Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF2	65122	broad.mit.edu	37	1	12919080	12919080	+	Silent	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12919080G>A	uc001aum.1	+	2	303	c.216G>A	c.(214-216)ACG>ACA	p.T72T		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	72											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGATGAAGACGCTTCATCTGG	0.552																0.200704	120.351855	143.978326	57	227	KEEP	---	---	---	---	32	33	125	137	-1	capture	Silent	SNP	12919080	12919080	PRAMEF2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12335	111
SPEN	23013	broad.mit.edu	37	1	16199442	16199442	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16199442G>C	uc001axk.1	+	2	419	c.215G>C	c.(214-216)AGA>ACA	p.R72T	SPEN_uc010obp.1_5'Flank	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	72	By similarity.|RRM 1.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATGGGTGACAGAGACCTACGC	0.493					551											0.144	37.762022	53.016179	18	107	KEEP	---	---	---	---	11	7	59	62	-1	capture	Missense_Mutation	SNP	16199442	16199442	SPEN	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14930	111
TCEA3	6920	broad.mit.edu	37	1	23720438	23720438	+	Silent	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23720438G>A	uc001bgx.1	-	8	888	c.753C>T	c.(751-753)CCC>CCT	p.P251P	TCEA3_uc009vqm.1_Silent_p.P20P	NM_003196	NP_003187	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	251	TFIIS central.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation, DNA-dependent	nucleus	DNA binding|translation elongation factor activity|zinc ion binding				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		GCCGCAGGCCGGGGTTCCTGG	0.597																0.075758	-1.164619	11.000967	5	61	KEEP	---	---	---	---	3	2	40	33	-1	capture	Silent	SNP	23720438	23720438	TCEA3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15556	111
MPL	4352	broad.mit.edu	37	1	43817970	43817970	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43817970G>A	uc001ciw.2	+	11	1694	c.1649G>A	c.(1648-1650)AGC>AAC	p.S550N	MPL_uc009vwr.2_Missense_Mutation_p.S543N	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	550	Cytoplasmic (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCAGCCCTGAGCCCGGTGAGT	0.607	NSCLC(52;534 1204 10016 41452 44427)				169	Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia						0.1875	24.788974	30.625912	12	52	KEEP	---	---	---	---	5	9	24	33	-1	capture	Missense_Mutation	SNP	43817970	43817970	MPL	1	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	9642	111
DAB1	1600	broad.mit.edu	37	1	57480758	57480758	+	Silent	SNP	C	T	T	rs147876561	byFrequency	TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57480758C>T	uc001cys.1	-	14	1916	c.1242G>A	c.(1240-1242)ACG>ACA	p.T414T	DAB1_uc001cyt.1_Silent_p.T412T|DAB1_uc001cyq.1_Silent_p.T412T|DAB1_uc001cyr.1_Silent_p.T328T|DAB1_uc009vzw.1_Silent_p.T396T|DAB1_uc009vzx.1_Silent_p.T414T	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	447					cell differentiation|nervous system development					skin(2)|ovary(1)	3						AATCCTTAAACGTTTCTTTGC	0.602					395											0.166667	17.614332	23.934598	10	50	KEEP	---	---	---	---	6	6	36	23	-1	capture	Silent	SNP	57480758	57480758	DAB1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4177	111
DCLRE1B	64858	broad.mit.edu	37	1	114454524	114454524	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114454524C>G	uc001eeg.2	+	4	1481	c.1310C>G	c.(1309-1311)TCT>TGT	p.S437C	DCLRE1B_uc001eeh.2_Intron|DCLRE1B_uc001eei.2_Missense_Mutation_p.S311C	NM_022836	NP_073747	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B (PSO2 homolog, S.	437					cell cycle checkpoint|DNA repair|protection from non-homologous end joining at telomere|telomeric 3' overhang formation|telomeric loop formation	centrosome|chromosome, telomeric region|nucleus	5'-3' exonuclease activity|protein binding				0	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACTTAAGGTCTACAGATGAG	0.473											Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					0.18705	127.526877	153.037477	52	226	KEEP	---	---	---	---	38	22	128	139	-1	capture	Missense_Mutation	SNP	114454524	114454524	DCLRE1B	1	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	4254	111
CRB1	23418	broad.mit.edu	37	1	197313558	197313558	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197313558C>A	uc001gtz.2	+	3	935	c.800C>A	c.(799-801)GCC>GAC	p.A267D	CRB1_uc010poz.1_Missense_Mutation_p.A198D|CRB1_uc001gty.1_Missense_Mutation_p.A267D|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Missense_Mutation_p.A267D|CRB1_uc010ppc.1_RNA	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	267	Extracellular (Potential).|EGF-like 7; calcium-binding (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						GATGAGTGTGCCAGTCAACCT	0.512																0.181818	60.965437	77.653571	32	144	KEEP	---	---	---	---	22	17	90	78	0.435897435897	capture	Missense_Mutation	SNP	197313558	197313558	CRB1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	3813	111
TLR5	7100	broad.mit.edu	37	1	223285038	223285038	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:223285038G>A	uc001hnv.1	-	4	1782	c.1336C>T	c.(1336-1338)CGG>TGG	p.R446W	TLR5_uc001hnw.1_Missense_Mutation_p.R446W	NM_003268	NP_003259	O60602	TLR5_HUMAN	toll-like receptor 5 precursor	446	Extracellular (Potential).		Missing (in 10% of the population; abolishes flagellin signaling; associated with resistance to SLEB1).		cellular response to mechanical stimulus|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of toll-like receptor signaling pathway	integral to membrane|plasma membrane	interleukin-1 receptor binding|transmembrane receptor activity			ovary(2)|lung(1)|skin(1)	4				GBM - Glioblastoma multiforme(131;0.0851)		TGAGGTACCCGTAGGAGAAAG	0.403																0.216495	46.220554	53.41427	21	76	KEEP	---	---	---	---	13	10	36	50	-1	capture	Missense_Mutation	SNP	223285038	223285038	TLR5	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	15839	111
C1orf150	148823	broad.mit.edu	37	1	247712504	247712504	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247712504A>T	uc001idf.2	+	1	56	c.11A>T	c.(10-12)TAT>TTT	p.Y4F	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_RNA|C1orf150_uc001idb.3_RNA|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823	4											0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			ATGGGAAATTATCTCCTGCGA	0.473																0.326923	49.260302	50.640297	17	35	KEEP	---	---	---	---	12	13	21	21	-1	capture	Missense_Mutation	SNP	247712504	247712504	C1orf150	1	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	1986	111
CDH23	64072	broad.mit.edu	37	10	73567464	73567464	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:73567464G>A	uc001jrx.3	+	57	8877	c.8500G>A	c.(8500-8502)GTT>ATT	p.V2834I	CDH23_uc001jsg.3_Missense_Mutation_p.V594I|CDH23_uc001jsh.3_Missense_Mutation_p.V594I|CDH23_uc001jsi.3_Missense_Mutation_p.V594I	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	2834	Cadherin 26.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						GGAGGTGCGCGTTGTGCTAGA	0.632																0.307692	10.001814	10.426743	4	9	KEEP	---	---	---	---	2	2	3	6	-1	capture	Missense_Mutation	SNP	73567464	73567464	CDH23	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3079	111
MYOF	26509	broad.mit.edu	37	10	95119651	95119651	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:95119651C>T	uc001kin.2	-	29	3182	c.3059G>A	c.(3058-3060)CGG>CAG	p.R1020Q	MYOF_uc001kio.2_Missense_Mutation_p.R1007Q|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1020	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						CAGCCTTCGCCGTCTATGAGT	0.502																0.304348	79.433644	82.538471	28	64	KEEP	---	---	---	---	17	12	50	31	-1	capture	Missense_Mutation	SNP	95119651	95119651	MYOF	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9999	111
OR51V1	283111	broad.mit.edu	37	11	5221570	5221570	+	Missense_Mutation	SNP	A	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5221570A>T	uc010qyz.1	-	1	361	c.361T>A	c.(361-363)TCC>ACC	p.S121T		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	121	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGACAGAGGACTCCATGAAG	0.473																0.326923	44.957043	46.338747	17	35	KEEP	---	---	---	---	7	10	21	16	-1	capture	Missense_Mutation	SNP	5221570	5221570	OR51V1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	11011	111
OR10A3	26496	broad.mit.edu	37	11	7960995	7960995	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7960995C>T	uc010rbi.1	-	1	73	c.73G>A	c.(73-75)GTG>ATG	p.V25M		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	25	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAGAGCTGCACCTGGAGCTCA	0.413																0.289474	57.22556	60.241267	22	54	KEEP	---	---	---	---	15	9	30	34	-1	capture	Missense_Mutation	SNP	7960995	7960995	OR10A3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	10795	111
INSC	387755	broad.mit.edu	37	11	15198673	15198673	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:15198673T>C	uc001mly.2	+	4	606	c.560T>C	c.(559-561)ATG>ACG	p.M187T	INSC_uc001mlz.2_Missense_Mutation_p.M140T|INSC_uc001mma.2_Missense_Mutation_p.M140T|INSC_uc010rcs.1_Missense_Mutation_p.M140T|INSC_uc001mmb.2_Missense_Mutation_p.M140T|INSC_uc001mmc.2_Missense_Mutation_p.M140T	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	187					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						AAGCTGCTAATGGAGAAATGC	0.353																0.042017	-16.81359	9.991902	5	114	KEEP	---	---	---	---	4	1	72	71	-1	capture	Missense_Mutation	SNP	15198673	15198673	INSC	11	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	7687	111
OR1S1	219959	broad.mit.edu	37	11	57982888	57982888	+	Silent	SNP	T	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57982888T>C	uc010rkc.1	+	1	672	c.672T>C	c.(670-672)TTT>TTC	p.F224F		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	224	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				TCTTCCCCTTTACACTCAGCT	0.453																0.1875	39.38342	46.693434	15	65	KEEP	---	---	---	---	8	17	38	34	-1	capture	Silent	SNP	57982888	57982888	OR1S1	11	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	10876	111
MMP27	64066	broad.mit.edu	37	11	102575419	102575419	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102575419G>A	uc001phd.1	-	2	213	c.190C>T	c.(190-192)CGG>TGG	p.R64W		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	64					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		TGCATTTCCCGAATTTTGTCA	0.428																0.265625	42.248755	45.424087	17	47	KEEP	---	---	---	---	9	8	28	20	-1	capture	Missense_Mutation	SNP	102575419	102575419	MMP27	11	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	9576	111
KDELC2	143888	broad.mit.edu	37	11	108345675	108345675	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108345675T>A	uc001pkj.2	-	8	1469	c.1403A>T	c.(1402-1404)TAT>TTT	p.Y468F	KDELC2_uc001pki.2_Missense_Mutation_p.Y412F	NM_153705	NP_714916	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2 precursor	468						endoplasmic reticulum lumen				ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		GCGCTCGGCATATTTCTGAAA	0.507																0.239024	123.694944	136.428402	49	156	KEEP	---	---	---	---	35	23	93	90	-1	capture	Missense_Mutation	SNP	108345675	108345675	KDELC2	11	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	8040	111
CLEC7A	64581	broad.mit.edu	37	12	10277922	10277922	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10277922G>C	uc001qxg.2	-	4	653	c.466C>G	c.(466-468)CTA>GTA	p.L156V	CLEC7A_uc001qxe.3_RNA|CLEC7A_uc001qxf.2_Missense_Mutation_p.L110V|CLEC7A_uc001qxh.2_Missense_Mutation_p.L110V|CLEC7A_uc001qxi.2_Missense_Mutation_p.L156V|CLEC7A_uc001qxj.2_Missense_Mutation_p.L77V|CLEC7A_uc009zhg.1_Intron|CLEC7A_uc001qxk.1_RNA|CLEC7A_uc001qxl.1_Missense_Mutation_p.L156V|CLEC7A_uc010sgy.1_Missense_Mutation_p.L110V|CLEC7A_uc001qxm.1_Missense_Mutation_p.L110V	NM_197947	NP_922938	Q9BXN2	CLC7A_HUMAN	dendritic cell-associated C-type lectin 1	156	C-type lectin.|Extracellular (Potential).				carbohydrate mediated signaling|defense response to protozoan|inflammatory response|innate immune response|phagocytosis, recognition|T cell activation	cytoplasm|integral to membrane	metal ion binding|MHC protein binding|sugar binding			central_nervous_system(1)	1						TCTATCTTTAGGAGATTAGAG	0.383																0.289474	62.817186	65.837371	22	54	KEEP	---	---	---	---	14	14	32	28	-1	capture	Missense_Mutation	SNP	10277922	10277922	CLEC7A	12	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	3486	111
KLRC3	3823	broad.mit.edu	37	12	10587963	10587963	+	Silent	SNP	G	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10587963G>T	uc001qyh.2	-	2	241	c.234C>A	c.(232-234)ATC>ATA	p.I78I	KLRC2_uc010she.1_Silent_p.I78I|KLRC2_uc001qyk.2_Silent_p.I78I	NM_002261	NP_002252	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C,	78	Helical; Signal-anchor for type II membrane protein; (Potential).				cellular defense response	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|skin(1)	3						CAATGCAAATGATTCCTAGGA	0.428																0.105263	31.162752	87.09681	38	323	KEEP	---	---	---	---	32	23	215	247	0.581818181818	capture	Silent	SNP	10587963	10587963	KLRC3	12	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	8337	111
HDAC7	51564	broad.mit.edu	37	12	48181754	48181754	+	Translation_Start_Site	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48181754G>A	uc010slp.1	-	1	194	c.-74C>T	c.(-76--72)GACGA>GATGA		HDAC7_uc009zku.2_Intron|HDAC7_uc001rqe.2_Intron|HDAC7_uc010slo.1_Intron|HDAC7_uc001rqj.3_Intron|HDAC7_uc001rqk.3_Intron			Q8WUI4	HDAC7_HUMAN	Synthetic construct DNA, clone: pF1KB0470, Homo sapiens HDAC7 gene for histone deacetylase 7, without stop codon, in Flexi system.						negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)		cacacagctcgtcatgacaga	0.274																0.25	7.320113	8.001303	3	9	KEEP	---	---	---	---	2	1	9	2	-1	capture	Translation_Start_Site	SNP	48181754	48181754	HDAC7	12	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	6939	111
METTL1	4234	broad.mit.edu	37	12	58162873	58162873	+	Missense_Mutation	SNP	C	T	T	rs140194153	byFrequency	TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58162873C>T	uc010ssd.1	-	6	785	c.737G>A	c.(736-738)CGT>CAT	p.R246H	CYP27B1_uc001spz.1_5'Flank|CYP27B1_uc001sqa.1_5'Flank|METTL1_uc009zqc.2_3'UTR	NM_005371	NP_005362	Q9UBP6	TRMB_HUMAN	methyltransferase-like protein 1 isoform a	246						cytoplasm|nucleus	protein binding|tRNA (guanine-N7-)-methyltransferase activity|tRNA binding				0	all_cancers(7;6.73e-81)|Lung NSC(6;1.07e-25)|all_lung(6;8.25e-24)|all_epithelial(6;4.6e-17)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.211)			CCCTCCATTACGTAGAACTTT	0.532																0.078947	-1.111347	12.652491	6	70	KEEP	---	---	---	---	2	4	41	33	-1	capture	Missense_Mutation	SNP	58162873	58162873	METTL1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9405	111
LRRIQ1	84125	broad.mit.edu	37	12	85459186	85459186	+	Silent	SNP	T	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85459186T>C	uc001tac.2	+	9	2649	c.2538T>C	c.(2536-2538)GAT>GAC	p.D846D	LRRIQ1_uc001tab.1_Silent_p.D846D	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	846	LRR 2.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		AGTACATTGATGCACAGGTAT	0.333																0.109589	7.049198	18.064398	8	65	KEEP	---	---	---	---	3	6	39	34	-1	capture	Silent	SNP	85459186	85459186	LRRIQ1	12	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	8944	111
KIAA1033	23325	broad.mit.edu	37	12	105519878	105519878	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:105519878A>G	uc001tld.2	+	11	970	c.883A>G	c.(883-885)ATT>GTT	p.I295V	KIAA1033_uc010swr.1_Missense_Mutation_p.I295V|KIAA1033_uc010sws.1_Missense_Mutation_p.I107V	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	295					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						TATTCGGTCAATTTTTGCAAA	0.308																0.263158	31.233718	33.160576	10	28	KEEP	---	---	---	---	5	5	15	17	-1	capture	Missense_Mutation	SNP	105519878	105519878	KIAA1033	12	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	8128	111
DYNC1H1	1778	broad.mit.edu	37	14	102514280	102514280	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:102514280G>A	uc001yks.2	+	73	13297	c.13133G>A	c.(13132-13134)CGG>CAG	p.R4378Q		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	4378					cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCCTGGATGCGGACACTGCAC	0.612																0.071429	-1.376171	6.543129	3	39	KEEP	---	---	---	---	1	2	18	28	-1	capture	Missense_Mutation	SNP	102514280	102514280	DYNC1H1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4796	111
NRG4	145957	broad.mit.edu	37	15	76301577	76301577	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:76301577C>A	uc002bbo.2	-	3	252	c.68G>T	c.(67-69)TGT>TTT	p.C23F	NRG4_uc010bkm.1_RNA|NRG4_uc002bbn.2_RNA|NRG4_uc010bkn.2_RNA|NRG4_uc010bko.2_RNA|NRG4_uc002bbp.2_RNA	NM_138573	NP_612640	Q8WWG1	NRG4_HUMAN	neuregulin 4	23	Extracellular (Potential).|EGF-like.					extracellular region|integral to membrane|plasma membrane	growth factor activity				0						TATCACATAACAAAGCCCCCC	0.388																0.260504	83.167195	89.348248	31	88	KEEP	---	---	---	---	21	22	54	63	0.511627906977	capture	Missense_Mutation	SNP	76301577	76301577	NRG4	15	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	10557	111
SRRM2	23524	broad.mit.edu	37	16	2812703	2812703	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2812703G>A	uc002crk.2	+	11	2723	c.2174G>A	c.(2173-2175)GGC>GAC	p.G725D	SRRM2_uc002crj.1_Missense_Mutation_p.G629D|SRRM2_uc002crl.1_Missense_Mutation_p.G725D|SRRM2_uc010bsu.1_Missense_Mutation_p.G629D	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	725	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GGCAGATCTGGCTCATCTTCA	0.463																0.195652	38.041852	45.953048	18	74	KEEP	---	---	---	---	10	11	45	38	-1	capture	Missense_Mutation	SNP	2812703	2812703	SRRM2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15061	111
CHD9	80205	broad.mit.edu	37	16	53276816	53276816	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53276816G>T	uc002ehb.2	+	12	3106	c.2942G>T	c.(2941-2943)GGA>GTA	p.G981V	CHD9_uc002egy.2_Missense_Mutation_p.G981V|CHD9_uc002eha.1_Missense_Mutation_p.G981V|CHD9_uc002ehc.2_Missense_Mutation_p.G981V|CHD9_uc002ehf.2_Missense_Mutation_p.G95V|CHD9_uc002ehd.2_Missense_Mutation_p.G507V|CHD9_uc002ehe.1_Missense_Mutation_p.G95V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	981	Helicase ATP-binding.				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				ATGATTCTTGGAGGCTGTGGA	0.363					1157											0.083333	-3.49583	32.523689	17	187	KEEP	---	---	---	---	12	7	102	113	0.631578947368	capture	Missense_Mutation	SNP	53276816	53276816	CHD9	16	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	3298	111
CDYL2	124359	broad.mit.edu	37	16	80718602	80718602	+	Missense_Mutation	SNP	T	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:80718602T>C	uc002ffs.2	-	2	554	c.449A>G	c.(448-450)AAA>AGA	p.K150R		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	150						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						CTGAGACTTTTTCAGGGGCAT	0.512																0.217391	71.418953	79.882021	25	90	KEEP	---	---	---	---	10	17	53	58	-1	capture	Missense_Mutation	SNP	80718602	80718602	CDYL2	16	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	3155	111
MAP2K3	5606	broad.mit.edu	37	17	21205510	21205510	+	Missense_Mutation	SNP	G	A	A	rs148304866		TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21205510G>A	uc002gys.2	+	6	720	c.455G>A	c.(454-456)CGG>CAG	p.R152Q	MAP2K3_uc002gyt.2_Missense_Mutation_p.R123Q|MAP2K3_uc002gyu.2_Missense_Mutation_p.R123Q	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	152	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		AAGTTCTACCGGAAGGTGCTG	0.592					346											0.075	-2.508815	12.317198	6	74	KEEP	---	---	---	---	4	3	51	34	-1	capture	Missense_Mutation	SNP	21205510	21205510	MAP2K3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9152	111
NOS2	4843	broad.mit.edu	37	17	26094858	26094858	+	Silent	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26094858G>A	uc002gzu.2	-	18	2304	c.2040C>T	c.(2038-2040)GCC>GCT	p.A680A	NOS2_uc010wab.1_Silent_p.A645A	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	680					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	ACGTCTCACAGGCTGCCTGGA	0.473					578											0.047619	-7.131316	6.596007	3	60	KEEP	---	---	---	---	1	4	31	38	-1	capture	Silent	SNP	26094858	26094858	NOS2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	10450	111
EVI2B	2124	broad.mit.edu	37	17	29632208	29632208	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29632208C>A	uc002hgk.2	-	2	575	c.420G>T	c.(418-420)AAG>AAT	p.K140N	NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2B_uc010csq.2_Missense_Mutation_p.K155N	NM_006495	NP_006486	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B precursor	140	Extracellular (Potential).					cytoplasm|integral to plasma membrane				ovary(2)	2		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		AGACAAATGACTTTGGTGGTT	0.438																0.305556	153.152413	159.225362	55	125	KEEP	---	---	---	---	31	33	61	86	0.515625	capture	Missense_Mutation	SNP	29632208	29632208	EVI2B	17	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	5243	111
EVI2B	2124	broad.mit.edu	37	17	29632210	29632210	+	Missense_Mutation	SNP	T	G	G			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29632210T>G	uc002hgk.2	-	2	573	c.418A>C	c.(418-420)AAG>CAG	p.K140Q	NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2B_uc010csq.2_Missense_Mutation_p.K155Q	NM_006495	NP_006486	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B precursor	140	Extracellular (Potential).					cytoplasm|integral to plasma membrane				ovary(2)	2		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		ACAAATGACTTTGGTGGTTGT	0.438																0.290323	173.095538	180.409918	54	132	KEEP	---	---	---	---	30	33	63	89	-1	capture	Missense_Mutation	SNP	29632210	29632210	EVI2B	17	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	5243	111
PEX12	5193	broad.mit.edu	37	17	33904178	33904178	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33904178G>A	uc002hjp.2	-	2	1175	c.559C>T	c.(559-561)CAG>TAG	p.Q187*		NM_000286	NP_000277	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	187	Peroxisomal matrix (Potential).				protein import into peroxisome matrix	integral to peroxisomal membrane	protein C-terminus binding|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAGTGATGCTGAGCTTTTCCT	0.493																0.403846	59.06131	59.482555	21	31	KEEP	---	---	---	---	6	16	20	12	-1	capture	Nonsense_Mutation	SNP	33904178	33904178	PEX12	17	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	11643	111
TEX14	56155	broad.mit.edu	37	17	56699012	56699012	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56699012C>A	uc010dcz.1	-	5	671	c.553G>T	c.(553-555)GGA>TGA	p.G185*	TEX14_uc002iwr.1_Nonsense_Mutation_p.G185*|TEX14_uc002iws.1_Nonsense_Mutation_p.G185*|TEX14_uc010dda.1_5'UTR	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a	185						cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGTACTCACCCCTGCACGAGG	0.612					598											0.155172	13.030933	19.630763	9	49	KEEP	---	---	---	---	7	3	30	26	0.3	capture	Nonsense_Mutation	SNP	56699012	56699012	TEX14	17	C	A	A	A	1	0	0	0	0	0	1	0	0	286	22	5	4	15663	111
TIMM44	10469	broad.mit.edu	37	19	7998999	7998999	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7998999G>T	uc002miz.2	-	5	520	c.518C>A	c.(517-519)ACA>AAA	p.T173K	TIMM44_uc002mja.2_5'UTR|TIMM44_uc010dvx.1_RNA	NM_006351	NP_006342	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44	173	ATP (Potential).				protein targeting to mitochondrion	mitochondrial inner membrane presequence translocase complex|mitochondrial matrix	ATP binding|P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1						GAAGGCCGCTGTCCTGCCCAG	0.677																0.285714	58.214789	61.389837	22	55	KEEP	---	---	---	---	13	16	31	32	0.448275862069	capture	Missense_Mutation	SNP	7998999	7998999	TIMM44	19	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	15797	111
SLC44A2	57153	broad.mit.edu	37	19	10748353	10748353	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10748353C>T	uc002mpf.2	+	17	1764	c.1625C>T	c.(1624-1626)ACC>ATC	p.T542I	SLC44A2_uc002mpe.3_Missense_Mutation_p.T540I|SLC44A2_uc002mpg.1_Missense_Mutation_p.T262I|SLC44A2_uc002mph.2_Missense_Mutation_p.T91I|SLC44A2_uc002mpi.2_5'Flank	NM_020428	NP_065161	Q8IWA5	CTL2_HUMAN	solute carrier family 44, member 2 isoform 1	542	Extracellular (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	choline transmembrane transporter activity|signal transducer activity			ovary(1)	1			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	TGCCTCATGACCTGTCTCAAA	0.527																0.196721	49.311309	59.803085	24	98	KEEP	---	---	---	---	16	14	66	58	-1	capture	Missense_Mutation	SNP	10748353	10748353	SLC44A2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	14528	111
ZNF709	163051	broad.mit.edu	37	19	12575471	12575471	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12575471C>T	uc002mtv.3	-	4	1426	c.1265G>A	c.(1264-1266)TGT>TAT	p.C422Y	ZNF709_uc002mtw.3_Missense_Mutation_p.C390Y|ZNF709_uc002mtx.3_Missense_Mutation_p.C422Y	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a	422	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACATTGTTTACATTCATGGGG	0.408	GBM(33;565 669 12371 29134 51667)															0.210884	64.843488	76.211251	31	116	KEEP	---	---	---	---	17	18	62	70	-1	capture	Missense_Mutation	SNP	12575471	12575471	ZNF709	19	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17989	111
ZNF570	148268	broad.mit.edu	37	19	37975633	37975633	+	Missense_Mutation	SNP	G	A	A	rs146360083		TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37975633G>A	uc002ogk.1	+	5	1638	c.1109G>A	c.(1108-1110)CGT>CAT	p.R370H	ZNF570_uc010efl.1_Missense_Mutation_p.R426H|ZNF570_uc010xtr.1_Missense_Mutation_p.R167H	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	370	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTAGCCTTCGTGCATACCTT	0.423																0.202899	28.209299	33.868242	14	55	KEEP	---	---	---	---	7	7	25	37	-1	capture	Missense_Mutation	SNP	37975633	37975633	ZNF570	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17881	111
GRLF1	2909	broad.mit.edu	37	19	47422855	47422855	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47422855A>G	uc010ekv.2	+	1	923	c.923A>G	c.(922-924)TAT>TGT	p.Y308C		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	308	FF 1.				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		TACCAGGACTATGTCTACCTG	0.502																0.3	28.366787	29.436845	9	21	KEEP	---	---	---	---	6	5	9	13	-1	capture	Missense_Mutation	SNP	47422855	47422855	GRLF1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	6728	111
LILRA5	353514	broad.mit.edu	37	19	54823844	54823844	+	Silent	SNP	G	A	A	rs143927346	byFrequency	TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54823844G>A	uc002qfe.2	-	2	171	c.51C>T	c.(49-51)GAC>GAT	p.D17D	LILRA5_uc002qff.2_Silent_p.D17D|LILRA5_uc010yev.1_Silent_p.D17D|LILRA5_uc010yew.1_Silent_p.D17D|LILRA5_uc002qfh.1_Silent_p.D17D|LILRA5_uc002qfg.1_Silent_p.D17D	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	17					innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGCTCACGGCGTCTCCTCCCA	0.632																0.26087	29.277886	31.659735	12	34	KEEP	---	---	---	---	4	11	26	16	-1	capture	Silent	SNP	54823844	54823844	LILRA5	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8708	111
EPAS1	2034	broad.mit.edu	37	2	46609718	46609718	+	Silent	SNP	G	A	A	rs4953362	byFrequency	TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46609718G>A	uc002ruv.2	+	15	2930	c.2442G>A	c.(2440-2442)TCG>TCA	p.S814S	EPAS1_uc002ruw.2_Silent_p.S280S	NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	814					angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			ACAGCCTGTCGTCAGCCCACA	0.567																0.210526	25.866923	30.287162	12	45	KEEP	---	---	---	---	9	3	23	23	-1	capture	Silent	SNP	46609718	46609718	EPAS1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5105	111
ANKRD36	375248	broad.mit.edu	37	2	97869931	97869931	+	Missense_Mutation	SNP	A	T	T	rs76309140		TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:97869931A>T	uc010yva.1	+	50	3236	c.2992A>T	c.(2992-2994)ACA>TCA	p.T998S	ANKRD36_uc002sxp.3_RNA	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	998											0						CATTCAGGCTACAAGTGATGA	0.289																0.153846	7.384361	10.361988	4	22	KEEP	---	---	---	---	2	2	12	14	-1	capture	Missense_Mutation	SNP	97869931	97869931	ANKRD36	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	661	111
THSD7B	80731	broad.mit.edu	37	2	138373761	138373761	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:138373761C>T	uc002tva.1	+	17	3353	c.3353C>T	c.(3352-3354)ACA>ATA	p.T1118I	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GATCCCCACACAATGCAGAGA	0.418																0.033333	-29.733427	6.479158	5	145	KEEP	---	---	---	---	3	2	73	99	-1	capture	Missense_Mutation	SNP	138373761	138373761	THSD7B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	15765	111
FAP	2191	broad.mit.edu	37	2	163074520	163074520	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163074520T>A	uc002ucd.2	-	9	946	c.738A>T	c.(736-738)AGA>AGT	p.R246S	FAP_uc010zct.1_Missense_Mutation_p.R221S|FAP_uc010fpd.2_Intron|FAP_uc010fpe.1_Missense_Mutation_p.R213S	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	246	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						TATTTATTGTTCTAGGATATT	0.353																0.242038	85.206687	94.714537	38	119	KEEP	---	---	---	---	24	23	55	90	-1	capture	Missense_Mutation	SNP	163074520	163074520	FAP	2	T	A	A	A	1	0	0	0	0	1	0	0	0	803	62	4	4	5619	111
DHRS9	10170	broad.mit.edu	37	2	169939876	169939876	+	Silent	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169939876C>T	uc002uep.2	+	6	1855	c.351C>T	c.(349-351)GGC>GGT	p.G117G	DHRS9_uc002ueq.2_Silent_p.G117G|DHRS9_uc010zdc.1_Silent_p.G177G|DHRS9_uc010zdd.1_Silent_p.G117G|DHRS9_uc010zde.1_Silent_p.G117G	NM_005771	NP_005762	Q9BPW9	DHRS9_HUMAN	NADP-dependent retinol dehydrogenase/reductase	117					9-cis-retinoic acid biosynthetic process|androgen metabolic process|epithelial cell differentiation|progesterone metabolic process|retinol metabolic process	integral to endoplasmic reticulum membrane|microsome	alcohol dehydrogenase (NAD) activity|binding|racemase and epimerase activity|retinol dehydrogenase activity|testosterone dehydrogenase (NAD+) activity				0						GTGTTCCCGGCGTGCTGGCTC	0.468																0.259615	64.478203	69.920875	27	77	KEEP	---	---	---	---	16	14	48	35	-1	capture	Silent	SNP	169939876	169939876	DHRS9	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4456	111
TTN	7273	broad.mit.edu	37	2	179599471	179599471	+	Silent	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179599471G>A	uc010zfg.1	-	48	11672	c.11448C>T	c.(11446-11448)GTC>GTT	p.V3816V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.V477V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4743							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATCACTGCCGACGTCATTCA	0.363				p.V3816V(DAUDI-Tumor)	8722											0.253456	137.862847	149.809936	55	162	KEEP	---	---	---	---	27	39	102	90	-1	capture	Silent	SNP	179599471	179599471	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	16617	111
DGKD	8527	broad.mit.edu	37	2	234363420	234363420	+	Missense_Mutation	SNP	C	G	G			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234363420C>G	uc002vui.1	+	19	2288	c.2276C>G	c.(2275-2277)ACG>AGG	p.T759R	DGKD_uc002vuj.1_Missense_Mutation_p.T715R|DGKD_uc010fyh.1_Missense_Mutation_p.T626R|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	759					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GAGTATTACACGGAGAAATGT	0.453																0.258065	49.175364	52.460572	16	46	KEEP	---	---	---	---	3	13	20	34	-1	capture	Missense_Mutation	SNP	234363420	234363420	DGKD	2	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	4425	111
PCSK2	5126	broad.mit.edu	37	20	17446060	17446060	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17446060G>A	uc002wpm.2	+	11	1612	c.1292G>A	c.(1291-1293)CGC>CAC	p.R431H	PCSK2_uc002wpl.2_Missense_Mutation_p.R412H|PCSK2_uc010zrm.1_Missense_Mutation_p.R396H|PCSK2_uc002wpn.2_Missense_Mutation_p.R85H	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	431					enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAGTGGCGGCGCAATGGGGTC	0.567																0.230769	26.808976	30.238852	12	40	KEEP	---	---	---	---	7	9	24	19	-1	capture	Missense_Mutation	SNP	17446060	17446060	PCSK2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11504	111
SYCP2	10388	broad.mit.edu	37	20	58444912	58444912	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:58444912G>A	uc002yaz.2	-	35	3821	c.3682C>T	c.(3682-3684)CGG>TGG	p.R1228W		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1228					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TCCATAAACCGTTCTTCTGAA	0.294																0.16	19.15559	27.412085	12	63	KEEP	---	---	---	---	8	5	34	36	-1	capture	Missense_Mutation	SNP	58444912	58444912	SYCP2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	15320	111
KRTAP10-7	386675	broad.mit.edu	37	21	46021295	46021295	+	Silent	SNP	A	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46021295A>C	uc002zfn.3	+	2	784	c.759A>C	c.(757-759)CCA>CCC	p.P253P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	258	30 X 5 AA repeats of C-C-X(3).|20.					keratin filament					0						GCTGCCAGCCAGCTTGCTGCA	0.632																0.191667	104.614822	125.927442	46	194	KEEP	---	---	---	---	23	30	98	110	-1	capture	Silent	SNP	46021295	46021295	KRTAP10-7	21	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	8434	111
LZTR1	8216	broad.mit.edu	37	22	21342314	21342314	+	Missense_Mutation	SNP	A	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21342314A>C	uc002zto.2	+	5	519	c.416A>C	c.(415-417)GAC>GCC	p.D139A	LZTR1_uc002ztn.2_Missense_Mutation_p.D98A|LZTR1_uc011ahy.1_Missense_Mutation_p.D120A|LZTR1_uc010gsr.1_Missense_Mutation_p.D10A	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	139	Kelch 2.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			TACACTGGGGACATTTATTCC	0.453					1299											0.09589	7.884621	19.826203	7	66	KEEP	---	---	---	---	5	2	43	38	-1	capture	Missense_Mutation	SNP	21342314	21342314	LZTR1	22	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	9052	111
MYO18B	84700	broad.mit.edu	37	22	26348345	26348345	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26348345G>C	uc003abz.1	+	38	6176	c.5926G>C	c.(5926-5928)GAG>CAG	p.E1976Q	MYO18B_uc003aca.1_Missense_Mutation_p.E1857Q|MYO18B_uc010guy.1_Missense_Mutation_p.E1858Q|MYO18B_uc010guz.1_Missense_Mutation_p.E1856Q|MYO18B_uc011aka.1_Missense_Mutation_p.E1130Q|MYO18B_uc011akb.1_Missense_Mutation_p.E1489Q|MYO18B_uc010gva.1_5'Flank	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1976	Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CTGTGACCTAGAGAACAAGAC	0.517					968											0.28	21.514272	22.602086	7	18	KEEP	---	---	---	---	5	2	9	12	-1	capture	Missense_Mutation	SNP	26348345	26348345	MYO18B	22	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	9976	111
SMC1B	27127	broad.mit.edu	37	22	45750854	45750854	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:45750854G>C	uc003bgc.2	-	20	3155	c.3103C>G	c.(3103-3105)CAA>GAA	p.Q1035E	SMC1B_uc003bgd.2_Missense_Mutation_p.Q1035E	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	1035	Potential.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GTGGACTCTTGAAACTTGTCT	0.408																0.23	68.970701	75.655035	23	77	KEEP	---	---	---	---	18	8	40	50	-1	capture	Missense_Mutation	SNP	45750854	45750854	SMC1B	22	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	14674	111
KCNH8	131096	broad.mit.edu	37	3	19574969	19574969	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:19574969C>T	uc003cbk.1	+	16	2897	c.2702C>T	c.(2701-2703)CCT>CTT	p.P901L	KCNH8_uc010hex.1_Missense_Mutation_p.P362L	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	901	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						GTTCTGTCACCTCAGCAGCCA	0.493	NSCLC(124;1625 1765 8018 24930 42026)															0.239583	60.774063	66.718942	23	73	KEEP	---	---	---	---	15	13	37	43	-1	capture	Missense_Mutation	SNP	19574969	19574969	KCNH8	3	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	7960	111
NBEAL2	23218	broad.mit.edu	37	3	47041686	47041686	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47041686G>T	uc003cqp.2	+	27	4276	c.4097G>T	c.(4096-4098)GGA>GTA	p.G1366V	NBEAL2_uc010hjm.1_Missense_Mutation_p.G743V|NBEAL2_uc010hjn.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1366							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TCTAGTGTAGGATCAGGCAAC	0.637																0.252336	60.538201	66.532645	27	80	KEEP	---	---	---	---	17	13	39	51	0.566666666667	capture	Missense_Mutation	SNP	47041686	47041686	NBEAL2	3	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	10096	111
CELSR3	1951	broad.mit.edu	37	3	48685382	48685382	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48685382G>A	uc003cul.2	-	20	7302	c.7021C>T	c.(7021-7023)CGT>TGT	p.R2341C	CELSR3_uc003cuf.1_Missense_Mutation_p.R2411C|CELSR3_uc010hkg.2_Missense_Mutation_p.R324C	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2341	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGTAGCGACGGGCCCCCCGG	0.632																0.202703	68.734455	80.833432	30	118	KEEP	---	---	---	---	12	24	70	77	-1	capture	Missense_Mutation	SNP	48685382	48685382	CELSR3	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3191	111
DNAJC13	23317	broad.mit.edu	37	3	132217972	132217972	+	Missense_Mutation	SNP	T	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132217972T>A	uc003eor.2	+	37	4224	c.4159T>A	c.(4159-4161)TTA>ATA	p.L1387I		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1387							heat shock protein binding			ovary(1)|breast(1)	2						TATTTCAGATTTACAGCCTTA	0.328																0.288889	31.656046	33.454569	13	32	KEEP	---	---	---	---	7	7	18	17	-1	capture	Missense_Mutation	SNP	132217972	132217972	DNAJC13	3	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	4588	111
ACAD11	84129	broad.mit.edu	37	3	132361623	132361623	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132361623C>A	uc003eov.3	-	3	653	c.273G>T	c.(271-273)CAG>CAT	p.Q91H	ACAD11_uc003eoy.2_Missense_Mutation_p.Q91H	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	91						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						ACAAGGCTTTCTGGACTTTAA	0.323																0.208861	68.577149	80.987808	33	125	KEEP	---	---	---	---	19	20	66	81	0.512820512821	capture	Missense_Mutation	SNP	132361623	132361623	ACAD11	3	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	109	111
ATP11B	23200	broad.mit.edu	37	3	182559871	182559871	+	Missense_Mutation	SNP	G	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182559871G>T	uc003flb.2	+	8	922	c.665G>T	c.(664-666)GGA>GTA	p.G222V		NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	222	Cytoplasmic (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			AGATTCATGGGACGAATGATC	0.294																0.220779	36.732885	42.26075	17	60	KEEP	---	---	---	---	8	11	32	42	0.421052631579	capture	Missense_Mutation	SNP	182559871	182559871	ATP11B	3	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	1111	111
DNAH5	1767	broad.mit.edu	37	5	13717485	13717485	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13717485G>A	uc003jfd.2	-	73	12686	c.12644C>T	c.(12643-12645)GCG>GTG	p.A4215V	DNAH5_uc003jfc.2_Missense_Mutation_p.A383V	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4215	AAA 6 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ATTAAAGTCCGCTTGGTTAAA	0.532												Kartagener_syndrome				0.236842	20.655605	23.061162	9	29	KEEP	---	---	---	---	7	3	19	15	-1	capture	Missense_Mutation	SNP	13717485	13717485	DNAH5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4561	111
C5orf42	65250	broad.mit.edu	37	5	37183582	37183582	+	Silent	SNP	A	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37183582A>C	uc011cpa.1	-	26	4932	c.4701T>G	c.(4699-4701)CCT>CCG	p.P1567P	C5orf42_uc011coy.1_Silent_p.P68P|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Silent_p.P642P|C5orf42_uc011cpb.1_Silent_p.P448P	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	1567										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CCCTGGAATAAGGTAGGTCTC	0.323																0.276596	35.954291	38.066017	13	34	KEEP	---	---	---	---	9	4	17	17	-1	capture	Silent	SNP	37183582	37183582	C5orf42	5	A	C	C	C	1	0	0	0	0	0	0	0	1	28	3	4	4	2278	111
IRF1	3659	broad.mit.edu	37	5	131821402	131821402	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131821402G>A	uc003kxa.2	-	8	908	c.674C>T	c.(673-675)ACA>ATA	p.T225I	C5orf56_uc010jds.1_Intron|IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_Missense_Mutation_p.T225I|IRF1_uc010jdt.1_Missense_Mutation_p.T225I	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1	225					blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		ATCCTCATCTGTTGTAGCTGT	0.542																0.202247	34.090442	41.431437	18	71	KEEP	---	---	---	---	7	11	35	46	-1	capture	Missense_Mutation	SNP	131821402	131821402	IRF1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	7750	111
DSP	1832	broad.mit.edu	37	6	7576571	7576571	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7576571G>A	uc003mxp.1	+	19	2954	c.2675G>A	c.(2674-2676)CGT>CAT	p.R892H	DSP_uc003mxq.1_Missense_Mutation_p.R892H	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	892	Globular 1.|Spectrin 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGGAATTATCGTGATAACTAT	0.368																0.142857	23.069527	35.963756	15	90	KEEP	---	---	---	---	7	12	63	40	-1	capture	Missense_Mutation	SNP	7576571	7576571	DSP	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4736	111
OR10C1	442194	broad.mit.edu	37	6	29408603	29408603	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29408603C>A	uc011dlp.1	+	1	811	c.811C>A	c.(811-813)CCT>ACT	p.P271T	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	271	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GGCCACTGACCCTCTGGTGTC	0.552																0.04329	-34.443865	17.2173	10	221	KEEP	---	---	---	---	6	6	112	130	0.5	capture	Missense_Mutation	SNP	29408603	29408603	OR10C1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	10802	111
FILIP1	27145	broad.mit.edu	37	6	76023523	76023523	+	Missense_Mutation	SNP	G	C	C			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76023523G>C	uc003pia.2	-	5	2398	c.2025C>G	c.(2023-2025)AAC>AAG	p.N675K	FILIP1_uc003phy.1_Missense_Mutation_p.N675K|FILIP1_uc003phz.2_Missense_Mutation_p.N576K|FILIP1_uc010kbe.2_Missense_Mutation_p.N678K|FILIP1_uc003pib.1_Missense_Mutation_p.N427K	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	675	Potential.									skin(3)|ovary(1)	4						GAGAGAGGAAGTTAGCCTTAT	0.438																0.217391	170.789964	191.082987	60	216	KEEP	---	---	---	---	30	35	119	108	-1	capture	Missense_Mutation	SNP	76023523	76023523	FILIP1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	5839	111
SDK1	221935	broad.mit.edu	37	7	4050626	4050626	+	Silent	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4050626C>T	uc003smx.2	+	15	2299	c.2160C>T	c.(2158-2160)AAC>AAT	p.N720N	SDK1_uc010kso.2_Translation_Start_Site	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	720	Fibronectin type-III 1.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ATCTGTCAAACGTTGGCCCTG	0.498																0.207792	32.399274	38.472526	16	61	KEEP	---	---	---	---	13	7	35	34	-1	capture	Silent	SNP	4050626	4050626	SDK1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13861	111
PCLO	27445	broad.mit.edu	37	7	82579889	82579889	+	Missense_Mutation	SNP	C	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82579889C>A	uc003uhx.2	-	6	10304	c.10015G>T	c.(10015-10017)GGT>TGT	p.G3339C	PCLO_uc003uhv.2_Missense_Mutation_p.G3339C|PCLO_uc010lec.2_Missense_Mutation_p.G304C	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3270					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GCATACTGACCTTCCAAAATT	0.478																0.16129	27.269725	37.417872	15	78	KEEP	---	---	---	---	11	7	42	44	0.388888888889	capture	Missense_Mutation	SNP	82579889	82579889	PCLO	7	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	11486	111
PCLO	27445	broad.mit.edu	37	7	82784328	82784328	+	Silent	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82784328C>T	uc003uhx.2	-	2	1918	c.1629G>A	c.(1627-1629)CAG>CAA	p.Q543Q	PCLO_uc003uhv.2_Silent_p.Q543Q	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	489	Gln-rich.|Pro-rich.|10 X 10 AA tandem approximate repeats of P-A-K-P-Q-P-Q-Q-P-X.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTGGGCTAGGCTGTTGAGCTG	0.547																0.012821	-118.336067	8.567001	6	462	KEEP	---	---	---	---	4	3	280	247	-1	capture	Silent	SNP	82784328	82784328	PCLO	7	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	11486	111
ABCB4	5244	broad.mit.edu	37	7	87049323	87049323	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87049323C>T	uc003uiv.1	-	19	2461	c.2385G>A	c.(2383-2385)ATG>ATA	p.M795I	ABCB4_uc003uiw.1_Missense_Mutation_p.M795I|ABCB4_uc003uix.1_Missense_Mutation_p.M795I	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	795	ABC transmembrane type-1 2.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					CCTGTCTTAGCATTGCTTTAA	0.428																0.131356	39.047986	70.240931	31	205	KEEP	---	---	---	---	17	19	132	118	-1	capture	Missense_Mutation	SNP	87049323	87049323	ABCB4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	43	111
PIK3CG	5294	broad.mit.edu	37	7	106523501	106523501	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106523501G>A	uc003vdv.3	+	8	2738	c.2653G>A	c.(2653-2655)GCC>ACC	p.A885T	PIK3CG_uc003vdu.2_Missense_Mutation_p.A885T|PIK3CG_uc003vdw.2_Missense_Mutation_p.A885T	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	885	PI3K/PI4K.				G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TGTGAAAGACGCCACGACAAT	0.478				p.A885T(CMLT1-Tumor)	292											0.086538	1.678705	55.62275	27	285	KEEP	---	---	---	---	9	21	144	168	-1	capture	Missense_Mutation	SNP	106523501	106523501	PIK3CG	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11819	111
ZNF282	8427	broad.mit.edu	37	7	148909483	148909483	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148909483G>A	uc003wfm.2	+	6	1091	c.986G>A	c.(985-987)CGG>CAG	p.R329Q	ZNF282_uc011kun.1_Missense_Mutation_p.R329Q|ZNF282_uc003wfn.2_Missense_Mutation_p.R269Q|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	329					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CTCTTGTCCCGGATTAAACAG	0.463																0.073171	-0.605985	7.072387	3	38	KEEP	---	---	---	---	2	3	19	26	-1	capture	Missense_Mutation	SNP	148909483	148909483	ZNF282	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17699	111
NCOA2	10499	broad.mit.edu	37	8	71057069	71057069	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71057069G>A	uc003xyn.1	-	13	2782	c.2620C>T	c.(2620-2622)CGA>TGA	p.R874*	NCOA2_uc011lfb.1_Intron	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	874					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TGCCCTGGTCGTGGGTTATTA	0.388					476	T	RUNXBP2	AML								0.348148	126.388954	129.134026	47	88	KEEP	---	---	---	---	31	26	49	55	-1	capture	Nonsense_Mutation	SNP	71057069	71057069	NCOA2	8	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	10136	111
PHF20L1	51105	broad.mit.edu	37	8	133806658	133806658	+	Missense_Mutation	SNP	A	G	G			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133806658A>G	uc003ytt.2	+	3	411	c.86A>G	c.(85-87)TAT>TGT	p.Y29C	PHF20L1_uc003ytr.2_Missense_Mutation_p.Y29C|PHF20L1_uc010mdv.2_Missense_Mutation_p.Y29C|PHF20L1_uc003yts.2_Missense_Mutation_p.Y29C|PHF20L1_uc011lja.1_Missense_Mutation_p.Y29C|PHF20L1_uc003ytu.1_RNA|PHF20L1_uc003ytq.2_Missense_Mutation_p.Y29C	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	29	Tudor 1.						nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TTTTTGAGGTATCCATCACGA	0.338																0.301887	49.985829	51.839619	16	37	KEEP	---	---	---	---	9	9	21	20	-1	capture	Missense_Mutation	SNP	133806658	133806658	PHF20L1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11735	111
SECISBP2	79048	broad.mit.edu	37	9	91973081	91973081	+	Silent	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:91973081G>A	uc004aqj.1	+	16	2516	c.2436G>A	c.(2434-2436)CTG>CTA	p.L812L	SECISBP2_uc011ltk.1_Silent_p.L811L|SECISBP2_uc004aqk.1_Silent_p.L739L|SECISBP2_uc010mqo.1_Silent_p.L517L|SECISBP2_uc011ltl.1_Silent_p.L744L	NM_024077	NP_076982	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	812					translation	nucleus	mRNA 3'-UTR binding			ovary(2)|skin(1)	3						CCCCAGCCCTGAAAGAAAAAG	0.562																0.206897	11.528155	13.844544	6	23	KEEP	---	---	---	---	5	2	6	25	-1	capture	Silent	SNP	91973081	91973081	SECISBP2	9	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	13899	111
LAMC3	10319	broad.mit.edu	37	9	133927934	133927934	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133927934C>T	uc004caa.1	+	10	1785	c.1687C>T	c.(1687-1689)CGG>TGG	p.R563W		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	563	Laminin IV type A.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		ACTGACCTTCCGGGTGCCCCC	0.597														OREG0019556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.238095	55.345007	61.915657	25	80	KEEP	---	---	---	---	18	12	54	40	-1	capture	Missense_Mutation	SNP	133927934	133927934	LAMC3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	8536	111
DCAF12L2	340578	broad.mit.edu	37	X	125299442	125299442	+	Missense_Mutation	SNP	C	T	T			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299442C>T	uc004euk.1	-	1	493	c.466G>A	c.(466-468)GAG>AAG	p.E156K		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	156	WD 1.							p.E156K(1)		lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						GGATTCAGCTCGATGGCATGG	0.682																0.285714	30.782628	32.513418	12	30	KEEP	---	---	---	---	5	8	16	18	-1	capture	Missense_Mutation	SNP	125299442	125299442	DCAF12L2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4224	111
PCDH11Y	83259	broad.mit.edu	37	Y	5605925	5605925	+	Missense_Mutation	SNP	G	A	A			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:5605925G>A	uc004fqo.2	+	5	4699	c.3965G>A	c.(3964-3966)CGC>CAC	p.R1322H		NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	1322	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TTCGCTCCACGCCAACAGGCC	0.408																0.380952	65.381531	66.16579	24	39	KEEP	---	---	---	---	11	15	20	22	-1	capture	Missense_Mutation	SNP	5605925	5605925	PCDH11Y	24	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11412	111
CD1D	912	broad.mit.edu	37	1	158151257	158151257	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158151257delT	uc001frr.2	+	3	573	c.74delT	c.(73-75)CTTfs	p.L25fs	CD1D_uc009wsr.1_Frame_Shift_Del_p.L25fs|CD1D_uc009wss.2_Frame_Shift_Del_p.L25fs|CD1D_uc009wst.1_Intron	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	25	Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					CCGCAAAGGCTTTTCCCCCTC	0.592																0.01			8	535		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	158151257	158151257	CD1D	1	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	2948	111
DARS	1615	broad.mit.edu	37	2	136682064	136682074	+	Splice_Site	DEL	GATGTCTAGAA	-	-			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136682064_136682074delGATGTCTAGAA	uc002tux.1	-	8	749	c.565_splice	c.e8-1	p.T189_splice	DARS_uc010fnj.1_Splice_Site_p.T89_splice	NM_001349	NP_001340	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase						aspartyl-tRNA aminoacylation|protein complex assembly	cytosol|nuclear membrane|plasma membrane|soluble fraction	aminoacylase activity|aspartate-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	CTGACTAGTTGATGTCTAGAAGACAGTAATA	0.374																0.18			8	37		---	---	---	---						capture_indel	Splice_Site	DEL	136682064	136682074	DARS	2	GATGTCTAGAA	-	-	-	1	0	1	0	1	0	0	1	0	585	45	5	5	4200	111
ZNF318	24149	broad.mit.edu	37	6	43308071	43308072	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-06-6697-01	TCGA-06-6697-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43308071_43308072delTC	uc003oux.2	-	10	3742_3743	c.3664_3665delGA	c.(3664-3666)GAAfs	p.E1222fs	ZNF318_uc003ouw.2_Intron	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1222	Lys-rich.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTCCTTTACTTCTTTCACAGCC	0.450																0.21			66	244		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	43308071	43308072	ZNF318	6	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	17716	111
