Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AURKAIP1	54998	broad.mit.edu	37	1	1309242	1309242	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1309242G>A	uc001afb.1	-	3	649	c.539C>T	c.(538-540)GCG>GTG	p.A180V	AURKAIP1_uc001afc.2_Missense_Mutation_p.A180V|AURKAIP1_uc001afd.2_Missense_Mutation_p.A180V|AURKAIP1_uc009vkb.1_Missense_Mutation_p.A180V	NM_017900	NP_060370	Q9NWT8	AKIP_HUMAN	aurora kinase A interacting protein 1	180					negative regulation of mitosis|positive regulation of proteolysis	mitochondrion|nucleus	protein binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.82e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CTTTAGCCCCGCCTTCAGCCA	0.597																0.046875	-15.953129	12.054244	6	122	KEEP	---	---	---	---	3	3	80	62	-1	capture	Missense_Mutation	SNP	1309242	1309242	AURKAIP1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1212	122
APITD1	378708	broad.mit.edu	37	1	10493980	10493980	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10493980C>T	uc001are.2	+	2	549	c.133C>T	c.(133-135)CAG>TAG	p.Q45*	APITD1_uc001arf.2_Nonsense_Mutation_p.Q45*|APITD1_uc001arg.2_Missense_Mutation_p.T124I|APITD1_uc001arh.2_Nonsense_Mutation_p.Q6*	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform	45					DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		GTTCAGCAAACAGACCATTGC	0.488																0.400862	249.59054	251.594489	93	139	KEEP	---	---	---	---	59	39	83	67	-1	capture	Nonsense_Mutation	SNP	10493980	10493980	APITD1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	768	122
DIRAS3	9077	broad.mit.edu	37	1	68512685	68512685	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68512685C>G	uc001ded.2	-	2	591	c.296G>C	c.(295-297)CGC>CCC	p.R99P	uc001deb.1_Intron|uc001dec.1_Intron	NM_004675	NP_004666	O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	99					regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						CTGCAGAGCGCGGTTGCCGTC	0.587																0.016447	-72.099939	8.173255	5	299	KEEP	---	---	---	---	5	1	180	148	-1	capture	Missense_Mutation	SNP	68512685	68512685	DIRAS3	1	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	4490	122
GON4L	54856	broad.mit.edu	37	1	155792117	155792117	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155792117T>G	uc001flz.2	-	4	945	c.848A>C	c.(847-849)CAG>CCG	p.Q283P	GON4L_uc001fly.1_Missense_Mutation_p.Q283P|GON4L_uc009wrh.1_Missense_Mutation_p.Q283P|GON4L_uc001fma.1_Missense_Mutation_p.Q283P|GON4L_uc001fmc.2_Missense_Mutation_p.Q283P|GON4L_uc001fmd.3_Missense_Mutation_p.Q283P|GON4L_uc009wri.2_5'UTR|GON4L_uc001fme.2_Missense_Mutation_p.Q111P|GON4L_uc001fmf.2_5'Flank	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	283					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TAGATTGTGCTGCTTGGCACC	0.458																0.447876	367.8466	368.461996	116	143	KEEP	---	---	---	---	85	60	99	60	-1	capture	Missense_Mutation	SNP	155792117	155792117	GON4L	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	6506	122
OLFML2B	25903	broad.mit.edu	37	1	161993080	161993080	+	Silent	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161993080G>A	uc001gbu.2	-	1	565	c.141C>T	c.(139-141)AAC>AAT	p.N47N	OLFML2B_uc010pkq.1_Silent_p.N47N	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	47	Potential.									skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			TGTCCGCCTCGTTTTGCAGAG	0.602																0.21875	65.531286	74.864056	28	100	KEEP	---	---	---	---	19	14	64	59	-1	capture	Silent	SNP	161993080	161993080	OLFML2B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10763	122
SMG7	9887	broad.mit.edu	37	1	183514093	183514093	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183514093C>T	uc001gqg.2	+	16	2138	c.2016C>T	c.(2014-2016)CCC>CCT	p.P672P	SMG7_uc010pob.1_Silent_p.P655P|SMG7_uc001gqf.2_Silent_p.P626P|SMG7_uc001gqh.2_Silent_p.P626P|SMG7_uc001gqi.2_Silent_p.P584P|SMG7_uc010poc.1_Silent_p.P630P	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	672	Gln/Pro-rich.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ATGTTATCCCCCCGCCTGTGG	0.443																0.408759	355.607907	357.609121	112	162	KEEP	---	---	---	---	67	53	102	80	-1	capture	Silent	SNP	183514093	183514093	SMG7	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14690	122
FAM129A	116496	broad.mit.edu	37	1	184787863	184787863	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:184787863C>T	uc001gra.2	-	9	1276	c.1082G>A	c.(1081-1083)GGA>GAA	p.G361E	FAM129A_uc001grb.1_Missense_Mutation_p.G124E|FAM129A_uc009wyh.1_Missense_Mutation_p.G189E|FAM129A_uc009wyi.1_Missense_Mutation_p.G159E	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	361					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						TTCACTGAATCCCGAGCTCAC	0.537																0.018519	-74.254384	10.3052	6	318	KEEP	---	---	---	---	8	0	184	162	-1	capture	Missense_Mutation	SNP	184787863	184787863	FAM129A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	5390	122
CFHR4	10877	broad.mit.edu	37	1	196884097	196884097	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196884097A>C	uc001gto.2	+	5	697	c.628A>C	c.(628-630)AAG>CAG	p.K210Q	CFHR4_uc009wyy.2_Missense_Mutation_p.K456Q|CFHR4_uc001gtp.2_Missense_Mutation_p.K457Q	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	210	Sushi 4.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						TTCTTCAGAAAAGTGTGGGCC	0.358																0.459184	155.668068	155.809926	45	53	KEEP	---	---	---	---	37	39	69	61	-1	capture	Missense_Mutation	SNP	196884097	196884097	CFHR4	1	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	3253	122
HIST3H3	8290	broad.mit.edu	37	1	228612870	228612870	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228612870G>A	uc001hsx.1	-	1	157	c.157C>T	c.(157-159)CGC>TGC	p.R53C		NM_003493	NP_003484	Q16695	H31T_HUMAN	histone cluster 3, H3	53					nucleosome assembly|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0		Prostate(94;0.0724)				TGGTAGCGGCGGATCTCGCGA	0.652																0.418605	114.489998	114.986114	36	50	KEEP	---	---	---	---	37	29	51	40	-1	capture	Missense_Mutation	SNP	228612870	228612870	HIST3H3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7109	122
CCAR1	55749	broad.mit.edu	37	10	70496806	70496806	+	Splice_Site	SNP	G	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70496806G>C	uc001joo.2	+	3	365	c.246_splice	c.e3+1	p.Q82_splice	CCAR1_uc001jol.1_Splice_Site|CCAR1_uc001jom.1_Splice_Site|CCAR1_uc009xpx.1_Splice_Site_p.Q82_splice|CCAR1_uc001jon.1_Splice_Site_p.A72_splice|CCAR1_uc010qiz.1_Splice_Site_p.Q82_splice|CCAR1_uc010qja.1_Splice_Site_p.Q82_splice|CCAR1_uc010qjb.1_Splice_Site	NM_018237	NP_060707	Q8IX12	CCAR1_HUMAN	cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7						ATTACAACAGGTAAATCTTTA	0.393																0.740741	83.214303	84.631745	20	7	KEEP	---	---	---	---	11	19	4	5	-1	capture	Splice_Site	SNP	70496806	70496806	CCAR1	10	G	C	C	C	1	0	0	0	0	0	0	1	0	572	44	5	4	2704	122
CRTAC1	55118	broad.mit.edu	37	10	99664517	99664517	+	Missense_Mutation	SNP	C	T	T	rs149424033		TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:99664517C>T	uc001kou.1	-	7	1261	c.905G>A	c.(904-906)CGT>CAT	p.R302H	CRTAC1_uc001kov.2_Missense_Mutation_p.R291H|CRTAC1_uc001kot.1_Missense_Mutation_p.R92H	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	302	FG-GAP 3; atypical.					proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		TTTGCCATCACGGTTGAAGTC	0.617																0.787879	268.103405	275.69053	78	21	KEEP	---	---	---	---	54	27	9	12	-1	capture	Missense_Mutation	SNP	99664517	99664517	CRTAC1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3861	122
RHOG	391	broad.mit.edu	37	11	3849147	3849147	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3849147C>T	uc001lyu.2	-	2	380	c.222G>A	c.(220-222)CAG>CAA	p.Q74Q		NM_001665	NP_001656	P84095	RHOG_HUMAN	ras homolog gene family, member G precursor	74					actin cytoskeleton organization|activation of Rac GTPase activity|axon guidance|cell chemotaxis|platelet activation|positive regulation of cell proliferation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of transcription, DNA-dependent|Rac protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding				0		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0349)|LUSC - Lung squamous cell carcinoma(625;0.194)		AAACGTTGGTCTGAGGGTAGG	0.602																0.049505	-12.517814	9.263643	5	96	KEEP	---	---	---	---	1	6	66	48	-1	capture	Silent	SNP	3849147	3849147	RHOG	11	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	13231	122
OR51F1	256892	broad.mit.edu	37	11	4790709	4790709	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4790709C>A	uc010qyl.1	-	1	439	c.439G>T	c.(439-441)GGT>TGT	p.G147C		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	147						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		ATCAGAAGACCCATTTGAATG	0.433																0.131313	19.002399	32.087437	13	86	KEEP	---	---	---	---	11	3	44	48	0.214285714286	capture	Missense_Mutation	SNP	4790709	4790709	OR51F1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	11000	122
SAPS3	55291	broad.mit.edu	37	11	68315674	68315674	+	Splice_Site	SNP	T	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68315674T>G	uc001onw.2	+	5	819	c.552_splice	c.e5+2	p.N184_splice	SAPS3_uc010rqb.1_Splice_Site_p.N93_splice|SAPS3_uc001onv.2_Splice_Site_p.N184_splice|SAPS3_uc001ony.3_Splice_Site_p.N184_splice|SAPS3_uc001onx.2_Splice_Site_p.N184_splice|SAPS3_uc009ysh.2_Splice_Site_p.N184_splice|SAPS3_uc001onu.2_Splice_Site_p.N184_splice|SAPS3_uc010rqc.1_Splice_Site_p.N93_splice	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			GTGCTGAATGTGAGTAGAATT	0.507																0.454955	363.660814	364.051716	101	121	KEEP	---	---	---	---	71	41	83	54	-1	capture	Splice_Site	SNP	68315674	68315674	SAPS3	11	T	G	G	G	1	0	0	0	0	0	0	1	0	767	59	5	4	13730	122
PCF11	51585	broad.mit.edu	37	11	82880169	82880169	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82880169A>T	uc001ozx.3	+	8	3137	c.2792A>T	c.(2791-2793)GAT>GTT	p.D931V	PCF11_uc010rsu.1_Missense_Mutation_p.D1062V	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	931	Gly-rich.				mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						ATTAGGTTTGATGGACCTCAT	0.537																0.4	73.587937	74.112676	24	36	KEEP	---	---	---	---	14	11	24	12	-1	capture	Missense_Mutation	SNP	82880169	82880169	PCF11	11	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	11476	122
ANO2	57101	broad.mit.edu	37	12	5908716	5908716	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5908716G>A	uc001qnm.2	-	10	1072	c.1000C>T	c.(1000-1002)CGC>TGC	p.R334C		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	339	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						ACTCCATAGCGCGCCCATTCT	0.423																0.630435	96.785613	97.473	29	17	KEEP	---	---	---	---	16	17	10	10	-1	capture	Missense_Mutation	SNP	5908716	5908716	ANO2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	691	122
ABCC9	10060	broad.mit.edu	37	12	21965043	21965043	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21965043G>T	uc001rfi.1	-	34	4171	c.4151C>A	c.(4150-4152)ACA>AAA	p.T1384K	ABCC9_uc001rfh.2_Missense_Mutation_p.T1384K|ABCC9_uc001rfj.1_Missense_Mutation_p.T1348K	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1384	Cytoplasmic (Potential).|ABC transporter 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGAACGTAGTGTGTGCAGTGG	0.358																0.436364	150.374573	150.764459	48	62	KEEP	---	---	---	---	29	26	44	27	0.527272727273	capture	Missense_Mutation	SNP	21965043	21965043	ABCC9	12	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	59	122
PIWIL1	9271	broad.mit.edu	37	12	130847606	130847606	+	Silent	SNP	A	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130847606A>G	uc001uik.2	+	18	2202	c.2112A>G	c.(2110-2112)GTA>GTG	p.V704V	PIWIL1_uc001uij.1_Silent_p.V704V	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	704	Piwi.				gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GCGATGGCGTAGGAGACGGCC	0.478																0.537037	219.062326	219.191586	58	50	KEEP	---	---	---	---	43	27	33	22	-1	capture	Silent	SNP	130847606	130847606	PIWIL1	12	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	11860	122
FLT3	2322	broad.mit.edu	37	13	28597589	28597589	+	Missense_Mutation	SNP	T	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28597589T>A	uc001urw.2	-	19	2398	c.2316A>T	c.(2314-2316)AAA>AAT	p.K772N	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.K772N	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	772	Protein kinase.|Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	CTTCCAGCCTTTTTTGGTTTT	0.348					630	Mis|O		AML|ALL								0.471154	146.263448	146.339038	49	55	KEEP	---	---	---	---	31	21	26	30	-1	capture	Missense_Mutation	SNP	28597589	28597589	FLT3	13	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	5886	122
FAM70B	348013	broad.mit.edu	37	13	114507939	114507939	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:114507939G>A	uc001vuh.2	+	8	778	c.751G>A	c.(751-753)GCA>ACA	p.A251T		NM_182614	NP_872420	Q8WV15	FA70B_HUMAN	family with sequence similarity 70, member B	251						integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)			CCTGGCCTACGCAGGCTTCCG	0.677																0.372093	88.485318	89.717951	32	54	KEEP	---	---	---	---	11	32	18	48	-1	capture	Missense_Mutation	SNP	114507939	114507939	FAM70B	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5554	122
EDDM3B	64184	broad.mit.edu	37	14	21238424	21238424	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21238424T>G	uc001vyd.2	+	2	213	c.115T>G	c.(115-117)TTA>GTA	p.L39V		NM_022360	NP_071755	P56851	EP3B_HUMAN	human epididymis-specific 3 beta precursor	39					spermatid development	extracellular region				ovary(1)	1						ACAGCACTACTTAAGTCCAAG	0.413																0.485915	232.669786	232.694346	69	73	KEEP	---	---	---	---	34	37	50	29	-1	capture	Missense_Mutation	SNP	21238424	21238424	EDDM3B	14	T	G	G	G	1	0	0	0	0	1	0	0	0	725	56	4	4	4865	122
CTSG	1511	broad.mit.edu	37	14	25042969	25042969	+	Silent	SNP	G	A	A	rs147260851	byFrequency	TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25042969G>A	uc001wpq.2	-	5	679	c.642C>T	c.(640-642)ATC>ATT	p.I214I		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	214	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		CATAGGAGACGATGCCGTGGG	0.557																0.378882	367.768294	371.914162	122	200	KEEP	---	---	---	---	79	55	120	109	-1	capture	Silent	SNP	25042969	25042969	CTSG	14	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	3996	122
CDKL1	8814	broad.mit.edu	37	14	50802891	50802891	+	Silent	SNP	A	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50802891A>G	uc010anu.1	-	20	2802	c.2802T>C	c.(2800-2802)TCT>TCC	p.S934S	CDKL1_uc001wxz.2_Intron	NM_004196	NP_004187	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1	Error:Variant_position_missing_in_Q00532_after_alignment						cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)|stomach(1)	2	all_epithelial(31;0.000746)|Breast(41;0.0102)					TCACAGCCCCAGAAGCAAGCA	0.567					153											0.809524	60.78625	62.66633	17	4	KEEP	---	---	---	---	11	9	3	1	-1	capture	Silent	SNP	50802891	50802891	CDKL1	14	A	G	G	G	1	0	0	0	0	0	0	0	1	79	7	3	3	3123	122
FAM181A	90050	broad.mit.edu	37	14	94394937	94394937	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94394937C>T	uc001ybz.1	+	3	799	c.492C>T	c.(490-492)AGC>AGT	p.S164S	C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.N102N|FAM181A_uc001yca.1_Silent_p.N102N	NM_138344	NP_612353	Q8N9Y4	F181A_HUMAN	hypothetical protein LOC90050	164				N -> S (in Ref. 2; BAC04151).							0						TGCTGAGGAACCCCTACAGGG	0.637																0.093023	0.964798	8.140681	4	39	KEEP	---	---	---	---	2	3	18	26	-1	capture	Silent	SNP	94394937	94394937	FAM181A	14	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	5460	122
SLC12A6	9990	broad.mit.edu	37	15	34528395	34528395	+	Silent	SNP	T	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34528395T>C	uc001zhw.2	-	23	3212	c.3048A>G	c.(3046-3048)CAA>CAG	p.Q1016Q	SLC12A6_uc001zhv.2_Silent_p.Q965Q|SLC12A6_uc001zhx.2_Silent_p.Q1001Q|SLC12A6_uc001zhy.2_RNA|SLC12A6_uc001zhz.2_RNA|SLC12A6_uc001zia.2_Silent_p.Q957Q|SLC12A6_uc001zib.2_Silent_p.Q1007Q|SLC12A6_uc001zic.2_Silent_p.Q1016Q|SLC12A6_uc010bau.2_Silent_p.Q1016Q|SLC12A6_uc001zid.2_Silent_p.Q957Q|SLC12A6_uc001zht.2_RNA|SLC12A6_uc001zhu.2_Silent_p.Q828Q	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a	1016	Cytoplasmic (Potential).				angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	CTTTCACCAATTGTGCCTGAG	0.413																0.421053	145.285857	145.8023	40	55	KEEP	---	---	---	---	27	14	33	23	-1	capture	Silent	SNP	34528395	34528395	SLC12A6	15	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	14280	122
LMAN1L	79748	broad.mit.edu	37	15	75116023	75116023	+	Silent	SNP	G	A	A	rs147808783	byFrequency	TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75116023G>A	uc002ayt.1	+	12	1325	c.1323G>A	c.(1321-1323)GCG>GCA	p.A441A	LMAN1L_uc010bke.1_Silent_p.A429A|CPLX3_uc002ayu.1_5'Flank	NM_021819	NP_068591	Q9HAT1	LMA1L_HUMAN	lectin, mannose-binding, 1 like precursor	441	Lumenal (Potential).					ER-Golgi intermediate compartment membrane|integral to membrane	sugar binding				0						GGGGCCCGGCGGTGAGGGGAA	0.622																0.12	12.619745	23.245588	9	66	KEEP	---	---	---	---	7	3	45	36	-1	capture	Silent	SNP	75116023	75116023	LMAN1L	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8757	122
DNAH3	55567	broad.mit.edu	37	16	20974846	20974846	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20974846A>T	uc010vbe.1	-	53	10360	c.10360T>A	c.(10360-10362)TGG>AGG	p.W3454R	DNAH3_uc010vbd.1_Missense_Mutation_p.W889R	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3454					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCATGGGGCCAGGCCGAGTCA	0.532																0.162162	37.479471	49.525162	18	93	KEEP	---	---	---	---	12	7	49	50	-1	capture	Missense_Mutation	SNP	20974846	20974846	DNAH3	16	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	4560	122
SRCAP	10847	broad.mit.edu	37	16	30748842	30748842	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30748842G>C	uc002dze.1	+	34	7866	c.7481G>C	c.(7480-7482)TGT>TCT	p.C2494S	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.C2289S	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2494	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			attcctccttgttcttctcct	0.149																0.56	104.90611	105.062737	28	22	KEEP	---	---	---	---	16	12	15	8	-1	capture	Missense_Mutation	SNP	30748842	30748842	SRCAP	16	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	15027	122
SRCAP	10847	broad.mit.edu	37	16	30748845	30748845	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30748845C>G	uc002dze.1	+	34	7869	c.7484C>G	c.(7483-7485)TCT>TGT	p.S2495C	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.S2290C	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2495	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			cctccttgttcttctcctgcc	0.154																0.538462	108.406507	108.473611	28	24	KEEP	---	---	---	---	15	13	16	9	-1	capture	Missense_Mutation	SNP	30748845	30748845	SRCAP	16	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	15027	122
ITGAD	3681	broad.mit.edu	37	16	31429674	31429674	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31429674G>T	uc002ebv.1	+	22	2718	c.2669G>T	c.(2668-2670)AGG>ATG	p.R890M	ITGAD_uc010cap.1_Missense_Mutation_p.R891M	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	890	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						CTGGGAGACAGGATGCTTATG	0.572																0.341085	127.562329	130.440622	44	85	KEEP	---	---	---	---	23	26	62	39	0.469387755102	capture	Missense_Mutation	SNP	31429674	31429674	ITGAD	16	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	7807	122
PLA2G15	23659	broad.mit.edu	37	16	68288909	68288909	+	Silent	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:68288909G>A	uc002evr.2	+	3	455	c.372G>A	c.(370-372)CTG>CTA	p.L124L	PLA2G15_uc010vld.1_Silent_p.L124L|PLA2G15_uc010vle.1_Nonsense_Mutation_p.W72*|PLA2G15_uc010vlf.1_Intron|PLA2G15_uc002evs.2_5'UTR	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)	124					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1						CCTTCTCACTGGAGTTCCTGG	0.572																0.344828	90.624229	92.473979	30	57	KEEP	---	---	---	---	18	14	25	32	-1	capture	Silent	SNP	68288909	68288909	PLA2G15	16	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	11895	122
ITGAE	3682	broad.mit.edu	37	17	3651273	3651273	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3651273C>T	uc002fwo.3	-	17	2197	c.2098G>A	c.(2098-2100)GTC>ATC	p.V700I		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	700	Extracellular (Potential).				cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ACATTCACGACGCCGTTGAAG	0.542	NSCLC(182;635 2928 8995 38788)				37											0.5	70.788313	70.788313	24	24	KEEP	---	---	---	---	12	16	22	8	-1	capture	Missense_Mutation	SNP	3651273	3651273	ITGAE	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7808	122
DVL2	1856	broad.mit.edu	37	17	7134114	7134114	+	Missense_Mutation	SNP	A	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7134114A>C	uc002gez.1	-	2	479	c.197T>G	c.(196-198)GTG>GGG	p.V66G	DVL2_uc010vtr.1_Missense_Mutation_p.V66G|DVL2_uc010vts.1_5'Flank|DVL2_uc010clz.1_Missense_Mutation_p.V66G	NM_004422	NP_004413	O14641	DVL2_HUMAN	dishevelled 2	66	DIX.				canonical Wnt receptor signaling pathway involved in regulation of cell proliferation|intracellular signal transduction|neural tube closure|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|segment specification|transcription from RNA polymerase II promoter	cytosol|nucleus|plasma membrane	frizzled binding|identical protein binding|signal transducer activity			lung(1)|kidney(1)	2						TTCCTTCACCACCCTGCCAAG	0.577																0.105691	-11.878646	8.107636	13	110	KEEP	---	---	---	---	31	11	50	68	-1	capture	Missense_Mutation	SNP	7134114	7134114	DVL2	17	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	4791	122
LGALS9B	284194	broad.mit.edu	37	17	20363749	20363749	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:20363749G>C	uc002gxa.1	-	2	112	c.47C>G	c.(46-48)CCC>CGC	p.P16R	LGALS9B_uc002gwz.1_Missense_Mutation_p.P16R|LGALS9B_uc010vzh.1_Intron	NM_001042685	NP_001036150	Q3B8N2	LEG9B_HUMAN	galectin-9 like	16							sugar binding			skin(1)	1						CCCAGAAAAGGGGACGGCCTG	0.592																0.413793	133.866524	134.621974	48	68	KEEP	---	---	---	---	29	42	72	66	-1	capture	Missense_Mutation	SNP	20363749	20363749	LGALS9B	17	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	8669	122
KRTAP4-8	728224	broad.mit.edu	37	17	39254142	39254142	+	Silent	SNP	A	G	G	rs151141551	by1000genomes	TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39254142A>G	uc010wfo.1	-	1	234	c.195T>C	c.(193-195)TGT>TGC	p.C65C		NM_031960	NP_114166	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4.8	65	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].|9.					keratin filament					0						AGCTGGGGCGACAGCAGGTGG	0.602																0.152174	12.085936	17.446016	7	39	KEEP	---	---	---	---	13	8	35	24	-1	capture	Silent	SNP	39254142	39254142	KRTAP4-8	17	A	G	G	G	1	0	0	0	0	0	0	0	1	128	10	3	3	8476	122
IGF2BP1	10642	broad.mit.edu	37	17	47115627	47115627	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47115627C>T	uc002iom.2	+	6	833	c.499C>T	c.(499-501)CGC>TGC	p.R167C	IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding	167					CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						TGAGAATGGGCGCCGAGGGGG	0.637	Esophageal Squamous(198;1041 2123 8248 37119 38268)															0.43	126.943	127.360428	43	57	KEEP	---	---	---	---	23	24	34	24	-1	capture	Missense_Mutation	SNP	47115627	47115627	IGF2BP1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7498	122
TNFSF14	8740	broad.mit.edu	37	19	6669978	6669978	+	Missense_Mutation	SNP	C	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6669978C>A	uc002mfk.1	-	2	485	c.103G>T	c.(103-105)GTG>TTG	p.V35L	TNFSF14_uc002mfj.1_Missense_Mutation_p.V35L	NM_003807	NP_003798	O43557	TNF14_HUMAN	tumor necrosis factor ligand superfamily, member	35	Cytoplasmic (Potential).				cellular response to mechanical stimulus|immune response|induction of apoptosis|release of cytoplasmic sequestered NF-kappaB|T cell homeostasis|T cell proliferation	cytoplasm|extracellular space|integral to membrane|plasma membrane	caspase inhibitor activity|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1						ACCCGGGCCACACTGCACGAC	0.632																0.043689	-27.906503	18.050148	9	197	KEEP	---	---	---	---	2	8	93	139	0.8	capture	Missense_Mutation	SNP	6669978	6669978	TNFSF14	19	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	16190	122
ZNF560	147741	broad.mit.edu	37	19	9579010	9579010	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9579010C>T	uc002mlp.1	-	10	823	c.613G>A	c.(613-615)GCA>ACA	p.A205T	ZNF560_uc010dwr.1_Missense_Mutation_p.A99T	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	205					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						TGGTTTCTTGCCTGTTAACAC	0.338																0.518987	134.676908	134.701576	41	38	KEEP	---	---	---	---	28	17	27	13	-1	capture	Missense_Mutation	SNP	9579010	9579010	ZNF560	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17870	122
OR1I1	126370	broad.mit.edu	37	19	15198267	15198267	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15198267C>T	uc010xoe.1	+	1	391	c.391C>T	c.(391-393)CGT>TGT	p.R131C		NM_001004713	NP_001004713	O60431	OR1I1_HUMAN	olfactory receptor, family 1, subfamily I,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3						CCACCCACAGCGTTACTTGGT	0.567																0.440678	78.041029	78.222047	26	33	KEEP	---	---	---	---	18	10	16	20	-1	capture	Missense_Mutation	SNP	15198267	15198267	OR1I1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10862	122
NLRP4	147945	broad.mit.edu	37	19	56388509	56388509	+	Silent	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56388509G>A	uc002qmd.3	+	8	3095	c.2673G>A	c.(2671-2673)ACG>ACA	p.T891T	NLRP4_uc002qmf.2_Silent_p.T816T|NLRP4_uc010etf.2_Silent_p.T666T	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	891							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TGACGCATACGGATTGCCGCT	0.478																0.388158	190.897182	192.560958	59	93	KEEP	---	---	---	---	36	26	69	40	-1	capture	Silent	SNP	56388509	56388509	NLRP4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10386	122
ASB3	51130	broad.mit.edu	37	2	53941692	53941692	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:53941692G>A	uc002rxg.1	-	7	944	c.809C>T	c.(808-810)ACT>ATT	p.T270I	ASB3_uc002rxh.1_Missense_Mutation_p.T197I|ASB3_uc002rxi.3_Missense_Mutation_p.T308I|ASB3_uc010yoo.1_Missense_Mutation_p.T187I	NM_016115	NP_057199	Q9Y575	ASB3_HUMAN	ankyrin repeat and SOCS box-containing protein 3	270	ANK 8.				intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GGCCCGGTTAGTAAGTGGTAT	0.393																0.034682	-29.709381	11.058069	6	167	KEEP	---	---	---	---	3	4	110	72	-1	capture	Missense_Mutation	SNP	53941692	53941692	ASB3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	1015	122
DPP10	57628	broad.mit.edu	37	2	116593731	116593731	+	Splice_Site	SNP	A	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116593731A>G	uc002tla.1	+	22	2408	c.1951_splice	c.e22-2	p.G651_splice	DPP10_uc002tlb.1_Splice_Site_p.G601_splice|DPP10_uc002tlc.1_Splice_Site_p.G647_splice|DPP10_uc002tle.2_Splice_Site_p.G655_splice|DPP10_uc002tlf.1_Splice_Site_p.G644_splice	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TTTCCCCCCCAGGGTTATGGT	0.264																0.5	26.673633	26.673633	9	9	KEEP	---	---	---	---	4	5	2	7	-1	capture	Splice_Site	SNP	116593731	116593731	DPP10	2	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	4682	122
RBM45	129831	broad.mit.edu	37	2	178990756	178990756	+	Silent	SNP	T	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:178990756T>C	uc002ulv.2	+	9	1370	c.1278T>C	c.(1276-1278)AAT>AAC	p.N426N		NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	428	RRM 3.				cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			CAGGAAAAAATGTGGGGTATG	0.348																0.1	7.275167	23.268055	10	90	KEEP	---	---	---	---	5	6	65	39	-1	capture	Silent	SNP	178990756	178990756	RBM45	2	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	13034	122
ZDBF2	57683	broad.mit.edu	37	2	207169709	207169709	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207169709C>T	uc002vbp.2	+	5	707	c.457C>T	c.(457-459)CAT>TAT	p.H153Y		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	153							nucleic acid binding|zinc ion binding			ovary(3)	3						GGAGTTTGTTCATAAAATTGG	0.448																0.388889	38.109655	38.508528	14	22	KEEP	---	---	---	---	8	6	11	13	-1	capture	Missense_Mutation	SNP	207169709	207169709	ZDBF2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	17479	122
STK35	140901	broad.mit.edu	37	20	2097899	2097899	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2097899C>T	uc010gak.2	+	3	1480	c.1480C>T	c.(1480-1482)CGC>TGC	p.R494C	STK35_uc010zpu.1_Intron|STK35_uc002wfw.3_Missense_Mutation_p.R361C	NM_080836	NP_543026	Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	494	Protein kinase.					cytoplasm|nucleolus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1						CCCCCAAAAACGCAGGACTTC	0.512					88											0.351515	168.012964	171.216077	58	107	KEEP	---	---	---	---	28	31	52	59	-1	capture	Missense_Mutation	SNP	2097899	2097899	STK35	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15191	122
CHD6	84181	broad.mit.edu	37	20	40043955	40043955	+	Silent	SNP	T	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:40043955T>C	uc002xka.1	-	34	6988	c.6810A>G	c.(6808-6810)GGA>GGG	p.G2270G	CHD6_uc002xjz.1_5'Flank	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2270					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				TGACAATCTGTCCAGTCACAG	0.537																0.070588	0.982321	17.145216	6	79	KEEP	---	---	---	---	3	3	55	44	-1	capture	Silent	SNP	40043955	40043955	CHD6	20	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	3295	122
SYS1	90196	broad.mit.edu	37	20	43995683	43995683	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43995683C>T	uc002xnv.2	+	4	657	c.399C>T	c.(397-399)ATC>ATT	p.I133I	SYS1_uc010gha.2_RNA|SYS1_uc002xnw.1_Intron|SYS1-DBNDD2_uc002xnx.2_Intron	NM_033542	NP_291020	Q8N2H4	SYS1_HUMAN	SYS1 Golgi-localized integral membrane protein	133	Helical; (Potential).				protein transport	Golgi membrane|integral to membrane				skin(1)	1		Myeloproliferative disorder(115;0.0122)				TGGCTGTCATCGGGGAGTACC	0.577																0.06	-13.809911	26.625989	12	188	KEEP	---	---	---	---	8	5	117	88	-1	capture	Silent	SNP	43995683	43995683	SYS1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	15352	122
TSHZ2	128553	broad.mit.edu	37	20	51870964	51870964	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870964C>T	uc002xwo.2	+	2	1923	c.967C>T	c.(967-969)CGC>TGC	p.R323C		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	323					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			GGCTAAGAAACGCGTTTTTGA	0.453																0.020833	-54.414985	7.260841	5	235	KEEP	---	---	---	---	3	2	134	117	-1	capture	Missense_Mutation	SNP	51870964	51870964	TSHZ2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16507	122
CSF2RB	1439	broad.mit.edu	37	22	37326752	37326752	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37326752G>A	uc003aqa.3	+	8	1109	c.892G>A	c.(892-894)GGC>AGC	p.G298S	CSF2RB_uc003aqc.3_Missense_Mutation_p.G304S	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	298	Extracellular (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	GGAGGGGCTCGGCAGCCTCCA	0.647																0.083333	0.304571	6.649821	3	33	KEEP	---	---	---	---	1	2	42	33	-1	capture	Missense_Mutation	SNP	37326752	37326752	CSF2RB	22	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3900	122
ENTHD1	150350	broad.mit.edu	37	22	40283548	40283548	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40283548G>A	uc003ayg.2	-	2	456	c.205C>T	c.(205-207)CGC>TGC	p.R69C		NM_152512	NP_689725	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	69	ENTH.									ovary(2)|skin(1)	3	Melanoma(58;0.0749)					TACACGTGGCGCCAGTTCTTC	0.403																0.421488	309.958205	311.246646	102	140	KEEP	---	---	---	---	60	49	94	60	-1	capture	Missense_Mutation	SNP	40283548	40283548	ENTHD1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5092	122
CYP2D6	1565	broad.mit.edu	37	22	42524294	42524294	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42524294C>T	uc003bce.2	-	5	815	c.725G>A	c.(724-726)CGC>CAC	p.R242H	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_5'UTR|CYP2D6_uc003bcf.2_Missense_Mutation_p.R191H	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	242							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						CTTTTGGAAGCGTAGGACCTT	0.607																0.273973	50.464161	53.829643	20	53	KEEP	---	---	---	---	10	13	30	33	-1	capture	Missense_Mutation	SNP	42524294	42524294	CYP2D6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4129	122
XIRP1	165904	broad.mit.edu	37	3	39225931	39225931	+	Missense_Mutation	SNP	G	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39225931G>T	uc003cjk.1	-	2	5227	c.5006C>A	c.(5005-5007)TCC>TAC	p.S1669Y	XIRP1_uc003cji.2_3'UTR|XIRP1_uc003cjj.2_Missense_Mutation_p.S352Y	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1669							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		AAATGTTGGGGAGGAGGGAGA	0.537																0.422764	142.495908	143.129126	52	71	KEEP	---	---	---	---	42	25	55	28	0.626865671642	capture	Missense_Mutation	SNP	39225931	39225931	XIRP1	3	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	17310	122
KALRN	8997	broad.mit.edu	37	3	124053259	124053259	+	Missense_Mutation	SNP	C	T	T	rs147539685		TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:124053259C>T	uc003ehg.2	+	9	1685	c.1558C>T	c.(1558-1560)CGG>TGG	p.R520W	KALRN_uc010hrv.1_Missense_Mutation_p.R520W|KALRN_uc003ehf.1_Missense_Mutation_p.R520W|KALRN_uc011bjy.1_Missense_Mutation_p.R520W	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	520					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TCACCAGCGACGGCTGGAGAG	0.622					1865											0.418605	220.006048	220.990735	72	100	KEEP	---	---	---	---	30	56	52	60	-1	capture	Missense_Mutation	SNP	124053259	124053259	KALRN	3	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	7898	122
MSL2	55167	broad.mit.edu	37	3	135870091	135870091	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:135870091A>T	uc003eqx.1	-	2	2365	c.1632T>A	c.(1630-1632)AGT>AGA	p.S544R	MSL2_uc011bmb.1_Missense_Mutation_p.S470R	NM_018133	NP_060603	Q9HCI7	MSL2_HUMAN	ring finger protein 184 isoform 1	544					histone H4-K16 acetylation	MSL complex	zinc ion binding			central_nervous_system(1)	1						CATTTATTACACTGGTGCTGG	0.468																0.369697	184.017793	186.484771	61	104	KEEP	---	---	---	---	35	27	55	50	-1	capture	Missense_Mutation	SNP	135870091	135870091	MSL2	3	A	T	T	T	1	0	0	0	0	1	0	0	0	76	6	4	4	9788	122
AFM	173	broad.mit.edu	37	4	74361147	74361147	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74361147G>A	uc003hhb.2	+	9	1220	c.1189G>A	c.(1189-1191)GCG>ACG	p.A397T		NM_001133	NP_001124	P43652	AFAM_HUMAN	afamin precursor	397	Albumin 2.				vitamin transport		vitamin E binding			ovary(2)|central_nervous_system(1)	3	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTACCGTTACGCGGTAGGTTC	0.378																0.404255	112.842569	113.592307	38	56	KEEP	---	---	---	---	18	24	36	27	-1	capture	Missense_Mutation	SNP	74361147	74361147	AFM	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	361	122
GRID2	2895	broad.mit.edu	37	4	94316790	94316790	+	Missense_Mutation	SNP	T	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:94316790T>G	uc011cdt.1	+	9	1536	c.1278T>G	c.(1276-1278)AAT>AAG	p.N426K	GRID2_uc011cdu.1_Missense_Mutation_p.N331K	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	426	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	CAGGTCTGAATGGGTCACTGA	0.433																0.067797	-0.247762	11.157669	4	55	KEEP	---	---	---	---	3	3	35	29	-1	capture	Missense_Mutation	SNP	94316790	94316790	GRID2	4	T	G	G	G	1	0	0	0	0	1	0	0	0	660	51	4	4	6705	122
ADAM29	11086	broad.mit.edu	37	4	175898213	175898213	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175898213G>A	uc003iuc.2	+	5	2207	c.1537G>A	c.(1537-1539)GCA>ACA	p.A513T	ADAM29_uc003iud.2_Missense_Mutation_p.A513T|ADAM29_uc010irr.2_Missense_Mutation_p.A513T|ADAM29_uc011cki.1_Missense_Mutation_p.A513T	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	513	Cys-rich.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding	p.A513T(1)		skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TGGTGCAGGCGCAAATACTGC	0.418	Ovarian(140;1727 1835 21805 25838 41440)				106											0.418919	186.736938	187.582511	62	86	KEEP	---	---	---	---	31	37	51	38	-1	capture	Missense_Mutation	SNP	175898213	175898213	ADAM29	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	247	122
TRIML1	339976	broad.mit.edu	37	4	189060967	189060967	+	Silent	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189060967G>A	uc003izm.1	+	1	370	c.255G>A	c.(253-255)GTG>GTA	p.V85V		NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	85					multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GGTCCCAGGTGCTGCAGAGCG	0.652	Melanoma(31;213 1036 16579 23968 32372)															0.098901	4.814571	19.450639	9	82	KEEP	---	---	---	---	4	5	56	43	-1	capture	Silent	SNP	189060967	189060967	TRIML1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	16433	122
PCDHGB4	8641	broad.mit.edu	37	5	140769313	140769313	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140769313C>T	uc003lkc.1	+	1	1862	c.1862C>T	c.(1861-1863)ACG>ATG	p.T621M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.T621M	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	621	Extracellular (Potential).|Cadherin 6.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTGCGCACGGGCGAAGTG	0.692																0.387097	104.894859	105.927582	36	57	KEEP	---	---	---	---	18	19	28	30	-1	capture	Missense_Mutation	SNP	140769313	140769313	PCDHGB4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11468	122
ATP10B	23120	broad.mit.edu	37	5	160061402	160061402	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160061402C>T	uc003lym.1	-	12	2187	c.1340G>A	c.(1339-1341)CGT>CAT	p.R447H	ATP10B_uc003lyp.2_Missense_Mutation_p.R447H|ATP10B_uc011deg.1_Missense_Mutation_p.R491H|ATP10B_uc003lyn.2_Missense_Mutation_p.R5H|ATP10B_uc003lyo.2_Missense_Mutation_p.R419H	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	447	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GATGGTGCAACGTCGGAACAC	0.507																0.488722	411.348915	411.377944	130	136	KEEP	---	---	---	---	72	62	81	61	-1	capture	Missense_Mutation	SNP	160061402	160061402	ATP10B	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1108	122
C6orf138	442213	broad.mit.edu	37	6	47976383	47976383	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47976383C>T	uc011dwm.1	-	2	928	c.843G>A	c.(841-843)CCG>CCA	p.P281P	C6orf138_uc011dwn.1_Silent_p.P45P|C6orf138_uc003ozf.2_Silent_p.P298P	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	298	Helical; (Potential).|SSD.					integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						TGGCGAAGAACGGGATTCCCA	0.488																0.555556	46.326288	46.398681	15	12	KEEP	---	---	---	---	8	8	6	9	-1	capture	Silent	SNP	47976383	47976383	C6orf138	6	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	2309	122
DEFB114	245928	broad.mit.edu	37	6	49928111	49928111	+	Missense_Mutation	SNP	C	T	T	rs146020038		TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49928111C>T	uc011dwp.1	-	2	104	c.104G>A	c.(103-105)CGT>CAT	p.R35H		NM_001037499	NP_001032588	Q30KQ6	DB114_HUMAN	beta-defensin 114 precursor	35					defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					TCTTTTACAACGACCGTAACG	0.353																0.666667	33.854517	34.223333	10	5	KEEP	---	---	---	---	6	6	3	3	-1	capture	Missense_Mutation	SNP	49928111	49928111	DEFB114	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4361	122
CD109	135228	broad.mit.edu	37	6	74475666	74475666	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74475666G>A	uc003php.2	+	11	1546	c.1121G>A	c.(1120-1122)CGT>CAT	p.R374H	CD109_uc010kaz.2_Missense_Mutation_p.R374H|CD109_uc003phq.2_Missense_Mutation_p.R374H|CD109_uc010kba.2_Missense_Mutation_p.R297H	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	374						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						AAGGTAACTCGTGCTGATGGC	0.358																0.47619	97.947424	97.978398	30	33	KEEP	---	---	---	---	20	10	24	11	-1	capture	Missense_Mutation	SNP	74475666	74475666	CD109	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2934	122
TTLL2	83887	broad.mit.edu	37	6	167754816	167754816	+	Silent	SNP	G	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167754816G>C	uc003qvs.1	+	3	1516	c.1428G>C	c.(1426-1428)GTG>GTC	p.V476V	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	476					protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGAAAGCTGTGAGTGTGCGTC	0.512																0.298387	115.134566	119.635312	37	87	KEEP	---	---	---	---	20	21	52	46	-1	capture	Silent	SNP	167754816	167754816	TTLL2	6	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	16609	122
PRKAR1B	5575	broad.mit.edu	37	7	618975	618975	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:618975G>A	uc003siu.1	-	10	915	c.809C>T	c.(808-810)GCG>GTG	p.A270V	PRKAR1B_uc003siv.2_Missense_Mutation_p.A270V|PRKAR1B_uc003siw.1_Missense_Mutation_p.A270V|PRKAR1B_uc003six.1_RNA	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type	270	cAMP 2.			A -> R (in Ref. 1; AAC37564).	activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		GGGCTCCAGCGCATCCGCCAC	0.612					35											0.073171	-9.280762	21.368725	12	152	KEEP	---	---	---	---	3	9	103	90	-1	capture	Missense_Mutation	SNP	618975	618975	PRKAR1B	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12400	122
NUPL2	11097	broad.mit.edu	37	7	23239787	23239787	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23239787G>A	uc003svu.2	+	7	954	c.695G>A	c.(694-696)GGC>GAC	p.G232D	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Missense_Mutation_p.G109D|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_Missense_Mutation_p.G109D|NUPL2_uc011jyx.1_Missense_Mutation_p.G4D	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	232					carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						ttgttTGTAGGCTTTCCAGTC	0.318																0.302326	35.58982	37.072807	13	30	KEEP	---	---	---	---	6	8	25	15	-1	capture	Missense_Mutation	SNP	23239787	23239787	NUPL2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10682	122
STK31	56164	broad.mit.edu	37	7	23825130	23825130	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:23825130C>T	uc003sws.3	+	18	2249	c.2182C>T	c.(2182-2184)CGA>TGA	p.R728*	STK31_uc003swt.3_Nonsense_Mutation_p.R705*|STK31_uc011jze.1_Nonsense_Mutation_p.R728*|STK31_uc010kuq.2_Nonsense_Mutation_p.R705*|STK31_uc003swv.1_5'Flank	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	728	Protein kinase.						ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						GAGCTTGGAACGAGATCTTCT	0.403					598											0.254839	207.977715	224.882686	79	231	KEEP	---	---	---	---	57	29	154	98	-1	capture	Nonsense_Mutation	SNP	23825130	23825130	STK31	7	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	15186	122
WNT2	7472	broad.mit.edu	37	7	116960726	116960726	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116960726C>T	uc003viz.2	-	2	505	c.205G>A	c.(205-207)GTG>ATG	p.V69M	WNT2_uc003vja.2_Translation_Start_Site	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	69					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CACTCGGCCACGCCCTGGCTA	0.602																0.301887	41.079204	42.937095	16	37	KEEP	---	---	---	---	8	8	31	15	-1	capture	Missense_Mutation	SNP	116960726	116960726	WNT2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17267	122
MGAM	8972	broad.mit.edu	37	7	141759386	141759386	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141759386G>A	uc003vwy.2	+	32	3988	c.3934G>A	c.(3934-3936)GTC>ATC	p.V1312I		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1312	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGGGATGCGGGTCATCCTCAT	0.507																0.02451	-42.895201	8.30849	5	199	KEEP	---	---	---	---	2	4	142	91	-1	capture	Missense_Mutation	SNP	141759386	141759386	MGAM	7	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9453	122
STC1	6781	broad.mit.edu	37	8	23709003	23709003	+	Silent	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:23709003G>A	uc003xdw.1	-	3	587	c.303C>T	c.(301-303)AAC>AAT	p.N101N		NM_003155	NP_003146	P52823	STC1_HUMAN	stanniocalcin 1 precursor	101					cell surface receptor linked signaling pathway|cell-cell signaling|cellular calcium ion homeostasis		hormone activity			skin(3)|upper_aerodigestive_tract(1)	4		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		AGGTGACCCCGTTGGCGATGC	0.517																0.419355	114.003008	114.532019	39	54	KEEP	---	---	---	---	23	18	36	23	-1	capture	Silent	SNP	23709003	23709003	STC1	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15165	122
UNC5D	137970	broad.mit.edu	37	8	35407016	35407016	+	Missense_Mutation	SNP	G	C	C			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:35407016G>C	uc003xjr.1	+	2	638	c.310G>C	c.(310-312)GAC>CAC	p.D104H	UNC5D_uc003xjs.1_Missense_Mutation_p.D99H	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	104	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		AGAGACTCTGGACGAGAGCTC	0.522																0.093023	5.166047	12.329662	4	39	KEEP	---	---	---	---	1	3	23	19	-1	capture	Missense_Mutation	SNP	35407016	35407016	UNC5D	8	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	16877	122
PTDSS1	9791	broad.mit.edu	37	8	97285591	97285591	+	Missense_Mutation	SNP	A	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:97285591A>G	uc003yht.1	+	2	346	c.244A>G	c.(244-246)ATC>GTC	p.I82V	PTDSS1_uc003yhu.1_5'UTR	NM_014754	NP_055569	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	82	Helical; (Potential).				phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	CTTCTTTCTTATCATCAGTGT	0.373																0.04	-9.537135	7.562949	3	72	KEEP	---	---	---	---	2	1	51	37	-1	capture	Missense_Mutation	SNP	97285591	97285591	PTDSS1	8	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	12631	122
TEK	7010	broad.mit.edu	37	9	27217701	27217701	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27217701C>T	uc003zqi.3	+	19	3449	c.3007C>T	c.(3007-3009)CGC>TGC	p.R1003C	TEK_uc011lno.1_Missense_Mutation_p.R960C|TEK_uc011lnp.1_Missense_Mutation_p.R855C	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	1003	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		GCTCCCAGTGCGCTGGATGGC	0.483					493											0.307692	53.873626	56.017793	20	45	KEEP	---	---	---	---	12	13	22	32	-1	capture	Missense_Mutation	SNP	27217701	27217701	TEK	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15636	122
ZNF618	114991	broad.mit.edu	37	9	116811355	116811355	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116811355C>T	uc004bid.2	+	15	1872	c.1773C>T	c.(1771-1773)AGC>AGT	p.S591S	ZNF618_uc004bic.2_Silent_p.S498S|ZNF618_uc011lxi.1_Silent_p.S558S|ZNF618_uc011lxj.1_Silent_p.S559S|ZNF618_uc010mvb.2_Silent_p.S181S	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	591					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCGCGACAGCGGTGACCTTG	0.592																0.465608	255.702298	255.893964	88	101	KEEP	---	---	---	---	63	29	61	43	-1	capture	Silent	SNP	116811355	116811355	ZNF618	9	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	17920	122
RABGAP1	23637	broad.mit.edu	37	9	125748579	125748579	+	Silent	SNP	G	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125748579G>T	uc011lzh.1	+	4	605	c.471G>T	c.(469-471)TCG>TCT	p.S157S	RABGAP1_uc004bnl.3_RNA|RABGAP1_uc004bnm.1_Silent_p.S157S	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	157	PID.				cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						GCTGTGCCTCGGTAAATGCTC	0.453																0.083333	3.608118	31.083053	13	143	KEEP	---	---	---	---	7	6	84	66	0.538461538462	capture	Silent	SNP	125748579	125748579	RABGAP1	9	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	12859	122
CAMSAP1	157922	broad.mit.edu	37	9	138714648	138714648	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138714648G>A	uc004cgr.3	-	11	1859	c.1859C>T	c.(1858-1860)CCG>CTG	p.P620L	CAMSAP1_uc004cgq.3_Missense_Mutation_p.P510L|CAMSAP1_uc010nbg.2_Missense_Mutation_p.P342L	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	620						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GATGCTCCTCGGTCTCCCTTC	0.542																0.465517	174.451282	174.569287	54	62	KEEP	---	---	---	---	40	23	36	30	-1	capture	Missense_Mutation	SNP	138714648	138714648	CAMSAP1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2587	122
TBL1X	6907	broad.mit.edu	37	X	9656243	9656243	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:9656243G>A	uc010ndq.2	+	7	912	c.544G>A	c.(544-546)GTT>ATT	p.V182I	TBL1X_uc004csq.3_Missense_Mutation_p.V131I|TBL1X_uc010ndr.2_Missense_Mutation_p.V131I|TBL1X_uc004csr.2_Missense_Mutation_p.V182I|TBL1X_uc004css.2_Missense_Mutation_p.V133I	NM_001139466	NP_001132938	O60907	TBL1X_HUMAN	transducin beta-like 1X isoform a	182					canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Hepatocellular(5;0.000888)				CTCAGCCGGCGTTTCCCACCA	0.448																0.666667	20.052676	20.273921	6	3	KEEP	---	---	---	---	2	4	2	4	-1	capture	Missense_Mutation	SNP	9656243	9656243	TBL1X	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15526	122
POLA1	5422	broad.mit.edu	37	X	24759540	24759540	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24759540C>T	uc004dbl.2	+	21	2270	c.2247C>T	c.(2245-2247)GCC>GCT	p.A749A		NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	749					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	GGAAAGATGCCAAGTTCATTT	0.348																0.397163	178.068975	179.374294	56	85	KEEP	---	---	---	---	40	20	51	42	-1	capture	Silent	SNP	24759540	24759540	POLA1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	12090	122
SATL1	340562	broad.mit.edu	37	X	84362599	84362599	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84362599G>A	uc011mqx.1	-	1	1376	c.1376C>T	c.(1375-1377)CCA>CTA	p.P459L	SATL1_uc004een.2_Missense_Mutation_p.P459L	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	272	Gln-rich.						N-acetyltransferase activity			breast(2)	2						GCTAGTGCCTGGTTGTCTCAT	0.592																0.464286	221.788146	221.978291	78	90	KEEP	---	---	---	---	56	29	72	33	-1	capture	Missense_Mutation	SNP	84362599	84362599	SATL1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	13747	122
PCDH11X	27328	broad.mit.edu	37	X	91132676	91132676	+	Missense_Mutation	SNP	C	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91132676C>G	uc004efk.1	+	2	2282	c.1437C>G	c.(1435-1437)AAC>AAG	p.N479K	PCDH11X_uc004efl.1_Missense_Mutation_p.N479K|PCDH11X_uc004efo.1_Missense_Mutation_p.N479K|PCDH11X_uc010nmv.1_Missense_Mutation_p.N479K|PCDH11X_uc004efm.1_Missense_Mutation_p.N479K|PCDH11X_uc004efn.1_Missense_Mutation_p.N479K|PCDH11X_uc004efh.1_Missense_Mutation_p.N479K|PCDH11X_uc004efj.1_Missense_Mutation_p.N479K	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	479	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CTGAGAATAACTCTCCTGGCA	0.433	NSCLC(38;925 1092 2571 38200 45895)															0.371212	165.142371	167.065551	49	83	KEEP	---	---	---	---	32	24	59	40	-1	capture	Missense_Mutation	SNP	91132676	91132676	PCDH11X	23	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	11411	122
PCDH11X	27328	broad.mit.edu	37	X	91132704	91132704	+	Missense_Mutation	SNP	A	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91132704A>T	uc004efk.1	+	2	2310	c.1465A>T	c.(1465-1467)AGT>TGT	p.S489C	PCDH11X_uc004efl.1_Missense_Mutation_p.S489C|PCDH11X_uc004efo.1_Missense_Mutation_p.S489C|PCDH11X_uc010nmv.1_Missense_Mutation_p.S489C|PCDH11X_uc004efm.1_Missense_Mutation_p.S489C|PCDH11X_uc004efn.1_Missense_Mutation_p.S489C|PCDH11X_uc004efh.1_Missense_Mutation_p.S489C|PCDH11X_uc004efj.1_Missense_Mutation_p.S489C	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	489	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						GACGAAAGTAAGTGCAATGGA	0.453	NSCLC(38;925 1092 2571 38200 45895)															0.369231	144.363639	146.318507	48	82	KEEP	---	---	---	---	27	22	55	32	-1	capture	Missense_Mutation	SNP	91132704	91132704	PCDH11X	23	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	11411	122
LONRF3	79836	broad.mit.edu	37	X	118108897	118108897	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118108897C>T	uc004eqw.2	+	1	185	c.154C>T	c.(154-156)CGG>TGG	p.R52W	LONRF3_uc004eqx.2_Missense_Mutation_p.R52W|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_5'Flank	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger	52					proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						TCTACCGACGCGGGAGCCAGA	0.677																0.130435	3.710649	6.765667	3	20	KEEP	---	---	---	---	1	2	12	9	-1	capture	Missense_Mutation	SNP	118108897	118108897	LONRF3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	8813	122
ZBTB33	10009	broad.mit.edu	37	X	119388318	119388318	+	Missense_Mutation	SNP	G	A	A			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119388318G>A	uc004esn.1	+	2	1276	c.1048G>A	c.(1048-1050)GTC>ATC	p.V350I	ZBTB33_uc010nqm.1_Missense_Mutation_p.V350I	NM_006777	NP_006768	Q86T24	KAISO_HUMAN	kaiso	350					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleolus|plasma membrane	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TGACTCGGCCGTCAGTAATAC	0.413																0.415205	216.302491	217.373734	71	100	KEEP	---	---	---	---	46	34	54	63	-1	capture	Missense_Mutation	SNP	119388318	119388318	ZBTB33	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17416	122
PLXNB3	5365	broad.mit.edu	37	X	153033075	153033075	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153033075C>T	uc004fii.2	+	3	967	c.793C>T	c.(793-795)CGC>TGC	p.R265C	PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Intron|PLXNB3_uc010nuk.2_Missense_Mutation_p.R288C|PLXNB3_uc011mzd.1_Intron	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	265	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CTACGTGGCCCGCGTCTGCCT	0.607																0.333333	18.346793	18.788208	6	12	KEEP	---	---	---	---	2	4	5	7	-1	capture	Missense_Mutation	SNP	153033075	153033075	PLXNB3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12028	122
FLNA	2316	broad.mit.edu	37	X	153588484	153588484	+	Missense_Mutation	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153588484C>T	uc004fkk.2	-	22	3928	c.3679G>A	c.(3679-3681)GGG>AGG	p.G1227R	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Missense_Mutation_p.G1227R	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1227	Filamin 10.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTGTAGGCCCCGGGGCAGAGG	0.637					518											0.066667	-7.497837	15.877262	8	112	KEEP	---	---	---	---	5	4	79	54	-1	capture	Missense_Mutation	SNP	153588484	153588484	FLNA	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5877	122
PLXNA3	55558	broad.mit.edu	37	X	153694763	153694763	+	Silent	SNP	C	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153694763C>T	uc004flm.2	+	16	3017	c.2844C>T	c.(2842-2844)TCC>TCT	p.S948S		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	948	IPT/TIG 2.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCCGGCGTCCGGGGGCACAC	0.672																0.392226	342.427813	345.283126	111	172	KEEP	---	---	---	---	76	54	98	99	-1	capture	Silent	SNP	153694763	153694763	PLXNA3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12024	122
UBTFL1	642623	broad.mit.edu	37	11	89819888	89819889	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89819888_89819889insT	uc010rub.1	+	1	771_772	c.771_772insT	c.(769-774)CGCTGGfs	p.R257fs		NM_001143975	NP_001137447	P0CB47	UBFL1_HUMAN	upstream binding transcription factor, RNA	257_258	HMG box 2.				multicellular organismal development	cytoplasm|nucleus	DNA binding				0						TTGGCAGACGCTGGCAGCGCAT	0.495																0.27			18	49		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	89819888	89819889	UBTFL1	11	-	T	T	T	1	0	1	1	0	0	0	0	0	353	28	5	5	16792	122
CNTN5	53942	broad.mit.edu	37	11	100211381	100211382	+	Splice_Site	INS	-	GT	GT			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100211381_100211382insGT	uc001pga.2	+	22	3256	c.2917_splice	c.e22+1	p.P973_splice	CNTN5_uc001pgb.2_Splice_Site_p.P899_splice|CNTN5_uc010ruk.1_Splice_Site_p.P244_splice	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CAAGAAATCCCGTAAGTGACCT	0.441					1117											0.32			12	25		---	---	---	---						capture_indel	Splice_Site	INS	100211381	100211382	CNTN5	11	-	GT	GT	GT	1	0	1	1	0	0	0	1	0	299	23	5	5	3609	122
ZG16B	124220	broad.mit.edu	37	16	2880250	2880251	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2880250_2880251insG	uc002cru.2	+	1	78_79	c.2_3insG	c.(1-3)ATGfs	p.M1fs		NM_145252	NP_660295	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16 homolog B precursor	1						extracellular region	sugar binding			ovary(1)	1						TCCTTCTGGATGGGGGCCCAGG	0.683																0.13			8	55		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	2880250	2880251	ZG16B	16	-	G	G	G	1	0	1	1	0	0	0	0	0	663	51	5	5	17552	122
BARD1	580	broad.mit.edu	37	2	215609857	215609857	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:215609857delC	uc002veu.2	-	9	1972	c.1837delG	c.(1837-1839)GCAfs	p.A613fs	BARD1_uc010zjm.1_Frame_Shift_Del_p.A469fs	NM_000465	NP_000456	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	613	BRCT 1.				cell cycle arrest|DNA repair|negative regulation of apoptosis|negative regulation of mRNA 3'-end processing|negative regulation of protein export from nucleus|positive regulation of apoptosis|positive regulation of protein catabolic process|protein K6-linked ubiquitination|regulation of phosphorylation|tissue homeostasis	BRCA1-A complex|BRCA1-BARD1 complex|cytoplasm	kinase binding|protein heterodimerization activity|protein homodimerization activity|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTTTGAACTGCATCACCAGGA	0.338												Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				0.53			31	28		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	215609857	215609857	BARD1	2	C	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	1301	122
TRMT6	51605	broad.mit.edu	37	20	5925484	5925485	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5925484_5925485delTA	uc002wmh.1	-	3	454_455	c.332_333delTA	c.(331-333)ATAfs	p.I111fs	TRMT6_uc010zra.1_Intron|TRMT6_uc010gbn.1_Intron|TRMT6_uc010gbo.1_RNA	NM_015939	NP_057023	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6	111					regulation of translational initiation|tRNA processing	nucleus	protein binding|translation initiation factor activity			pancreas(1)	1						TCAAAGCTTTTATGTCATCTTG	0.342																0.30			67	157		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	5925484	5925485	TRMT6	20	TA	-	-	-	1	0	1	0	1	0	0	0	0	784	61	5	5	16451	122
SLC5A3	6526	broad.mit.edu	37	21	35468403	35468404	+	Frame_Shift_Ins	INS	-	G	G			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35468403_35468404insG	uc002yto.2	+	2	1418_1419	c.906_907insG	c.(904-909)GCTGGCfs	p.A302fs	MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864	P53794	SC5A3_HUMAN	solute carrier family 5 (inositol transporters),	302_303	Cytoplasmic (Potential).					integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2						CTCTTATGGCTGGCTTCTTAAA	0.470																0.02			7	288		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	35468403	35468404	SLC5A3	21	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	14558	122
AASDH	132949	broad.mit.edu	37	4	57220268	57220269	+	Frame_Shift_Ins	INS	-	A	A	rs148777026		TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57220268_57220269insA	uc003hbn.2	-	8	1472_1473	c.1319_1320insT	c.(1318-1320)TTGfs	p.L440fs	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Frame_Shift_Ins_p.L287fs|AASDH_uc003hbo.2_Frame_Shift_Ins_p.L340fs|AASDH_uc011cab.1_Intron|AASDH_uc010ihc.2_Frame_Shift_Ins_p.L440fs|AASDH_uc003hbp.2_Frame_Shift_Ins_p.L440fs	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	440					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CTTTTCGTCCCAAAAAAAAAAT	0.361																0.09			7	72		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	57220268	57220269	AASDH	4	-	A	A	A	1	0	1	1	0	0	0	0	0	272	21	5	5	22	122
STAG2	10735	broad.mit.edu	37	X	123176479	123176479	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123176479delC	uc004etz.3	+	6	785	c.446delC	c.(445-447)ACTfs	p.T149fs	STAG2_uc004eua.2_Frame_Shift_Del_p.T149fs|STAG2_uc004eub.2_Frame_Shift_Del_p.T149fs|STAG2_uc004euc.2_Frame_Shift_Del_p.T149fs|STAG2_uc004eud.2_Frame_Shift_Del_p.T149fs|STAG2_uc004eue.2_Frame_Shift_Del_p.T149fs	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	149					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CGAAAAATGACTGAAGAATTC	0.299																0.42			32	45		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	123176479	123176479	STAG2	23	C	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	15133	122
RBMX	27316	broad.mit.edu	37	X	135961585	135961586	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-0692-01	TCGA-12-0692-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135961585_135961586insT	uc004fae.1	-	2	211_212	c.1_2insA	c.(1-3)ATGfs	p.M1fs	RBMX_uc011mwf.1_Frame_Shift_Ins_p.M1fs|RBMX_uc004fad.1_Frame_Shift_Ins_p.M1fs|RBMX_uc011mwg.1_Translation_Start_Site|RBMX_uc004faf.1_Translation_Start_Site|RBMX_uc010nsf.1_Intron|RBMX_uc004fag.1_Intron|SNORD61_uc004fah.1_5'Flank	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1	1						catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TGCTTCAACCATGTTTTTTTTT	0.391																0.05			13	233		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	135961585	135961586	RBMX	23	-	T	T	T	1	0	1	1	0	0	0	0	0	104	8	5	5	13046	122
