P	HS3ST2_uc002dlj.2_RNA	NM_006043	NP_006034	Q9Y278	HS3S2_HUMAN	heparan sulfate D-glucosaminyl	281	Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)		TCACTGACCCGGCCGGCGAGA	0.552																0.028	-48.29023	12.991899	7	243	KEEP	---	---	---	---	1	7	136	149	-1	capture	Silent	SNP	22926622	22926622	HS3ST2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7289	102
C16orf54	283897	broad.mit.edu	37	16	29756241	29756241	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29756241C>T	uc002dtp.2	-	2	141	c.32G>A	c.(31-33)CGC>CAC	p.R11H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|uc002dtq.1_5'Flank	NM_175900	NP_787096	Q6UWD8	CP054_HUMAN	hypothetical protein LOC283897	11						integral to membrane					0						CCCCTCCACGCGCCCAGAGGG	0.652																0.736842	90.207828	92.132814	28	10	KEEP	---	---	---	---	20	16	2	10	-1	capture	Missense_Mutation	SNP	29756241	29756241	C16orf54	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1805	102
ZNF689	115509	broad.mit.edu	37	16	30616193	30616193	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30616193G>A	uc002dyx.2	-	3	1215	c.895C>T	c.(895-897)CGC>TGC	p.R299C	ZNF689_uc010bzy.2_5'UTR	NM_138447	NP_612456	Q96CS4	ZN689_HUMAN	zinc finger protein HIT-39	299	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			Colorectal(24;0.198)			GTGCGCTGGCGGAAGCGGCGG	0.672																0.820513	110.223383	113.994969	32	7	KEEP	---	---	---	---	20	15	3	4	-1	capture	Missense_Mutation	SNP	30616193	30616193	ZNF689	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17972	102
FBXL19	54620	broad.mit.edu	37	16	30958480	30958480	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30958480C>T	uc002eab.2	+	11	2172	c.2014C>T	c.(2014-2016)CGG>TGG	p.R672W	FBXL19_uc002dzz.1_Missense_Mutation_p.R360W|FBXL19_uc002eaa.1_Missense_Mutation_p.R571W|ORAI3_uc002eac.2_5'Flank	NM_001099784	NP_001093254	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	672	LRR 6.						DNA binding|zinc ion binding			ovary(2)|lung(1)|breast(1)	4						AGCTTGTGCCCGGCTGGCAGC	0.711																0.75	62.055172	63.418176	18	6	KEEP	---	---	---	---	12	15	4	3	-1	capture	Missense_Mutation	SNP	30958480	30958480	FBXL19	16	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	5661	102
CCDC102A	92922	broad.mit.edu	37	16	57546730	57546730	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57546730G>A	uc002elw.2	-	9	1789	c.1576C>T	c.(1576-1578)CGC>TGC	p.R526C		NM_033212	NP_149989	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	526										ovary(1)	1						GTGCCAAAGCGAGCACTGCGG	0.637																0.753731	339.538497	347.395698	101	33	KEEP	---	---	---	---	52	57	16	17	-1	capture	Missense_Mutation	SNP	57546730	57546730	CCDC102A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2710	102
FAM65A	79567	broad.mit.edu	37	16	67578997	67578997	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67578997G>A	uc010vjp.1	+	17	3164	c.3068G>A	c.(3067-3069)CGC>CAC	p.R1023H	FAM65A_uc002eth.2_Missense_Mutation_p.R1003H|FAM65A_uc010cej.2_Missense_Mutation_p.R1006H|FAM65A_uc010vjq.1_Missense_Mutation_p.R1017H|FAM65A_uc002etk.2_Missense_Mutation_p.R1001H	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	1007						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CTCTCCCTGCGCCAGCCAGGC	0.627																0.039474	-23.480407	11.298991	6	146	KEEP	---	---	---	---	2	7	125	116	-1	capture	Missense_Mutation	SNP	67578997	67578997	FAM65A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5547	102
PKD1L2	114780	broad.mit.edu	37	16	81236192	81236192	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81236192G>A	uc002fgh.1	-	6	1056	c.1056C>T	c.(1054-1056)TCC>TCT	p.S352S	PKD1L2_uc002fgj.2_Silent_p.S352S	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	352	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GGGACAGGCCGGAGCATGCAG	0.582																0.04902	-11.709902	10.327938	5	97	KEEP	---	---	---	---	1	4	50	53	-1	capture	Silent	SNP	81236192	81236192	PKD1L2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11868	102
SLC7A5	8140	broad.mit.edu	37	16	87873310	87873310	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:87873310C>T	uc002fkm.2	-	5	1009	c.937G>A	c.(937-939)GTG>ATG	p.V313M		NM_003486	NP_003477	Q01650	LAT1_HUMAN	solute carrier family 7 (cationic amino acid	313					blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding				0				BRCA - Breast invasive adenocarcinoma(80;0.049)		CGGCTCACCACGGCCACGGCC	0.662																0.697674	183.300137	186.305021	60	26	KEEP	---	---	---	---	32	33	13	14	-1	capture	Missense_Mutation	SNP	87873310	87873310	SLC7A5	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14592	102
RPA1	6117	broad.mit.edu	37	17	1780602	1780602	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1780602C>T	uc002fto.2	+	8	799	c.684C>T	c.(682-684)GAC>GAT	p.D228D		NM_002945	NP_002936	P27694	RFA1_HUMAN	replication protein A1	228					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0						AACTGGTTGACGAAAGTGTGA	0.562											NER					0.727273	54.209848	55.234827	16	6	KEEP	---	---	---	---	9	7	5	1	-1	capture	Silent	SNP	1780602	1780602	RPA1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13428	102
PLD2	5338	broad.mit.edu	37	17	4713214	4713214	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4713214C>T	uc002fzc.2	+	9	851	c.750C>T	c.(748-750)CTC>CTT	p.L250L	PLD2_uc010vsj.1_Silent_p.L107L|PLD2_uc002fzd.2_Silent_p.L250L	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2	250	PH.				cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	ACATGTGCCTCGAGACAGGTG	0.562																0.040268	-21.175429	12.746862	6	143	KEEP	---	---	---	---	4	2	75	88	-1	capture	Silent	SNP	4713214	4713214	PLD2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	11949	102
WSCD1	23302	broad.mit.edu	37	17	6023636	6023636	+	Silent	SNP	G	A	A	rs146617432		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6023636G>A	uc010cli.2	+	9	1762	c.1383G>A	c.(1381-1383)CCG>CCA	p.P461P	WSCD1_uc002gcn.2_Silent_p.P461P|WSCD1_uc002gco.2_Silent_p.P461P|WSCD1_uc010clj.2_Silent_p.P152P	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1	461						integral to membrane	sulfotransferase activity				0						TAGAGTGGCCGGACTTTGTCA	0.672																0.019011	-60.04292	8.34987	5	258	KEEP	---	---	---	---	2	5	133	165	-1	capture	Silent	SNP	6023636	6023636	WSCD1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17287	102
DLG4	1742	broad.mit.edu	37	17	7097030	7097030	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7097030C>T	uc002get.3	-	17	2877	c.1676G>A	c.(1675-1677)CGA>CAA	p.R559Q	DLG4_uc010vtm.1_RNA|DLG4_uc010vtn.1_Missense_Mutation_p.R456Q|DLG4_uc010cly.2_Missense_Mutation_p.R513Q|DLG4_uc010vto.1_Missense_Mutation_p.R556Q	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	516					axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2						CGAGTCTTCTCGACCTGGTGG	0.612																0.111111	4.273905	9.656764	4	32	KEEP	---	---	---	---	1	4	12	24	-1	capture	Missense_Mutation	SNP	7097030	7097030	DLG4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4515	102
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	T	T	rs28934578		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578406C>T	uc002gim.2	-	5	718	c.524G>A	c.(523-525)CGC>CAC	p.R175H	TP53_uc002gig.1_Missense_Mutation_p.R175H|TP53_uc002gih.2_Missense_Mutation_p.R175H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R43H|TP53_uc010cng.1_Missense_Mutation_p.R43H|TP53_uc002gii.1_Missense_Mutation_p.R43H|TP53_uc010cnh.1_Missense_Mutation_p.R175H|TP53_uc010cni.1_Missense_Mutation_p.R175H|TP53_uc002gij.2_Missense_Mutation_p.R175H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R82H|TP53_uc002gio.2_Missense_Mutation_p.R43H|TP53_uc010vug.1_Missense_Mutation_p.R136H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	175	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R175H(729)|p.R175L(19)|p.R175C(12)|p.R175G(11)|p.0?(7)|p.R175P(5)|p.R175S(5)|p.R43H(5)|p.R82H(5)|p.R175R(4)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.R175fs*5(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.K164_P219del(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*6(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R175fs*72(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGGGGGCAGCGCCTCACAAC	0.652	Pancreas(47;798 1329 9957 10801)	R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(HCC1395_BREAST)|R175H(KLE_ENDOMETRIUM)|R175H(NCIH196_LUNG)|R175H(AU565_BREAST)|R175H(TYKNU_OVARY)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(SKUT1_SOFT_TISSUE)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(LS123_LARGE_INTESTINE)|R175H(SKBR3_BREAST)|R175H(RKN_OVARY)|R175H(HUCCT1_BILIARY_TRACT)	111	p.R175L(LS123-Tumor)|p.R175L(VMRCLCD-Tumor)|p.R175L(DETROIT562-Tumor)|p.R175L(KMS26-Tumor)|p.R175L(KLE-Tumor)|p.R175L(SNU245-Tumor)|p.R175L(SKBR3-Tumor)|p.R175L(RKN-Tumor)|p.R174fs(THP1-Tumor)|p.R175L(HCC1395-Tumor)|p.R175L(VMCUB1-Tumor)|p.R175L(RT11284-Tumor)|p.R175L(AU565-Tumor)|p.R175L(SKUT1-Tumor)|p.R175L(HS571.T-Tumor)|p.R175L(HUCCT1-Tumor)|p.R175L(TYKNU-Tumor)|p.R175L(LMSU-Tumor)|p.R175L(CAL33-Tumor)|p.R175L(SNU1197-Tumor)|p.R175L(NCIH196-Tumor)|p.R175H(HCC44-Tumor)|p.R175L(OPM2-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.692308	170.065376	172.641941	54	24	KEEP	---	---	---	---	30	26	12	13	-1	capture	Missense_Mutation	SNP	7578406	7578406	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	102
KDM6B	23135	broad.mit.edu	37	17	7752152	7752152	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7752152C>T	uc002giw.1	+	11	2922	c.2546C>T	c.(2545-2547)CCG>CTG	p.P849L	KDM6B_uc002gix.2_Missense_Mutation_p.P151L	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	849	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						ACCGCCCTGCCGCCCACCTCA	0.687																0.769231	269.955882	276.883811	80	24	KEEP	---	---	---	---	41	47	10	18	-1	capture	Missense_Mutation	SNP	7752152	7752152	KDM6B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8060	102
C17orf76	388341	broad.mit.edu	37	17	16347362	16347362	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16347362C>T	uc010cph.1	-	4	751	c.575G>A	c.(574-576)CGG>CAG	p.R192Q	C17orf76_uc002gqh.2_Silent_p.A153A|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|C17orf76_uc002gqg.1_3'UTR	NM_001113567	NP_001107039	Q8NAA5	CQ076_HUMAN	hypothetical protein LOC388341 isoform 1	192											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		GCTGGTCACCCGCTCCAGGTC	0.632																0.704545	104.437901	106.083995	31	13	KEEP	---	---	---	---	12	19	8	7	-1	capture	Missense_Mutation	SNP	16347362	16347362	C17orf76	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1866	102
NOS2	4843	broad.mit.edu	37	17	26116655	26116655	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26116655G>A	uc002gzu.2	-	3	434	c.170C>T	c.(169-171)CCG>CTG	p.P57L	NOS2_uc010crh.1_Missense_Mutation_p.P57L|NOS2_uc010wab.1_Missense_Mutation_p.P57L	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	57					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GAGGGGCTGCGGGGACTCATT	0.537					578											0.785235	418.155644	429.351057	117	32	KEEP	---	---	---	---	82	62	17	18	-1	capture	Missense_Mutation	SNP	26116655	26116655	NOS2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10450	102
SRCIN1	80725	broad.mit.edu	37	17	36704805	36704805	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:36704805G>A	uc002hqd.2	-	17	3483	c.3258C>T	c.(3256-3258)ATC>ATT	p.I1086I	SRCIN1_uc002hqf.1_Silent_p.I958I|SRCIN1_uc002hqe.2_Silent_p.I940I	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	958				I -> L (in Ref. 6; AA sequence).	exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						CTAGCTCTGCGATGATGCGAT	0.667																0.710345	347.182443	352.937673	103	42	KEEP	---	---	---	---	65	57	25	24	-1	capture	Silent	SNP	36704805	36704805	SRCIN1	17	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	15028	102
KRTAP4-11	653240	broad.mit.edu	37	17	39274424	39274424	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274424G>C	uc002hvz.2	-	1	183	c.144C>G	c.(142-144)AGC>AGG	p.S48R		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	48	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].|5.		Missing (in allele KAP4.14).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCCTGCAGCAGCTGGACACAC	0.672																0.073684	-0.23072	17.401095	7	88	KEEP	---	---	---	---	6	2	48	57	-1	capture	Missense_Mutation	SNP	39274424	39274424	KRTAP4-11	17	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	8469	102
SC65	10609	broad.mit.edu	37	17	39966036	39966036	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39966036T>C	uc002hxt.2	-	4	1122	c.838A>G	c.(838-840)ACC>GCC	p.T280A	FKBP10_uc002hxv.2_5'Flank|SC65_uc002hxu.2_Missense_Mutation_p.T371A	NM_006455	NP_006446	Q92791	SC65_HUMAN	synaptonemal complex protein SC65	280					synaptonemal complex assembly	nucleolus|synaptonemal complex	binding				0		Breast(137;0.000162)		BRCA - Breast invasive adenocarcinoma(366;0.149)		ACATTGGGGGTCAAATTGGCC	0.562																0.037975	-11.032452	7.194451	3	76	KEEP	---	---	---	---	2	3	35	45	-1	capture	Missense_Mutation	SNP	39966036	39966036	SC65	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	13759	102
BRCA1	672	broad.mit.edu	37	17	41243940	41243940	+	Missense_Mutation	SNP	C	T	T	rs55930959		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41243940C>T	uc002icq.2	-	10	3840	c.3608G>A	c.(3607-3609)CGA>CAA	p.R1203Q	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.R1132Q|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.R1156Q|BRCA1_uc002ict.2_Missense_Mutation_p.R1203Q|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.R1203Q|BRCA1_uc002ide.1_Missense_Mutation_p.R1034Q|BRCA1_uc010cyy.1_Missense_Mutation_p.R1203Q|BRCA1_uc010whs.1_Missense_Mutation_p.R1203Q|BRCA1_uc010cyz.2_Missense_Mutation_p.R1156Q|BRCA1_uc010cza.2_Missense_Mutation_p.R1177Q|BRCA1_uc010wht.1_Missense_Mutation_p.R907Q	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1203					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGCCCCTCTTCGGTAACCCTG	0.433					296	D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			0.728814	146.251616	149.039052	43	16	KEEP	---	---	---	---	18	26	11	7	-1	capture	Missense_Mutation	SNP	41243940	41243940	BRCA1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1486	102
MYCBPAP	84073	broad.mit.edu	37	17	48597088	48597088	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48597088C>T	uc010wmr.1	+	7	1147	c.985C>T	c.(985-987)CGT>TGT	p.R329C	MYCBPAP_uc002iqx.2_Missense_Mutation_p.R329C|MYCBPAP_uc002iqz.2_RNA	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	292					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			AAAAACTCAGCGTGGCCTCAT	0.562																0.098039	2.942569	11.186063	5	46	KEEP	---	---	---	---	2	3	22	34	-1	capture	Missense_Mutation	SNP	48597088	48597088	MYCBPAP	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9929	102
AMZ2	51321	broad.mit.edu	37	17	66246475	66246475	+	Silent	SNP	A	G	G	rs138991707		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66246475A>G	uc002jgs.1	+	3	264	c.147A>G	c.(145-147)GGA>GGG	p.G49G	AMZ2_uc002jgr.1_Silent_p.G49G|AMZ2_uc002jgt.1_Silent_p.G49G|AMZ2_uc002jgu.1_Silent_p.G49G|AMZ2_uc002jgv.1_Silent_p.G49G|AMZ2_uc002jgw.1_Silent_p.G49G|AMZ2_uc002jgx.1_Silent_p.G49G|AMZ2_uc002jgy.1_Silent_p.G49G	NM_001033572	NP_001028744	Q86W34	AMZ2_HUMAN	archaemetzincins-2 isoform 1	49							metallopeptidase activity|zinc ion binding				0	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATCTCTTTGGACCCATTACCT	0.458					87											0.02069	-30.69106	6.592821	3	142	KEEP	---	---	---	---	1	2	66	93	-1	capture	Silent	SNP	66246475	66246475	AMZ2	17	A	G	G	G	1	0	0	0	0	0	0	0	1	119	10	3	3	594	102
QRICH2	84074	broad.mit.edu	37	17	74287140	74287140	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74287140C>T	uc002jrd.1	-	4	3350	c.3170G>A	c.(3169-3171)GGC>GAC	p.G1057D	QRICH2_uc010wsz.1_Missense_Mutation_p.G983D|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1057							protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						GTCGGTTTGGCCGGCCTGCTC	0.532																0.026846	-30.035058	6.82227	4	145	KEEP	---	---	---	---	3	1	61	92	-1	capture	Missense_Mutation	SNP	74287140	74287140	QRICH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12775	102
UBE2O	63893	broad.mit.edu	37	17	74395033	74395033	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74395033G>A	uc002jrm.3	-	10	1733	c.1668C>T	c.(1666-1668)GAC>GAT	p.D556D	UBE2O_uc002jrn.3_Silent_p.D556D|UBE2O_uc002jrl.3_Silent_p.D159D	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	556							ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						GCCACATCACGTCGGCTGAGG	0.627					583											0.803922	406.201861	419.371339	123	30	KEEP	---	---	---	---	59	76	18	17	-1	capture	Silent	SNP	74395033	74395033	UBE2O	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	16750	102
AATK	9625	broad.mit.edu	37	17	79094804	79094804	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79094804G>A	uc010dia.2	-	11	3012	c.2932C>T	c.(2932-2934)CGG>TGG	p.R978W	AATK_uc010dhz.2_Intron	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	978						integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GTGGAGAGCCGTGTCTCGGGC	0.652					507											0.392857	32.018974	32.300321	11	17	KEEP	---	---	---	---	8	5	9	13	-1	capture	Missense_Mutation	SNP	79094804	79094804	AATK	17	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	26	102
NPLOC4	55666	broad.mit.edu	37	17	79556036	79556036	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79556036G>A	uc002kat.3	-	12	1397	c.1215C>T	c.(1213-1215)GAC>GAT	p.D405D	NPLOC4_uc002kau.3_Silent_p.D405D|NPLOC4_uc010wur.1_Silent_p.D244D	NM_017921	NP_060391	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4	405					cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCTCCGGGGCGTCCTTGCATG	0.493																0.742268	232.935955	238.092727	72	25	KEEP	---	---	---	---	24	51	21	9	-1	capture	Silent	SNP	79556036	79556036	NPLOC4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10493	102
ARHGDIA	396	broad.mit.edu	37	17	79826780	79826780	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79826780A>C	uc002kbp.2	-	5	626	c.587T>G	c.(586-588)CTC>CGC	p.L196R	ARHGDIA_uc002kjk.1_Missense_Mutation_p.L71R|ARHGDIA_uc002kbq.2_Missense_Mutation_p.L196R|ARHGDIA_uc002kbr.2_Missense_Mutation_p.S169A|ARHGDIA_uc002kbs.1_Intron|ARHGDIA_uc002kbt.1_Intron	NM_004309	NP_004300	P52565	GDIR1_HUMAN	Rho GDP dissociation inhibitor (GDI) alpha	196					anti-apoptosis|cellular component movement|negative regulation of axonogenesis|negative regulation of cell adhesion|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoskeleton|cytosol	GTPase activator activity|identical protein binding|Rho GDP-dissociation inhibitor activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CTTGATGGTGAGATTCCACTC	0.642																0.791045	190.461524	195.695722	53	14	KEEP	---	---	---	---	31	30	5	10	-1	capture	Missense_Mutation	SNP	79826780	79826780	ARHGDIA	17	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	883	102
MC2R	4158	broad.mit.edu	37	18	13885086	13885086	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13885086C>T	uc002ksp.1	-	2	609	c.432G>A	c.(430-432)ATG>ATA	p.M144I		NM_000529	NP_000520	Q01718	ACTHR_HUMAN	melanocortin 2 receptor	144	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding			ovary(4)|skin(1)	5					Corticotropin(DB01285)|Cosyntropin(DB01284)	CAGTGCGGCGCATGGTCACGA	0.577	Colon(141;1584 1782 35999 48227 48692)															0.095238	6.633039	30.812692	14	133	KEEP	---	---	---	---	6	8	58	83	-1	capture	Missense_Mutation	SNP	13885086	13885086	MC2R	18	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	9277	102
NPC1	4864	broad.mit.edu	37	18	21119357	21119357	+	Missense_Mutation	SNP	C	T	T	rs120074132		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21119357C>T	uc002kum.3	-	19	3147	c.2873G>A	c.(2872-2874)CGA>CAA	p.R958Q	NPC1_uc010xaz.1_Missense_Mutation_p.R691Q	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	958			R -> L (in NPC1).|R -> Q (in NPC1).		autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATTGTCCACTCGACAGCAAGA	0.448																0.418919	96.212617	96.637124	31	43	KEEP	---	---	---	---	20	16	27	24	-1	capture	Missense_Mutation	SNP	21119357	21119357	NPC1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10477	102
NPC1	4864	broad.mit.edu	37	18	21119839	21119839	+	Missense_Mutation	SNP	C	T	T	rs34302553	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21119839C>T	uc002kum.3	-	18	3005	c.2731G>A	c.(2731-2733)GGC>AGC	p.G911S	NPC1_uc010xaz.1_Missense_Mutation_p.G644S|NPC1_uc010xba.1_Missense_Mutation_p.G756S	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	911					autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					CAGCCCATGCCGCCGCACACC	0.547																0.370787	206.811524	209.419852	66	112	KEEP	---	---	---	---	27	43	65	62	-1	capture	Missense_Mutation	SNP	21119839	21119839	NPC1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	10477	102
NPC1	4864	broad.mit.edu	37	18	21136387	21136387	+	Silent	SNP	T	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21136387T>C	uc002kum.3	-	8	1420	c.1146A>G	c.(1144-1146)TCA>TCG	p.S382S	NPC1_uc010xaz.1_Silent_p.S183S|NPC1_uc010xba.1_Silent_p.S227S	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor	382					autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TGCTGGGGGCTGACCAGAGGT	0.567																0.346667	77.927557	79.48417	26	49	KEEP	---	---	---	---	13	15	31	21	-1	capture	Silent	SNP	21136387	21136387	NPC1	18	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	10477	102
DSG1	1828	broad.mit.edu	37	18	28908192	28908192	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28908192G>A	uc002kwp.2	+	4	469	c.257G>A	c.(256-258)CGC>CAC	p.R86H		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	86	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GTTACATACCGCATCTCTGGA	0.373																0.451923	141.621736	141.829381	47	57	KEEP	---	---	---	---	22	33	42	24	-1	capture	Missense_Mutation	SNP	28908192	28908192	DSG1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4731	102
KIAA1012	22878	broad.mit.edu	37	18	29447379	29447379	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29447379C>T	uc002kxc.3	-	17	2813	c.2449G>A	c.(2449-2451)GAA>AAA	p.E817K	KIAA1012_uc002kxb.3_Missense_Mutation_p.E763K|KIAA1012_uc002kxd.3_RNA	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	817					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						TTTGATTCTTCGCCATTAATT	0.259																0.405405	93.434914	94.014009	30	44	KEEP	---	---	---	---	18	21	19	36	-1	capture	Missense_Mutation	SNP	29447379	29447379	KIAA1012	18	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8126	102
RNF165	494470	broad.mit.edu	37	18	44036518	44036518	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44036518C>T	uc002lcb.1	+	8	1011	c.960C>T	c.(958-960)TGC>TGT	p.C320C	RNF165_uc002lby.1_Silent_p.C253C|RNF165_uc010dnn.1_Silent_p.C116C	NM_152470	NP_689683	Q6ZSG1	RN165_HUMAN	ring finger protein 165	320	RING-type; atypical.						zinc ion binding				0				READ - Rectum adenocarcinoma(1;0.0873)		ACCAACTGTGCGTGGACCAGT	0.587																0.134199	44.057834	74.067597	31	200	KEEP	---	---	---	---	14	19	107	125	-1	capture	Silent	SNP	44036518	44036518	RNF165	18	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	13348	102
TCEB3C	162699	broad.mit.edu	37	18	44554670	44554670	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44554670G>A	uc010xdb.1	-	1	1780	c.1544C>T	c.(1543-1545)GCG>GTG	p.A515V	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	515					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						GTccgcgggcgccgcgtgccg	0.373																0.022059	-96.718545	7.359841	9	399	KEEP	---	---	---	---	9	14	475	497	-1	capture	Missense_Mutation	SNP	44554670	44554670	TCEB3C	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15570	102
MAPK4	5596	broad.mit.edu	37	18	48252336	48252336	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:48252336C>T	uc002lev.2	+	5	1858	c.858C>T	c.(856-858)ATC>ATT	p.I286I	MAPK4_uc010xdm.1_Silent_p.I75I|MAPK4_uc010doz.2_Intron	NM_002747	NP_002738	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	286	Protein kinase.				cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)		CTGCAGCCATCGACTTTCTGG	0.542					110											0.410526	239.113227	240.442262	78	112	KEEP	---	---	---	---	35	53	62	66	-1	capture	Silent	SNP	48252336	48252336	MAPK4	18	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	9193	102
KCNG2	26251	broad.mit.edu	37	18	77624216	77624216	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77624216C>T	uc010xfl.1	+	1	549	c.549C>T	c.(547-549)TCC>TCT	p.S183S		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	183	Helical; Name=Segment S1; (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCTGCGTGTCCGTGTCCTTCG	0.458																0.051282	-7.858056	8.760929	4	74	KEEP	---	---	---	---	3	2	49	48	-1	capture	Silent	SNP	77624216	77624216	KCNG2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7950	102
LPPR3	79948	broad.mit.edu	37	19	813085	813085	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:813085C>T	uc002lpx.1	-	8	1706	c.1642G>A	c.(1642-1644)GCG>ACG	p.A548T	LPPR3_uc010dru.1_Intron|LPPR3_uc002lpw.1_Missense_Mutation_p.A576T|LPPR3_uc002lpy.1_Missense_Mutation_p.A329T|hsa-mir-3187|MI0014231_5'Flank	NM_024888	NP_079164	Q6T4P5	LPPR3_HUMAN	plasticity-related protein 2	548						integral to membrane	phosphatidate phosphatase activity				0						GGGCCCGGCGCGCCCGGAGCC	0.726																0.933333	45.202197	47.075382	14	1	KEEP	---	---	---	---	9	6	0	1	-1	capture	Missense_Mutation	SNP	813085	813085	LPPR3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8842	102
MLLT1	4298	broad.mit.edu	37	19	6222504	6222504	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6222504C>T	uc002mek.2	-	6	902	c.738G>A	c.(736-738)CCG>CCA	p.P246P		NM_005934	NP_005925	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	246					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1						CAGCCTTGGGCGGTGGCGCCT	0.567					190	T	MLL	AL								0.756098	93.326894	95.770272	31	10	KEEP	---	---	---	---	19	17	6	6	-1	capture	Silent	SNP	6222504	6222504	MLLT1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9537	102
MUC16	94025	broad.mit.edu	37	19	9008202	9008202	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9008202G>A	uc002mkp.2	-	41	39554	c.39350C>T	c.(39349-39351)ACC>ATC	p.T13117I	MUC16_uc010dwi.2_5'Flank|MUC16_uc010dwj.2_5'Flank|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13119	Extracellular (Potential).|SEA 7.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCGGTCCAGGGTGTAGGGGCC	0.547																0.712838	685.742226	697.742528	211	85	KEEP	---	---	---	---	120	120	43	61	-1	capture	Missense_Mutation	SNP	9008202	9008202	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9883	102
DNM2	1785	broad.mit.edu	37	19	10886407	10886407	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10886407G>A	uc002mps.1	+	4	578	c.414G>A	c.(412-414)CCG>CCA	p.P138P	DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Silent_p.P138P|DNM2_uc002mpv.1_Silent_p.P138P|DNM2_uc002mpu.1_Silent_p.P138P|DNM2_uc010dxl.1_Silent_p.P138P	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2	138	GTP (By similarity).				G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TCGACCTCCCGGGTATCACCA	0.587																0.141333	96.763819	143.263148	53	322	KEEP	---	---	---	---	32	34	155	219	-1	capture	Silent	SNP	10886407	10886407	DNM2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4628	102
CARM1	10498	broad.mit.edu	37	19	11018751	11018751	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11018751G>A	uc002mpz.2	+	3	509	c.383G>A	c.(382-384)CGG>CAG	p.R128Q	CARM1_uc010dxn.2_RNA	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine	128					cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0						AAAACCTGCCGGGGCCACACC	0.617																0.760331	321.563323	329.054528	92	29	KEEP	---	---	---	---	60	54	17	21	-1	capture	Missense_Mutation	SNP	11018751	11018751	CARM1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2631	102
MAST1	22983	broad.mit.edu	37	19	12975736	12975736	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12975736G>A	uc002mvm.2	+	13	1608	c.1480G>A	c.(1480-1482)GTG>ATG	p.V494M		NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	494	Protein kinase.				cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						CTATGGCATCGTGCACCGCGA	0.572					239											0.804878	226.096335	233.204071	66	16	KEEP	---	---	---	---	28	47	14	5	-1	capture	Missense_Mutation	SNP	12975736	12975736	MAST1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9237	102
TRMT1	55621	broad.mit.edu	37	19	13216154	13216154	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13216154C>T	uc002mwj.2	-	15	2010	c.1760G>A	c.(1759-1761)CGG>CAG	p.R587Q	LYL1_uc002mwi.2_5'Flank|TRMT1_uc010xmy.1_Missense_Mutation_p.R191Q|TRMT1_uc002mwk.2_Missense_Mutation_p.R558Q|TRMT1_uc002mwl.3_Missense_Mutation_p.R587Q|TRMT1_uc010xmz.1_3'UTR	NM_017722	NP_060192	Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 isoform 1	587							RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		CGGCTCCTTCCGCTTGTTCTG	0.622														OREG0025289	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.122449	16.43936	30.108301	12	86	KEEP	---	---	---	---	10	2	41	52	-1	capture	Missense_Mutation	SNP	13216154	13216154	TRMT1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16444	102
IL27RA	9466	broad.mit.edu	37	19	14150709	14150709	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14150709C>T	uc002mxx.2	+	4	944	c.521C>T	c.(520-522)GCG>GTG	p.A174V		NM_004843	NP_004834	Q6UWB1	I27RA_HUMAN	class I cytokine receptor precursor	174	Extracellular (Potential).|Fibronectin type-III 1.				cell surface receptor linked signaling pathway|immune response	integral to plasma membrane	transmembrane receptor activity				0						TGTCAGGAGGCGGCCTGGACC	0.592	Colon(164;1849 1896 4443 37792 47834)															0.657143	225.724227	228.033376	69	36	KEEP	---	---	---	---	37	46	21	24	-1	capture	Missense_Mutation	SNP	14150709	14150709	IL27RA	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7604	102
SLC27A1	376497	broad.mit.edu	37	19	17612106	17612106	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17612106C>T	uc002ngu.1	+	11	1711	c.1661C>T	c.(1660-1662)GCG>GTG	p.A554V	SLC27A1_uc010xpp.1_Missense_Mutation_p.A375V|SLC27A1_uc002ngv.1_Missense_Mutation_p.A156V	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1	554	Cytoplasmic (Potential).				cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						GCAGGGATGGCGGCCGTCGCA	0.647																0.115385	8.433566	19.703924	9	69	KEEP	---	---	---	---	5	5	40	38	-1	capture	Missense_Mutation	SNP	17612106	17612106	SLC27A1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14417	102
NCAN	1463	broad.mit.edu	37	19	19356151	19356151	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19356151G>A	uc002nlz.2	+	13	3621	c.3522G>A	c.(3520-3522)CCG>CCA	p.P1174P	NCAN_uc002nma.2_Intron	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1174	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			AGAACCAGCCGGACAATTTCT	0.572																0.771429	187.386102	192.118943	54	16	KEEP	---	---	---	---	33	32	8	9	-1	capture	Silent	SNP	19356151	19356151	NCAN	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10111	102
NPHS1	4868	broad.mit.edu	37	19	36340484	36340484	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36340484G>A	uc002oby.2	-	6	680	c.680C>T	c.(679-681)CCC>CTC	p.P227L		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	227	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCCTTGATGGGGGCCTCCAG	0.587																0.689655	207.631883	210.420775	60	27	KEEP	---	---	---	---	28	42	12	18	-1	capture	Missense_Mutation	SNP	36340484	36340484	NPHS1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10489	102
SIPA1L3	23094	broad.mit.edu	37	19	38590640	38590640	+	Silent	SNP	G	A	A	rs142598144		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38590640G>A	uc002ohk.2	+	5	2213	c.1704G>A	c.(1702-1704)ACG>ACA	p.T568T		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	568					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AAGATGCTACGCCCACAGCCA	0.607																0.68595	263.442838	267.161632	83	38	KEEP	---	---	---	---	48	43	19	26	-1	capture	Silent	SNP	38590640	38590640	SIPA1L3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14224	102
SPTBN4	57731	broad.mit.edu	37	19	41009787	41009787	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41009787C>T	uc002ony.2	+	12	1499	c.1413C>T	c.(1411-1413)CAC>CAT	p.H471H	SPTBN4_uc002onx.2_Silent_p.H471H|SPTBN4_uc002onz.2_Silent_p.H471H	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	471	Spectrin 3.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGAAGAAACACGAAGCGATCG	0.622																0.757576	84.0904	86.086171	25	8	KEEP	---	---	---	---	14	17	8	2	-1	capture	Silent	SNP	41009787	41009787	SPTBN4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15013	102
ARHGEF1	9138	broad.mit.edu	37	19	42398544	42398544	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42398544G>A	uc002orx.2	+	10	874	c.765G>A	c.(763-765)TCG>TCA	p.S255S	ARHGEF1_uc002orw.1_Silent_p.S255S|ARHGEF1_uc002ory.2_Silent_p.S222S|ARHGEF1_uc002orz.2_Silent_p.S93S|ARHGEF1_uc002osa.2_Silent_p.S270S|ARHGEF1_uc002osb.2_Silent_p.S237S|ARHGEF1_uc002osc.2_5'Flank|ARHGEF1_uc002osd.2_5'Flank	NM_004706	NP_004697	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform	255					cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		ACCGGCGGTCGGACGAGCCTG	0.622																0.52459	97.602334	97.635201	32	29	KEEP	---	---	---	---	22	13	12	19	-1	capture	Silent	SNP	42398544	42398544	ARHGEF1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	886	102
DEDD2	162989	broad.mit.edu	37	19	42703643	42703643	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42703643G>A	uc002osu.1	-	5	996	c.928C>T	c.(928-930)CGC>TGC	p.R310C	DEDD2_uc002osv.1_RNA|DEDD2_uc002osw.1_Missense_Mutation_p.R305C|DEDD2_uc002osx.1_3'UTR|DEDD2_uc002osy.1_Missense_Mutation_p.R310C	NM_133328	NP_579874	Q8WXF8	DEDD2_HUMAN	death effector domain-containing  DNA binding	310					activation of pro-apoptotic gene products|apoptotic nuclear change|cellular homeostasis|induction of apoptosis via death domain receptors|intracellular signal transduction|negative regulation of transcription, DNA-dependent|RNA processing|rRNA catabolic process|transcription, DNA-dependent	nucleolus	DNA binding|receptor signaling complex scaffold activity				0		Prostate(69;0.0704)				AGCAACAGGCGGCGCCGGCCA	0.672																0.070175	-2.848427	7.931858	4	53	KEEP	---	---	---	---	2	2	20	37	-1	capture	Missense_Mutation	SNP	42703643	42703643	DEDD2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4343	102
PSG8	440533	broad.mit.edu	37	19	43259226	43259226	+	Missense_Mutation	SNP	G	A	A	rs150991804		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43259226G>A	uc002ouo.2	-	4	1000	c.902C>T	c.(901-903)ACG>ATG	p.T301M	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc010eim.2_Intron|PSG8_uc002oui.2_Missense_Mutation_p.T140M|PSG8_uc002ouh.2_Missense_Mutation_p.T301M|PSG8_uc010ein.2_Missense_Mutation_p.T179M|PSG8_uc002ouj.3_Missense_Mutation_p.T83M|PSG8_uc002ouk.3_Missense_Mutation_p.T140M|PSG8_uc002oul.3_Missense_Mutation_p.T301M|PSG8_uc002oum.3_Missense_Mutation_p.T208M|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Missense_Mutation_p.T208M	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	301	Ig-like C2-type 2.					extracellular region					0		Prostate(69;0.00899)				TTCATTTCTCGTGACACTGGG	0.478																0.718447	497.262619	506.093735	148	58	KEEP	---	---	---	---	81	111	77	79	-1	capture	Missense_Mutation	SNP	43259226	43259226	PSG8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12556	102
EML2	24139	broad.mit.edu	37	19	46137650	46137650	+	Missense_Mutation	SNP	C	T	T	rs143778766		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46137650C>T	uc002pcn.2	-	4	294	c.259G>A	c.(259-261)GTA>ATA	p.V87I	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Missense_Mutation_p.V234I|EML2_uc010xxm.1_Missense_Mutation_p.V288I|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Missense_Mutation_p.V87I|EML2_uc010ekj.2_Missense_Mutation_p.V87I	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	87					sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		AGCACGGCTACGGAGGCCACA	0.607																0.685185	119.086325	120.732542	37	17	KEEP	---	---	---	---	22	21	9	10	-1	capture	Missense_Mutation	SNP	46137650	46137650	EML2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5052	102
SYMPK	8189	broad.mit.edu	37	19	46345702	46345702	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46345702C>T	uc002pdn.2	-	9	1138	c.893G>A	c.(892-894)CGT>CAT	p.R298H	SYMPK_uc002pdo.1_Missense_Mutation_p.R298H|SYMPK_uc002pdp.1_Missense_Mutation_p.R298H|SYMPK_uc002pdq.1_Missense_Mutation_p.R298H	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	298					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAGATTCTTACGCACACTGCT	0.592																0.731092	287.438484	293.166954	87	32	KEEP	---	---	---	---	35	64	15	22	-1	capture	Missense_Mutation	SNP	46345702	46345702	SYMPK	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15327	102
SYMPK	8189	broad.mit.edu	37	19	46351088	46351088	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46351088C>T	uc002pdn.2	-	7	843	c.598G>A	c.(598-600)GAC>AAC	p.D200N	SYMPK_uc002pdo.1_Missense_Mutation_p.D200N|SYMPK_uc002pdp.1_Missense_Mutation_p.D200N|SYMPK_uc002pdq.1_Missense_Mutation_p.D200N	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	200					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		ATCTCTGAGTCAGCCATGCGG	0.577																0.549296	119.227692	119.377461	39	32	KEEP	---	---	---	---	16	28	16	22	-1	capture	Missense_Mutation	SNP	46351088	46351088	SYMPK	19	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	15327	102
GRIN2D	2906	broad.mit.edu	37	19	48945047	48945047	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48945047C>T	uc002pjc.3	+	11	2362	c.2274C>T	c.(2272-2274)TAC>TAT	p.Y758Y	GRIN2D_uc010elx.2_Translation_Start_Site	NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	758	Extracellular (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	CCTTCATCTACGATGCTGCAG	0.622																0.288462	41.113276	43.193867	15	37	KEEP	---	---	---	---	8	8	24	17	-1	capture	Silent	SNP	48945047	48945047	GRIN2D	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6715	102
TSKS	60385	broad.mit.edu	37	19	50243103	50243103	+	Missense_Mutation	SNP	G	A	A	rs141726866	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50243103G>A	uc002ppm.2	-	11	1720	c.1709C>T	c.(1708-1710)ACG>ATG	p.T570M		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	570							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CATTGTTCCCGTGGACCCCTC	0.562																0.740458	321.221111	328.082856	97	34	KEEP	---	---	---	---	49	55	12	25	-1	capture	Missense_Mutation	SNP	50243103	50243103	TSKS	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16509	102
SIGLEC6	946	broad.mit.edu	37	19	52034117	52034117	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52034117C>T	uc002pwy.2	-	3	686	c.524G>A	c.(523-525)GGG>GAG	p.G175E	SIGLEC6_uc002pwz.2_Missense_Mutation_p.G175E|SIGLEC6_uc002pxa.2_Missense_Mutation_p.G175E|SIGLEC6_uc010ydb.1_Missense_Mutation_p.G128E|SIGLEC6_uc010ydc.1_Missense_Mutation_p.G164E|SIGLEC6_uc010eoz.1_Missense_Mutation_p.G153E|SIGLEC6_uc010epb.1_Missense_Mutation_p.G128E|SIGLEC6_uc010epa.1_Missense_Mutation_p.G164E	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1	175	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GGGGGGCGTCCCCTGCTCACA	0.667																0.029762	-31.186254	9.527942	5	163	KEEP	---	---	---	---	4	1	81	103	-1	capture	Missense_Mutation	SNP	52034117	52034117	SIGLEC6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	14205	102
FPR1	2357	broad.mit.edu	37	19	52249297	52249297	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52249297G>A	uc002pxq.2	-	2	1046	c.951C>T	c.(949-951)CCC>CCT	p.P317P		NM_002029	NP_002020	P21462	FPR1_HUMAN	formyl peptide receptor 1	317	Cytoplasmic (Potential).				activation of MAPK activity|cellular component movement|chemotaxis|G-protein signaling, coupled to cAMP nucleotide second messenger|nitric oxide mediated signal transduction	endosome|integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)|lung(1)|skin(1)	3		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	CCAGACTGGCGGGAAGGGCGT	0.557																0.810219	393.0035	405.337104	111	26	KEEP	---	---	---	---	45	76	13	18	-1	capture	Silent	SNP	52249297	52249297	FPR1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5982	102
ASAP2	8853	broad.mit.edu	37	2	9517083	9517083	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:9517083G>A	uc002qzh.2	+	18	2133	c.1793G>A	c.(1792-1794)CGA>CAA	p.R598Q	ASAP2_uc002qzi.2_Missense_Mutation_p.R598Q	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	598	ANK 1.				regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						TCCGTGGATCGAACCTCTCTT	0.448																0.690647	322.240744	326.742035	96	43	KEEP	---	---	---	---	62	56	30	29	-1	capture	Missense_Mutation	SNP	9517083	9517083	ASAP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1002	102
GALNT14	79623	broad.mit.edu	37	2	31167749	31167749	+	Missense_Mutation	SNP	G	A	A	rs143143842	by1000genomes	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31167749G>A	uc002rnr.2	-	8	1421	c.802C>T	c.(802-804)CGC>TGC	p.R268C	GALNT14_uc002rnq.2_Missense_Mutation_p.R248C|GALNT14_uc002rns.2_Missense_Mutation_p.R273C|GALNT14_uc010ymr.1_Missense_Mutation_p.R233C|GALNT14_uc010ezo.1_Missense_Mutation_p.R235C|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848	Q96FL9	GLT14_HUMAN	N-acetylgalactosaminyltransferase 14	268	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					GGGTCCAGGCGCCGAGCCTTC	0.587																0.04	-14.78509	8.020718	4	96	KEEP	---	---	---	---	2	2	50	60	-1	capture	Missense_Mutation	SNP	31167749	31167749	GALNT14	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6152	102
ARHGAP25	9938	broad.mit.edu	37	2	69034467	69034467	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:69034467G>A	uc002seu.2	+	5	890	c.526G>A	c.(526-528)GTG>ATG	p.V176M	ARHGAP25_uc010yqk.1_Missense_Mutation_p.V151M|ARHGAP25_uc010fdg.2_Missense_Mutation_p.V177M|ARHGAP25_uc010yql.1_Missense_Mutation_p.V137M|ARHGAP25_uc002sev.2_Missense_Mutation_p.V170M|ARHGAP25_uc002sew.2_Missense_Mutation_p.V169M|ARHGAP25_uc002sex.2_Missense_Mutation_p.V170M|ARHGAP25_uc010fdh.1_RNA|ARHGAP25_uc002sey.2_Translation_Start_Site	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	176	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						CCCCCATCTGGTGCCCATCCT	0.562																0.064516	-3.252224	8.970335	4	58	KEEP	---	---	---	---	5	0	28	32	-1	capture	Missense_Mutation	SNP	69034467	69034467	ARHGAP25	2	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	867	102
C2orf68	388969	broad.mit.edu	37	2	85836146	85836146	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85836146C>T	uc002sqc.2	-	4	495	c.423G>A	c.(421-423)ACG>ACA	p.T141T	USP39_uc002sqb.2_Intron	NM_001013649	NP_001013671	Q2NKX9	CB068_HUMAN	hypothetical protein LOC388969	141										central_nervous_system(1)	1						GATCCAGAGGCGTGTGTGCCG	0.572																0.676056	156.050048	158.032582	48	23	KEEP	---	---	---	---	35	19	16	10	-1	capture	Silent	SNP	85836146	85836146	C2orf68	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2167	102
TBC1D8	11138	broad.mit.edu	37	2	101656773	101656773	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:101656773G>A	uc010fiv.2	-	6	1033	c.902C>T	c.(901-903)GCG>GTG	p.A301V	TBC1D8_uc010yvw.1_Missense_Mutation_p.A316V|TBC1D8_uc002tau.3_Missense_Mutation_p.A58V	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	301	GRAM 2.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						GTCCACAACCGCGTGCAGCTT	0.577																0.170732	13.197835	17.403294	7	34	KEEP	---	---	---	---	5	4	15	24	-1	capture	Missense_Mutation	SNP	101656773	101656773	TBC1D8	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15512	102
TUBA3D	113457	broad.mit.edu	37	2	132238322	132238322	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132238322G>T	uc002tsu.3	+	4	1163	c.1056G>T	c.(1054-1056)AAG>AAT	p.K352N		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	352					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)		CTGGATTTAAGGTATGACTGG	0.552	Ovarian(137;2059 2432 35543 39401)															0.046512	-11.67267	7.195369	4	82	KEEP	---	---	---	---	2	2	49	48	0.5	capture	Missense_Mutation	SNP	132238322	132238322	TUBA3D	2	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	16629	102
TANC1	85461	broad.mit.edu	37	2	160074082	160074082	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160074082C>T	uc002uag.2	+	20	3593	c.3319C>T	c.(3319-3321)CGG>TGG	p.R1107W	TANC1_uc010zcm.1_Missense_Mutation_p.R1099W|TANC1_uc010fom.1_Missense_Mutation_p.R913W|TANC1_uc010fon.2_5'UTR	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1107	ANK 6.					cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TGCTGTGTCGCGGACAAACAG	0.597																0.081871	2.169707	32.553547	14	157	KEEP	---	---	---	---	5	11	81	89	-1	capture	Missense_Mutation	SNP	160074082	160074082	TANC1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15432	102
TTN	7273	broad.mit.edu	37	2	179396884	179396884	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179396884C>T	uc010zfg.1	-	307	96978	c.96754G>A	c.(96754-96756)GAA>AAA	p.E32252K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E25947K|TTN_uc010zfi.1_Missense_Mutation_p.E25880K|TTN_uc010zfj.1_Missense_Mutation_p.E25755K|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33179							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTGAGATTTCGTATTCTTCC	0.413				p.E32252K(SNU283-Tumor)	8722											0.727273	107.517406	109.565418	32	12	KEEP	---	---	---	---	17	16	8	6	-1	capture	Missense_Mutation	SNP	179396884	179396884	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16617	102
SPATS2L	26010	broad.mit.edu	37	2	201337625	201337625	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201337625C>T	uc002uvn.3	+	12	1483	c.1131C>T	c.(1129-1131)CAC>CAT	p.H377H	SPATS2L_uc010fst.2_Silent_p.H377H|SPATS2L_uc002uvo.3_Silent_p.H317H|SPATS2L_uc002uvp.3_Silent_p.H377H|SPATS2L_uc002uvq.3_Silent_p.H308H|SPATS2L_uc002uvr.3_Silent_p.H377H|SPATS2L_uc010zhc.1_Silent_p.H407H	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a	377						cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						TGAATGCGCACGCAGCAACCT	0.483																0.100775	10.282463	30.802546	13	116	KEEP	---	---	---	---	6	8	53	81	-1	capture	Silent	SNP	201337625	201337625	SPATS2L	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14912	102
PID1	55022	broad.mit.edu	37	2	230020577	230020577	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:230020577G>A	uc002vpr.3	-	2	271	c.233C>T	c.(232-234)ACG>ATG	p.T78M	PID1_uc002vps.3_Missense_Mutation_p.T76M|PID1_uc002vpt.3_Missense_Mutation_p.T45M|PID1_uc002vpu.3_Intron	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	78						cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		CGGTGTGGTCGTGCACAGCTC	0.517																0.14	34.985321	53.747079	21	129	KEEP	---	---	---	---	11	14	75	64	-1	capture	Missense_Mutation	SNP	230020577	230020577	PID1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11785	102
UGT1A9	54600	broad.mit.edu	37	2	234580843	234580843	+	Missense_Mutation	SNP	G	A	A	rs148603525	by1000genomes	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234580843G>A	uc002vus.2	+	1	300	c.263G>A	c.(262-264)CGG>CAG	p.R88Q	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Missense_Mutation_p.R88Q	NM_021027	NP_066307	O60656	UD19_HUMAN	UDP glycosyltransferase 1 family, polypeptide A9	88					drug metabolic process|flavone metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|retinoic acid binding			ovary(3)|breast(1)|skin(1)	5		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Entacapone(DB00494)|Etodolac(DB00749)|Indomethacin(DB00328)|Irinotecan(DB00762)|Mycophenolic acid(DB01024)|Oxyphenonium(DB00219)|Propofol(DB00818)|Sorafenib(DB00398)	GATCTGGACCGGGAGTTCAAG	0.408																0.693878	244.938846	248.224577	68	30	KEEP	---	---	---	---	41	39	11	23	-1	capture	Missense_Mutation	SNP	234580843	234580843	UGT1A9	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16834	102
TRPM8	79054	broad.mit.edu	37	2	234851383	234851383	+	Silent	SNP	C	T	T	rs147774253		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234851383C>T	uc002vvh.2	+	6	730	c.690C>T	c.(688-690)TGC>TGT	p.C230C	TRPM8_uc010fyj.2_5'UTR|TRPM8_uc002vvi.3_Silent_p.C180C|TRPM8_uc002vvj.3_Silent_p.C153C	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	230	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	TCAGGAATTGCGATGCTGAGG	0.562					505											0.461538	170.54815	170.697585	54	63	KEEP	---	---	---	---	36	26	32	35	-1	capture	Silent	SNP	234851383	234851383	TRPM8	2	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	16475	102
KIF1A	547	broad.mit.edu	37	2	241728662	241728662	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241728662C>T	uc002vzy.2	-	3	320	c.174G>A	c.(172-174)TCG>TCA	p.S58S	KIF1A_uc010fzk.2_Silent_p.S58S|KIF1A_uc002vzz.1_Silent_p.S58S	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	58	Kinesin-motor.				anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CTGAGGTGTGCGACCAGTAGG	0.612																0.698413	138.414349	140.628614	44	19	KEEP	---	---	---	---	29	21	9	13	-1	capture	Silent	SNP	241728662	241728662	KIF1A	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8205	102
PREX1	57580	broad.mit.edu	37	20	47249039	47249039	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47249039G>A	uc002xtw.1	-	34	4429	c.4406C>T	c.(4405-4407)ACG>ATG	p.T1469M	PREX1_uc002xtv.1_Missense_Mutation_p.T766M	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1469					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CTCACCTTTCGTGAACAGCGC	0.677																0.05814	-7.689598	9.910554	5	81	KEEP	---	---	---	---	1	4	45	47	-1	capture	Missense_Mutation	SNP	47249039	47249039	PREX1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12372	102
EEF1A2	1917	broad.mit.edu	37	20	62126254	62126254	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62126254G>A	uc002yfd.1	-	3	626	c.525C>T	c.(523-525)AGC>AGT	p.S175S	EEF1A2_uc002yfe.1_Silent_p.S175S|EEF1A2_uc010gkg.1_Silent_p.S175S	NM_001958	NP_001949	Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha	175						nucleus	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			TGATGTAGGCGCTGACTTCCT	0.602																0.746835	192.246708	196.619679	59	20	KEEP	---	---	---	---	33	32	9	11	-1	capture	Silent	SNP	62126254	62126254	EEF1A2	20	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	4879	102
ADAMTS5	11096	broad.mit.edu	37	21	28338467	28338467	+	Missense_Mutation	SNP	A	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:28338467A>C	uc002ymg.2	-	1	973	c.244T>G	c.(244-246)TCC>GCC	p.S82A		NM_007038	NP_008969	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1	82					proteolysis	proteinaceous extracellular matrix	integrin binding|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						CCGCCGCCGGAGTAGAGTTGG	0.697	Esophageal Squamous(53;683 1080 10100 14424 45938)															0.737864	232.605006	237.866931	76	27	KEEP	---	---	---	---	40	51	20	10	-1	capture	Missense_Mutation	SNP	28338467	28338467	ADAMTS5	21	A	C	C	C	1	0	0	0	0	1	0	0	0	143	11	4	4	269	102
HSF2BP	11077	broad.mit.edu	37	21	44949729	44949729	+	Missense_Mutation	SNP	G	A	A	rs138290442	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:44949729G>A	uc002zdi.2	-	9	1242	c.910C>T	c.(910-912)CGC>TGC	p.R304C	HSF2BP_uc011aey.1_Missense_Mutation_p.R229C	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding	304					spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		GCCAGGATGCGTTGCAGGGGC	0.587																0.061538	-10.078463	15.982566	8	122	KEEP	---	---	---	---	3	5	70	63	-1	capture	Missense_Mutation	SNP	44949729	44949729	HSF2BP	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7322	102
ICOSLG	23308	broad.mit.edu	37	21	45657075	45657075	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45657075C>T	uc002zee.2	-	3	215	c.81G>A	c.(79-81)GCG>GCA	p.A27A	ICOSLG_uc011afc.1_Intron|ICOSLG_uc002zef.2_Intron|ICOSLG_uc010gpp.1_Silent_p.A27A	NM_015259	NP_056074	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand precursor	27	Ig-like V-type.|Extracellular (Potential).				B cell activation|defense response|hyperosmotic response|positive regulation of activated T cell proliferation|signal transduction|T cell activation|T cell costimulation		receptor binding				0				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		TGCCTACCATCGCTCTGACTT	0.498																0.123711	16.635578	30.064319	12	85	KEEP	---	---	---	---	6	6	47	55	-1	capture	Silent	SNP	45657075	45657075	ICOSLG	21	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	7412	102
PFKL	5211	broad.mit.edu	37	21	45732042	45732042	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45732042C>T	uc002zel.2	+	4	351	c.292C>T	c.(292-294)CGC>TGC	p.R98C	PFKL_uc002zek.2_Missense_Mutation_p.R145C|PFKL_uc011afd.1_Missense_Mutation_p.R145C	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase	98					fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		CAGGGAGGGGCGCCGGGCAGC	0.642																0.583333	20.72675	20.799828	7	5	KEEP	---	---	---	---	4	4	4	1	-1	capture	Missense_Mutation	SNP	45732042	45732042	PFKL	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11667	102
MICAL3	57553	broad.mit.edu	37	22	18301786	18301786	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:18301786G>A	uc002zng.3	-	26	3994	c.3641C>T	c.(3640-3642)TCG>TTG	p.S1214L	MICAL3_uc011agl.1_Missense_Mutation_p.S1130L	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	1214	Pro-rich.					cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		TTTCAGATCCGAGGGGGCATC	0.622																0.565217	84.062989	84.235955	26	20	KEEP	---	---	---	---	19	9	6	15	-1	capture	Missense_Mutation	SNP	18301786	18301786	MICAL3	22	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9483	102
TSSK2	23617	broad.mit.edu	37	22	19119833	19119833	+	Silent	SNP	C	T	T	rs150037057		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19119833C>T	uc002zow.2	+	1	1513	c.921C>T	c.(919-921)CCC>CCT	p.P307P	DGCR14_uc002zot.2_3'UTR|DGCR14_uc002zou.2_3'UTR|DGCR14_uc002zov.2_RNA	NM_053006	NP_443732	Q96PF2	TSSK2_HUMAN	testis-specific serine kinase 2	307					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)	1	Colorectal(54;0.0993)					GCTTGAGGCCCGACCACCGGC	0.637					13											0.685185	119.507167	121.180746	37	17	KEEP	---	---	---	---	18	23	13	8	-1	capture	Silent	SNP	19119833	19119833	TSSK2	22	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16551	102
HIRA	7290	broad.mit.edu	37	22	19398254	19398254	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19398254C>T	uc002zpf.1	-	2	305	c.85G>A	c.(85-87)GCA>ACA	p.A29T	HIRA_uc011agx.1_5'UTR|HIRA_uc010grn.1_Missense_Mutation_p.A29T|HIRA_uc010gro.1_5'UTR|HIRA_uc010grp.2_RNA	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	29	WD 1.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					CCTCCAGTTGCGAACTTGGTC	0.408																0.038567	-55.896057	27.551902	14	349	KEEP	---	---	---	---	4	11	178	234	-1	capture	Missense_Mutation	SNP	19398254	19398254	HIRA	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7045	102
TFIP11	24144	broad.mit.edu	37	22	26906086	26906086	+	Silent	SNP	G	A	A	rs150326842	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26906086G>A	uc003acr.2	-	3	527	c.153C>T	c.(151-153)TAC>TAT	p.Y51Y	TFIP11_uc003acs.2_Silent_p.Y51Y|TFIP11_uc003act.2_Silent_p.Y51Y	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	51					biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0						CCCACACCCCGTAGGTGGCTT	0.567																0.767123	376.470217	386.011173	112	34	KEEP	---	---	---	---	56	73	19	21	-1	capture	Silent	SNP	26906086	26906086	TFIP11	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15692	102
MCM5	4174	broad.mit.edu	37	22	35802697	35802697	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:35802697C>T	uc003anu.3	+	5	669	c.575C>T	c.(574-576)GCC>GTC	p.A192V	MCM5_uc010gwr.2_Missense_Mutation_p.P2S|MCM5_uc003anv.3_Missense_Mutation_p.A149V|MCM5_uc010gws.1_5'Flank	NM_006739	NP_006730	P33992	MCM5_HUMAN	minichromosome maintenance complex component 5	192					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)	1						GAGGGCTATGCCCTGCCCAGG	0.602																0.054545	-4.921854	6.577692	3	52	KEEP	---	---	---	---	3	1	17	41	-1	capture	Missense_Mutation	SNP	35802697	35802697	MCM5	22	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9303	102
CSF2RB	1439	broad.mit.edu	37	22	37328885	37328885	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37328885G>A	uc003aqa.3	+	9	1308	c.1091G>A	c.(1090-1092)CGA>CAA	p.R364Q	CSF2RB_uc003aqc.3_Missense_Mutation_p.R370Q	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	364	Extracellular (Potential).|Fibronectin type-III 2.				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	ATGAAAATGCGATACGAACAC	0.552																0.595745	93.309561	93.686732	28	19	KEEP	---	---	---	---	13	18	7	12	-1	capture	Missense_Mutation	SNP	37328885	37328885	CSF2RB	22	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3900	102
FAM19A5	25817	broad.mit.edu	37	22	49042484	49042484	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:49042484G>A	uc003bim.3	+	2	305	c.188G>A	c.(187-189)CGG>CAG	p.R63Q	FAM19A5_uc003bio.3_Missense_Mutation_p.R56Q	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine	63						extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		ACGATCGCCCGGCAGACCGCC	0.692																0.071429	-0.809619	7.139522	3	39	KEEP	---	---	---	---	2	1	27	19	-1	capture	Missense_Mutation	SNP	49042484	49042484	FAM19A5	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5487	102
MOV10L1	54456	broad.mit.edu	37	22	50596540	50596540	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50596540G>A	uc003bjj.2	+	23	3204	c.3121G>A	c.(3121-3123)GTC>ATC	p.V1041I	MOV10L1_uc003bjk.3_Missense_Mutation_p.V1041I|MOV10L1_uc011arp.1_Missense_Mutation_p.V1021I|MOV10L1_uc003bjl.2_Missense_Mutation_p.V168I|MOV10L1_uc003bjm.1_Missense_Mutation_p.V84I	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	1041					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		GGCCGAGGCCGTCCAGGTCCT	0.567																0.810345	308.393549	318.834936	94	22	KEEP	---	---	---	---	45	61	14	11	-1	capture	Missense_Mutation	SNP	50596540	50596540	MOV10L1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9631	102
NCAPH2	29781	broad.mit.edu	37	22	50957116	50957116	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50957116G>A	uc003blr.3	+	8	807	c.685G>A	c.(685-687)GTG>ATG	p.V229M	NCAPH2_uc003blq.3_Missense_Mutation_p.V229M|NCAPH2_uc003blv.2_Missense_Mutation_p.V229M|NCAPH2_uc010hbb.2_Missense_Mutation_p.V80M|NCAPH2_uc003blu.3_RNA|NCAPH2_uc003bls.3_RNA|NCAPH2_uc003blt.3_RNA|NCAPH2_uc003blw.3_RNA|NCAPH2_uc003blx.3_Missense_Mutation_p.V229M|NCAPH2_uc003bly.3_RNA	NM_152299	NP_689512	Q6IBW4	CNDH2_HUMAN	kleisin beta isoform 2	229					chromosome condensation	chromosome|nucleus				ovary(1)|skin(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		GGAAGTTTCCGTGTGCAGGAG	0.647																0.75	59.160655	60.524676	18	6	KEEP	---	---	---	---	10	11	5	2	-1	capture	Missense_Mutation	SNP	50957116	50957116	NCAPH2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10117	102
IL5RA	3568	broad.mit.edu	37	3	3139680	3139680	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:3139680C>T	uc011ask.1	-	8	1227	c.583G>A	c.(583-585)GCA>ACA	p.A195T	IL5RA_uc010hbq.2_Missense_Mutation_p.A195T|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Missense_Mutation_p.A195T|IL5RA_uc011asl.1_Missense_Mutation_p.A195T|IL5RA_uc011asm.1_Missense_Mutation_p.A195T|IL5RA_uc010hbt.2_Missense_Mutation_p.A195T|IL5RA_uc011asn.1_Missense_Mutation_p.A195T|IL5RA_uc010hbu.2_Missense_Mutation_p.A195T	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	195	Extracellular (Potential).				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		AACCAGCATGCGATATTTCTC	0.483	GBM(169;430 2801 24955 28528)															0.731707	292.191276	298.151296	90	33	KEEP	---	---	---	---	45	55	21	15	-1	capture	Missense_Mutation	SNP	3139680	3139680	IL5RA	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7623	102
SCN5A	6331	broad.mit.edu	37	3	38620857	38620857	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38620857T>C	uc003cio.2	-	18	3552	c.3358A>G	c.(3358-3360)AAA>GAA	p.K1120E	SCN5A_uc003cin.2_Missense_Mutation_p.K1119E|SCN5A_uc003cil.3_Missense_Mutation_p.K1120E|SCN5A_uc010hhi.2_Missense_Mutation_p.K1120E|SCN5A_uc010hhk.2_Missense_Mutation_p.K1119E|SCN5A_uc011ayr.1_Intron|SCN5A_uc010hhj.1_Missense_Mutation_p.K730E	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1120					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GGTTCCGCTTTCCACTGCTGC	0.662																0.666667	68.459369	69.123636	18	9	KEEP	---	---	---	---	9	9	6	5	-1	capture	Missense_Mutation	SNP	38620857	38620857	SCN5A	3	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	13815	102
TTC21A	199223	broad.mit.edu	37	3	39152446	39152446	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39152446C>T	uc003cjc.2	+	4	550	c.373C>T	c.(373-375)CGC>TGC	p.R125C	TTC21A_uc003cja.2_Missense_Mutation_p.R125C|TTC21A_uc010hho.1_Missense_Mutation_p.R88C|TTC21A_uc003cjb.2_Intron|TTC21A_uc003cje.2_Missense_Mutation_p.R125C|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.R125C	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	125	TPR 2.						binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GCTCATAGGCCGCCATGACAA	0.502																0.754386	151.052476	154.413774	43	14	KEEP	---	---	---	---	19	29	5	10	-1	capture	Missense_Mutation	SNP	39152446	39152446	TTC21A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16569	102
NBEAL2	23218	broad.mit.edu	37	3	47040042	47040042	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47040042C>T	uc003cqp.2	+	22	3387	c.3208C>T	c.(3208-3210)CGC>TGC	p.R1070C	NBEAL2_uc010hjm.1_Missense_Mutation_p.R631C	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1070							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GGATGCTCTGCGCACCCACTA	0.612														OREG0015546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.555556	47.118071	47.189891	15	12	KEEP	---	---	---	---	5	13	6	6	-1	capture	Missense_Mutation	SNP	47040042	47040042	NBEAL2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10096	102
NCKIPSD	51517	broad.mit.edu	37	3	48719898	48719898	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48719898G>C	uc003cun.2	-	3	463	c.369C>G	c.(367-369)GAC>GAG	p.D123E	NCKIPSD_uc003cum.2_Missense_Mutation_p.D123E|NCKIPSD_uc010hkh.1_Missense_Mutation_p.D123E	NM_016453	NP_057537	Q9NZQ3	SPN90_HUMAN	NCK interacting protein with SH3 domain isoform	123					cytoskeleton organization|NLS-bearing substrate import into nucleus|signal transduction	intermediate filament|nucleus	cytoskeletal protein binding|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCAAGTGGTGGTCACTGGTTG	0.592					56											0.031847	-25.941848	11.669617	5	152	KEEP	---	---	---	---	1	4	65	95	-1	capture	Missense_Mutation	SNP	48719898	48719898	NCKIPSD	3	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	10132	102
P4HTM	54681	broad.mit.edu	37	3	49043241	49043241	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49043241G>A	uc003cvg.2	+	7	1454	c.1105G>A	c.(1105-1107)GTC>ATC	p.V369I	P4HTM_uc003cvh.2_Missense_Mutation_p.V430I|WDR6_uc011bbx.1_5'Flank|WDR6_uc003cvj.2_5'Flank|WDR6_uc011bby.1_5'Flank|WDR6_uc010hkn.2_5'Flank|WDR6_uc011bbz.1_5'Flank	NM_177939	NP_808808	Q9NXG6	P4HTM_HUMAN	hypoxia-inducible factor prolyl 4-hydroxylase	369	Lumenal (Potential).|Fe2OG dioxygenase.					endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)	TTTGAACAACGTCACTGGTGG	0.542																0.028986	-26.717247	6.95665	4	134	KEEP	---	---	---	---	2	2	64	84	-1	capture	Missense_Mutation	SNP	49043241	49043241	P4HTM	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11264	102
TMF1	7110	broad.mit.edu	37	3	69097037	69097037	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:69097037C>T	uc003dnn.2	-	2	1066	c.819G>A	c.(817-819)GCG>GCA	p.A273A	TMF1_uc011bfx.1_Silent_p.A273A	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	273					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GTCTCGAGCTCGCTGAGCTCT	0.398																0.741379	145.251214	148.314397	43	15	KEEP	---	---	---	---	20	23	5	10	-1	capture	Silent	SNP	69097037	69097037	TMF1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16111	102
FILIP1L	11259	broad.mit.edu	37	3	99568062	99568062	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:99568062G>A	uc003dtm.2	-	5	2921	c.2458C>T	c.(2458-2460)CGT>TGT	p.R820C	C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Missense_Mutation_p.R820C|FILIP1L_uc010hpf.2_Missense_Mutation_p.R396C|FILIP1L_uc010hpg.2_Missense_Mutation_p.R580C|FILIP1L_uc003dtn.2_Missense_Mutation_p.R580C|FILIP1L_uc003dtp.1_Missense_Mutation_p.R580C	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1	820						cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						ATGACTGCACGTTCCAGAGGA	0.438																0.455357	313.137849	313.524419	102	122	KEEP	---	---	---	---	64	51	59	73	-1	capture	Missense_Mutation	SNP	99568062	99568062	FILIP1L	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5840	102
KALRN	8997	broad.mit.edu	37	3	124017688	124017688	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:124017688G>A	uc003ehg.2	+	6	1141	c.1014G>A	c.(1012-1014)ACG>ACA	p.T338T	KALRN_uc010hrv.1_Silent_p.T338T|KALRN_uc003ehf.1_Silent_p.T338T|KALRN_uc011bjy.1_Silent_p.T338T	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	338	Spectrin 2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AGAGCCACACGGAGATCGGAG	0.512					1865											0.564972	337.527029	338.1795	100	77	KEEP	---	---	---	---	54	54	29	54	-1	capture	Silent	SNP	124017688	124017688	KALRN	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7898	102
ZNF148	7707	broad.mit.edu	37	3	124951615	124951615	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:124951615G>A	uc003ehx.3	-	9	2441	c.1955C>T	c.(1954-1956)GCC>GTC	p.A652V	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.A652V|ZNF148_uc010hsa.2_Missense_Mutation_p.A652V|ZNF148_uc003eia.3_Missense_Mutation_p.A652V|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	652					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						GGGCATGGTGGCATAGACCTG	0.443																0.018349	-50.391055	6.556895	4	214	KEEP	---	---	---	---	3	1	109	122	-1	capture	Missense_Mutation	SNP	124951615	124951615	ZNF148	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17614	102
CCDC37	348807	broad.mit.edu	37	3	126153184	126153184	+	Missense_Mutation	SNP	G	A	A	rs141942694	by1000genomes	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126153184G>A	uc003eiu.1	+	15	1687	c.1588G>A	c.(1588-1590)GAG>AAG	p.E530K	CCDC37_uc010hsg.1_Missense_Mutation_p.E531K	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	530	Potential.									ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)		GGTCAAGATCGAGCAGGCCGA	0.637																0.746667	188.428175	192.568758	56	19	KEEP	---	---	---	---	34	30	7	15	-1	capture	Missense_Mutation	SNP	126153184	126153184	CCDC37	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2783	102
MBD4	8930	broad.mit.edu	37	3	129155916	129155916	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129155916G>A	uc003emh.1	-	3	747	c.571C>T	c.(571-573)CCG>TCG	p.P191S	MBD4_uc003emi.1_Missense_Mutation_p.P191S|MBD4_uc003emj.1_Missense_Mutation_p.P191S|MBD4_uc003emk.1_Intron|MBD4_uc011bkw.1_Missense_Mutation_p.P191S	NM_003925	NP_003916	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	191					depyrimidination	nucleoplasm	DNA N-glycosylase activity|endodeoxyribonuclease activity|protein binding|satellite DNA binding			ovary(1)|lung(1)	2						CTACTTGGCGGCATAAACACA	0.443											BER_DNA_glycosylases					0.023952	-34.886178	7.121664	4	163	KEEP	---	---	---	---	0	6	104	81	-1	capture	Missense_Mutation	SNP	129155916	129155916	MBD4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9259	102
IFT122	55764	broad.mit.edu	37	3	129195512	129195512	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129195512G>A	uc003emm.2	+	11	1221	c.1015G>A	c.(1015-1017)GGC>AGC	p.G339S	IFT122_uc003eml.2_Missense_Mutation_p.G390S|IFT122_uc003emn.2_Missense_Mutation_p.G280S|IFT122_uc003emo.2_Missense_Mutation_p.G228S|IFT122_uc003emp.2_Missense_Mutation_p.G189S|IFT122_uc010htc.2_Missense_Mutation_p.G331S|IFT122_uc011bky.1_Missense_Mutation_p.G130S|IFT122_uc003emq.2_Missense_Mutation_p.G179S|IFT122_uc003emr.2_Missense_Mutation_p.G130S|IFT122_uc011bla.1_Missense_Mutation_p.G130S|IFT122_uc011bkx.1_Missense_Mutation_p.G179S|IFT122_uc011bkz.1_RNA	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	339	WD 6.				camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						GCAGGTGGTCGGCTGCCAGGA	0.527																0.6	232.943808	233.972672	69	46	KEEP	---	---	---	---	37	46	26	27	-1	capture	Missense_Mutation	SNP	129195512	129195512	IFT122	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7480	102
CEP63	80254	broad.mit.edu	37	3	134226076	134226076	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134226076G>A	uc003eqo.1	+	4	619	c.170G>A	c.(169-171)CGT>CAT	p.R57H	CEP63_uc003eql.1_Missense_Mutation_p.R57H|CEP63_uc003eqm.2_Missense_Mutation_p.R57H|CEP63_uc003eqn.1_Missense_Mutation_p.R57H	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a	57	Potential.				cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						TTGAAAATCCGTGAACAGGAA	0.368																0.195876	41.699508	50.039128	19	78	KEEP	---	---	---	---	14	12	36	52	-1	capture	Missense_Mutation	SNP	134226076	134226076	CEP63	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3225	102
CPB1	1360	broad.mit.edu	37	3	148545842	148545842	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148545842G>A	uc003ewl.2	+	2	148	c.125G>A	c.(124-126)CGC>CAC	p.R42H		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	42					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			AACATAATCCGCGAGTTGGCC	0.363																0.448276	120.513504	120.716337	39	48	KEEP	---	---	---	---	17	25	19	37	-1	capture	Missense_Mutation	SNP	148545842	148545842	CPB1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3761	102
EPHB3	2049	broad.mit.edu	37	3	184298249	184298249	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184298249C>T	uc003foz.2	+	12	2669	c.2232C>T	c.(2230-2232)GCC>GCT	p.A744A		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	744	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GCATTGCTGCCGGCATGAAGT	0.572					292											0.04	-18.40449	10.077224	5	120	KEEP	---	---	---	---	1	5	58	83	-1	capture	Silent	SNP	184298249	184298249	EPHB3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5131	102
LIPH	200879	broad.mit.edu	37	3	185245282	185245282	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:185245282G>A	uc003fpm.2	-	4	728	c.618C>T	c.(616-618)TCC>TCT	p.S206S	LIPH_uc010hyh.2_Intron	NM_139248	NP_640341	Q8WWY8	LIPH_HUMAN	lipase, member H precursor	206					lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CATCAGTGTCGGAATGGATGA	0.527																0.742268	252.446068	257.609789	72	25	KEEP	---	---	---	---	35	49	13	16	-1	capture	Silent	SNP	185245282	185245282	LIPH	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8744	102
BCL6	604	broad.mit.edu	37	3	187442788	187442788	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:187442788G>A	uc003frp.3	-	9	2375	c.1918C>T	c.(1918-1920)CGG>TGG	p.R640W	BCL6_uc011bsf.1_Missense_Mutation_p.R584W|BCL6_uc010hza.2_Missense_Mutation_p.R538W|BCL6_uc003frq.1_Missense_Mutation_p.R640W	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	640	C2H2-type 5.				negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		TGAAGGTGCCGGAAACGGGTG	0.557				p.R640W(NALM6-Tumor)	277	T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								0.707547	253.818278	257.89296	75	31	KEEP	---	---	---	---	45	44	13	20	-1	capture	Missense_Mutation	SNP	187442788	187442788	BCL6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	1365	102
TP63	8626	broad.mit.edu	37	3	189582118	189582118	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189582118G>A	uc003fry.2	+	5	766	c.677G>A	c.(676-678)CGC>CAC	p.R226H	TP63_uc003frx.2_Missense_Mutation_p.R226H|TP63_uc003frz.2_Missense_Mutation_p.R226H|TP63_uc010hzc.1_Missense_Mutation_p.R226H|TP63_uc003fsa.2_Missense_Mutation_p.R132H|TP63_uc003fsb.2_Missense_Mutation_p.R132H|TP63_uc003fsc.2_Missense_Mutation_p.R132H|TP63_uc003fsd.2_Missense_Mutation_p.R132H|TP63_uc010hzd.1_Missense_Mutation_p.R47H|TP63_uc003fse.1_Missense_Mutation_p.R107H	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	226					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GCTGTTATCCGCGCCATGCCT	0.522					423							Hay-Wells_syndrome	HNSCC(45;0.13)			0.703125	292.591427	297.31384	90	38	KEEP	---	---	---	---	40	65	21	18	-1	capture	Missense_Mutation	SNP	189582118	189582118	TP63	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16275	102
ADD1	118	broad.mit.edu	37	4	2877779	2877779	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:2877779G>A	uc003gfr.2	+	2	325	c.137G>A	c.(136-138)CGC>CAC	p.R46H	ADD1_uc003gfn.2_Intron|ADD1_uc010ico.1_Missense_Mutation_p.R46H|ADD1_uc003gfo.2_Missense_Mutation_p.R46H|ADD1_uc003gfp.2_Missense_Mutation_p.R46H|ADD1_uc003gfq.2_Missense_Mutation_p.R46H|ADD1_uc003gfs.2_Missense_Mutation_p.R46H|ADD1_uc003gft.3_Missense_Mutation_p.R46H	NM_001119	NP_001110	P35611	ADDA_HUMAN	adducin 1 (alpha) isoform a	46					actin filament bundle assembly|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|positive regulation of protein binding	cytosol|F-actin capping protein complex|nucleus|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding|transcription factor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCAGACCTTCGCCAGGACTTC	0.517	Esophageal Squamous(71;505 1201 20414 34538 37449)															0.694737	211.9706	215.180691	66	29	KEEP	---	---	---	---	35	34	15	15	-1	capture	Missense_Mutation	SNP	2877779	2877779	ADD1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	304	102
TMPRSS11F	389208	broad.mit.edu	37	4	68964683	68964683	+	Missense_Mutation	SNP	G	A	A	rs140054355	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68964683G>A	uc003hdt.1	-	2	134	c.85C>T	c.(85-87)CGG>TGG	p.R29W		NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	29	Cytoplasmic (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						AGAGCTAGCCGTACTGAGTCC	0.378																0.742857	172.429371	176.170356	52	18	KEEP	---	---	---	---	24	29	10	9	-1	capture	Missense_Mutation	SNP	68964683	68964683	TMPRSS11F	4	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16126	102
RXFP1	59350	broad.mit.edu	37	4	159567947	159567947	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159567947C>T	uc003ipz.2	+	16	1432	c.1350C>T	c.(1348-1350)GCC>GCT	p.A450A	RXFP1_uc011cja.1_Silent_p.A345A|RXFP1_uc010iqo.2_Silent_p.A402A|RXFP1_uc011cjb.1_Silent_p.A348A|RXFP1_uc010iqk.2_Silent_p.A318A|RXFP1_uc011cjc.1_Silent_p.A369A|RXFP1_uc011cjd.1_Silent_p.A369A|RXFP1_uc010iql.2_Silent_p.A294A|RXFP1_uc011cje.1_Silent_p.A477A|RXFP1_uc010iqm.2_Silent_p.A417A|RXFP1_uc011cjf.1_Silent_p.A319A|RXFP1_uc010iqn.2_Silent_p.A395A	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	450	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CTCTAGGTGCCGACTGCTTAA	0.348																0.18705	63.670118	76.417061	26	113	KEEP	---	---	---	---	16	19	73	64	-1	capture	Silent	SNP	159567947	159567947	RXFP1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13651	102
ASB5	140458	broad.mit.edu	37	4	177143569	177143569	+	Silent	SNP	A	G	G			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:177143569A>G	uc003iuq.1	-	3	295	c.279T>C	c.(277-279)GGT>GGC	p.G93G	ASB5_uc003iup.1_Silent_p.G40G	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	93	ANK 1.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		TTACATTATAACCCTAAATGT	0.398																0.126761	17.333029	26.97384	9	62	KEEP	---	---	---	---	4	7	39	35	-1	capture	Silent	SNP	177143569	177143569	ASB5	4	A	G	G	G	1	0	0	0	0	0	0	0	1	15	2	3	3	1017	102
ZFP42	132625	broad.mit.edu	37	4	188924752	188924752	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:188924752C>T	uc003izg.1	+	3	1036	c.791C>T	c.(790-792)ACG>ATG	p.T264M	ZFP42_uc003izh.1_Missense_Mutation_p.T264M|ZFP42_uc003izi.1_Missense_Mutation_p.T264M	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	264	C2H2-type 3.				female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		AATTTGCGTACGCACGTGCGC	0.483																0.75	140.373699	143.554246	42	14	KEEP	---	---	---	---	20	27	7	7	-1	capture	Missense_Mutation	SNP	188924752	188924752	ZFP42	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17530	102
NIPBL	25836	broad.mit.edu	37	5	36984865	36984865	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36984865C>T	uc003jkl.3	+	10	2082	c.1583C>T	c.(1582-1584)ACG>ATG	p.T528M	NIPBL_uc003jkk.3_Missense_Mutation_p.T528M|NIPBL_uc003jkm.1_Missense_Mutation_p.T407M	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	528					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCTCAGGAGACGGGTTCTACG	0.448				p.T528M(2313287-Tumor)	934											0.020761	-64.48671	9.811762	6	283	KEEP	---	---	---	---	2	4	169	169	-1	capture	Missense_Mutation	SNP	36984865	36984865	NIPBL	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10335	102
MAST4	375449	broad.mit.edu	37	5	66416869	66416869	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:66416869C>T	uc003jut.1	+	13	1185	c.1117C>T	c.(1117-1119)CGA>TGA	p.R373*	MAST4_uc003juu.1_Nonsense_Mutation_p.R383*|MAST4_uc011cra.1_Nonsense_Mutation_p.R356*|MAST4_uc003juv.2_Nonsense_Mutation_p.R368*|MAST4_uc003juw.2_Nonsense_Mutation_p.R368*	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	565						cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CCTGAAACTTCGAAGGAAACC	0.313					805											0.777778	48.659309	49.936481	14	4	KEEP	---	---	---	---	8	9	2	3	-1	capture	Nonsense_Mutation	SNP	66416869	66416869	MAST4	5	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	9240	102
PDE8B	8622	broad.mit.edu	37	5	76709099	76709099	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:76709099G>A	uc003kfa.2	+	17	1921	c.1876G>A	c.(1876-1878)GCC>ACC	p.A626T	PDE8B_uc003kfb.2_Missense_Mutation_p.A606T|PDE8B_uc003kfc.2_Missense_Mutation_p.A571T|PDE8B_uc003kfd.2_Missense_Mutation_p.A579T|PDE8B_uc003kfe.2_Missense_Mutation_p.A529T	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1	626	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		CGTCCTGCACGCCACCGCTTT	0.478																0.733945	242.676526	248.041458	80	29	KEEP	---	---	---	---	40	53	9	24	-1	capture	Missense_Mutation	SNP	76709099	76709099	PDE8B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11557	102
FBXL17	64839	broad.mit.edu	37	5	107684192	107684192	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:107684192C>T	uc011cvc.1	-	4	1821	c.1414G>A	c.(1414-1416)GGC>AGC	p.G472S	FBXL17_uc003kon.3_Missense_Mutation_p.G74S	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	472											0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		TAACACTGGCCGAAATGAATA	0.368																0.685393	212.809432	215.53329	61	28	KEEP	---	---	---	---	31	35	17	12	-1	capture	Missense_Mutation	SNP	107684192	107684192	FBXL17	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5659	102
KCNN2	3781	broad.mit.edu	37	5	113740527	113740527	+	Silent	SNP	C	T	T	rs147034356	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:113740527C>T	uc003kqo.2	+	3	1432	c.975C>T	c.(973-975)GCC>GCT	p.A325A		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	325	Helical; Name=Segment S5; (Potential).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		GGATAATTGCCGCATGGACTG	0.328																0.023364	-44.009029	10.09053	5	209	KEEP	---	---	---	---	2	4	116	134	-1	capture	Silent	SNP	113740527	113740527	KCNN2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8001	102
PCDHA3	56145	broad.mit.edu	37	5	140180853	140180853	+	Missense_Mutation	SNP	C	T	T	rs147990915		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140180853C>T	uc003lhf.2	+	1	71	c.71C>T	c.(70-72)TCG>TTG	p.S24L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.S24L	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	24					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGCAGCCTCGGAGGTGGGG	0.597																0.78125	337.583304	347.006648	100	28	KEEP	---	---	---	---	58	49	14	19	-1	capture	Missense_Mutation	SNP	140180853	140180853	PCDHA3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11428	102
PCDHA4	56144	broad.mit.edu	37	5	140188279	140188279	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140188279G>A	uc003lhi.2	+	1	1608	c.1507G>A	c.(1507-1509)GCG>ACG	p.A503T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Missense_Mutation_p.A503T|PCDHA4_uc011daa.1_Missense_Mutation_p.A503T	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	503	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGGAGCGCGCGCTGTCGAG	0.662																0.756757	265.421069	272.088521	84	27	KEEP	---	---	---	---	43	53	14	17	-1	capture	Missense_Mutation	SNP	140188279	140188279	PCDHA4	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11429	102
PCDHB4	56131	broad.mit.edu	37	5	140502471	140502471	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140502471G>A	uc003lip.1	+	1	891	c.891G>A	c.(889-891)ACG>ACA	p.T297T		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	297	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGAAGTCACGGGAGAAATAC	0.358																0.028037	-40.709538	11.791492	6	208	KEEP	---	---	---	---	1	5	91	132	-1	capture	Silent	SNP	140502471	140502471	PCDHB4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11447	102
PCDHGA1	56114	broad.mit.edu	37	5	140712338	140712338	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140712338C>T	uc003lji.1	+	1	2087	c.2087C>T	c.(2086-2088)GCG>GTG	p.A696V	PCDHGA1_uc011dan.1_Missense_Mutation_p.A696V	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	696	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGTGGTGGCGGCGGCCGCG	0.672																0.091954	7.623885	36.748653	16	158	KEEP	---	---	---	---	12	9	99	90	-1	capture	Missense_Mutation	SNP	140712338	140712338	PCDHGA1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11453	102
PCDHGB6	56100	broad.mit.edu	37	5	140789386	140789386	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140789386G>A	uc003lkj.1	+	1	1617	c.1617G>A	c.(1615-1617)TCG>TCA	p.S539S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lki.1_Silent_p.S539S	NM_018926	NP_061749	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6 isoform 1	539	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCACGGCTCGCCCACGCTCA	0.701																0.882353	48.592429	50.790926	15	2	KEEP	---	---	---	---	9	7	0	2	-1	capture	Silent	SNP	140789386	140789386	PCDHGB6	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11470	102
PCDHGA11	56105	broad.mit.edu	37	5	140802272	140802272	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140802272C>T	uc003lkq.1	+	1	1736	c.1478C>T	c.(1477-1479)ACG>ATG	p.T493M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.T493M|PCDHGA11_uc003lkp.1_Missense_Mutation_p.T493M	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	493	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTCTCTGACGGATGACACT	0.532																0.75	269.622491	275.763402	81	27	KEEP	---	---	---	---	32	50	12	16	-1	capture	Missense_Mutation	SNP	140802272	140802272	PCDHGA11	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11455	102
PDGFRB	5159	broad.mit.edu	37	5	149497261	149497261	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149497261G>A	uc003lro.2	-	22	3526	c.3057C>T	c.(3055-3057)AAC>AAT	p.N1019N	PDGFRB_uc010jhd.2_Silent_p.N858N	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	1019	Cytoplasmic (Potential).				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGATATAGTCGTTGTCACCCT	0.642					880	T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								0.055118	-12.079215	14.383212	7	120	KEEP	---	---	---	---	7	3	59	77	-1	capture	Silent	SNP	149497261	149497261	PDGFRB	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11565	102
FGF18	8817	broad.mit.edu	37	5	170883601	170883601	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:170883601C>T	uc003mbk.2	+	5	953	c.416C>T	c.(415-417)ACG>ATG	p.T139M		NM_003862	NP_003853	O76093	FGF18_HUMAN	fibroblast growth factor 18 precursor	139					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AACAACTACACGGCCCTGATG	0.562																0.725714	414.812221	422.812006	127	48	KEEP	---	---	---	---	74	71	22	31	-1	capture	Missense_Mutation	SNP	170883601	170883601	FGF18	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5792	102
TSPAN17	26262	broad.mit.edu	37	5	176078841	176078841	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176078841G>A	uc003met.2	+	3	454	c.225G>A	c.(223-225)TCG>TCA	p.S75S	TSPAN17_uc003mes.3_Intron|TSPAN17_uc003meu.2_Silent_p.S75S|TSPAN17_uc003mev.2_Silent_p.S75S|TSPAN17_uc003mew.2_Silent_p.S75S	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a	75	Helical; (Potential).					integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGTCATGTCGGTGCTGGGCT	0.612																0.766667	324.662432	332.475678	92	28	KEEP	---	---	---	---	51	48	17	17	-1	capture	Silent	SNP	176078841	176078841	TSPAN17	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16524	102
WRNIP1	56897	broad.mit.edu	37	6	2770518	2770518	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:2770518C>T	uc003mtz.2	+	3	1370	c.1179C>T	c.(1177-1179)ATC>ATT	p.I393I	WRNIP1_uc003mua.2_Silent_p.I368I	NM_020135	NP_064520	Q96S55	WRIP1_HUMAN	Werner helicase interacting protein isoform 1	393					DNA replication|DNA synthesis involved in DNA repair|regulation of DNA-dependent DNA replication initiation	mitochondrion|nucleus|perinuclear region of cytoplasm	ATP binding|ATPase activity|DNA binding|metal ion binding|protein binding			ovary(1)|pancreas(1)	2	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				TGCGAGCGATCAACTCCCTGG	0.532																0.621622	145.684145	146.625979	46	28	KEEP	---	---	---	---	29	23	12	18	-1	capture	Silent	SNP	2770518	2770518	WRNIP1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	17284	102
SLC35B3	51000	broad.mit.edu	37	6	8422856	8422856	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:8422856T>C	uc010joe.2	-	5	587	c.421A>G	c.(421-423)ATA>GTA	p.I141V	SLC35B3_uc003mya.2_Missense_Mutation_p.I109V|SLC35B3_uc003myc.2_Intron|SLC35B3_uc003myb.2_Missense_Mutation_p.I141V|SLC35B3_uc011did.1_Missense_Mutation_p.I141V|SLC35B3_uc003myd.2_RNA	NM_001142541	NP_001136013	Q9H1N7	S35B3_HUMAN	solute carrier family 35, member B3	141					transmembrane transport	Golgi membrane|integral to membrane					0	Ovarian(93;0.0569)					TTTCCTGGTATTCTGTAAAAG	0.338	Melanoma(83;700 1353 9357 11478 30548)															0.153846	23.107216	30.553243	10	55	KEEP	---	---	---	---	8	2	21	41	-1	capture	Missense_Mutation	SNP	8422856	8422856	SLC35B3	6	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14469	102
HIVEP1	3096	broad.mit.edu	37	6	12124017	12124017	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:12124017C>T	uc003nac.2	+	4	4168	c.3989C>T	c.(3988-3990)ACG>ATG	p.T1330M	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1330					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GTTTCTAAAACGGAGGCTTCC	0.433																0.684932	165.874486	168.095418	50	23	KEEP	---	---	---	---	21	34	12	12	-1	capture	Missense_Mutation	SNP	12124017	12124017	HIVEP1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7111	102
SIRT5	23408	broad.mit.edu	37	6	13588650	13588650	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:13588650C>T	uc003nay.2	+	4	499	c.203C>T	c.(202-204)CCG>CTG	p.P68L	SIRT5_uc003naw.2_Missense_Mutation_p.P68L|SIRT5_uc003nax.2_Intron|SIRT5_uc011dit.1_Missense_Mutation_p.P68L	NM_012241	NP_036373	Q9NXA8	SIRT5_HUMAN	sirtuin 5 isoform 1	68	NAD.|Deacetylase sirtuin-type.				chromatin silencing|protein ADP-ribosylation|protein deacetylation	mitochondrial intermembrane space|mitochondrial matrix	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ ADP-ribosyltransferase activity|NAD+ binding|zinc ion binding			skin(2)|upper_aerodigestive_tract(1)	3	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)		Suramin(DB04786)	AGTGGTGTTCCGACCTTCAGA	0.423																0.661538	147.847398	149.349307	43	22	KEEP	---	---	---	---	20	26	13	11	-1	capture	Missense_Mutation	SNP	13588650	13588650	SIRT5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14234	102
SCAND3	114821	broad.mit.edu	37	6	28554340	28554340	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28554340C>T	uc003nlo.2	-	1	773	c.155G>A	c.(154-156)CGT>CAT	p.R52H	uc003nlp.1_5'Flank	NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	52	SCAN box.				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GAAGCGCTGACGAGAGAGTTC	0.507																0.736842	184.930408	188.786041	56	20	KEEP	---	---	---	---	27	34	9	12	-1	capture	Missense_Mutation	SNP	28554340	28554340	SCAND3	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13768	102
CSNK2B	1460	broad.mit.edu	37	6	31637206	31637206	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31637206G>A	uc003nvr.1	+	6	818	c.478G>A	c.(478-480)GGC>AGC	p.G160S	CSNK2B_uc003nvs.1_Missense_Mutation_p.G160S|LY6G5B_uc003nvt.1_5'Flank	NM_001320	NP_001311	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	160					adiponectin-mediated signaling pathway|axon guidance|cellular protein complex assembly|negative regulation of cell proliferation|regulation of DNA binding|Wnt receptor signaling pathway	cytosol|nucleus|protein kinase CK2 complex	identical protein binding|protein domain specific binding|protein kinase regulator activity|receptor binding|transcription factor binding				0						CGCCTACTTCGGCACTGGTTT	0.562																0.079646	0.126371	20.466207	9	104	KEEP	---	---	---	---	4	5	51	59	-1	capture	Missense_Mutation	SNP	31637206	31637206	CSNK2B	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3924	102
EHMT2	10919	broad.mit.edu	37	6	31852241	31852241	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31852241G>A	uc003nxz.1	-	21	2709	c.2699C>T	c.(2698-2700)GCG>GTG	p.A900V	EHMT2_uc003nxv.1_5'UTR|EHMT2_uc003nxw.1_5'UTR|EHMT2_uc003nxx.1_Missense_Mutation_p.A98V|EHMT2_uc003nxy.1_Missense_Mutation_p.A698V|EHMT2_uc011don.1_Missense_Mutation_p.A923V|EHMT2_uc003nya.1_Missense_Mutation_p.A866V	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	900					DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						GAGTTGAAGCGCAAACCACAC	0.612																0.018868	-48.629288	6.506957	4	208	KEEP	---	---	---	---	2	2	109	129	-1	capture	Missense_Mutation	SNP	31852241	31852241	EHMT2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4939	102
CYP21A2	1589	broad.mit.edu	37	6	32008215	32008215	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32008215C>T	uc003nze.1	+	8	1090	c.972C>T	c.(970-972)CAC>CAT	p.H324H	CYP21A2_uc003nzf.1_Silent_p.H294H	NM_000500	NP_000491	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A,	323					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						AGCTAGACCACGAACTGGGCC	0.677	Melanoma(174;1669 1998 3915 34700 46447)															0.731707	99.63838	101.615968	30	11	KEEP	---	---	---	---	19	21	4	12	-1	capture	Silent	SNP	32008215	32008215	CYP21A2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4113	102
USP49	25862	broad.mit.edu	37	6	41773646	41773646	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41773646C>T	uc003ori.2	-	4	1298	c.1076G>A	c.(1075-1077)CGT>CAT	p.R359H		NM_018561	NP_061031	Q70CQ1	UBP49_HUMAN	ubiquitin thioesterase 49	359					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GTGCAGTTCACGGCAGAGGGA	0.602																0.62963	166.743062	167.939344	51	30	KEEP	---	---	---	---	28	33	15	17	-1	capture	Missense_Mutation	SNP	41773646	41773646	USP49	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16962	102
GPR116	221395	broad.mit.edu	37	6	46836637	46836637	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46836637G>A	uc003oyo.3	-	12	1893	c.1604C>T	c.(1603-1605)TCG>TTG	p.S535L	GPR116_uc011dwj.1_Missense_Mutation_p.S90L|GPR116_uc011dwk.1_5'UTR|GPR116_uc003oyp.3_Missense_Mutation_p.S393L|GPR116_uc003oyq.3_Missense_Mutation_p.S535L|GPR116_uc010jzi.1_Missense_Mutation_p.S207L	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	535	Ig-like 3.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			CTCCCTGGTCGAGGTCTTGAC	0.393	NSCLC(59;410 1274 8751 36715 50546)															0.788235	233.372779	239.903055	67	18	KEEP	---	---	---	---	40	38	12	10	-1	capture	Missense_Mutation	SNP	46836637	46836637	GPR116	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6567	102
GPR116	221395	broad.mit.edu	37	6	46836810	46836810	+	Silent	SNP	C	T	T	rs150327469		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46836810C>T	uc003oyo.3	-	12	1720	c.1431G>A	c.(1429-1431)CCG>CCA	p.P477P	GPR116_uc011dwj.1_Silent_p.P32P|GPR116_uc011dwk.1_5'UTR|GPR116_uc003oyp.3_Silent_p.P335P|GPR116_uc003oyq.3_Silent_p.P477P|GPR116_uc010jzi.1_Silent_p.P149P	NM_001098518	NP_001091988	Q8IZF2	GP116_HUMAN	G-protein coupled receptor 116 precursor	477	Ig-like 3.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(1)|skin(1)	2			Lung(136;0.192)			AAATTGGGTCCGGGGTTATTG	0.363	NSCLC(59;410 1274 8751 36715 50546)															0.727273	111.820107	113.869408	32	12	KEEP	---	---	---	---	14	21	8	7	-1	capture	Silent	SNP	46836810	46836810	GPR116	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6567	102
TAB2	23118	broad.mit.edu	37	6	149699411	149699411	+	Silent	SNP	A	G	G			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:149699411A>G	uc003qmj.2	+	3	538	c.360A>G	c.(358-360)GAA>GAG	p.E120E	TAB2_uc011eec.1_Silent_p.E88E|TAB2_uc010kia.1_Silent_p.E120E|TAB2_uc010kib.1_Silent_p.E120E|TAB2_uc003qmk.3_RNA	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7	120					activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						CCAATAGTGAACTATTTCAGC	0.458					127											0.747126	249.144316	254.016048	65	22	KEEP	---	---	---	---	41	29	10	14	-1	capture	Silent	SNP	149699411	149699411	TAB2	6	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	15384	102
MLLT4	4301	broad.mit.edu	37	6	168348980	168348980	+	Missense_Mutation	SNP	C	T	T	rs145954704	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168348980C>T	uc003qwd.2	+	28	3771	c.3629C>T	c.(3628-3630)ACG>ATG	p.T1210M	MLLT4_uc003qwb.1_Missense_Mutation_p.T1195M|MLLT4_uc003qwc.1_Missense_Mutation_p.T1211M|MLLT4_uc003qwg.1_Missense_Mutation_p.T520M	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1211					adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CAGGAGCAGACGCCTCCGCCT	0.418				p.T1210M(SNU1040-Tumor)	1250	T	MLL	AL								0.612245	96.441135	96.978283	30	19	KEEP	---	---	---	---	21	15	13	8	-1	capture	Missense_Mutation	SNP	168348980	168348980	MLLT4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9541	102
SDK1	221935	broad.mit.edu	37	7	4091337	4091337	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4091337G>A	uc003smx.2	+	19	2925	c.2786G>A	c.(2785-2787)GGA>GAA	p.G929E	SDK1_uc010kso.2_Missense_Mutation_p.G205E	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	929	Fibronectin type-III 3.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GATTTCCACGGAGTCCACCAT	0.567																0.071685	-9.711589	43.00633	20	259	KEEP	---	---	---	---	11	10	123	166	-1	capture	Missense_Mutation	SNP	4091337	4091337	SDK1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	13861	102
PAPOLB	56903	broad.mit.edu	37	7	4900644	4900644	+	Silent	SNP	C	T	T	rs112213840		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4900644C>T	uc003snk.2	-	1	982	c.798G>A	c.(796-798)GCG>GCA	p.A266A	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	265					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CAAGAGTTGACGCTACTGCAT	0.428																0.434629	377.935132	378.97662	123	160	KEEP	---	---	---	---	51	81	73	112	-1	capture	Silent	SNP	4900644	4900644	PAPOLB	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	11334	102
FBXL18	80028	broad.mit.edu	37	7	5521489	5521489	+	Silent	SNP	G	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5521489G>T	uc003son.3	-	5	2168	c.2074C>A	c.(2074-2076)CGG>AGG	p.R692R		NM_024963	NP_079239	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	Error:Variant_position_missing_in_Q96ME1_after_alignment										central_nervous_system(2)|ovary(1)	3		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GGGACGTCCCGGATGACGTCG	0.642																0.021918	-78.303467	14.829153	8	357	KEEP	---	---	---	---	5	5	186	213	0.5	capture	Silent	SNP	5521489	5521489	FBXL18	7	G	T	T	T	1	0	0	0	0	0	0	0	1	506	39	4	4	5660	102
FBXL18	80028	broad.mit.edu	37	7	5540355	5540355	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5540355G>A	uc003soo.2	-	3	1639	c.1545C>T	c.(1543-1545)CGC>CGT	p.R515R	FBXL18_uc003son.3_Silent_p.R515R	NM_024963	NP_079239	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	515										central_nervous_system(2)|ovary(1)	3		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		CACTCTGTGCGCGGCTGCAGG	0.687																0.45098	68.820675	68.927023	23	28	KEEP	---	---	---	---	7	18	20	13	-1	capture	Silent	SNP	5540355	5540355	FBXL18	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5660	102
MRPL32	64983	broad.mit.edu	37	7	42974713	42974713	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:42974713C>T	uc003tia.2	+	2	337	c.290C>T	c.(289-291)CCG>CTG	p.P97L	C7orf25_uc010kxr.2_5'Flank|PSMA2_uc003thy.2_5'Flank|PSMA2_uc010kxt.2_5'Flank|PSMA2_uc003thz.1_5'Flank|MRPL32_uc003tib.2_RNA|MRPL32_uc003tic.2_Missense_Mutation_p.P44L	NM_031903	NP_114109	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32 precursor	97					translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0						AGAAGAAATCCGCAGAAGCTT	0.408																0.06383	-6.633051	21.264399	9	132	KEEP	---	---	---	---	6	3	67	89	-1	capture	Missense_Mutation	SNP	42974713	42974713	MRPL32	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9705	102
ZMIZ2	83637	broad.mit.edu	37	7	44806136	44806136	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44806136G>A	uc003tlr.2	+	18	2652	c.2529G>A	c.(2527-2529)GCG>GCA	p.A843A	ZMIZ2_uc003tlq.2_Silent_p.A785A|ZMIZ2_uc003tls.2_Silent_p.A817A|ZMIZ2_uc003tlt.2_Silent_p.A466A|ZMIZ2_uc010kyj.2_Silent_p.A365A|ZMIZ2_uc003tlu.2_Silent_p.A124A|ZMIZ2_uc010kyk.1_5'Flank	NM_031449	NP_113637	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2 isoform 1	843	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear replication fork	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|zinc ion binding			ovary(2)|large_intestine(2)|breast(1)	5						CTCCCCCAGCGTCCCGGCAGT	0.647	NSCLC(20;604 852 1948 16908 50522)															0.028807	-48.365116	11.006473	7	236	KEEP	---	---	---	---	5	2	124	134	-1	capture	Silent	SNP	44806136	44806136	ZMIZ2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17577	102
TNS3	64759	broad.mit.edu	37	7	47342939	47342939	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47342939G>A	uc003tnv.2	-	22	3433	c.3066C>T	c.(3064-3066)TTC>TTT	p.F1022F	TNS3_uc003tnw.2_Silent_p.F1022F	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	1022						focal adhesion	protein binding			ovary(4)	4						GGGCGGTGCCGAAGCCCAGGA	0.682																0.403226	75.269853	75.775192	25	37	KEEP	---	---	---	---	18	8	23	18	-1	capture	Silent	SNP	47342939	47342939	TNS3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	16227	102
POM121L12	285877	broad.mit.edu	37	7	53104043	53104043	+	Missense_Mutation	SNP	G	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53104043G>T	uc003tpz.2	+	1	695	c.679G>T	c.(679-681)GCT>TCT	p.A227S		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	227											0						TGGAGCGGTTGCTTCCTTCGT	0.647																0.464706	236.18405	236.370249	79	91	KEEP	---	---	---	---	38	43	34	62	0.469135802469	capture	Missense_Mutation	SNP	53104043	53104043	POM121L12	7	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	12143	102
ZNF107	51427	broad.mit.edu	37	7	64168851	64168851	+	Silent	SNP	A	G	G			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:64168851A>G	uc003ttd.2	+	7	2955	c.2169A>G	c.(2167-2169)GAA>GAG	p.E723E	ZNF107_uc003tte.2_Silent_p.E723E	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	723	C2H2-type 24.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				ACAAATGTGAAGAATGTGGCA	0.348																0.390244	54.689965	55.122887	16	25	KEEP	---	---	---	---	5	12	9	17	-1	capture	Silent	SNP	64168851	64168851	ZNF107	7	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	17595	102
CALN1	83698	broad.mit.edu	37	7	71252795	71252795	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71252795C>T	uc003twa.3	-	6	1152	c.625G>A	c.(625-627)GCA>ACA	p.A209T	CALN1_uc003twb.3_Missense_Mutation_p.A251T|CALN1_uc003twc.3_Missense_Mutation_p.A209T	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	209	Helical; Anchor for type IV membrane protein; (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TGGTTGGCTGCAATCAGCATG	0.587																0.119266	10.085025	25.63064	13	96	KEEP	---	---	---	---	6	7	47	53	-1	capture	Missense_Mutation	SNP	71252795	71252795	CALN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	2567	102
RHBDD2	57414	broad.mit.edu	37	7	75511205	75511205	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75511205C>T	uc003udw.1	+	2	321	c.237C>T	c.(235-237)GGC>GGT	p.G79G	RHBDD2_uc003udv.1_5'UTR	NM_001040456	NP_001035546	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2 isoform a	79	Helical; (Potential).					integral to membrane	serine-type endopeptidase activity				0						TGCTCTGCGGCGCTATCATCA	0.567																0.452769	412.728984	413.315927	139	168	KEEP	---	---	---	---	60	99	83	106	-1	capture	Silent	SNP	75511205	75511205	RHBDD2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13209	102
ZAN	7455	broad.mit.edu	37	7	100350423	100350423	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100350423C>T	uc003uwj.2	+	14	2860	c.2695C>T	c.(2695-2697)CTC>TTC	p.L899F	ZAN_uc003uwk.2_Missense_Mutation_p.L899F|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	899	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CACAGAAAAACTCACCATCCC	0.517																0.377193	124.493226	126.00345	43	71	KEEP	---	---	---	---	31	23	32	48	-1	capture	Missense_Mutation	SNP	100350423	100350423	ZAN	7	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	17394	102
SLC26A5	375611	broad.mit.edu	37	7	103014906	103014906	+	Silent	SNP	C	A	A	rs138320783	byFrequency	TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103014906C>A	uc003vbz.2	-	20	2411	c.2175G>T	c.(2173-2175)TCG>TCT	p.S725S	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Silent_p.S693S|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	725	Cytoplasmic (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						AAGGGGGAGCCGAGGCTTCCT	0.532																0.034483	-20.442234	6.869127	4	112	KEEP	---	---	---	---	2	2	56	63	0.5	capture	Silent	SNP	103014906	103014906	SLC26A5	7	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	14412	102
RELN	5649	broad.mit.edu	37	7	103162532	103162532	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103162532G>A	uc003vca.2	-	48	7765	c.7605C>T	c.(7603-7605)AAC>AAT	p.N2535N	RELN_uc010liz.2_Silent_p.N2535N	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2535					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATTTCCCTCCGTTCACAGTCA	0.532	NSCLC(146;835 1944 15585 22231 52158)															0.406061	195.502751	196.771977	67	98	KEEP	---	---	---	---	40	29	51	56	-1	capture	Silent	SNP	103162532	103162532	RELN	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13115	102
CTTNBP2	83992	broad.mit.edu	37	7	117375046	117375046	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117375046C>T	uc003vjf.2	-	16	3889	c.3797G>A	c.(3796-3798)CGC>CAC	p.R1266H		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1266										ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CTGCACCCAGCGGAAATGCTG	0.493																0.392857	127.282781	128.405653	44	68	KEEP	---	---	---	---	26	24	38	33	-1	capture	Missense_Mutation	SNP	117375046	117375046	CTTNBP2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4006	102
AASS	10157	broad.mit.edu	37	7	121773679	121773679	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121773679G>A	uc003vka.2	-	1	198	c.102C>T	c.(100-102)AAC>AAT	p.N34N	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Silent_p.N34N|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	34	Lysine-ketoglutarate reductase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	TCTCCCAGGCGTTCACATCCT	0.582																0.385892	272.137426	274.880802	93	148	KEEP	---	---	---	---	41	57	67	89	-1	capture	Silent	SNP	121773679	121773679	AASS	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	24	102
NRF1	4899	broad.mit.edu	37	7	129357145	129357145	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129357145G>A	uc003voz.2	+	9	1269	c.1152G>A	c.(1150-1152)TCG>TCA	p.S384S	NRF1_uc003vpa.2_Silent_p.S384S|NRF1_uc011kpa.1_Silent_p.S223S|NRF1_uc003vpb.2_Silent_p.S384S	NM_005011	NP_005002	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	384	Required for transcriptional activation.				generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						CGGTGGCATCGTTGGCAGAGG	0.572																0.406897	175.206274	176.301005	59	86	KEEP	---	---	---	---	34	32	50	46	-1	capture	Silent	SNP	129357145	129357145	NRF1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10553	102
CPA1	1357	broad.mit.edu	37	7	130021608	130021608	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:130021608G>A	uc003vpx.2	+	3	357	c.285G>A	c.(283-285)TCG>TCA	p.S95S	CPA1_uc011kpf.1_Silent_p.S7S|CPA1_uc003vpw.2_Intron	NM_001868	NP_001859	P15085	CBPA1_HUMAN	carboxypeptidase A1 precursor	95					proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					ACGTGCAGTCGCTGCTGGACG	0.612														OREG0018314	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.391304	129.271656	130.453472	45	70	KEEP	---	---	---	---	24	27	39	40	-1	capture	Silent	SNP	130021608	130021608	CPA1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3754	102
HIPK2	28996	broad.mit.edu	37	7	139259877	139259877	+	Missense_Mutation	SNP	G	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139259877G>C	uc003vvf.3	-	14	3297	c.3123C>G	c.(3121-3123)AGC>AGG	p.S1041R	HIPK2_uc003vvd.3_Missense_Mutation_p.S1014R	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	1041	Autoinhibitory domain (AID).|Interaction with AXIN1 (By similarity).				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GGCTTACCTGGCTGAGATTGA	0.672					363											0.16	8.483126	11.23544	4	21	KEEP	---	---	---	---	2	4	11	13	-1	capture	Missense_Mutation	SNP	139259877	139259877	HIPK2	7	G	C	C	C	1	0	0	0	0	1	0	0	0	542	42	4	4	7042	102
ZNF425	155054	broad.mit.edu	37	7	148815402	148815402	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148815402C>T	uc003wfj.2	-	2	130	c.57G>A	c.(55-57)TCG>TCA	p.S19S		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	19	KRAB.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			ACTCTTGTTCCGAAAAATATA	0.393																0.03794	-55.746614	29.442534	14	355	KEEP	---	---	---	---	7	8	169	227	-1	capture	Silent	SNP	148815402	148815402	ZNF425	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17779	102
SLC4A2	6522	broad.mit.edu	37	7	150771186	150771186	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150771186G>A	uc003wit.3	+	17	2852	c.2596G>A	c.(2596-2598)GGT>AGT	p.G866S	SLC4A2_uc011kve.1_Missense_Mutation_p.G857S|SLC4A2_uc003wiu.3_Missense_Mutation_p.G852S|SLC4A2_uc003wiv.3_Missense_Mutation_p.G60S	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	866	Membrane (anion exchange).|Extracellular (Potential).				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGTGGACGGCGGTGAGAACAT	0.677					2											0.441558	214.146384	214.608798	68	86	KEEP	---	---	---	---	32	40	32	59	-1	capture	Missense_Mutation	SNP	150771186	150771186	SLC4A2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14546	102
MLL3	58508	broad.mit.edu	37	7	151878185	151878185	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151878185C>T	uc003wla.2	-	36	6979	c.6760G>A	c.(6760-6762)GCA>ACA	p.A2254T	MLL3_uc003wkz.2_Missense_Mutation_p.A1315T	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2254	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		CGGTTTTGTGCTGCTTGCAGG	0.527	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.028249	-35.744487	8.033085	5	172	KEEP	---	---	---	---	2	3	71	119	-1	capture	Missense_Mutation	SNP	151878185	151878185	MLL3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9534	102
HTR5A	3361	broad.mit.edu	37	7	154863298	154863298	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:154863298G>A	uc003wlu.1	+	1	753	c.689G>A	c.(688-690)CGC>CAC	p.R230H	uc011kvt.1_5'Flank|uc003wlt.2_5'Flank	NM_024012	NP_076917	P47898	5HT5A_HUMAN	5-hydroxytryptamine receptor 5A	230	Cytoplasmic (By similarity).					integral to plasma membrane	serotonin receptor activity			ovary(2)|large_intestine(1)	3	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)		GCCAAGTTCCGCGTGGGCTCC	0.542																0.392	145.340149	146.585113	49	76	KEEP	---	---	---	---	28	28	38	48	-1	capture	Missense_Mutation	SNP	154863298	154863298	HTR5A	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7375	102
PTPRN2	5799	broad.mit.edu	37	7	157370776	157370776	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157370776G>A	uc003wno.2	-	18	2674	c.2553C>T	c.(2551-2553)AAC>AAT	p.N851N	PTPRN2_uc003wnp.2_Silent_p.N834N|PTPRN2_uc003wnq.2_Silent_p.N822N|PTPRN2_uc003wnr.2_Silent_p.N813N|PTPRN2_uc011kwa.1_Silent_p.N874N	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	851	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GCCGGACGCCGTTCTCCGCGA	0.622																0.052326	-19.140929	17.277494	9	163	KEEP	---	---	---	---	4	5	79	105	-1	capture	Silent	SNP	157370776	157370776	PTPRN2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12703	102
VIPR2	7434	broad.mit.edu	37	7	158896531	158896531	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:158896531T>C	uc003woh.2	-	4	460	c.274A>G	c.(274-276)AAC>GAC	p.N92D	VIPR2_uc010lqx.2_RNA|VIPR2_uc010lqy.2_RNA	NM_003382	NP_003373	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	92	Extracellular (Potential).				cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CTCGTACAGTTTTTGCTTATG	0.512	Pancreas(154;1876 1931 2329 17914 20079)															0.270492	103.719748	109.516665	33	89	KEEP	---	---	---	---	16	21	40	58	-1	capture	Missense_Mutation	SNP	158896531	158896531	VIPR2	7	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	17052	102
KIAA1429	25962	broad.mit.edu	37	8	95521969	95521969	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95521969G>A	uc003ygo.1	-	15	3839	c.3826C>T	c.(3826-3828)CGC>TGC	p.R1276C	KIAA1429_uc010maz.1_RNA	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	1276					mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CACTGTTGGCGAATAACACTG	0.348																0.719101	219.040765	222.887502	64	25	KEEP	---	---	---	---	37	35	19	13	-1	capture	Missense_Mutation	SNP	95521969	95521969	KIAA1429	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	8153	102
TG	7038	broad.mit.edu	37	8	133880437	133880437	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133880437G>A	uc003ytw.2	+	2	186	c.145G>A	c.(145-147)GTG>ATG	p.V49M		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	49	Thyroglobulin type-1 1.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AGCAGACTACGTGCCCCAGTG	0.532					1778											0.75	158.726203	162.361666	48	16	KEEP	---	---	---	---	17	34	7	9	-1	capture	Missense_Mutation	SNP	133880437	133880437	TG	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15698	102
ZNF623	9831	broad.mit.edu	37	8	144732159	144732159	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144732159G>A	uc003yzd.2	+	1	206	c.117G>A	c.(115-117)ACG>ACA	p.T39T	ZNF623_uc011lkp.1_5'UTR|ZNF623_uc003yzc.2_5'UTR	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	39					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACAGACTCACGGTGATGGAGC	0.522																0.728155	259.668624	264.501504	75	28	KEEP	---	---	---	---	34	48	16	14	-1	capture	Silent	SNP	144732159	144732159	ZNF623	8	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17925	102
KIAA2026	158358	broad.mit.edu	37	9	5988438	5988438	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5988438C>T	uc003zjq.3	-	2	917	c.701G>A	c.(700-702)CGA>CAA	p.R234Q		NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	234										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TGCCAAACTTCGCGGTGTTGA	0.423																0.797468	215.87315	222.379694	63	16	KEEP	---	---	---	---	44	29	9	9	-1	capture	Missense_Mutation	SNP	5988438	5988438	KIAA2026	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8192	102
ACER2	340485	broad.mit.edu	37	9	19423911	19423911	+	Missense_Mutation	SNP	C	T	T	rs145427232		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19423911C>T	uc003zny.1	+	2	318	c.160C>T	c.(160-162)CGT>TGT	p.R54C	ACER2_uc003znx.1_RNA|ACER2_uc003znz.1_Missense_Mutation_p.R5C	NM_001010887	NP_001010887	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2	54	Cytoplasmic (Potential).				ceramide metabolic process|negative regulation of cell adhesion mediated by integrin|negative regulation of cell-matrix adhesion|negative regulation of protein glycosylation in Golgi|positive regulation of cell proliferation|response to retinoic acid|sphingosine biosynthetic process	integral to Golgi membrane	ceramidase activity	p.R54C(1)		haematopoietic_and_lymphoid_tissue(1)|skin(1)	2						GTGCTTGTTTCGTCAGTATGC	0.398																0.729592	492.510761	501.829083	143	53	KEEP	---	---	---	---	74	96	30	32	-1	capture	Missense_Mutation	SNP	19423911	19423911	ACER2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	139	102
CCIN	881	broad.mit.edu	37	9	36169599	36169599	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:36169599G>A	uc003zzb.3	+	1	211	c.100G>A	c.(100-102)GTG>ATG	p.V34M		NM_005893	NP_005884	Q13939	CALI_HUMAN	calicin	34	BTB.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			ovary(1)|skin(1)	2			STAD - Stomach adenocarcinoma(86;0.228)			GGCCCTGAGTGTGGACAACCA	0.502																0.054348	-8.69811	10.555829	5	87	KEEP	---	---	---	---	2	3	49	47	-1	capture	Missense_Mutation	SNP	36169599	36169599	CCIN	9	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	2851	102
KIAA1529	57653	broad.mit.edu	37	9	100126341	100126341	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100126341C>T	uc011lut.1	+	41	5233	c.4460C>T	c.(4459-4461)CCG>CTG	p.P1487L	KIAA1529_uc004axe.1_Missense_Mutation_p.P1293L|KIAA1529_uc004axg.1_Missense_Mutation_p.P1348L|KIAA1529_uc004axh.1_RNA|KIAA1529_uc011luw.1_Intron|MIR1302-8_hsa-mir-1302-8|MI0006369_5'Flank	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				AGCTTCACACCGCACCCCAAG	0.592																0.6875	116.693007	118.195665	33	15	KEEP	---	---	---	---	13	23	10	9	-1	capture	Missense_Mutation	SNP	100126341	100126341	KIAA1529	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8162	102
SVEP1	79987	broad.mit.edu	37	9	113228166	113228166	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113228166C>T	uc010mtz.2	-	18	3638	c.3301G>A	c.(3301-3303)GTG>ATG	p.V1101M	SVEP1_uc010mua.1_Missense_Mutation_p.V1101M	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	1101					cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						GAAATGTTCACGGCTCCTCTT	0.438																0.904762	64.944179	68.392785	19	2	KEEP	---	---	---	---	10	12	0	3	-1	capture	Missense_Mutation	SNP	113228166	113228166	SVEP1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15308	102
COL27A1	85301	broad.mit.edu	37	9	116994128	116994128	+	Silent	SNP	C	T	T	rs144760825		TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116994128C>T	uc011lxl.1	+	16	2547	c.2547C>T	c.(2545-2547)CCC>CCT	p.P849P	COL27A1_uc004bii.2_RNA	NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	849	Pro-rich.|Triple-helical region.|Collagen-like 4.				cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						TGGGGGAGCCCGGACTGAAAG	0.522																0.732143	712.366992	726.101852	205	75	KEEP	---	---	---	---	133	114	47	41	-1	capture	Silent	SNP	116994128	116994128	COL27A1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3650	102
DAB2IP	153090	broad.mit.edu	37	9	124528842	124528842	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124528842G>A	uc004bln.2	+	9	1515	c.1446G>A	c.(1444-1446)CCG>CCA	p.P482P	DAB2IP_uc004blo.2_Silent_p.P386P|DAB2IP_uc004blp.2_5'Flank	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform	510	Ras-GAP.				activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						GCGGCCGCCCGGACATCAGTG	0.617																0.792079	262.539884	270.532538	80	21	KEEP	---	---	---	---	34	52	9	15	-1	capture	Silent	SNP	124528842	124528842	DAB2IP	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4179	102
RC3H2	54542	broad.mit.edu	37	9	125617558	125617558	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125617558G>A	uc010mwc.1	-	15	2961	c.2720C>T	c.(2719-2721)GCG>GTG	p.A907V	RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Missense_Mutation_p.A907V|RC3H2_uc004bne.3_Missense_Mutation_p.A907V	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2	907						cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						TCTGGAAATCGCACCCCATTT	0.443																0.811111	245.624534	253.775819	73	17	KEEP	---	---	---	---	39	39	10	7	-1	capture	Missense_Mutation	SNP	125617558	125617558	RC3H2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13062	102
STRBP	55342	broad.mit.edu	37	9	125922701	125922701	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125922701C>T	uc004bns.2	-	8	1098	c.668G>A	c.(667-669)CGC>CAC	p.R223H	STRBP_uc004bnt.2_Missense_Mutation_p.R41H|STRBP_uc004bnu.2_Missense_Mutation_p.R209H|STRBP_uc004bnv.2_Missense_Mutation_p.R223H	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	223	DZF.				multicellular organismal development	cytoplasm|nucleus	DNA binding			breast(1)|skin(1)	2						ACGCAGAATGCGGAGGACAAT	0.393																0.704918	145.14908	147.441786	43	18	KEEP	---	---	---	---	23	26	8	12	-1	capture	Missense_Mutation	SNP	125922701	125922701	STRBP	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15217	102
NTNG2	84628	broad.mit.edu	37	9	135073844	135073844	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135073844G>A	uc004cbh.2	+	3	1481	c.705G>A	c.(703-705)ACG>ACA	p.T235T		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	235	Laminin N-terminal.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		ACCTCTACACGCGGCTGGAGA	0.677																0.730769	311.935678	318.275144	95	35	KEEP	---	---	---	---	49	58	15	26	-1	capture	Silent	SNP	135073844	135073844	NTNG2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10612	102
SEC16A	9919	broad.mit.edu	37	9	139350207	139350207	+	Silent	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139350207C>T	uc004chx.2	-	20	6012	c.5703G>A	c.(5701-5703)CCG>CCA	p.P1901P	SEC16A_uc004chs.2_5'Flank|SEC16A_uc004cht.2_5'Flank|SEC16A_uc004chu.2_Silent_p.P86P|SEC16A_uc004chv.3_Silent_p.P1291P|SEC16A_uc004chw.2_Silent_p.P1901P|SEC16A_uc010nbn.2_Silent_p.P1901P	NM_014866	NP_055681	O15027	SC16A_HUMAN	SEC16 homolog A	1723					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane					0		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		GACACTGCTGCGGGAGGGCTC	0.667																0.4	11.697599	11.785162	4	6	KEEP	---	---	---	---	2	3	3	3	-1	capture	Silent	SNP	139350207	139350207	SEC16A	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13879	102
SLC34A3	142680	broad.mit.edu	37	9	140128881	140128881	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140128881G>A	uc004cmf.1	+	11	1293	c.1107G>A	c.(1105-1107)CCG>CCA	p.P369P	SLC34A3_uc011met.1_Silent_p.P369P	NM_080877	NP_543153	Q8N130	NPT2C_HUMAN	solute carrier family 34 (sodium phosphate),	369	Helical; Name=M5; (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|integral to membrane	sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		TCCCCTTCCCGCTGGGCTGGC	0.716																0.791667	59.625839	61.512011	19	5	KEEP	---	---	---	---	17	12	3	6	-1	capture	Silent	SNP	140128881	140128881	SLC34A3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	14461	102
PNPLA7	375775	broad.mit.edu	37	9	140356687	140356687	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140356687G>A	uc004cnf.2	-	30	3851	c.3514C>T	c.(3514-3516)CGC>TGC	p.R1172C	C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Missense_Mutation_p.R419C|PNPLA7_uc004cne.1_Missense_Mutation_p.R438C|PNPLA7_uc011mfa.1_Missense_Mutation_p.R580C|PNPLA7_uc010ncj.1_Missense_Mutation_p.R1197C|NELF_uc004cna.2_5'Flank|NELF_uc011mez.1_5'Flank|NELF_uc004cmz.2_5'Flank|NELF_uc004cnc.2_5'Flank|NELF_uc004cnb.2_5'Flank	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	1172					lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		ATGGGGGGGCGCAGGTACTCG	0.647																0.740741	184.108141	188.356242	60	21	KEEP	---	---	---	---	22	40	7	18	-1	capture	Missense_Mutation	SNP	140356687	140356687	PNPLA7	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12073	102
PNPLA7	375775	broad.mit.edu	37	9	140361890	140361890	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140361890G>A	uc004cnf.2	-	25	3180	c.2843C>T	c.(2842-2844)GCG>GTG	p.A948V	C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Missense_Mutation_p.A214V|PNPLA7_uc004cne.1_Missense_Mutation_p.A214V|PNPLA7_uc011mfa.1_Missense_Mutation_p.A356V|PNPLA7_uc010ncj.1_Missense_Mutation_p.A973V	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	948	Patatin.				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GCCGCACTCCGCCAAGGCCTT	0.652																0.678161	190.450372	192.911321	59	28	KEEP	---	---	---	---	24	42	15	16	-1	capture	Missense_Mutation	SNP	140361890	140361890	PNPLA7	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12073	102
ZBED1	9189	broad.mit.edu	37	X	2408513	2408513	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2408513G>A	uc004cqg.2	-	2	449	c.248C>T	c.(247-249)ACG>ATG	p.T83M	DHRSX_uc004cqf.3_Intron|ZBED1_uc004cqh.1_Missense_Mutation_p.T83M	NM_004729	NP_004720	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	83						nuclear chromosome	DNA binding|metal ion binding|protein dimerization activity|transposase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CATCTGCTCCGTGTTGCTCTT	0.632																0.151724	37.564337	54.399475	22	123	KEEP	---	---	---	---	10	15	61	83	-1	capture	Missense_Mutation	SNP	2408513	2408513	ZBED1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17398	102
HDHD1A	8226	broad.mit.edu	37	X	6995419	6995419	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:6995419C>T	uc004crv.2	-	3	429	c.352G>A	c.(352-354)GCG>ACG	p.A118T	HDHD1A_uc011mhm.1_Missense_Mutation_p.A141T|HDHD1A_uc011mhn.1_Missense_Mutation_p.A75T|HDHD1A_uc010ndl.2_Intron|HDHD1A_uc011mho.1_Missense_Mutation_p.A118T	NM_012080	NP_036212	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain	118					nucleotide metabolic process		metal ion binding|phosphatase activity				0		Colorectal(8;0.0114)|Medulloblastoma(8;0.184)				TCGAACGACGCGGACCCCGAG	0.582																0.6	52.237567	52.498253	18	12	KEEP	---	---	---	---	14	12	3	11	-1	capture	Missense_Mutation	SNP	6995419	6995419	HDHD1A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6949	102
CXorf22	170063	broad.mit.edu	37	X	35993898	35993898	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:35993898C>T	uc004ddj.2	+	15	2640	c.2581C>T	c.(2581-2583)CGA>TGA	p.R861*	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	861										large_intestine(1)|lung(1)|ovary(1)	3						ATTGAGACCACGAGGCTTCTT	0.438																0.718147	622.544149	633.615536	186	73	KEEP	---	---	---	---	104	116	39	43	-1	capture	Nonsense_Mutation	SNP	35993898	35993898	CXorf22	23	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	4062	102
BMP15	9210	broad.mit.edu	37	X	50659329	50659329	+	Missense_Mutation	SNP	C	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50659329C>T	uc011mnw.1	+	2	901	c.901C>T	c.(901-903)CGC>TGC	p.R301C		NM_005448	NP_005439	O95972	BMP15_HUMAN	bone morphogenetic protein 15 precursor	301					female gamete generation|granulosa cell development|ovarian follicle development	extracellular space	cytokine activity|growth factor activity			ovary(2)	2	Ovarian(276;0.236)					AATCAGCTTCCGCCAGCTGGG	0.498																0.689076	287.276538	291.06052	82	37	KEEP	---	---	---	---	56	42	22	22	-1	capture	Missense_Mutation	SNP	50659329	50659329	BMP15	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1446	102
ATRX	546	broad.mit.edu	37	X	76814187	76814187	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76814187G>A	uc004ecp.3	-	29	6689	c.6457C>T	c.(6457-6459)CGC>TGC	p.R2153C	ATRX_uc004ecq.3_Missense_Mutation_p.R2115C|ATRX_uc004eco.3_Missense_Mutation_p.R1938C	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	2153	Helicase C-terminal.				DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TGTCCAAAGCGATAAACTCTG	0.333					2	Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						0.663793	257.316598	260.082952	77	39	KEEP	---	---	---	---	51	40	20	24	-1	capture	Missense_Mutation	SNP	76814187	76814187	ATRX	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1199	102
PCDH19	57526	broad.mit.edu	37	X	99662086	99662086	+	Missense_Mutation	SNP	T	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99662086T>C	uc010nmz.2	-	1	3186	c.1510A>G	c.(1510-1512)ACC>GCC	p.T504A	PCDH19_uc004efw.3_Missense_Mutation_p.T504A|PCDH19_uc004efx.3_Missense_Mutation_p.T504A	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	504	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						GAGACATAGGTGAAGACAGGC	0.577																0.173653	53.139295	70.024274	29	138	KEEP	---	---	---	---	12	18	68	93	-1	capture	Missense_Mutation	SNP	99662086	99662086	PCDH19	23	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	11417	102
FLNA	2316	broad.mit.edu	37	X	153580717	153580717	+	Missense_Mutation	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153580717G>A	uc004fkk.2	-	41	6850	c.6601C>T	c.(6601-6603)CGC>TGC	p.R2201C	FLNA_uc004fki.2_Missense_Mutation_p.R244C|FLNA_uc011mzn.1_Missense_Mutation_p.R334C|FLNA_uc010nuu.1_Missense_Mutation_p.R2193C	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	2201	Filamin 20.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGAACAAAGCGGATGCAGTAG	0.597					518											0.172414	41.53891	53.290472	20	96	KEEP	---	---	---	---	5	18	48	57	-1	capture	Missense_Mutation	SNP	153580717	153580717	FLNA	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5877	102
FLNA	2316	broad.mit.edu	37	X	153587696	153587696	+	Silent	SNP	G	A	A			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153587696G>A	uc004fkk.2	-	25	4470	c.4221C>T	c.(4219-4221)GAC>GAT	p.D1407D	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Silent_p.D1407D	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1407	Filamin 12.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGCAGCTGCCGTCCTTGTTAT	0.632					518											0.781395	557.099287	572.797016	168	47	KEEP	---	---	---	---	76	105	22	26	-1	capture	Silent	SNP	153587696	153587696	FLNA	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5877	102
CLCN6	1185	broad.mit.edu	37	1	11893604	11893605	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11893604_11893605insT	uc001ate.3	+	14	1394_1395	c.1281_1282insT	c.(1279-1284)ACATTTfs	p.T427fs	CLCN6_uc010oat.1_Frame_Shift_Ins_p.T143fs|CLCN6_uc010oau.1_Frame_Shift_Ins_p.T405fs	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	427_428					cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GTATCAAGACATTTTTTTGTCC	0.455																0.12			9	69		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	11893604	11893605	CLCN6	1	-	T	T	T	1	0	1	1	0	0	0	0	0	93	8	5	5	3432	102
INPPL1	3636	broad.mit.edu	37	11	71942122	71942123	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-5858-01	TCGA-06-5858-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71942122_71942123insC	uc001osf.2	+	12	1533_1534	c.1386_1387insC	c.(1384-1389)ATACCCfs	p.I462fs	INPPL1_uc001osg.2_Frame_Shift_Ins_p.I220fs	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	462_463					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						CAGTGACCATACCCCATGACAT	0.579																0.07			30	398		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	71942122	71942123	INPPL1	11	-	C	C	C	1	0	1	1	0	0	0	0	0	176	14	5	5	7684	102
