Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PER3	8863	broad.mit.edu	37	1	7887817	7887817	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7887817C>T	uc001aoo.2	+	17	2979	c.2804C>T	c.(2803-2805)CCC>CTC	p.P935L	PER3_uc009vmg.1_Missense_Mutation_p.P943L|PER3_uc009vmh.1_Missense_Mutation_p.P936L|PER3_uc001aop.2_Missense_Mutation_p.P943L|PER3_uc010nzw.1_Missense_Mutation_p.P624L	NM_016831	NP_058515	P56645	PER3_HUMAN	period 3	935					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			ovary(1)|pancreas(1)|skin(1)	3	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGAGATGCCCAGACCCTCT	0.473													5	54	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12343573	12343573	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12343573G>T	uc001atv.2	+	21	5555	c.5414G>T	c.(5413-5415)CGA>CTA	p.R1805L	VPS13D_uc001atw.2_Missense_Mutation_p.R1805L|VPS13D_uc001atx.2_Missense_Mutation_p.R993L	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1805					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AGTTACAATCGAGTTAACCGG	0.373													5	75	---	---	---	---	PASS
CELA2B	51032	broad.mit.edu	37	1	15808768	15808768	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15808768G>T	uc001awl.2	+	4	261	c.236G>T	c.(235-237)GGG>GTG	p.G79V		NM_015849	NP_056933	P08218	CEL2B_HUMAN	elastase 2B preproprotein	79	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						AGCTCCTCCGGGATCTACCGC	0.572													5	42	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22154752	22154752	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22154752G>T	uc001bfj.2	-	89	12445	c.12405C>A	c.(12403-12405)TTC>TTA	p.F4135L	HSPG2_uc001bfi.2_Missense_Mutation_p.F152L|HSPG2_uc009vqd.2_Missense_Mutation_p.F4136L	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	4135	EGF-like 3.			F -> I (in Ref. 2; CAA44373).	angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TCCCACCTTTGAATCCATCTC	0.642													9	57	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24419491	24419491	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24419491G>T	uc001bin.3	-	10	1199	c.1036C>A	c.(1036-1038)CGG>AGG	p.R346R	MYOM3_uc001bim.3_Silent_p.R3R|MYOM3_uc001bio.2_Silent_p.R346R|MYOM3_uc001bip.1_Silent_p.R3R	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	346	Ig-like C2-type 2.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GAGGGCACCCGGACCATGTAG	0.488													3	16	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34067979	34067979	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34067979T>C	uc001bxn.1	-	44	6735	c.6706A>G	c.(6706-6708)ATC>GTC	p.I2236V	CSMD2_uc001bxm.1_Missense_Mutation_p.I2234V|CSMD2_uc001bxo.1_Missense_Mutation_p.I1107V	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2236	Extracellular (Potential).|CUB 13.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAGATGGTGATGAAATCTCCA	0.542													5	40	---	---	---	---	PASS
GJB4	127534	broad.mit.edu	37	1	35227351	35227351	+	Missense_Mutation	SNP	G	A	A	rs141637346		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35227351G>A	uc001bxv.1	+	2	866	c.496G>A	c.(496-498)GTG>ATG	p.V166M	GJB4_uc001bxw.3_Missense_Mutation_p.V166M	NM_153212	NP_694944	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4	166	Extracellular (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity			ovary(2)|central_nervous_system(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GGCCTGCTCCGTGGAGCCTTG	0.582													8	23	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92756981	92756981	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92756981C>A	uc001dor.2	-	4	394	c.279G>T	c.(277-279)TTG>TTT	p.L93F	GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.L93F	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin	93					muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		TTACCTTTACCAATAAATCAA	0.308									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				5	25	---	---	---	---	PASS
FMO5	2330	broad.mit.edu	37	1	146684906	146684906	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146684906G>T	uc001epi.2	-	4	845	c.456C>A	c.(454-456)ACC>ACA	p.T152T	FMO5_uc001eph.3_Silent_p.T152T|FMO5_uc001epj.2_Silent_p.T152T|FMO5_uc001epk.3_Silent_p.T152T	NM_001461	NP_001452	P49326	FMO5_HUMAN	flavin containing monooxygenase 5 isoform 1	152						integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			ovary(3)	3	all_hematologic(923;0.0487)					GATGAGCATTGGTGTGATGGC	0.507													6	116	---	---	---	---	PASS
SV2A	9900	broad.mit.edu	37	1	149880790	149880790	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149880790G>T	uc001etg.2	-	8	1824	c.1333C>A	c.(1333-1335)CGC>AGC	p.R445S	SV2A_uc009wlk.2_5'Flank|SV2A_uc001eth.2_Missense_Mutation_p.R445S	NM_014849	NP_055664	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2	445	Cytoplasmic (Potential).				neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGAGTGATGCGCCGATATTCG	0.507													6	144	---	---	---	---	PASS
RPRD2	23248	broad.mit.edu	37	1	150444878	150444878	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150444878G>A	uc009wlr.2	+	11	3655	c.3454G>A	c.(3454-3456)GGG>AGG	p.G1152R	RPRD2_uc010pcc.1_3'UTR|RPRD2_uc001eup.3_Missense_Mutation_p.G1126R	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	1152	Poly-Gly.						protein binding			ovary(1)	1						GGCATCCCTTGGGGGTGGGGG	0.547													6	39	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152278619	152278619	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152278619G>T	uc001ezu.1	-	3	8779	c.8743C>A	c.(8743-8745)CAT>AAT	p.H2915N		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2915	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCCATGATGGTTTCTGGAA	0.567									Ichthyosis				7	263	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152280465	152280465	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152280465G>T	uc001ezu.1	-	3	6933	c.6897C>A	c.(6895-6897)TCC>TCA	p.S2299S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2299	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGATTGTCTGGAGCTCTCTG	0.552									Ichthyosis				9	429	---	---	---	---	PASS
C1orf77	26097	broad.mit.edu	37	1	153615769	153615769	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153615769G>T	uc001fcm.1	+	5	782	c.470G>T	c.(469-471)CGA>CTA	p.R157L	C1orf77_uc001fcn.1_Missense_Mutation_p.R158L|C1orf77_uc001fco.1_Missense_Mutation_p.R132L|C1orf77_uc001fcp.2_5'Flank|C1orf77_uc009woj.1_3'UTR	NM_015607	NP_056422	Q9Y3Y2	CHTOP_HUMAN	small protein rich in arginine and glycine	157	Arg/Gly-rich.|Interaction with PRMT1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	protein binding|RNA binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGTGGTGTTCGAGGTCGTGGA	0.562													7	123	---	---	---	---	PASS
UBAP2L	9898	broad.mit.edu	37	1	154227742	154227742	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154227742C>A	uc001fep.3	+	17	2191	c.2024C>A	c.(2023-2025)TCC>TAC	p.S675Y	UBAP2L_uc009wot.2_Missense_Mutation_p.S675Y|UBAP2L_uc010pek.1_Missense_Mutation_p.S667Y|UBAP2L_uc010pel.1_Missense_Mutation_p.S685Y|UBAP2L_uc010pen.1_Missense_Mutation_p.S589Y|UBAP2L_uc001feq.2_5'UTR|UBAP2L_uc001fer.2_5'Flank	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	675					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CATTCATCCTCCTTGGGTGGC	0.498													6	71	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155317595	155317595	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155317595A>G	uc009wqq.2	-	20	8150	c.7670T>C	c.(7669-7671)ATT>ACT	p.I2557T	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.I2552T|MIR555_hsa-mir-555|MI0003561_5'Flank	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2557					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CTCTCCCACAATCTCATCAAT	0.493													7	78	---	---	---	---	PASS
MEX3A	92312	broad.mit.edu	37	1	156047123	156047123	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156047123C>A	uc001fnd.3	-	2	805	c.805G>T	c.(805-807)GAG>TAG	p.E269*		NM_001093725	NP_001087194	A1L020	MEX3A_HUMAN	MEX3A protein	269	KH 2.					cytoplasmic mRNA processing body|nucleus	RNA binding|zinc ion binding				0	Hepatocellular(266;0.158)|all_neural(408;0.195)					CCCGTGATCTCGAACACGGGG	0.602													3	16	---	---	---	---	PASS
CCT3	7203	broad.mit.edu	37	1	156287294	156287294	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156287294G>T	uc001fol.1	-	9	1024	c.804C>A	c.(802-804)CTC>CTA	p.L268L	CCT3_uc001fom.1_Silent_p.L267L|CCT3_uc001fon.1_Silent_p.L230L|CCT3_uc010phj.1_Silent_p.L222L|CCT3_uc010phk.1_Silent_p.L222L|CCT3_uc010phl.1_Silent_p.L222L	NM_005998	NP_005989	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 isoform a	268					'de novo' posttranslational protein folding	cytoskeleton|cytosol|plasma membrane	ATP binding|unfolded protein binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					CCTCCATCTGGAGAATTCGGG	0.463													7	162	---	---	---	---	PASS
INSRR	3645	broad.mit.edu	37	1	156819146	156819146	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156819146G>T	uc010pht.1	-	6	1590	c.1336C>A	c.(1336-1338)CCG>ACG	p.P446T	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	446					protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CAGAGGCGCGGGTTGAAGGCG	0.612													6	83	---	---	---	---	PASS
PEAR1	375033	broad.mit.edu	37	1	156882414	156882414	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156882414G>T	uc001fqj.1	+	17	2325	c.2209G>T	c.(2209-2211)GGA>TGA	p.G737*	PEAR1_uc001fqk.1_Nonsense_Mutation_p.G362*	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	737						integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TTGCAGGATTGGTGAGTTCTT	0.602													5	52	---	---	---	---	PASS
CD1A	909	broad.mit.edu	37	1	158225830	158225830	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158225830T>G	uc001frt.2	+	3	895	c.362T>G	c.(361-363)CTG>CGG	p.L121R		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	121	Extracellular (Potential).				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	GGCTGTGAGCTGCACTCTGGA	0.423													7	36	---	---	---	---	PASS
PRDX6	9588	broad.mit.edu	37	1	173454564	173454564	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173454564G>T	uc001giy.1	+	3	368	c.317G>T	c.(316-318)AGG>ATG	p.R106M		NM_004905	NP_004896	P30041	PRDX6_HUMAN	peroxiredoxin 6	106	Thioredoxin.				cell redox homeostasis|phospholipid catabolic process	cytoplasmic membrane-bounded vesicle|cytosol|lysosome	peroxiredoxin activity|phospholipase A2 activity|protein binding			central_nervous_system(1)	1						ATCGATGATAGGAATCGGGAG	0.448													5	45	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181680149	181680149	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181680149G>A	uc001gow.2	+	8	1280	c.1115G>A	c.(1114-1116)CGC>CAC	p.R372H	CACNA1E_uc009wxs.2_Missense_Mutation_p.R279H	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	372	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AAGCTGCGGCGCCAGCAGCAG	0.567													10	68	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228607	21228607	+	Silent	SNP	G	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228607G>C	uc002red.2	-	26	11261	c.11133C>G	c.(11131-11133)ACC>ACG	p.T3711T		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3711					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGGGGTTTTTGGTGTACACAA	0.403													8	58	---	---	---	---	PASS
C2orf39	92749	broad.mit.edu	37	2	26671582	26671582	+	Missense_Mutation	SNP	G	T	T	rs145706376	byFrequency	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26671582G>T	uc002rhg.2	+	11	1494	c.1420G>T	c.(1420-1422)GCC>TCC	p.A474S		NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	474											0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAAGAGGCCGCCGCGGAACC	0.507													4	73	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32773032	32773032	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32773032C>T	uc010ezu.2	+	64	13060	c.12926C>T	c.(12925-12927)GCC>GTC	p.A4309V		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4309					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GTGGAACAAGCCTTAACTAAG	0.403													5	47	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86705771	86705771	+	Silent	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86705771G>A	uc002sri.3	+	15	2556	c.2229G>A	c.(2227-2229)GCG>GCA	p.A743A	KDM3A_uc010ytj.1_Silent_p.A743A|KDM3A_uc010ytk.1_Silent_p.A691A	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A	743					androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						CTGTAAGAGCGAAATGGGGAA	0.403													18	42	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89326856	89326856	+	RNA	SNP	A	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89326856A>C	uc010ytr.1	-	68		c.6322T>G			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TACCAGGCTAAGTAGCTGCTA	0.572													8	103	---	---	---	---	PASS
CKAP2L	150468	broad.mit.edu	37	2	113498469	113498469	+	Silent	SNP	C	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113498469C>G	uc002tie.2	-	8	2017	c.1938G>C	c.(1936-1938)ACG>ACC	p.T646T	CKAP2L_uc002tif.2_Silent_p.T235T|CKAP2L_uc010yxp.1_Silent_p.T481T|uc002tid.2_Intron	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	646						centrosome					0						GGGGTGTCGCCGTGACTTGTT	0.433													35	138	---	---	---	---	PASS
CCDC74A	90557	broad.mit.edu	37	2	132288338	132288338	+	Missense_Mutation	SNP	G	A	A	rs140463466	byFrequency	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132288338G>A	uc002tta.2	+	3	534	c.482G>A	c.(481-483)CGC>CAC	p.R161H	CCDC74A_uc002ttb.2_Intron	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	161										skin(1)	1						GACACTGTGCGCTCTCCTGCA	0.627													13	21	---	---	---	---	PASS
SCN7A	6332	broad.mit.edu	37	2	167319016	167319016	+	Silent	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167319016A>G	uc002udu.1	-	9	1093	c.966T>C	c.(964-966)TGT>TGC	p.C322C	SCN7A_uc010fpm.1_RNA	NM_002976	NP_002967	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha	322					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1						CAGCTTTTACACACACATATC	0.378													6	30	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170009390	170009390	+	Missense_Mutation	SNP	C	T	T	rs142934522	byFrequency	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170009390C>T	uc002ues.2	-	67	12593	c.12380G>A	c.(12379-12381)CGC>CAC	p.R4127H		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4127	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AAGATTATTGCGGCCGGATTC	0.473													24	211	---	---	---	---	PASS
SLC25A12	8604	broad.mit.edu	37	2	172700882	172700882	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172700882G>T	uc002uhh.2	-	5	551	c.462C>A	c.(460-462)CTC>CTA	p.L154L	SLC25A12_uc010fqh.2_Silent_p.L47L|SLC25A12_uc010zdv.1_RNA	NM_003705	NP_003696	O75746	CMC1_HUMAN	solute carrier family 25, member 12	154	EF-hand 3.				gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	AGCTCACCTGGAGAAACTGCG	0.348													5	68	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189927746	189927746	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189927746G>T	uc002uqk.2	-	28	2188	c.1913C>A	c.(1912-1914)CCT>CAT	p.P638H	COL5A2_uc010frx.2_Missense_Mutation_p.P214H	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	638					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCTCTGCCCAGGAACTCCAGC	0.353													7	101	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198498590	198498590	+	Silent	SNP	T	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198498590T>A	uc002uuo.3	-	4	972	c.570A>T	c.(568-570)TCA>TCT	p.S190S		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	190						plasma membrane					0						AGTTTTCATCTGAACCGTGTC	0.398													7	50	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202625741	202625741	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202625741C>A	uc002uyo.2	-	4	1332	c.976G>T	c.(976-978)GGA>TGA	p.G326*	ALS2_uc002uyp.3_Nonsense_Mutation_p.G326*|ALS2_uc002uyq.2_Nonsense_Mutation_p.G326*|ALS2_uc002uyr.2_Nonsense_Mutation_p.G326*	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	326					cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						TCAGTTGTTCCCATGACATTT	0.433													7	103	---	---	---	---	PASS
VIL1	7429	broad.mit.edu	37	2	219296605	219296605	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219296605T>A	uc002via.2	+	11	1193	c.1128T>A	c.(1126-1128)GAT>GAA	p.D376E	VIL1_uc010zke.1_Missense_Mutation_p.D65E|VIL1_uc002vib.2_Missense_Mutation_p.D376E	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	376	Core.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAAGTTCGATGCCACATCCA	0.493													5	17	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219328034	219328034	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219328034A>C	uc002vie.2	-	22	2975	c.2522T>G	c.(2521-2523)CTT>CGT	p.L841R	USP37_uc010fvs.1_Missense_Mutation_p.L841R|USP37_uc010zkf.1_Missense_Mutation_p.L841R|USP37_uc002vif.2_Missense_Mutation_p.L841R|USP37_uc002vig.2_Missense_Mutation_p.L747R	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	841	UIM 3.				ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		CACACCTTGAAGACTTAACTC	0.234													9	87	---	---	---	---	PASS
ZFAND2B	130617	broad.mit.edu	37	2	220072369	220072369	+	Splice_Site	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220072369G>T	uc002vka.2	+	3	323	c.151_splice	c.e3-1	p.D51_splice	ZFAND2B_uc010zkt.1_Splice_Site_p.D51_splice|ZFAND2B_uc010fwd.1_Splice_Site_p.D51_splice|ZFAND2B_uc002vjy.1_Splice_Site_p.D51_splice|ZFAND2B_uc002vjz.1_Splice_Site_p.D51_splice|ZFAND2B_uc002vkb.1_Splice_Site	NM_138802	NP_620157	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B							endoplasmic reticulum	protein binding|zinc ion binding				0		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTGACTACAGGATATCCAGG	0.537													5	57	---	---	---	---	PASS
TRPM8	79054	broad.mit.edu	37	2	234878421	234878421	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234878421C>A	uc002vvh.2	+	16	2148	c.2108C>A	c.(2107-2109)CCC>CAC	p.P703H	TRPM8_uc010fyj.2_Intron	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	703	Helical; Name=1; (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	TTTATTATACCCTTGGTGGGC	0.423													14	81	---	---	---	---	PASS
CCBP2	1238	broad.mit.edu	37	3	42906223	42906223	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42906223C>A	uc003cme.2	+	3	408	c.229C>A	c.(229-231)CGC>AGC	p.R77S	CCBP2_uc003cmd.1_Missense_Mutation_p.R77S|CCBP2_uc003cmf.2_Missense_Mutation_p.R77S|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2	77	Cytoplasmic (Potential).				chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		TTACGTGCCTCGCAGGCGGAT	0.537													4	74	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52417939	52417939	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52417939C>A	uc011bef.1	+	52	8475	c.8214C>A	c.(8212-8214)ACC>ACA	p.T2738T	DNAH1_uc003ddv.2_5'Flank	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2738	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACTGCTGTACCATCGACTGGT	0.552													4	17	---	---	---	---	PASS
ITIH3	3699	broad.mit.edu	37	3	52833895	52833895	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52833895C>A	uc003dfv.2	+	9	1069	c.1033C>A	c.(1033-1035)CAG>AAG	p.Q345K	ITIH3_uc011bek.1_Missense_Mutation_p.Q345K	NM_002217	NP_002208	Q06033	ITIH3_HUMAN	inter-alpha (globulin) inhibitor H3	345	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CGAGAACCTCCAGGAGGCCAG	0.542													5	55	---	---	---	---	PASS
HCLS1	3059	broad.mit.edu	37	3	121363748	121363748	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121363748C>A	uc003eeh.3	-	5	441	c.316G>T	c.(316-318)GAG>TAG	p.E106*	HCLS1_uc011bjj.1_Nonsense_Mutation_p.E106*|HCLS1_uc011bjk.1_RNA|HCLS1_uc011bjl.1_Nonsense_Mutation_p.E106*	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	106	Cortactin 1.				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		TTCTCCACCTCGGCAACATAC	0.463													4	85	---	---	---	---	PASS
SLC15A2	6565	broad.mit.edu	37	3	121631906	121631906	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121631906G>T	uc003eep.2	+	5	620	c.467G>T	c.(466-468)GGG>GTG	p.G156V	SLC15A2_uc011bjn.1_Missense_Mutation_p.G125V	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a	156	Helical; (Potential).				protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	ATAGCTTTGGGGACAGGAGGC	0.418													10	326	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178927980	178927980	+	Missense_Mutation	SNP	T	C	C	rs121913272		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178927980T>C	uc003fjk.2	+	8	1415	c.1258T>C	c.(1258-1260)TGT>CGT	p.C420R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	420	C2 PI3K-type.		C -> R (in cancer; shows an increase in lipid kinase activity; may increase the affinity for lipid membranes).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.C420R(26)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TAAGGAACACTGTCCATTGGC	0.328	C420R(EFM192A_BREAST)|C420R(OVISE_OVARY)|C420R(HEC151_ENDOMETRIUM)|C420R(CCK81_LARGE_INTESTINE)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			19	23	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	183995720	183995720	+	Silent	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183995720C>T	uc003fni.3	+	5	878	c.840C>T	c.(838-840)ACC>ACT	p.T280T	ECE2_uc011brg.1_Silent_p.T208T|ECE2_uc011brh.1_Silent_p.T133T|ECE2_uc003fnl.3_Silent_p.T208T|ECE2_uc003fnm.3_Silent_p.T162T|ECE2_uc003fnk.3_Silent_p.T133T|ECE2_uc011bri.1_Silent_p.T195T|ECE2_uc010hxv.2_5'UTR	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	280	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGAAAACACCACCTTCAACT	0.557													11	140	---	---	---	---	PASS
FGF12	2257	broad.mit.edu	37	3	192125875	192125875	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192125875G>T	uc003fsx.2	-	1	964	c.138C>A	c.(136-138)CTC>CTA	p.L46L	FGF12_uc003fsy.2_Intron	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1	46					cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		TGAACACCCCGAGGACGTGCC	0.687													5	125	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20598114	20598114	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20598114G>T	uc003gpr.1	+	32	3601	c.3397G>T	c.(3397-3399)GGA>TGA	p.G1133*	SLIT2_uc003gps.1_Nonsense_Mutation_p.G1125*	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1133	EGF-like 6.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						TTGTCAGAATGGAGCTCAGTG	0.398													4	26	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71509219	71509219	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71509219C>A	uc011caw.1	+	9	2357	c.2076C>A	c.(2074-2076)ACC>ACA	p.T692T		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	692					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			AACAATATACCTCAAATCAGC	0.413													6	87	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76788552	76788552	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76788552G>T	uc003hix.2	-	14	2027	c.1670C>A	c.(1669-1671)TCG>TAG	p.S557*	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Nonsense_Mutation_p.S557*	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	557					detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TCTCAGAGCCGACTCCTCCAC	0.398													4	31	---	---	---	---	PASS
ANKRD56	345079	broad.mit.edu	37	4	77816806	77816806	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77816806G>T	uc003hki.2	-	1	2197	c.2197C>A	c.(2197-2199)CCT>ACT	p.P733T		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	733											0						GGATAGACAGGGAAAATGGGC	0.502													9	327	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82355128	82355128	+	Intron	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82355128A>T	uc003hmi.1	-						RASGEF1B_uc003hmj.1_Intron|RASGEF1B_uc010ijq.1_Intron	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						CTGGAAGATAAGTAAAAAAAG	0.328													13	62	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154525134	154525134	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154525134C>A	uc003inm.3	+	25	3019	c.2967C>A	c.(2965-2967)ACC>ACA	p.T989T	KIAA0922_uc010ipp.2_Silent_p.T990T|KIAA0922_uc010ipq.2_Silent_p.T758T	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	989	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				AACACAAAACCAGCACAGCTG	0.517													4	24	---	---	---	---	PASS
HMGB2	3148	broad.mit.edu	37	4	174254762	174254762	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174254762C>A	uc011ckc.1	-	1	159	c.39G>T	c.(37-39)ATG>ATT	p.M13I	HMGB2_uc003ita.3_Missense_Mutation_p.M13I|HMGB2_uc003itb.2_Missense_Mutation_p.M13I|HMGB2_uc003itc.2_Missense_Mutation_p.M13I	NM_001130689	NP_001124161	P26583	HMGB2_HUMAN	high-mobility group box 2	13	HMG box 1.				base-excision repair, DNA ligation|cell chemotaxis|cellular response to lipopolysaccharide|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|negative regulation of transcription, DNA-dependent|nucleosome assembly|phosphatidylinositol-mediated signaling|positive regulation of DNA binding|positive regulation of endothelial cell proliferation|positive regulation of erythrocyte differentiation|positive regulation of megakaryocyte differentiation|positive regulation of nuclease activity|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	condensed chromosome|extracellular space|nucleolus|nucleoplasm|perinuclear region of cytoplasm|protein complex	chemoattractant activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding|transcription regulatory region DNA binding				0		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CGTACGAGGACATTTTGCCCC	0.602													10	17	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41055934	41055934	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41055934T>G	uc003jmj.3	-	10	1433	c.943A>C	c.(943-945)ATG>CTG	p.M315L	HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	315	HEAT 4.						binding			ovary(6)|central_nervous_system(2)	8						AAAAATTCCATCAGCTCTCCA	0.398													10	54	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54555722	54555722	+	Silent	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54555722A>G	uc003jpx.2	-	26	4131	c.4011T>C	c.(4009-4011)GAT>GAC	p.D1337D	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	1337							ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTAAAACTGAATCAATGAGAA	0.373													10	51	---	---	---	---	PASS
CAMK4	814	broad.mit.edu	37	5	110809031	110809031	+	Silent	SNP	T	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110809031T>C	uc011cvj.1	+	9	747	c.648T>C	c.(646-648)TGT>TGC	p.C216C	CAMK4_uc003kpf.2_Silent_p.C216C|CAMK4_uc010jbv.2_Silent_p.C19C	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	216	Protein kinase.				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TTAGAGGTTGTGCCTATGGAC	0.338													7	50	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140564336	140564336	+	Silent	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140564336G>A	uc003liv.2	+	1	3357	c.2202G>A	c.(2200-2202)GGG>GGA	p.G734G	PCDHB9_uc003liw.1_5'Flank	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	734	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTTTCCAGGGCGTCTGGTGG	0.627													24	69	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149212301	149212301	+	Nonsense_Mutation	SNP	C	A	A	rs75266799	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149212301C>A	uc003lrc.2	+	5	707	c.665C>A	c.(664-666)TCG>TAG	p.S222*	PPARGC1B_uc003lrb.1_Nonsense_Mutation_p.S222*|PPARGC1B_uc003lrd.2_Nonsense_Mutation_p.S183*|PPARGC1B_uc003lrf.2_Nonsense_Mutation_p.S201*|PPARGC1B_uc003lre.1_Nonsense_Mutation_p.S201*	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	222					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CACCTCACCTCGGCACAGTGC	0.617													5	122	---	---	---	---	PASS
F13A1	2162	broad.mit.edu	37	6	6146012	6146012	+	Intron	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6146012G>T	uc003mwv.2	-						F13A1_uc011dib.1_Intron	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor						peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TTCACTGAAAGGATGGAAAAG	0.512													5	45	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7584770	7584770	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7584770C>A	uc003mxp.1	+	24	7554	c.7275C>A	c.(7273-7275)ACC>ACA	p.T2425T	DSP_uc003mxq.1_Silent_p.T1826T	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2425	Plectin 11.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAAATCTTACCTATCTGCAAC	0.398													6	121	---	---	---	---	PASS
C6orf105	84830	broad.mit.edu	37	6	11723606	11723606	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11723606C>A	uc003nab.2	-	5	922	c.634G>T	c.(634-636)GAG>TAG	p.E212*	C6orf105_uc003naa.2_RNA|C6orf105_uc011dip.1_Nonsense_Mutation_p.E230*	NM_032744	NP_116133	Q96IZ2	CF105_HUMAN	hypothetical protein LOC84830 isoform 2	212						integral to membrane					0	Ovarian(93;0.0848)|Breast(50;0.0871)	all_hematologic(90;0.135)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.193)			TTGAGCTTCTCTCCAAGTAGG	0.493													8	218	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12164614	12164614	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12164614C>G	uc003nac.2	+	9	8256	c.8077C>G	c.(8077-8079)CTA>GTA	p.L2693V	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2693					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GCCCACAGCACTACCGCGGAG	0.522													10	38	---	---	---	---	PASS
OR12D2	26529	broad.mit.edu	37	6	29364649	29364649	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29364649A>T	uc003nmf.3	+	1	234	c.173A>T	c.(172-174)TAT>TTT	p.Y58F		NM_013936	NP_039224	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TCCCTTATGTATTTCTTCCTG	0.448													14	30	---	---	---	---	PASS
TAP1	6890	broad.mit.edu	37	6	32818803	32818803	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32818803C>G	uc003ocg.2	-	4	1303	c.1148G>C	c.(1147-1149)GGA>GCA	p.G383A	TAP1_uc011dqi.1_Missense_Mutation_p.G122A	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family	383	Lumenal (Potential).|ABC transmembrane type-1.				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						GGACACTGATCCCCAGAGCAT	0.527													6	74	---	---	---	---	PASS
HTR1E	3354	broad.mit.edu	37	6	87725275	87725275	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87725275G>A	uc003pli.2	+	2	926	c.223G>A	c.(223-225)GTC>ATC	p.V75I		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	75	Helical; Name=2; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	GGCAGTGCTCGTCATGCCCCT	0.562													24	60	---	---	---	---	PASS
PAPOLB	56903	broad.mit.edu	37	7	4900001	4900001	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4900001C>A	uc003snk.2	-	1	1625	c.1441G>T	c.(1441-1443)GGT>TGT	p.G481C	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	480					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		ATTTTCATACCCATCTCAAAC	0.388													5	30	---	---	---	---	PASS
PRPS1L1	221823	broad.mit.edu	37	7	18067280	18067280	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18067280C>A	uc003stz.2	-	1	207	c.126G>T	c.(124-126)GTG>GTT	p.V42V		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	42					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					CATCAATTTCCACGCAGGTCT	0.498													7	225	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21938980	21938980	+	Missense_Mutation	SNP	G	T	T	rs113653972		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21938980G>T	uc003svc.2	+	81	13128	c.13097G>T	c.(13096-13098)CGA>CTA	p.R4366L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4366					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CTGCGATGCCGAGAACTCGAT	0.502									Kartagener_syndrome				5	182	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30818085	30818085	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30818085G>T	uc003tbt.2	+	2	178	c.101G>T	c.(100-102)CGC>CTC	p.R34L	FAM188B_uc010kwe.2_Missense_Mutation_p.R5L	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	34											0						GACCAGGAACGCCCACGCTCT	0.423													4	81	---	---	---	---	PASS
TXNDC3	51314	broad.mit.edu	37	7	37901736	37901736	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37901736C>T	uc003tfn.2	+	7	749	c.377C>T	c.(376-378)GCT>GTT	p.A126V		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	126					cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GGTGAAATGGCTCGACCTCAG	0.358									Kartagener_syndrome				4	20	---	---	---	---	PASS
PCOLCE	5118	broad.mit.edu	37	7	100205276	100205276	+	Silent	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100205276G>A	uc003uvo.2	+	8	1227	c.1029G>A	c.(1027-1029)GTG>GTA	p.V343V	PCOLCE_uc010lhb.1_RNA|PCOLCE_uc003uvp.1_RNA	NM_002593	NP_002584	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	343	NTR.				multicellular organismal development	extracellular space	collagen binding|heparin binding|peptidase activator activity				0	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CTGCGACAGTGAAGTCCATGG	0.562													12	83	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100373092	100373092	+	Silent	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100373092C>T	uc003uwj.2	+	33	6087	c.5922C>T	c.(5920-5922)GCC>GCT	p.A1974A	ZAN_uc003uwk.2_Silent_p.A1974A|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Silent_p.A61A	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1974	Extracellular (Potential).|VWFD 3.				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGATCAGTGCCAAGCATGAGA	0.552													7	42	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100683976	100683976	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100683976C>A	uc003uxp.1	+	3	9332	c.9279C>A	c.(9277-9279)ACC>ACA	p.T3093T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3093	Extracellular (Potential).|Ser-rich.|50.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CTGAAGGTACCAGCATGCCAA	0.493													9	364	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113518998	113518998	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113518998C>T	uc010ljy.1	-	4	2180	c.2149G>A	c.(2149-2151)GCT>ACT	p.A717T		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	717					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						CCATGATCAGCTAGAGAAGAC	0.408													12	52	---	---	---	---	PASS
HYAL4	23553	broad.mit.edu	37	7	123508765	123508765	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123508765G>T	uc003vlc.2	+	3	1076	c.438G>T	c.(436-438)TGG>TGT	p.W146C	HYAL4_uc011knz.1_Missense_Mutation_p.W146C	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	146	Extracellular (Potential).				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						TTATAGATTGGGAATATTGGC	0.393													6	60	---	---	---	---	PASS
CNOT4	4850	broad.mit.edu	37	7	135078943	135078943	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135078943C>A	uc003vsv.1	-	10	1661	c.1354G>T	c.(1354-1356)GGA>TGA	p.G452*	CNOT4_uc003vss.2_Nonsense_Mutation_p.G449*|CNOT4_uc011kpz.1_Nonsense_Mutation_p.G449*|CNOT4_uc003vst.2_Nonsense_Mutation_p.G452*|CNOT4_uc003vsu.1_Nonsense_Mutation_p.G449*|CNOT4_uc011kpy.1_Nonsense_Mutation_p.G452*	NM_001008225	NP_001008226	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	452					nuclear-transcribed mRNA poly(A) tail shortening|protein autoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	nucleotide binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding				0						TGCAGGAATCCAGAGCCTGGA	0.507													5	49	---	---	---	---	PASS
ANGPT2	285	broad.mit.edu	37	8	6371296	6371296	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6371296G>A	uc003wqj.3	-	7	1431	c.1102C>T	c.(1102-1104)CGC>TGC	p.R368C	MCPH1_uc003wqi.2_Intron|ANGPT2_uc003wqk.3_Missense_Mutation_p.R367C|ANGPT2_uc010lri.2_Missense_Mutation_p.R316C|ANGPT2_uc003wql.3_Missense_Mutation_p.R367C	NM_001147	NP_001138	O15123	ANGP2_HUMAN	angiopoietin 2 isoform a precursor	368	Fibrinogen C-terminal.				angiogenesis|blood coagulation|leukocyte migration|negative regulation of blood vessel endothelial cell migration|negative regulation of positive chemotaxis|Tie receptor signaling pathway	extracellular space	metal ion binding|receptor tyrosine kinase binding			upper_aerodigestive_tract(1)	1		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		AGCACATAGCGTTGCTGATTA	0.363													7	71	---	---	---	---	PASS
PPP1R3B	79660	broad.mit.edu	37	8	8998700	8998700	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8998700G>T	uc003wsn.3	-	2	627	c.462C>A	c.(460-462)CTC>CTA	p.L154L	PPP1R3B_uc003wso.3_Silent_p.L153L	NM_024607	NP_078883	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory (inhibitor)	154	CBM21.				glycogen metabolic process					ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		TCTCAAATGCGAGGTTCTGAA	0.488													5	137	---	---	---	---	PASS
TOX	9760	broad.mit.edu	37	8	59852027	59852027	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59852027G>T	uc003xtw.1	-	3	466	c.245C>A	c.(244-246)TCG>TAG	p.S82*		NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX	82						nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GTGCACCAGCGAGTGGTCTGG	0.478													4	36	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72958758	72958758	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72958758G>A	uc003xza.2	-	17	2226	c.2051C>T	c.(2050-2052)ACA>ATA	p.T684I	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	684	Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	GTTGAGGGCTGTAAGCGGTTC	0.239													4	23	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618422	77618422	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618422G>A	uc003yav.2	+	2	2486	c.2099G>A	c.(2098-2100)CGT>CAT	p.R700H	ZFHX4_uc003yat.1_Missense_Mutation_p.R700H|ZFHX4_uc003yau.1_Missense_Mutation_p.R700H|ZFHX4_uc003yaw.1_Missense_Mutation_p.R700H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	700	C2H2-type 3.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAACCCTTCCGTTGTGAGGTT	0.502										HNSCC(33;0.089)			7	45	---	---	---	---	PASS
SNTB1	6641	broad.mit.edu	37	8	121644768	121644768	+	Silent	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121644768C>T	uc010mdg.2	-	3	1138	c.912G>A	c.(910-912)GTG>GTA	p.V304V	SNTB1_uc003ype.2_Silent_p.V304V	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	304					muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CCTCAGCAATCACTCGGGTCA	0.527													7	19	---	---	---	---	PASS
NDRG1	10397	broad.mit.edu	37	8	134276808	134276808	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134276808G>T	uc003yuh.2	-	4	773	c.187C>A	c.(187-189)CAT>AAT	p.H63N	NDRG1_uc003yug.2_Missense_Mutation_p.H63N|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_5'UTR|NDRG1_uc011ljh.1_5'UTR|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	63					cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCGATGTCATGGTAGGTGAGG	0.562													5	75	---	---	---	---	PASS
KDM4C	23081	broad.mit.edu	37	9	7174612	7174612	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7174612G>T	uc003zkh.2	+	22	3634	c.3054G>T	c.(3052-3054)GGG>GGT	p.G1018G	KDM4C_uc011lmk.1_Silent_p.G763G|KDM4C_uc011lml.1_Silent_p.G705G	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1	1018					positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						TTATCCAAGGGGAGAGAAAGA	0.448													8	180	---	---	---	---	PASS
FAM154A	158297	broad.mit.edu	37	9	18928612	18928612	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18928612G>T	uc003zni.1	-	4	1141	c.863C>A	c.(862-864)TCC>TAC	p.S288Y	FAM154A_uc010mip.1_Missense_Mutation_p.S96Y	NM_153707	NP_714918	Q8IYX7	F154A_HUMAN	hypothetical protein LOC158297	288										pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.53e-16)		GGGAGCTTTGGAGAACATCCG	0.542													5	55	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971029	21971029	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971029C>T	uc003zpk.2	-	2	541	c.329G>A	c.(328-330)TGG>TAG	p.W110*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Silent_p.L165L	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	110	ANK 4.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.W110*(38)|p.?(13)|p.H83fs*2(2)|p.W110fs*9(1)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)|p.W110fs*36(1)|p.W110C(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CAGACGGCCCCAGGCATCGCG	0.731		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			7	12	---	---	---	---	PASS
GNE	10020	broad.mit.edu	37	9	36227385	36227385	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36227385C>A	uc010mlh.2	-	7	1356	c.1141G>T	c.(1141-1143)GAG>TAG	p.E381*	CLTA_uc003zzf.1_Intron|GNE_uc010mlg.2_Nonsense_Mutation_p.E381*|GNE_uc011lpl.1_Nonsense_Mutation_p.E271*|GNE_uc010mli.2_Nonsense_Mutation_p.E412*|GNE_uc010mlj.2_Nonsense_Mutation_p.E376*	NM_005476	NP_005467	Q9Y223	GLCNE_HUMAN	UDP-N-acetylglucosamine-2-epimerase/N-	381	UDP-N-acetylglucosamine 2-epimerase.				cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity				0			STAD - Stomach adenocarcinoma(86;0.228)			TGCAGTGGCTCTTGAAGATCG	0.358													7	38	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84606846	84606846	+	Silent	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84606846A>G	uc004amn.2	+	4	1508	c.1461A>G	c.(1459-1461)CCA>CCG	p.P487P		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	487						integral to membrane					0						AGCAGCCTCCACACTCTAAAT	0.453													18	85	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104356757	104356757	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104356757G>T	uc004bbr.2	-	1	527	c.456C>A	c.(454-456)TCC>TCA	p.S152S	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	149	EF-hand 4.|4.						calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	ATTCCTCAAAGGATATCTTCC	0.502													5	50	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117798447	117798447	+	Silent	SNP	T	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117798447T>C	uc004bjj.3	-	21	5948	c.5586A>G	c.(5584-5586)GAA>GAG	p.E1862E	TNC_uc010mvf.2_Silent_p.E1589E	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1862	Fibronectin type-III 14.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						TCAGTGTGTATTCCGTGGCAG	0.507													16	54	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131760858	131760858	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131760858C>A	uc004bws.1	+	32	3493	c.3471C>A	c.(3469-3471)TCC>TCA	p.S1157S	NUP188_uc004bwu.2_Silent_p.S500S	NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1157					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						GCCTTGGCTCCATGAAGTGCA	0.572													5	63	---	---	---	---	PASS
PPP2R4	5524	broad.mit.edu	37	9	131898812	131898812	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131898812G>T	uc004bxm.1	+	8	995	c.728G>T	c.(727-729)GGA>GTA	p.G243V	PPP2R4_uc004bxl.1_Missense_Mutation_p.G208V|PPP2R4_uc011mbo.1_Missense_Mutation_p.G243V|PPP2R4_uc010myr.1_Intron|PPP2R4_uc004bxn.1_Missense_Mutation_p.G208V|PPP2R4_uc004bxo.1_Missense_Mutation_p.G166V|PPP2R4_uc011mbp.1_Missense_Mutation_p.G179V|PPP2R4_uc011mbq.1_Missense_Mutation_p.G166V|PPP2R4_uc010mys.1_Missense_Mutation_p.G173V|PPP2R4_uc011mbr.1_5'Flank	NM_178001	NP_821068	Q15257	PTPA_HUMAN	protein phosphatase 2A, regulatory subunit B'	243					ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		GGCAGCCAGGGAGTGTGGGGT	0.562													7	141	---	---	---	---	PASS
SURF2	6835	broad.mit.edu	37	9	136226940	136226940	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136226940G>T	uc004cdi.2	+	4	500	c.452G>T	c.(451-453)TGG>TTG	p.W151L		NM_017503	NP_059973	Q15527	SURF2_HUMAN	surfeit 2	151							protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		GAAGCCTTCTGGGAGCCCACA	0.642													5	20	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88259869	88259869	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88259869C>A	uc001kdo.2	-	3	1573	c.1131G>T	c.(1129-1131)ATG>ATT	p.M377I	WAPAL_uc001kdn.2_Missense_Mutation_p.M420I|WAPAL_uc009xsw.2_Missense_Mutation_p.M377I	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	377	Mediates interaction with the cohesin complex.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						TGCTGCGTTCCATAGTATCCT	0.438													4	19	---	---	---	---	PASS
ANO9	338440	broad.mit.edu	37	11	418531	418531	+	Nonsense_Mutation	SNP	G	T	T	rs144928396	byFrequency	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:418531G>T	uc001lpi.2	-	23	2274	c.2189C>A	c.(2188-2190)TCG>TAG	p.S730*	SIGIRR_uc001lpf.2_5'Flank|SIGIRR_uc001lpe.1_5'Flank|ANO9_uc001lph.2_Nonsense_Mutation_p.S423*|ANO9_uc010qvv.1_Nonsense_Mutation_p.S586*	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	730	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						GTTCTTCACCGACTGAGGGAT	0.637													5	78	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1015965	1015965	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1015965C>A	uc001lsw.2	-	31	6887	c.6836G>T	c.(6835-6837)CGA>CTA	p.R2279L		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	2279	Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTGGGAACTCGGGTGGTGAG	0.627													6	94	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1256581	1256581	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1256581G>A	uc009ycr.1	+	39	4921	c.4795G>A	c.(4795-4797)GAG>AAG	p.E1599K	MUC5B_uc009yct.1_Missense_Mutation_p.E940K|MUC5B_uc001ltb.2_Missense_Mutation_p.E943K|MUC5B_uc001lta.2_Missense_Mutation_p.E608K	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	940	VWFD 3.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGTCACCGAGAACATCCC	0.657													5	17	---	---	---	---	PASS
NUCB2	4925	broad.mit.edu	37	11	17332440	17332440	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17332440G>T	uc001mmw.2	+	7	797	c.552G>T	c.(550-552)AAG>AAT	p.K184N	NUCB2_uc001mms.1_Missense_Mutation_p.K185N|NUCB2_uc001mmt.1_Missense_Mutation_p.K184N|NUCB2_uc001mmv.1_Missense_Mutation_p.K184N|NUCB2_uc009ygz.2_Missense_Mutation_p.K184N	NM_005013	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2 precursor	184	By similarity.					cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						AAATGATGAAGGAACATGAAA	0.289													5	57	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21581914	21581914	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21581914G>C	uc001mqe.2	+	17	2119	c.1966G>C	c.(1966-1968)GTC>CTC	p.V656L	NELL1_uc001mqf.2_Missense_Mutation_p.V609L|NELL1_uc009yid.2_Missense_Mutation_p.V684L|NELL1_uc010rdo.1_Missense_Mutation_p.V599L|NELL1_uc010rdp.1_Missense_Mutation_p.V369L|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	656	VWFC 3.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						CAGGTGTTCTGTCTGCTCCTG	0.542													5	11	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46896436	46896436	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46896436G>A	uc001ndn.3	-	28	4290	c.4144C>T	c.(4144-4146)CCT>TCT	p.P1382S		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	1382	Extracellular (Potential).				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		TTGAGCTCAGGAACAGGGACA	0.522													13	60	---	---	---	---	PASS
DDB2	1643	broad.mit.edu	37	11	47254483	47254483	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47254483G>T	uc001neb.2	+	4	770	c.575G>T	c.(574-576)CGA>CTA	p.R192L	DDB2_uc001nec.2_RNA|DDB2_uc009yli.1_Missense_Mutation_p.R128L|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Missense_Mutation_p.R56L|DDB2_uc001neh.2_RNA	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2	192	WD 2.				nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						AACATTCTACGAGTTTTTGCC	0.468			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				5	140	---	---	---	---	PASS
SCYL1	57410	broad.mit.edu	37	11	65305479	65305479	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65305479C>A	uc001oea.1	+	16	2150	c.2073C>A	c.(2071-2073)TCC>TCA	p.S691S	SCYL1_uc009yqk.2_Silent_p.S691S|SCYL1_uc001oeb.1_Silent_p.S674S|SCYL1_uc001oec.1_Missense_Mutation_p.P679Q|SCYL1_uc001oed.1_Silent_p.S548S|SCYL1_uc001oee.1_Silent_p.S335S	NM_020680	NP_065731	Q96KG9	NTKL_HUMAN	SCY1-like 1 isoform A	691					regulation of transcription, DNA-dependent|retrograde vesicle-mediated transport, Golgi to ER|transcription, DNA-dependent	cis-Golgi network|COPI vesicle coat|ER-Golgi intermediate compartment|microtubule organizing center|nucleus	ATP binding|DNA binding|protein tyrosine kinase activity			skin(1)	1						CCCCAGAGTCCGACTGGAGCA	0.627													3	14	---	---	---	---	PASS
TMEM135	65084	broad.mit.edu	37	11	87016979	87016979	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87016979T>A	uc001pch.2	+	9	723	c.700T>A	c.(700-702)TGC>AGC	p.C234S	TMEM135_uc010rtt.1_Missense_Mutation_p.C95S|TMEM135_uc001pci.2_Missense_Mutation_p.C212S	NM_022918	NP_075069	Q86UB9	TM135_HUMAN	transmembrane protein 135	234						integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CAATTTCAGATGCAAACATGG	0.284													5	26	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133806017	133806017	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133806017C>A	uc001qgx.3	-	6	983	c.752G>T	c.(751-753)CGG>CTG	p.R251L	IGSF9B_uc001qgy.1_Missense_Mutation_p.R93L	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	251	Extracellular (Potential).|Ig-like 3.					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CGCCTCTGCCCGGCAGGTGAG	0.582													4	19	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14613749	14613749	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14613749G>T	uc001rbw.2	+	9	2637	c.2479G>T	c.(2479-2481)GGT>TGT	p.G827C	ATF7IP_uc010shs.1_3'UTR|ATF7IP_uc001rbu.2_Missense_Mutation_p.G827C|ATF7IP_uc001rbv.1_Missense_Mutation_p.G826C|ATF7IP_uc001rbx.2_Missense_Mutation_p.G826C|ATF7IP_uc010sht.1_3'UTR|ATF7IP_uc001rby.3_Missense_Mutation_p.G827C|ATF7IP_uc001rca.2_Missense_Mutation_p.G827C	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	827					DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						TACAGTGAGTGGTCTTACCAA	0.468													4	27	---	---	---	---	PASS
SFRS2IP	9169	broad.mit.edu	37	12	46321720	46321720	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46321720G>T	uc001rox.2	-	11	2051	c.1764C>A	c.(1762-1764)TCC>TCA	p.S588S	SFRS2IP_uc001row.2_Silent_p.S273S|SFRS2IP_uc001roy.1_Silent_p.S662S	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,	588					spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTTCTACTAGGGAACTCTCTG	0.368													5	34	---	---	---	---	PASS
KRT73	319101	broad.mit.edu	37	12	53004546	53004546	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53004546T>G	uc001sas.2	-	7	1219	c.1184A>C	c.(1183-1185)AAG>ACG	p.K395T		NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73	395	Rod.|Coil 2.					keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCATCCAGCTTGGCCCTGGC	0.642													5	32	---	---	---	---	PASS
KRT79	338785	broad.mit.edu	37	12	53228025	53228025	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53228025C>A	uc001sbb.2	-	1	53	c.20G>T	c.(19-21)CGG>CTG	p.R7L		NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	7	Head.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4						GTATGTTTGCCGAGAGACGGA	0.627													3	12	---	---	---	---	PASS
TMPO	7112	broad.mit.edu	37	12	98926689	98926689	+	Intron	SNP	T	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98926689T>G	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Missense_Mutation_p.F218L	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						GTGGTGGATTTTTTCAGGGTA	0.438													7	47	---	---	---	---	PASS
HCFC2	29915	broad.mit.edu	37	12	104481815	104481815	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104481815G>C	uc001tkj.3	+	9	1386	c.1283G>C	c.(1282-1284)AGT>ACT	p.S428T	HCFC2_uc009zul.2_Intron	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	428	Fibronectin type-III 1.				regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						GTTCCTAACAGTGTAAGTAAA	0.343													6	14	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30135343	30135343	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30135343A>G	uc001wqh.2	-	3	656	c.475T>C	c.(475-477)TTC>CTC	p.F159L		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	159	Phorbol-ester/DAG-type 1.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TGATCACAGAAAGCTGGAGCT	0.418													17	48	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25442783	25442783	+	Intron	SNP	A	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25442783A>C	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-16_uc001yzm.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AATCATGCTCAATAGGATTAC	0.488													31	325	---	---	---	---	PASS
FMN1	342184	broad.mit.edu	37	15	33256413	33256413	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33256413G>T	uc001zhf.3	-	5	2364	c.2364C>A	c.(2362-2364)GAC>GAA	p.D788E		NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	1011	FH2.				actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GGTCCCGAATGTCAGGTTCTT	0.378													7	60	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35210573	35210573	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35210573G>T	uc001ziv.2	-	15	1409	c.1228C>A	c.(1228-1230)CGT>AGT	p.R410S		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	410						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CGTTCATGACGAGATACCTAA	0.338													4	37	---	---	---	---	PASS
KIF7	374654	broad.mit.edu	37	15	90171694	90171694	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90171694G>A	uc002bof.2	-	19	4065	c.3988C>T	c.(3988-3990)CGA>TGA	p.R1330*	KIF7_uc010upw.1_Nonsense_Mutation_p.R816*|C15orf42_uc010upv.1_Intron	NM_198525	NP_940927	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1330					microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GGGCTGGCTCGTCGCAGTTCC	0.672													9	35	---	---	---	---	PASS
PCSK6	5046	broad.mit.edu	37	15	101933582	101933582	+	Silent	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101933582G>A	uc002bwy.2	-	9	1358	c.1044C>T	c.(1042-1044)GGC>GGT	p.G348G	PCSK6_uc010bpd.2_Silent_p.G218G|PCSK6_uc010bpe.2_Silent_p.G348G|PCSK6_uc002bxa.2_Silent_p.G348G|PCSK6_uc002bxb.2_Silent_p.G348G|PCSK6_uc002bxc.1_Silent_p.G348G|PCSK6_uc002bxd.1_Silent_p.G348G|PCSK6_uc002bxe.2_Silent_p.G348G|PCSK6_uc002bxg.1_Silent_p.G348G	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	348	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCTCTCTCCCGCCATTCCCAG	0.617													8	33	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1388906	1388906	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1388906A>C	uc002clk.1	+	3	240	c.240A>C	c.(238-240)AAA>AAC	p.K80N	BAIAP3_uc002clj.2_Missense_Mutation_p.K45N|BAIAP3_uc010uuz.1_Missense_Mutation_p.K45N|BAIAP3_uc010uva.1_Missense_Mutation_p.K45N|BAIAP3_uc010uvb.1_Missense_Mutation_p.K80N|BAIAP3_uc010uvc.1_Missense_Mutation_p.K45N	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	80					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				TCTCCAGGAAACCCGGGGATG	0.642													8	89	---	---	---	---	PASS
TRAF7	84231	broad.mit.edu	37	16	2223536	2223536	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2223536G>T	uc002cow.2	+	11	1166	c.1067G>T	c.(1066-1068)CGG>CTG	p.R356L		NM_032271	NP_115647	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7	356					activation of MAPKKK activity|apoptosis|regulation of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic membrane-bounded vesicle|ubiquitin ligase complex	identical protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						GAGTTCCGGCGGGACGCATCC	0.672													4	19	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3789636	3789636	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3789636C>T	uc002cvv.2	-	25	4427	c.4223G>A	c.(4222-4224)TGC>TAC	p.C1408Y	CREBBP_uc002cvw.2_Missense_Mutation_p.C1370Y	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1408	Cys/His-rich.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	p.C1408Y(1)		haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCCAAAAAAGCAGACATCCAC	0.478			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				6	55	---	---	---	---	PASS
A2BP1	54715	broad.mit.edu	37	16	7629902	7629902	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7629902G>A	uc002cys.2	+	6	1382	c.394G>A	c.(394-396)GAC>AAC	p.D132N	A2BP1_uc010buf.1_Missense_Mutation_p.D132N|A2BP1_uc002cyr.1_Missense_Mutation_p.D131N|A2BP1_uc002cyt.2_Missense_Mutation_p.D132N|A2BP1_uc010uxz.1_Missense_Mutation_p.D175N|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Missense_Mutation_p.D132N|A2BP1_uc010uyb.1_Missense_Mutation_p.D132N|A2BP1_uc002cyw.2_Missense_Mutation_p.D152N|A2BP1_uc002cyy.2_Missense_Mutation_p.D152N|A2BP1_uc002cyx.2_Missense_Mutation_p.D152N|A2BP1_uc010uyc.1_Missense_Mutation_p.D152N	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	132	RRM.				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		CCGGGATCCGGACCTCAGACA	0.532													7	36	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15865568	15865568	+	Silent	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15865568A>G	uc002ddy.2	-	9	998	c.891T>C	c.(889-891)AGT>AGC	p.S297S	MYH11_uc002ddv.2_Silent_p.S304S|MYH11_uc002ddw.2_Silent_p.S297S|MYH11_uc002ddx.2_Silent_p.S304S|MYH11_uc010bvg.2_Silent_p.S129S|MYH11_uc002dea.1_Silent_p.S3S	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	297	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						AAAGCAAGTCACCTAGAAGGA	0.488			T	CBFB	AML								11	56	---	---	---	---	PASS
ZKSCAN2	342357	broad.mit.edu	37	16	25264319	25264319	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25264319C>A	uc002dod.3	-	3	1033	c.626G>T	c.(625-627)TGG>TTG	p.W209L	ZKSCAN2_uc010vcl.1_Missense_Mutation_p.M1I|ZKSCAN2_uc002doe.2_Missense_Mutation_p.W209L	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	209					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		TAGGGTATTCCATTCATCAGC	0.398													9	195	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31139364	31139364	+	Intron	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31139364C>A	uc002eay.2	+						MYST1_uc002eax.2_Intron|MYST1_uc002eaz.2_Intron|MYST1_uc002eba.2_Intron|MYST1_uc002ebb.2_5'Flank	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1						histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						CTCTTGTCCCCGACCAGGGTC	0.567													4	19	---	---	---	---	PASS
NETO2	81831	broad.mit.edu	37	16	47162370	47162370	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47162370G>T	uc002eer.1	-	4	732	c.347C>A	c.(346-348)CCT>CAT	p.P116H	NETO2_uc010vgf.1_5'UTR|NETO2_uc002ees.1_Missense_Mutation_p.P116H	NM_018092	NP_060562	Q8NC67	NETO2_HUMAN	neuropilin- and tolloid-like protein 2	116	Extracellular (Potential).|CUB 1.					integral to membrane	receptor activity				0		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				ATCTATAAGAGGAGAGAAACC	0.388										HNSCC(25;0.065)			6	102	---	---	---	---	PASS
FTO	79068	broad.mit.edu	37	16	53922817	53922817	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53922817A>T	uc002ehr.2	+	7	1415	c.1193A>T	c.(1192-1194)CAA>CTA	p.Q398L	FTO_uc010vha.1_Missense_Mutation_p.Q102L|FTO_uc010cbz.2_5'UTR	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	398					DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TGGTGGTGTCAACCCATGGCT	0.498													8	57	---	---	---	---	PASS
GPR56	9289	broad.mit.edu	37	16	57689812	57689812	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57689812G>T	uc002emb.2	+	8	1217	c.925G>T	c.(925-927)GGT>TGT	p.G309C	GPR56_uc002elz.1_Missense_Mutation_p.G139C|GPR56_uc002ema.1_Missense_Mutation_p.G134C|GPR56_uc002emc.2_Missense_Mutation_p.G309C|GPR56_uc002emf.2_Missense_Mutation_p.G309C|GPR56_uc010vhs.1_Missense_Mutation_p.G309C|GPR56_uc002emd.2_Missense_Mutation_p.G309C|GPR56_uc002eme.2_Missense_Mutation_p.G309C|GPR56_uc010vht.1_Missense_Mutation_p.G314C|GPR56_uc002emg.3_Missense_Mutation_p.G309C|GPR56_uc010vhu.1_Missense_Mutation_p.G134C	NM_005682	NP_005673	Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56 isoform a	309	Extracellular (Potential).				brain development|cell adhesion|cell-cell signaling|neuropeptide signaling pathway	integral to plasma membrane	G-protein coupled receptor activity				0						CCAAGTCCTGGGTGAGAAGGT	0.557													7	127	---	---	---	---	PASS
RANBP10	57610	broad.mit.edu	37	16	67768792	67768792	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67768792G>T	uc002eud.2	-	6	861	c.745C>A	c.(745-747)CGG>AGG	p.R249R	RANBP10_uc010ceo.2_Silent_p.R20R|RANBP10_uc010vju.1_Silent_p.R193R|RANBP10_uc010vjv.1_Silent_p.R132R|RANBP10_uc010vjx.1_Silent_p.R249R|RANBP10_uc010vjy.1_Silent_p.R117R	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10	249										ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		TCGCCAAGCCGGGCACTGATG	0.627													3	16	---	---	---	---	PASS
NFATC3	4775	broad.mit.edu	37	16	68156951	68156951	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68156951G>T	uc002evo.1	+	2	1375	c.1165G>T	c.(1165-1167)GGT>TGT	p.G389C	NFATC3_uc010vkl.1_5'UTR|NFATC3_uc010vkm.1_5'UTR|NFATC3_uc010vkn.1_5'UTR|NFATC3_uc010vko.1_5'UTR|NFATC3_uc010vkp.1_5'UTR|NFATC3_uc010vkq.1_5'UTR|NFATC3_uc002evl.2_Intron|NFATC3_uc002evk.2_Missense_Mutation_p.G389C|NFATC3_uc002evm.1_Missense_Mutation_p.G389C|NFATC3_uc002evn.1_Missense_Mutation_p.G389C|NFATC3_uc010vkr.1_5'UTR|NFATC3_uc010vks.1_5'UTR|NFATC3_uc010vkt.1_5'UTR|NFATC3_uc010vku.1_5'UTR|NFATC3_uc010vkv.1_5'UTR|NFATC3_uc010vkw.1_5'UTR|NFATC3_uc010vkx.1_5'UTR|NFATC3_uc010vky.1_5'UTR|NFATC3_uc010vkz.1_5'UTR|NFATC3_uc010vla.1_5'UTR|NFATC3_uc010vlb.1_5'UTR|NFATC3_uc010vlc.1_5'UTR	NM_173165	NP_775188	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells,	389					inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		AGATTCATGTGGTGATCAGTT	0.468													6	93	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2202732	2202732	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2202732C>A	uc002fub.1	-	2	1370	c.1315G>T	c.(1315-1317)GGT>TGT	p.G439C	SMG6_uc002fud.1_Missense_Mutation_p.G408C	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	439	Interaction with telomeric DNA.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						CCCTTACTACCAGATCCAAAC	0.542													6	115	---	---	---	---	PASS
OR1A1	8383	broad.mit.edu	37	17	3118956	3118956	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3118956C>A	uc010vrc.1	+	1	42	c.42C>A	c.(40-42)CTC>CTA	p.L14L		NM_014565	NP_055380	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AATTCATCCTCCTGGGAGTTA	0.418													5	34	---	---	---	---	PASS
DLG4	1742	broad.mit.edu	37	17	7094078	7094078	+	Silent	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7094078G>A	uc002get.3	-	22	3454	c.2253C>T	c.(2251-2253)ATC>ATT	p.I751I	DLG4_uc010vtm.1_RNA|DLG4_uc010vtn.1_Silent_p.I648I|DLG4_uc010cly.2_Silent_p.I705I|DLG4_uc010vto.1_Silent_p.I748I	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	708	Guanylate kinase-like.				axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2						AGAGGTCCTCGATGACACGCT	0.622													13	69	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7696493	7696493	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7696493C>A	uc002giu.1	+	47	7553	c.7539C>A	c.(7537-7539)GAC>GAA	p.D2513E		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2513	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCTGGTATGACCGTACGAAGC	0.532													4	39	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33690294	33690294	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33690294G>C	uc010ctp.2	-	4	975	c.533C>G	c.(532-534)CCT>CGT	p.P178R	SLFN11_uc010ctq.2_Missense_Mutation_p.P178R|SLFN11_uc002hjh.3_Missense_Mutation_p.P178R|SLFN11_uc002hjg.3_Missense_Mutation_p.P178R|SLFN11_uc010ctr.2_Missense_Mutation_p.P178R	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	178						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATCCGAGTTAGGGAGCTCTTG	0.433													7	98	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35879033	35879033	+	3'UTR	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35879033G>T	uc002hoa.2	-	22					SYNRG_uc010wde.1_3'UTR|SYNRG_uc010wdf.1_3'UTR|SYNRG_uc002hoc.2_3'UTR|SYNRG_uc002hoe.2_3'UTR|SYNRG_uc002hod.2_3'UTR|SYNRG_uc010wdg.1_3'UTR|SYNRG_uc002hob.2_3'UTR	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1						endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						ATGCTTCACAGAGGAGTTGTT	0.517													8	200	---	---	---	---	PASS
CWC25	54883	broad.mit.edu	37	17	36958422	36958422	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36958422C>A	uc002hqu.2	-	10	1354	c.1201G>T	c.(1201-1203)GAG>TAG	p.E401*	CWC25_uc010wdv.1_Nonsense_Mutation_p.E338*|PIP4K2B_uc002hqs.2_5'Flank|PIP4K2B_uc010wdt.1_5'Flank	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49	401											0						ACCCGATCCTCCAGGGAGGAA	0.438													5	47	---	---	---	---	PASS
KRT39	390792	broad.mit.edu	37	17	39122796	39122796	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39122796C>A	uc002hvo.1	-	1	349	c.313G>T	c.(313-315)GAG>TAG	p.E105*	KRT39_uc010wfm.1_5'UTR	NM_213656	NP_998821	Q6A163	K1C39_HUMAN	type I hair keratin KA35	105	Coil 1A.|Rod.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)				GCAAGGCGCTCGTTCAAGATT	0.448													5	159	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42937901	42937901	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42937901C>A	uc002ihn.2	-	17	1879	c.1618G>T	c.(1618-1620)GAG>TAG	p.E540*	EFTUD2_uc010wje.1_Nonsense_Mutation_p.E505*|EFTUD2_uc010wjf.1_Nonsense_Mutation_p.E530*	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	540						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				CGGTTCACCTCGATGTGGTAC	0.393													4	57	---	---	---	---	PASS
MYST2	11143	broad.mit.edu	37	17	47886480	47886480	+	Splice_Site	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47886480G>T	uc002ipm.2	+	6	790	c.664_splice	c.e6-1	p.V222_splice	MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Splice_Site_p.V83_splice|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Splice_Site_p.V66_splice|MYST2_uc010wme.1_Intron	NM_007067	NP_008998	O95251	MYST2_HUMAN	MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						GATGGTTGCAGGTGAGAGCAC	0.388													5	47	---	---	---	---	PASS
CA10	56934	broad.mit.edu	37	17	50008434	50008434	+	Silent	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50008434C>T	uc002itw.3	-	3	1181	c.195G>A	c.(193-195)CGG>CGA	p.R65R	CA10_uc002itv.3_Silent_p.R71R|CA10_uc002itx.3_Silent_p.R65R|CA10_uc002ity.3_Silent_p.R65R|CA10_uc002itz.2_Silent_p.R65R	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	65					brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			CTGGCGACTGCCGTTTCCCCA	0.478													7	83	---	---	---	---	PASS
TOM1L1	10040	broad.mit.edu	37	17	52993166	52993166	+	Silent	SNP	C	T	T	rs141567240		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52993166C>T	uc002iud.2	+	7	838	c.663C>T	c.(661-663)GCC>GCT	p.A221A	TOM1L1_uc002iub.2_Silent_p.A186A|TOM1L1_uc002iuc.2_Silent_p.A221A|TOM1L1_uc010dca.1_Silent_p.A221A|TOM1L1_uc010wnb.1_Silent_p.A214A|TOM1L1_uc010wnc.1_Silent_p.A144A|TOM1L1_uc010dbz.2_Silent_p.A144A|TOM1L1_uc010wnd.1_Silent_p.A109A|TOM1L1_uc010dcb.1_RNA	NM_005486	NP_005477	O75674	TM1L1_HUMAN	target of myb1-like 1	221	GAT.				intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1						TGATGTCCGCCATATTGATGG	0.433													4	31	---	---	---	---	PASS
SSTR2	6752	broad.mit.edu	37	17	71166359	71166359	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71166359A>T	uc002jje.2	+	2	1261	c.901A>T	c.(901-903)ACC>TCC	p.T301S		NM_001050	NP_001041	P30874	SSR2_HUMAN	somatostatin receptor 2	301	Helical; Name=7; (Potential).				digestion|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	PDZ domain binding|somatostatin receptor activity				0			LUSC - Lung squamous cell carcinoma(166;0.197)			GGTGGTCCTCACCTATGCTAA	0.507													26	77	---	---	---	---	PASS
MGAT5B	146664	broad.mit.edu	37	17	74878253	74878253	+	Missense_Mutation	SNP	C	A	A	rs142999318		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74878253C>A	uc002jtg.3	+	3	516	c.202C>A	c.(202-204)CGC>AGC	p.R68S	MGAT5B_uc002jth.2_Missense_Mutation_p.R68S|MGAT5B_uc002jti.2_Missense_Mutation_p.R79S			Q3V5L5	MGT5B_HUMAN	Homo sapiens GnT-IX mRNA for N-Acetylglucosaminyltransferase IX, complete cds.	68	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding	p.R68H(1)		ovary(2)|skin(1)	3						CCCCGAGTCCCGCGGCGTCCT	0.682													3	13	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75208270	75208270	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75208270G>A	uc002jto.2	+	15	2117	c.1850G>A	c.(1849-1851)GGA>GAA	p.G617E	SEC14L1_uc010dhc.2_Missense_Mutation_p.G617E|SEC14L1_uc010wth.1_Missense_Mutation_p.G617E|SEC14L1_uc002jtm.2_Missense_Mutation_p.G617E|SEC14L1_uc010wti.1_Missense_Mutation_p.G583E|SEC14L1_uc010wtj.1_Silent_p.R105R|SEC14L1_uc002jtr.2_Missense_Mutation_p.G11E	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	617	GOLD.				transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						TGCAAAGAAGGAGAAAGCGTG	0.537													39	170	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76464818	76464818	+	5'Flank	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76464818C>A	uc010dhp.1	-						DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACCTCGTCCTCCATAAACAGC	0.532													8	85	---	---	---	---	PASS
CCDC40	55036	broad.mit.edu	37	17	78039299	78039299	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78039299G>A	uc010dht.2	+	10	1483	c.1456G>A	c.(1456-1458)GAC>AAC	p.D486N	CCDC40_uc010wub.1_Intron|CCDC40_uc002jxm.3_Missense_Mutation_p.D269N	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	486					axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CACCGAGATCGACGCCATCAG	0.627													18	67	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31324284	31324284	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31324284T>C	uc010dmg.1	+	12	4527	c.4472T>C	c.(4471-4473)GTT>GCT	p.V1491A	ASXL3_uc002kxq.2_Missense_Mutation_p.V1198A	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1491					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						ACTGTCTCCGTTGAAAGCTCA	0.562											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	34	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47500812	47500812	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47500812G>T	uc002leb.2	-	10	1518	c.1230C>A	c.(1228-1230)GCC>GCA	p.A410A	MYO5B_uc002lec.1_Silent_p.A409A	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	410	Myosin head-like.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		CGAACAACTGGGCATAGATGT	0.582													6	86	---	---	---	---	PASS
ANKRD24	170961	broad.mit.edu	37	19	4217104	4217104	+	Silent	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4217104A>G	uc010dtt.1	+	18	2223	c.1947A>G	c.(1945-1947)GAA>GAG	p.E649E	ANKRD24_uc002lzs.2_Silent_p.E620E|ANKRD24_uc002lzt.2_Silent_p.E621E	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	649											0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		AAGCAGAGGAAGCAGAAATGC	0.597													5	79	---	---	---	---	PASS
SH3GL1	6455	broad.mit.edu	37	19	4366964	4366964	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4366964C>A	uc002maj.2	-	2	179	c.73G>T	c.(73-75)GAG>TAG	p.E25*	SH3GL1_uc002mak.2_Nonsense_Mutation_p.E25*|SH3GL1_uc010xig.1_Nonsense_Mutation_p.E25*	NM_003025	NP_003016	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	25	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	lipid binding|protein binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		TTGGTCCCCTCGGCCCCTCCG	0.602			T	MLL	AL								7	541	---	---	---	---	PASS
SEMA6B	10501	broad.mit.edu	37	19	4548318	4548318	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4548318G>T	uc010duc.1	-	12	1449	c.1411C>A	c.(1411-1413)CTC>ATC	p.L471I	SEMA6B_uc010dud.2_Missense_Mutation_p.L471I|SEMA6B_uc010xih.1_Missense_Mutation_p.L471I	NM_032108	NP_115484	Q9H3T3	SEM6B_HUMAN	semaphorin 6B precursor	471	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGACACTGAGCCCAGACGTC	0.632													5	84	---	---	---	---	PASS
SAFB	6294	broad.mit.edu	37	19	5641789	5641789	+	Silent	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5641789C>T	uc002mcf.2	+	4	431	c.378C>T	c.(376-378)ATC>ATT	p.I126I	SAFB_uc010xiq.1_Silent_p.I126I|SAFB_uc002mcg.2_Silent_p.I126I|SAFB_uc002mce.3_Silent_p.I126I|SAFB_uc010xir.1_Silent_p.I126I|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B	126					chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		TGCAGGACATCGACATCATGG	0.498													13	107	---	---	---	---	PASS
ZNF358	140467	broad.mit.edu	37	19	7584121	7584121	+	5'UTR	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7584121C>A	uc002mgn.2	+	2						NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358						embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GGCACATCCACGCCTGAAATG	0.602													7	87	---	---	---	---	PASS
ZNF358	140467	broad.mit.edu	37	19	7584123	7584123	+	5'UTR	SNP	C	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7584123C>G	uc002mgn.2	+	2						NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358						embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						CACATCCACGCCTGAAATGCG	0.597													8	89	---	---	---	---	PASS
MCOLN1	57192	broad.mit.edu	37	19	7595392	7595392	+	Intron	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7595392G>T	uc002mgo.2	+						MCOLN1_uc002mgp.2_Intron	NM_020533	NP_065394	Q9GZU1	MCLN1_HUMAN	mucolipin 1						calcium ion transport|cellular iron ion homeostasis|transferrin transport	integral to plasma membrane|late endosome membrane|lysosomal membrane	cation channel activity|iron ion transmembrane transporter activity			breast(1)	1						ATCAAGGTCAGCCGCATGCAC	0.602													6	121	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9056521	9056521	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056521C>A	uc002mkp.2	-	3	31129	c.30925G>T	c.(30925-30927)GAG>TAG	p.E10309*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10311	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGGCCTGACTCTGTCCTAGAG	0.527													7	114	---	---	---	---	PASS
CDC37	11140	broad.mit.edu	37	19	10506132	10506132	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10506132C>A	uc002mof.1	-	3	582	c.466G>T	c.(466-468)GAG>TAG	p.E156*	CDC37_uc002moe.1_Nonsense_Mutation_p.E111*|CDC37_uc010dxf.1_5'UTR|CDC37_uc002mog.1_Nonsense_Mutation_p.E156*|CDC37_uc002moh.2_Nonsense_Mutation_p.E156*	NM_007065	NP_008996	Q16543	CDC37_HUMAN	cell division cycle 37 protein	156					protein targeting|regulation of cyclin-dependent protein kinase activity|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway		unfolded protein binding				0			OV - Ovarian serous cystadenocarcinoma(20;4.65e-10)|Epithelial(33;6.48e-07)|all cancers(31;2.31e-06)	GBM - Glioblastoma multiforme(1328;0.0318)		ATCTGTTTCTCGTATTTTTCC	0.567													9	431	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10610247	10610247	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10610247C>A	uc002moq.1	-	2	619	c.463G>T	c.(463-465)GTC>TTC	p.V155F	KEAP1_uc002mor.1_Missense_Mutation_p.V155F	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	155					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CCGTTCATGACGTGGAGGACA	0.587													25	49	---	---	---	---	PASS
SIN3B	23309	broad.mit.edu	37	19	16962230	16962230	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16962230G>C	uc002ney.1	+	6	748	c.734G>C	c.(733-735)GGA>GCA	p.G245A	SIN3B_uc002new.2_Missense_Mutation_p.G245A|SIN3B_uc002nex.2_Missense_Mutation_p.G177A|SIN3B_uc002nez.1_Missense_Mutation_p.G245A	NM_015260	NP_056075	O75182	SIN3B_HUMAN	SIN3 homolog B, transcription regulator	245					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	protein binding			ovary(2)	2						TAGTTCACAGGAAACGGGCCG	0.647													12	49	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21605993	21605993	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21605993G>T	uc002npx.2	+	2	428	c.148G>T	c.(148-150)GGA>TGA	p.G50*	ZNF493_uc002npw.2_Nonsense_Mutation_p.G178*|ZNF493_uc002npy.2_Nonsense_Mutation_p.G50*	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	50					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAAACATACTGGAAAGAAACC	0.289													14	24	---	---	---	---	PASS
ZNF260	339324	broad.mit.edu	37	19	37005242	37005242	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37005242C>A	uc002oee.1	-	4	1743	c.899G>T	c.(898-900)GGA>GTA	p.G300V	ZNF260_uc002oed.1_Missense_Mutation_p.G297V|ZNF260_uc010eey.1_Missense_Mutation_p.G297V|ZNF260_uc002oef.1_Missense_Mutation_p.G297V	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	300					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					GGGTTTCTCTCCTGTATGAAT	0.353													4	26	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39002950	39002950	+	Nonsense_Mutation	SNP	C	A	A	rs148412985		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39002950C>A	uc002oit.2	+	63	9429	c.9299C>A	c.(9298-9300)TCG>TAG	p.S3100*	RYR1_uc002oiu.2_Nonsense_Mutation_p.S3100*|RYR1_uc002oiv.1_Nonsense_Mutation_p.S20*|RYR1_uc010xuf.1_Nonsense_Mutation_p.S20*	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3100	Cytoplasmic.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GAGAGTGCCTCGGAGGACATC	0.607													4	45	---	---	---	---	PASS
ZFP36	7538	broad.mit.edu	37	19	39898388	39898388	+	Silent	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39898388C>A	uc002olh.1	+	2	88	c.30C>A	c.(28-30)CTC>CTA	p.L10L	ZFP36_uc010egn.1_5'UTR	NM_003407	NP_003398	P26651	TTP_HUMAN	zinc finger protein 36, C3H type, homolog	10					positive regulation of nuclear-transcribed mRNA poly(A) tail shortening	cytosol|nucleus	AU-rich element binding|DNA binding|mRNA binding|protein binding|single-stranded RNA binding|zinc ion binding			pancreas(1)	1	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGCAGAGCCTCCTGTCGCTGA	0.667													8	159	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40421114	40421114	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40421114C>A	uc002omp.3	-	5	2815	c.2807G>T	c.(2806-2808)CGG>CTG	p.R936L		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	936	VWFD 2.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGGGTACTCCCGGCGCACGGC	0.672													3	16	---	---	---	---	PASS
PLD3	23646	broad.mit.edu	37	19	40872569	40872569	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40872569A>T	uc002onm.3	+	4	478	c.80A>T	c.(79-81)GAG>GTG	p.E27V	PLD3_uc002onj.3_Missense_Mutation_p.E27V|PLD3_uc002onk.3_Missense_Mutation_p.E27V|PLD3_uc002onl.3_Missense_Mutation_p.E27V|PLD3_uc002onn.2_Missense_Mutation_p.E27V|PLD3_uc002ono.2_Missense_Mutation_p.E27V	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	phospholipase D3	27	Cytoplasmic (Potential).				lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding			skin(2)|ovary(1)	3			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			AATGAGATTGAGGCGTGGAAG	0.647													10	42	---	---	---	---	PASS
CYP2A6	1548	broad.mit.edu	37	19	41351983	41351983	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41351983G>A	uc002opl.3	-	6	872	c.851C>T	c.(850-852)ACG>ATG	p.T284M	CYP2A6_uc010ehe.1_Missense_Mutation_p.T80M|CYP2A6_uc010ehf.1_RNA	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	284					coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	GTAGAACTCCGTGTTGGGGTT	0.562													10	51	---	---	---	---	PASS
TMEM91	641649	broad.mit.edu	37	19	41888702	41888702	+	Nonsense_Mutation	SNP	C	A	A	rs140231326	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41888702C>A	uc002oqk.3	+	3	587	c.236C>A	c.(235-237)TCG>TAG	p.S79*	CYP2F1_uc010xvw.1_Intron|TMEM91_uc002oqi.2_Nonsense_Mutation_p.S79*|TMEM91_uc010ehq.2_Nonsense_Mutation_p.S79*|TMEM91_uc002oql.2_Nonsense_Mutation_p.S79*|TMEM91_uc010ehr.2_Nonsense_Mutation_p.S79*|TMEM91_uc010ehs.2_Nonsense_Mutation_p.S79*|TMEM91_uc010eht.2_Nonsense_Mutation_p.S79*|BCKDHA_uc002oqm.3_Intron|TMEM91_uc002oqn.2_Nonsense_Mutation_p.S79*	NM_001098821	NP_001092291	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91 isoform a	79					response to biotic stimulus	integral to membrane					0						GACAGTGACTCGGACTGGGAT	0.572													9	321	---	---	---	---	PASS
B3GNT8	374907	broad.mit.edu	37	19	41932031	41932031	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41932031G>C	uc002oqs.2	-	3	1107	c.653C>G	c.(652-654)CCA>CGA	p.P218R	CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	NM_198540	NP_940942	Q7Z7M8	B3GN8_HUMAN	UDP-GlcNAc:betaGal	218	Lumenal (Potential).				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity				0						CTGGTTGAATGGGACGTCGAG	0.627													4	27	---	---	---	---	PASS
PSG2	5670	broad.mit.edu	37	19	43575959	43575959	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43575959A>T	uc002ovr.2	-	4	950	c.857T>A	c.(856-858)CTG>CAG	p.L286Q	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Missense_Mutation_p.L286Q|PSG2_uc010eiq.1_Missense_Mutation_p.L286Q|PSG2_uc002ovs.3_Missense_Mutation_p.L286Q|PSG2_uc002ovt.3_Missense_Mutation_p.L286Q	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	286	Ig-like C2-type 2.				cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				GGGGATAAACAGATTTTGTCC	0.453													19	228	---	---	---	---	PASS
ZNF225	7768	broad.mit.edu	37	19	44622462	44622462	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44622462C>A	uc002oyj.1	+	3	380	c.137C>A	c.(136-138)TCA>TAA	p.S46*	ZNF225_uc010eje.1_5'UTR|ZNF225_uc010ejf.1_Nonsense_Mutation_p.S46*	NM_013362	NP_037494	Q9UK10	ZN225_HUMAN	zinc finger protein 225	46	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)				AACCTGCTCTCAGTGGGTGAG	0.517													7	156	---	---	---	---	PASS
FBXO46	23403	broad.mit.edu	37	19	46216674	46216674	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46216674G>T	uc002pcy.2	-	2	205	c.80C>A	c.(79-81)CCG>CAG	p.P27Q	FBXO46_uc002pcz.2_Missense_Mutation_p.P27Q	NM_001080469	NP_001073938	Q6PJ61	FBX46_HUMAN	F-box protein 46	27							protein binding			ovary(1)|lung(1)|breast(1)	3		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00568)|GBM - Glioblastoma multiforme(486;0.0844)|Epithelial(262;0.201)		CGCAGAAGGCGGGCGTGGCTG	0.672													4	20	---	---	---	---	PASS
IGFL3	388555	broad.mit.edu	37	19	46627192	46627192	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46627192C>A	uc002pea.1	-	3	326	c.301G>T	c.(301-303)GGT>TGT	p.G101C		NM_207393	NP_997276	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3 precursor	101						extracellular region	protein binding				0		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		GACTTCATACCCAGAACCCTC	0.542													7	194	---	---	---	---	PASS
VSTM1	284415	broad.mit.edu	37	19	54545432	54545432	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54545432G>T	uc002qcw.3	-	6	682	c.506C>A	c.(505-507)TCC>TAC	p.S169Y	VSTM1_uc010erb.2_Intron|VSTM1_uc002qcx.3_Missense_Mutation_p.S138Y	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	169						integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CCTCTTGGTGGATTCCTCAGA	0.502													36	104	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56436016	56436016	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56436016G>T	uc010ygg.1	-	3	422	c.397C>A	c.(397-399)CAG>AAG	p.Q133K		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	133							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CCCTGGGTCTGCATATTCCCT	0.418													9	45	---	---	---	---	PASS
ZNF749	388567	broad.mit.edu	37	19	57956622	57956622	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57956622G>T	uc002qoq.2	+	3	2360	c.2106G>T	c.(2104-2106)AGG>AGT	p.R702S	ZNF547_uc002qpm.3_Intron	NM_001023561	NP_001018855	O43361	ZN749_HUMAN	zinc finger protein 749	702	C2H2-type 18.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		GTAAATGTAGGGAATTGTTTA	0.393													6	66	---	---	---	---	PASS
ZNF329	79673	broad.mit.edu	37	19	58639458	58639458	+	Silent	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58639458G>T	uc002qrn.2	-	4	1650	c.1413C>A	c.(1411-1413)ACC>ACA	p.T471T	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	471	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TCTGGTGCTTGGTCAGACAGG	0.507													9	75	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3211213	3211213	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3211213G>T	uc002wig.2	-	11	1459	c.1411C>A	c.(1411-1413)CTT>ATT	p.L471I	SLC4A11_uc010zqe.1_Missense_Mutation_p.L498I|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.L455I	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	471	Helical; (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						TAAAGCGCAAGGAAGAAACTA	0.542													6	136	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20505105	20505105	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20505105G>A	uc002wrz.2	-	30	3988	c.3845C>T	c.(3844-3846)GCA>GTA	p.A1282V	RALGAPA2_uc010gcx.2_Missense_Mutation_p.A986V|RALGAPA2_uc010zsg.1_Missense_Mutation_p.A730V|RALGAPA2_uc002wsa.1_Missense_Mutation_p.A54V	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1282					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						CTCTAGGACTGCTGTGGACAC	0.542													6	48	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57829592	57829592	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57829592A>T	uc002yan.2	+	5	4828	c.4828A>T	c.(4828-4830)AGT>TGT	p.S1610C		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1610						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					CTCTTTAGGAAGTGACGGTAG	0.498													10	56	---	---	---	---	PASS
YTHDF1	54915	broad.mit.edu	37	20	61828055	61828055	+	3'UTR	SNP	C	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61828055C>T	uc002yeh.2	-	5					YTHDF1_uc011aaq.1_3'UTR	NM_017798	NP_060268	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1											ovary(2)	2						GAAACTGGTTCGCCCTCATTG	0.443													7	81	---	---	---	---	PASS
PDGFB	5155	broad.mit.edu	37	22	39631864	39631864	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39631864C>A	uc003axf.2	-	2	1068	c.79G>T	c.(79-81)GAG>TAG	p.E27*	PDGFB_uc003axe.2_Nonsense_Mutation_p.E12*	NM_002608	NP_002599	P01127	PDGFB_HUMAN	platelet-derived growth factor beta isoform 1	27					activation of protein kinase B activity|cellular response to mycophenolic acid|embryonic placenta development|heart development|hemopoiesis|metanephric glomerular mesangial cell development|monocyte chemotaxis|negative regulation of phosphatidylinositol biosynthetic process|negative regulation of platelet activation|negative regulation of transcription, DNA-dependent|paracrine signaling|peptidyl-serine phosphorylation|peptidyl-tyrosine phosphorylation|platelet activation|platelet degranulation|positive regulation of blood vessel endothelial cell migration|positive regulation of calcium ion import|positive regulation of cell division|positive regulation of chemotaxis|positive regulation of cyclin-dependent protein kinase activity|positive regulation of DNA biosynthetic process|positive regulation of DNA replication|positive regulation of endothelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of glomerular filtration|positive regulation of glomerular mesangial cell proliferation|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription, DNA-dependent|reactive oxygen species metabolic process|transforming growth factor beta receptor signaling pathway	basolateral plasma membrane|cell surface|endoplasmic reticulum lumen|extracellular region|Golgi membrane|platelet alpha granule lumen	collagen binding|eukaryotic cell surface binding|growth factor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity|superoxide-generating NADPH oxidase activator activity		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(1)	373	Melanoma(58;0.04)				Becaplermin(DB00102)	TAAAGCTCCTCGGGAATGGGG	0.607			T	COL1A1	DFSP								3	17	---	---	---	---	PASS
PMM1	5372	broad.mit.edu	37	22	41980049	41980049	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41980049C>A	uc003bal.2	-	5	450	c.388G>T	c.(388-390)GAG>TAG	p.E130*		NM_002676	NP_002667	Q92871	PMM1_HUMAN	phosphomannomutase 1	130					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	cytosol	metal ion binding|phosphomannomutase activity			ovary(1)	1						TTCCGGAACTCGATGAAGGTT	0.577													4	57	---	---	---	---	PASS
TTLL12	23170	broad.mit.edu	37	22	43575988	43575988	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43575988G>A	uc003bdq.2	-	4	597	c.565C>T	c.(565-567)CCG>TCG	p.P189S	TTLL12_uc003bdr.1_Missense_Mutation_p.P189S	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	189					protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				TACCACACCGGCATCTTCTCC	0.612													12	111	---	---	---	---	PASS
PARVG	64098	broad.mit.edu	37	22	44583692	44583692	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44583692G>T	uc011aqe.1	+	5	605	c.181G>T	c.(181-183)GAG>TAG	p.E61*	PARVG_uc010gzo.2_3'UTR|PARVG_uc010gzp.2_RNA|PARVG_uc003bep.2_Nonsense_Mutation_p.E61*|PARVG_uc010gzr.1_RNA|PARVG_uc011aqf.1_Nonsense_Mutation_p.E61*|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma	61	CH 1.				cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				TCTTCTCCCCGAGCACATTGT	0.502													4	41	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46652800	46652800	+	Silent	SNP	T	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46652800T>C	uc003bhh.2	-	1	6420	c.6420A>G	c.(6418-6420)GAA>GAG	p.E2140E		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	2140	Extracellular (Potential).				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TATTGGAAAATTCAGTGTTCT	0.418													10	51	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46712232	46712232	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46712232G>T	uc011aqy.1	+	7	1567	c.1355G>T	c.(1354-1356)CGA>CTA	p.R452L	GTSE1_uc011aqz.1_Missense_Mutation_p.R299L|GTSE1_uc003bhl.1_Missense_Mutation_p.R77L|GTSE1_uc003bhm.1_Missense_Mutation_p.R77L	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	433					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		ATCAGACGGCGAGATTCCTGT	0.413													6	185	---	---	---	---	PASS
PIM3	415116	broad.mit.edu	37	22	50356382	50356382	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50356382A>G	uc003bjb.2	+	5	1115	c.662A>G	c.(661-663)TAC>TGC	p.Y221C	PIM3_uc011arj.1_5'UTR	NM_001001852	NP_001001852	Q86V86	PIM3_HUMAN	serine/threonine protein kinase pim-3	221	Protein kinase.				cell cycle|negative regulation of apoptosis|regulation of mitotic cell cycle		ATP binding|protein binding|protein serine/threonine kinase activity				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)		TACCACCGCTACCACGGGCGC	0.652													7	26	---	---	---	---	PASS
IQSEC2	23096	broad.mit.edu	37	X	53279723	53279723	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53279723G>A	uc004dsd.2	-	5	2236	c.2035C>T	c.(2035-2037)CGG>TGG	p.R679W	IQSEC2_uc004dsc.2_Missense_Mutation_p.R474W	NM_001111125	NP_001104595	Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2 isoform1	669					regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3						CCCAACCTCCGACCCCCAGCC	0.433													8	8	---	---	---	---	PASS
TEX11	56159	broad.mit.edu	37	X	69898679	69898679	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69898679C>G	uc004dyl.2	-	16	1424	c.1262G>C	c.(1261-1263)TGG>TCG	p.W421S	TEX11_uc004dyk.2_Missense_Mutation_p.W96S|TEX11_uc004dym.2_Missense_Mutation_p.W406S	NM_001003811	NP_001003811	Q8IYF3	TEX11_HUMAN	testis expressed sequence 11 isoform 1	421							protein binding			ovary(3)|breast(1)|skin(1)	5	Renal(35;0.156)					AGCTTGTCTCCACAGAATGTT	0.343													4	14	---	---	---	---	PASS
TCEAL2	140597	broad.mit.edu	37	X	101381881	101381881	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101381881G>T	uc004eip.2	+	3	298	c.79G>T	c.(79-81)GAG>TAG	p.E27*		NM_080390	NP_525129	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	27					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						GCCACCGCACGAGGGAAAGCC	0.433													4	85	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153036446	153036446	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153036446G>T	uc004fii.2	+	12	2337	c.2163G>T	c.(2161-2163)TGG>TGT	p.W721C	PLXNB3_uc011mzb.1_Missense_Mutation_p.G177V|PLXNB3_uc011mzc.1_Missense_Mutation_p.W403C|PLXNB3_uc010nuk.2_Missense_Mutation_p.W744C|PLXNB3_uc011mzd.1_Missense_Mutation_p.W360C	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	721	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCACTGCTGGCTGGAGCTGC	0.652													21	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	2942562	2942564	+	IGR	DEL	GGA	-	-	rs56024559		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2942562_2942564delGGA								ACTRT2 (3097 upstream) : FLJ42875 (33619 downstream)																							tgatggtgatggaggtgatggtg	0.000													4	2	---	---	---	---	
PRDM16	63976	broad.mit.edu	37	1	3253242	3253243	+	Intron	DEL	AT	-	-	rs113197747		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3253242_3253243delAT	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		ATTCACACACAtatgtgttttt	0.030			T	EVI1	MDS|AML								4	2	---	---	---	---	
MEGF6	1953	broad.mit.edu	37	1	3421601	3421617	+	Intron	DEL	CAAGGCAACACCGGTAG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3421601_3421617delCAAGGCAACACCGGTAG	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GACAGGCCGTCAAGGCAACACCGGTAGCAAGGCAACA	0.641													8	5	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	6997211	6997219	+	Intron	DEL	TCATCACCG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6997211_6997219delTCATCACCG	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		accatcaccatcatcaccgtcatcaccac	0.000													4	4	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7017256	7017256	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7017256delT	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TGATGAGGTGTTACAGGATGC	0.552													4	2	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7167338	7167339	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs148905936	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7167338_7167339insTGTGTGTG	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		gtgtgtgtgcatgtgtgtgtgt	0.361													4	2	---	---	---	---	
TNFRSF9	3604	broad.mit.edu	37	1	7992794	7992795	+	Intron	INS	-	AC	AC	rs146456969	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7992794_7992795insAC	uc001aot.2	-							NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,						induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		cacacacacatacacacacaca	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	10904926	10904927	+	IGR	INS	-	T	T	rs144065458	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10904926_10904927insT								CASZ1 (48219 upstream) : C1orf127 (101606 downstream)																							tagcccagtacgttaagtaaac	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11052186	11052186	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11052186delA								C1orf127 (27928 upstream) : TARDBP (20493 downstream)																							gcaaagaaagaaaaggaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11925913	11925914	+	IGR	INS	-	T	T	rs71568365		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11925913_11925914insT								NPPB (6921 upstream) : KIAA2013 (54210 downstream)																							ctaacctcctcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	12736569	12736569	+	IGR	DEL	T	-	-	rs35669072		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12736569delT								AADACL4 (9473 upstream) : AADACL3 (39549 downstream)																							atcagagacattttttttttt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	12883966	12883967	+	IGR	INS	-	AAAAAC	AAAAAC	rs149161763	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12883966_12883967insAAAAAC								PRAMEF1 (27743 upstream) : PRAMEF11 (501 downstream)																							ggagacctttaaaaaacaaaaa	0.000													3	3	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16957305	16957306	+	Intron	INS	-	C	C	rs139092192	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16957305_16957306insC	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						CCCCAGACACGCCCCCACCCCC	0.663													5	3	---	---	---	---	
CROCC	9696	broad.mit.edu	37	1	17228387	17228398	+	Intron	DEL	AAAAAGGGACTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17228387_17228398delAAAAAGGGACTG	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AAGGATTTTCAAAAAGGGACTGAAGCAGAACA	0.245													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17730705	17730706	+	IGR	INS	-	TCCCTGCA	TCCCTGCA	rs148026761	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17730705_17730706insTCCCTGCA								PADI6 (2510 upstream) : RCC2 (2546 downstream)																							CCCTTCCCTCCTCCCTGCATCC	0.584													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18058483	18058484	+	IGR	INS	-	AC	AC	rs145737245	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18058483_18058484insAC								ARHGEF10L (34114 upstream) : ACTL8 (23324 downstream)																							ccctgtcACTTacacacacaca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18864025	18864025	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18864025delC								KLHDC7A (51486 upstream) : PAX7 (93475 downstream)																							CGTGCTGGCTCCCCCATCCAC	0.617													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26418057	26418057	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26418057delA								TRIM63 (23936 upstream) : PDIK1L (19599 downstream)																							tcaaaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
NUDC	10726	broad.mit.edu	37	1	27245570	27245571	+	5'Flank	INS	-	T	T	rs140537557		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27245570_27245571insT	uc001bng.1	+						NUDC_uc001bnh.1_5'Flank|NUDC_uc009vsq.1_5'Flank	NM_006600	NP_006591	Q9Y266	NUDC_HUMAN	nuclear distribution gene C homolog						cell proliferation|cytokinesis|mitotic prometaphase|multicellular organismal development	cytosol|microtubule|nucleoplasm	protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;6.1e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.87e-29)|Colorectal(126;5.74e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000281)|STAD - Stomach adenocarcinoma(196;0.000604)|KIRC - Kidney renal clear cell carcinoma(1967;0.000739)|READ - Rectum adenocarcinoma(331;0.0421)		catccagcTACttttttttttt	0.005													4	2	---	---	---	---	
GMEB1	10691	broad.mit.edu	37	1	29007247	29007248	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29007247_29007248insA	uc001bra.2	+						GMEB1_uc001bqz.2_Intron|GMEB1_uc001brb.2_Intron	NM_006582	NP_006573	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|metal ion binding|transcription coactivator activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		actccatctttaaaaaaaaaaa	0.040													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	33782169	33782170	+	Intron	INS	-	TAGGTGCC	TAGGTGCC	rs141453070	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33782169_33782170insTAGGTGCC	uc001bxd.1	-							NM_001080438	NP_001073907			RecName: Full=Alpha 1,3-galactosyltransferase 2;          Short=A3galt2;          EC=2.4.1.87; AltName: Full=Isoglobotriaosylceramide synthase; AltName: Full=iGb3 synthase;          Short=iGb3S; Flags: Precursor;																		GGAAGATGAGTTAGGTGCCAGC	0.599													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35115942	35115943	+	IGR	DEL	AA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35115942_35115943delAA								C1orf94 (431213 upstream) : MIR552 (19257 downstream)																							aaagaaagagaaagagagaaaa	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	35234550	35234551	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35234550_35234551insA								GJB4 (5225 upstream) : GJB3 (12239 downstream)																							ggcagaatcagaaaaaaaaaaa	0.000													2	4	---	---	---	---	
KIAA0319L	79932	broad.mit.edu	37	1	35899684	35899684	+	3'UTR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35899684delC	uc001byx.2	-	21					KIAA0319L_uc001byw.2_3'UTR	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GATATCAtttctttttttttt	0.299													5	3	---	---	---	---	
MTF1	4520	broad.mit.edu	37	1	38308747	38308747	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38308747delG	uc001cce.1	-						MTF1_uc009vvj.1_Intron	NM_005955	NP_005946	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			ovary(1)|pancreas(1)	2	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				agagtgcagtggtgtattcac	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39237013	39237014	+	IGR	INS	-	A	A	rs79921531		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39237013_39237014insA								POU3F1 (724563 upstream) : RRAGC (68001 downstream)																							aaagtataattaaaaaaaaaaG	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41066749	41066749	+	IGR	DEL	T	-	-	rs34865869		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41066749delT								ZNF684 (52910 upstream) : RIMS3 (19603 downstream)																							CCATCCCttcttttttttttt	0.119													4	2	---	---	---	---	
RIMKLA	284716	broad.mit.edu	37	1	42851389	42851396	+	Intron	DEL	TCTTTCTT	-	-	rs35500484		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42851389_42851396delTCTTTCTT	uc001chi.2	+							NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						tctttccttctctttctttctttctttc	0.178													4	2	---	---	---	---	
EBNA1BP2	10969	broad.mit.edu	37	1	43705436	43705436	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43705436delA	uc001cio.2	-							NM_006824	NP_006815	Q99848	EBP2_HUMAN	EBNA1 binding protein 2 isoform 2						ribosome biogenesis	membrane fraction|nucleolus	protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGAAGGGAGAAATGGAGAGA	0.448													4	2	---	---	---	---	
RNF220	55182	broad.mit.edu	37	1	44985757	44985758	+	Intron	INS	-	TGTGTG	TGTGTG	rs60905455		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44985757_44985758insTGTGTG	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						AAGTCCAGCATtgtgtgtgtgt	0.173													3	3	---	---	---	---	
TSPAN1	10103	broad.mit.edu	37	1	46645637	46645638	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46645637_46645638delGT	uc001cpd.2	+						TSPAN1_uc009vyd.1_5'Flank	NM_005727	NP_005718	O60635	TSN1_HUMAN	tetraspan 1							integral to membrane|lysosomal membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)	Medulloblastoma(700;0.00498)|all_neural(321;0.0212)				gaaagagggagtgtgtgtgtgt	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47311919	47311919	+	IGR	DEL	G	-	-	rs67634403		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47311919delG								CYP4B1 (26899 upstream) : CYP4Z2P (11987 downstream)																							tcatctctctgggggcttgtc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	47390200	47390200	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47390200delT								CYP4Z2P (24053 upstream) : CYP4A11 (4648 downstream)																							atttttggcatttttgcactg	0.000													4	2	---	---	---	---	
DMRTA2	63950	broad.mit.edu	37	1	50885623	50885623	+	Intron	DEL	C	-	-	rs5774087		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50885623delC	uc010ona.1	-						DMRTA2_uc010onb.1_Intron	NM_032110	NP_115486	Q96SC8	DMTA2_HUMAN	DMRT-like family A2						sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						CTCCTCAGAACCCCAACTACC	0.577													3	8	---	---	---	---	
FAF1	11124	broad.mit.edu	37	1	51189978	51189979	+	Intron	INS	-	AT	AT	rs141893686	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51189978_51189979insAT	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity	p.0?(1)		ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		tacacacacacacacacacaca	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	55416472	55416473	+	IGR	INS	-	T	T	rs149277180	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55416472_55416473insT								DHCR24 (63551 upstream) : TMEM61 (29992 downstream)																							AATGTCCTCCATTACCGCAACT	0.356											OREG0013503	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56905636	56905637	+	IGR	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56905636_56905637insG								None (None upstream) : PPAP2B (54796 downstream)																							GTTGGTGTTGTGGGTTTTTTTT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	57085220	57085221	+	IGR	INS	-	TAGGTCT	TAGGTCT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57085220_57085221insTAGGTCT								PPAP2B (39963 upstream) : PRKAA2 (25769 downstream)																							TCAGGTAGCTGTAGAAATGGCA	0.322													9	4	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76792961	76792962	+	Intron	DEL	GT	-	-	rs28627540		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76792961_76792962delGT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						gtatatatgcgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80449805	80449805	+	IGR	DEL	T	-	-	rs11342802		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80449805delT								ELTD1 (977310 upstream) : None (None downstream)																							TCACTCATCATTTTTTTtttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80481697	80481697	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80481697delT								None (None upstream) : None (None downstream)																							acatctctgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	89011022	89011023	+	Intron	INS	-	A	A	rs5775995		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89011022_89011023insA	uc001dml.1	-											Homo sapiens cDNA FLJ41840 fis, clone NT2RI3002303.																		ccatctcaaagaaaaaaaaaaa	0.163													4	2	---	---	---	---	
GTF2B	2959	broad.mit.edu	37	1	89322488	89322488	+	Intron	DEL	T	-	-	rs11343493		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89322488delT	uc001dmo.3	-							NM_001514	NP_001505	Q00403	TF2B_HUMAN	general transcription factor IIB						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	thyroid hormone receptor binding|translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		TAAACGTGGGttttttttttt	0.164													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90537410	90537410	+	IGR	DEL	A	-	-	rs66639887		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90537410delA								ZNF326 (43316 upstream) : BARHL2 (640170 downstream)																							aactttggacaaaaaaaacaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	90616184	90616185	+	IGR	INS	-	T	T	rs147432484	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90616184_90616185insT								ZNF326 (122090 upstream) : BARHL2 (561395 downstream)																							ccaatgtgtagtttttttatcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	96160932	96160933	+	IGR	INS	-	GT	GT	rs138218646	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96160932_96160933insGT								RWDD3 (448159 upstream) : None (None downstream)																							CCTACTGAAAAgtgtgtgtgtg	0.337													0	7	---	---	---	---	
WDR47	22911	broad.mit.edu	37	1	109578122	109578122	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109578122delT	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc001dwk.2_Intron	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		AATTTTTAAAttttttttttt	0.124													4	2	---	---	---	---	
PROK1	84432	broad.mit.edu	37	1	110998563	110998564	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110998563_110998564delGT	uc001dzs.2	+							NM_032414	NP_115790	P58294	PROK1_HUMAN	prokineticin 1 precursor						angiogenesis|positive regulation of cell division	extracellular region	growth factor activity				0		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		Atgtgtgtgcgtgtgtgtgtgt	0.059													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	112689581	112689584	+	IGR	DEL	TCCT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112689581_112689584delTCCT								KCND3 (157804 upstream) : CTTNBP2NL (249216 downstream)																							cttctttccctccttccttccttc	0.196													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142585978	142585979	+	IGR	DEL	AT	-	-	rs113516449		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142585978_142585979delAT								None (None upstream) : None (None downstream)																							AGTTAAAAACATAAAATCCAGT	0.396													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142621888	142621889	+	Intron	INS	-	TCGA	TCGA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142621888_142621889insTCGA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		AACtgtcgtacctgagtgagag	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142632962	142632963	+	Intron	INS	-	T	T	rs143018251		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142632962_142632963insT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		atctatTAttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143125254	143125255	+	Intron	INS	-	A	A	rs138864124		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143125254_143125255insA	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		ctccatctcagaaaaaaaaaat	0.000													3	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144852877	144852877	+	Intron	DEL	T	-	-	rs71909310		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852877delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAACAGCCTGTTTGTAGGAAG	0.443			T	PDGFRB	MPD								2	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145034729	145034730	+	Intron	INS	-	T	T	rs60343280		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145034729_145034730insT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		aaaaaaaaaaagtttgtggtga	0.114			T	PDGFRB	MPD								4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145113167	145113170	+	Intron	DEL	TGTA	-	-	rs148357806		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145113167_145113170delTGTA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GGACCTGTTCTGTATGTAAGACCT	0.392													4	2	---	---	---	---	
SEC22B	9554	broad.mit.edu	37	1	145116299	145116300	+	3'UTR	INS	-	TT	TT	rs71696722		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116299_145116300insTT	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						TTGGGAAGGTGttttttttttt	0.317													4	2	---	---	---	---	
BCL9	607	broad.mit.edu	37	1	147016192	147016192	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147016192delC	uc001epq.2	+							NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9						Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					CACCATCCTTCACTCTCTCTC	0.473			T	IGH@|IGL@	B-ALL								4	2	---	---	---	---	
LOC645166	645166	broad.mit.edu	37	1	148948880	148948881	+	Intron	INS	-	A	A	rs144249846		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148948880_148948881insA	uc010pbc.1	+						LOC645166_uc010pbd.1_Intron|LOC645166_uc009wkw.1_Intron	NR_027355				Homo sapiens cDNA, FLJ18771.												0						caagactatctaaaaaaaaaaa	0.124													5	4	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150432871	150432873	+	Intron	DEL	GTT	-	-	rs72401668		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150432871_150432873delGTT	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						TTTTGGGGGGgttgttgttgttg	0.158													7	4	---	---	---	---	
GABPB2	126626	broad.mit.edu	37	1	151058722	151058722	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151058722delA	uc001ewr.2	+						GABPB2_uc010pcp.1_Intron|GABPB2_uc001ews.2_Intron	NM_144618	NP_653219	Q8TAK5	GABP2_HUMAN	GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		accctgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
TNFAIP8L2	79626	broad.mit.edu	37	1	151126955	151126955	+	5'Flank	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151126955delA	uc001ewx.2	+							NM_024575	NP_078851	Q6P589	TP8L2_HUMAN	tumor necrosis factor, alpha-induced protein						innate immune response						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			agactctgtcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154686656	154686658	+	Intron	DEL	GTG	-	-	rs138099065		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154686656_154686658delGTG	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			tgtgtggtgtgtggtgtgtgtgt	0.000													5	3	---	---	---	---	
GON4L	54856	broad.mit.edu	37	1	155785777	155785777	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155785777delA	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_5'UTR|GON4L_uc001fme.2_Intron|GON4L_uc001fmf.2_Intron	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGCAGGGCAGAAAAAAAAAAA	0.348													6	4	---	---	---	---	
NOS1AP	9722	broad.mit.edu	37	1	162190809	162190809	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162190809delG	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			ttggctcactgcaacctccac	0.030													4	2	---	---	---	---	
ABL2	27	broad.mit.edu	37	1	179099862	179099863	+	Intron	DEL	TG	-	-	rs35792934		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179099862_179099863delTG	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron|ABL2_uc001gmg.3_Intron|ABL2_uc001gmi.3_Intron|ABL2_uc001gmh.3_Intron|ABL2_uc010pne.1_Intron|ABL2_uc009wxf.1_Intron|ABL2_uc001gmk.2_Intron	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TTATTGATTTtgtgtgtgtgtg	0.252			T	ETV6	AML								5	3	---	---	---	---	
RGSL1	353299	broad.mit.edu	37	1	182429296	182429297	+	Intron	DEL	TG	-	-	rs10572829		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182429296_182429297delTG	uc009wxw.2	+						RGSL1_uc010pnu.1_Intron	NM_001137669	NP_001131141	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1							integral to membrane	signal transducer activity			central_nervous_system(1)	1						tgcgtgtgtctgtgtgtgtgtg	0.238													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	184604377	184604377	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184604377delA								C1orf21 (6222 upstream) : EDEM3 (55250 downstream)																							TCTGACCAACAACCTCTCACT	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	198430869	198430870	+	IGR	INS	-	A	A	rs138179699	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198430869_198430870insA								NEK7 (139323 upstream) : ATP6V1G3 (61486 downstream)																							cacacaaacacaaaaaaCAAAC	0.114													2	4	---	---	---	---	
TMEM9	252839	broad.mit.edu	37	1	201104513	201104513	+	3'UTR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201104513delG	uc001gvw.2	-	6					TMEM9_uc001gvx.2_3'UTR|TMEM9_uc001gvy.2_3'UTR|TMEM9_uc010ppo.1_3'UTR|TMEM9_uc001gvz.2_3'UTR|TMEM9_uc001gwa.2_3'UTR	NM_016456	NP_057540	Q9P0T7	TMEM9_HUMAN	transmembrane protein 9 precursor						transport	integral to membrane|late endosome membrane|lysosomal membrane					0		Breast(1374;0.000301)				CCACTCCTGAGGCCGCCTCGA	0.547													4	2	---	---	---	---	
PIK3C2B	5287	broad.mit.edu	37	1	204448441	204448442	+	Intron	INS	-	CTCT	CTCT	rs145442411	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204448441_204448442insCTCT	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron|PIK3C2B_uc001hax.1_Intron|PIK3C2B_uc009xbd.1_Intron	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CCCCAGGTTCCAAGGGCATGGT	0.559													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	210457831	210457834	+	IGR	DEL	AATA	-	-	rs60229422		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210457831_210457834delAATA								SERTAD4 (41393 upstream) : HHAT (43772 downstream)																							ggaaggaaggaataaaggaaggaa	0.098													5	3	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	210881579	210881580	+	Intron	INS	-	AA	AA	rs151037321	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210881579_210881580insAA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ATTGTTGGTTCAGACTTTCTCT	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	211708480	211708487	+	IGR	DEL	CTTCCTTT	-	-	rs12725452	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211708480_211708487delCTTCCTTT								RD3 (42221 upstream) : SLC30A1 (39894 downstream)																							tccttccttccttcctttctttctttct	0.139													6	3	---	---	---	---	
PROX1	5629	broad.mit.edu	37	1	214179287	214179288	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214179287_214179288delGT	uc001hkh.2	+							NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1						aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		gtgtgtatgcgtgtgtgtgtgt	0.282													4	2	---	---	---	---	
SLC30A10	55532	broad.mit.edu	37	1	219916891	219916891	+	Intron	DEL	G	-	-	rs111279932	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219916891delG	uc001hlu.1	-									Q6XR72	ZNT10_HUMAN	Synthetic construct DNA, clone: pF1KB7405, Homo sapiens SLC30A10 gene for solute carrier family 30, member 10, without stop codon, in Flexi system.						zinc ion transport	integral to membrane|plasma membrane	cation transmembrane transporter activity				0				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		aaaaaaagaagaagaagaaga	0.030													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225978394	225978395	+	IGR	INS	-	T	T	rs71646743		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225978394_225978395insT								SRP9 (229 upstream) : EPHX1 (19402 downstream)																							TTGGCTTTTTGTTTTTTTTTCC	0.347													2	4	---	---	---	---	
CDC42BPA	8476	broad.mit.edu	37	1	227498375	227498376	+	Intron	INS	-	T	T	rs34491074		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227498375_227498376insT	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TTGGAAAGGAGttttttttttt	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	228388614	228388614	+	IGR	DEL	G	-	-	rs5781505		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228388614delG								C1orf69 (18657 upstream) : OBSCN (7247 downstream)																							agccaggtgtgggtagcatgc	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229229620	229229620	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229229620delC								RHOU (347211 upstream) : RAB4A (177259 downstream)																							acggacagaacagactcctaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230531256	230531257	+	IGR	DEL	CT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230531256_230531257delCT								PGBD5 (17889 upstream) : COG2 (246945 downstream)																							cttcccatccctgagcttctct	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230879192	230879193	+	IGR	INS	-	CTC	CTC	rs143383576	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230879192_230879193insCTC								AGT (28856 upstream) : CAPN9 (3937 downstream)																							TGACAGTACTTCTAGAAGAATC	0.559													6	3	---	---	---	---	
DISC1	27185	broad.mit.edu	37	1	231868988	231868990	+	Intron	DEL	GTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231868988_231868990delGTG	uc001huz.2	+						TSNAX-DISC1_uc010pwf.1_Intron|TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwo.1_Intron|DISC1_uc010pwp.1_Intron|DISC1_uc010pwq.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				gtaggtaggagtggtggtgatgg	0.089													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232763890	232763892	+	IGR	DEL	CTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232763890_232763892delCTG								SIPA1L2 (112647 upstream) : KIAA1383 (176746 downstream)																							AACTGGGAGCctgctgctgctgc	0.340													3	3	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233162865	233162866	+	Intron	INS	-	AAG	AAG	rs142962934	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233162865_233162866insAAG	uc001hvl.2	-						PCNXL2_uc001hvk.1_Intron|PCNXL2_uc001hvm.1_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				gaaagaaaaccaagtcccaaaa	0.000													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237905571	237905571	+	Intron	DEL	T	-	-	rs71656371		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237905571delT	uc001hyl.1	+						RYR2_uc010pya.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCCTGTCTCCttttttttttt	0.308													4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239834635	239834636	+	Intron	DEL	GG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239834635_239834636delGG	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	ccaacaccttgggagaccgtac	0.000													4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	240062576	240062577	+	Intron	INS	-	GT	GT	rs144462179	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240062576_240062577insGT	uc001hyp.2	+							NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	TTTTGAACTCAgtgtgtgtgtg	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240809648	240809648	+	IGR	DEL	A	-	-	rs34982345		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240809648delA								GREM2 (34186 upstream) : RGS7 (121907 downstream)																							gtcccatctcaaaaaaaaaaa	0.045													2	4	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241493220	241493221	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241493220_241493221insT	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			Atttttctttgttttttttttg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242172784	242172785	+	IGR	INS	-	T	T	rs67586998		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242172784_242172785insT								MAP1LC3C (10399 upstream) : PLD5 (79487 downstream)																							ggaaaatgctcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242711801	242711802	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242711801_242711802insA								PLD5 (23803 upstream) : CEP170 (575929 downstream)																							agactgtcttgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242783649	242783649	+	IGR	DEL	T	-	-	rs77061341		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242783649delT								PLD5 (95651 upstream) : CEP170 (504082 downstream)																							acctggcctgttttttttttt	0.000													3	3	---	---	---	---	
AKT3	10000	broad.mit.edu	37	1	243691229	243691240	+	Intron	DEL	ACACACACACAG	-	-	rs34254681	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243691229_243691240delACACACACACAG	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456	Q9Y243	AKT3_HUMAN	AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			acacacacacacacacacacagagagagagag	0.132													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	245901699	245901699	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245901699delA								KIF26B (35271 upstream) : SMYD3 (10946 downstream)																							AATTGaagtcaaaaaaactct	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1556096	1556096	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1556096delT								TPO (9598 upstream) : PXDN (79564 downstream)																							gttatagcgatttgacttgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	3993524	3993524	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3993524delG								ALLC (243266 upstream) : None (None downstream)																							TAGGTTTGAAGGAAAGGCAGA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	5471720	5471723	+	IGR	DEL	TTTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5471720_5471723delTTTG								None (None upstream) : SOX11 (361076 downstream)																							aggttttgtttttgtttgtttgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8787864	8787865	+	IGR	INS	-	AG	AG	rs141570112	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8787864_8787865insAG								LOC339788 (670887 upstream) : ID2 (31475 downstream)																							gggtagaggacagaggatggaa	0.000													4	3	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10724063	10724063	+	Intron	DEL	A	-	-	rs76147673		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10724063delA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		AAGTATTTACAACACTAGGGG	0.423													4	4	---	---	---	---	
ATP6V1C2	245973	broad.mit.edu	37	2	10916344	10916344	+	Intron	DEL	G	-	-	rs67464144		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10916344delG	uc002ras.2	+						ATP6V1C2_uc002rat.2_Intron	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN	vacuolar H+ ATPase C2 isoform a						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		AGTTTATATAGGGGGTTTTTC	0.413													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11645976	11645976	+	IGR	DEL	A	-	-	rs148976924	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11645976delA								E2F6 (39679 upstream) : GREB1 (28266 downstream)																							ctgttttgggaaaaaaaaaaG	0.144													6	3	---	---	---	---	
LPIN1	23175	broad.mit.edu	37	2	11843700	11843700	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11843700delC	uc010yjm.1	+							NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1						fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		CATTATTTTGCCATAAACATA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	15950666	15950667	+	IGR	DEL	AA	-	-	rs68187138		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15950666_15950667delAA								DDX1 (179442 upstream) : MYCNOS (129353 downstream)																							TCTGCTCCACAAACACCAGTCC	0.470													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21348148	21348148	+	IGR	DEL	G	-	-	rs34326968		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21348148delG								APOB (81203 upstream) : None (None downstream)																							TCTAGCGTCTGTGTGTGAGAG	0.438													4	2	---	---	---	---	
KIF3C	3797	broad.mit.edu	37	2	26152486	26152486	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26152486delT	uc002rgu.2	-						KIF3C_uc010eyj.1_Intron|KIF3C_uc010ykr.1_Intron	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATAGGCTCttttttttttt	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	27943045	27943046	+	IGR	DEL	GT	-	-	rs10563173		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27943045_27943046delGT								SLC4A1AP (25199 upstream) : MRPL33 (51538 downstream)																							TGGTCTGTAGgtgtgtgtgtgt	0.416													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39711064	39711064	+	Intron	DEL	T	-	-	rs79469367		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39711064delT	uc002rrq.2	+						uc002rrr.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																		TGGAACCAGATTTTTTTTTTT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39824359	39824359	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39824359delA	uc002rrq.2	+						uc002rrr.1_Intron|uc002rrs.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																		CAGATAAAATAAAGCTTCAGG	0.284													4	2	---	---	---	---	
COX7A2L	9167	broad.mit.edu	37	2	42586988	42586988	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42586988delA	uc002rsk.2	-						COX7A2L_uc002rsl.2_Intron	NM_004718	NP_004709	O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2						respiratory electron transport chain	mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0						CTAACCCCCGAAAAAAAAAAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45120936	45120936	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45120936delT								C2orf34 (121207 upstream) : SIX3 (48101 downstream)																							CTTAAGAAAATTTTAGGCTCG	0.413													4	2	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45645825	45645826	+	Intron	INS	-	C	C	rs147083036		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45645825_45645826insC	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			Taaaaaaaaaaacaaaaaaaaa	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59402220	59402225	+	IGR	DEL	CCGCTG	-	-	rs11278170		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59402220_59402225delCCGCTG								FANCL (933705 upstream) : None (None downstream)																							gcagctgatcccgctgccgctgctcc	0.107													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59996494	59996495	+	IGR	DEL	AC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59996494_59996495delAC								None (None upstream) : BCL11A (681808 downstream)																							AATATGCAATacacacacacac	0.272													4	2	---	---	---	---	
COMMD1	150684	broad.mit.edu	37	2	62359032	62359032	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62359032delT	uc002sbp.2	+						uc002sbr.2_Intron	NM_152516	NP_689729	Q8N668	COMD1_HUMAN	MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			cacacacacattttttttttt	0.030													4	2	---	---	---	---	
B3GNT2	10678	broad.mit.edu	37	2	62444629	62444629	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62444629delT	uc002sbs.2	+							NM_006577	NP_006568	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal							Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			TGTTTCACTATTACATGTAGG	0.363													4	2	---	---	---	---	
SERTAD2	9792	broad.mit.edu	37	2	64861512	64861512	+	3'UTR	DEL	G	-	-	rs3832127		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64861512delG	uc002sde.1	-	2						NM_014755	NP_055570	Q14140	SRTD2_HUMAN	SERTA domain containing 2						negative regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleus					0						ATAAGGTGATGGGGGGGGGAA	0.443													3	3	---	---	---	---	
TIA1	7072	broad.mit.edu	37	2	70462674	70462675	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70462674_70462675delGT	uc002sgj.3	-						TIA1_uc002sgk.3_Intron|TIA1_uc002sgl.3_Intron|TIA1_uc002sgm.3_Intron|TIA1_uc010yqt.1_Intron	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						AGATGAATGAgtgtgtgtgtgt	0.163													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71283965	71283966	+	IGR	INS	-	TT	TT	rs57204226		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71283965_71283966insTT								OR7E91P (26907 upstream) : NAGK (11442 downstream)																							AGGTAAGTGGATTTTTTTTTTT	0.129													4	2	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71708859	71708862	+	Intron	DEL	TGCT	-	-	rs72038137		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71708859_71708862delTGCT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						catccatccatgcttccatccatc	0.152													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	79406480	79406481	+	IGR	INS	-	T	T	rs142605070	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79406480_79406481insT								REG3A (19601 upstream) : CTNNA2 (5876 downstream)																							tagtttcagcatttttttttct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91665165	91665166	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91665165_91665166insA								None (None upstream) : LOC654342 (140026 downstream)																							aaaatttcactaaaaaaaaaaa	0.000													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91705139	91705140	+	IGR	INS	-	T	T	rs142679773		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91705139_91705140insT								None (None upstream) : LOC654342 (100052 downstream)																							aaacccagctattttttttttt	0.000													4	3	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91829600	91829600	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91829600delT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						GAGAGAGGTCTTTTTTTTTTT	0.443													4	2	---	---	---	---	
FAM178B	51252	broad.mit.edu	37	2	97592379	97592381	+	Intron	DEL	TCA	-	-	rs72265164		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97592379_97592381delTCA	uc002sxl.3	-						FAM178B_uc002sxk.3_Intron	NM_001122646	NP_001116118	Q8IXR5	F178B_HUMAN	hypothetical protein LOC51252 isoform A												0						CTCCCCAGTCTCATCATTGAGCA	0.537													5	3	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100758673	100758674	+	Intron	DEL	CA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100758673_100758674delCA	uc002tag.2	-							NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CACCCTCTACcacacacacaca	0.381													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103882027	103882028	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103882027_103882028insA								TMEM182 (447891 upstream) : None (None downstream)																							AGTTAGAAAGGAAAAAAAAAAT	0.391													4	2	---	---	---	---	
RGPD6	729540	broad.mit.edu	37	2	111334482	111334483	+	Intron	INS	-	CT	CT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111334482_111334483insCT	uc010yxe.1	-						uc010yxg.1_Intron	NM_001123363	NP_001116835	Q99666	RGPD5_HUMAN	RANBP2-like and GRIP domain containing 6 isoform						intracellular transport	cytoplasm	binding				0						cccccctccccccccggccggg	0.554													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	118076190	118076190	+	IGR	DEL	G	-	-	rs334853	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118076190delG								None (None upstream) : DDX18 (496065 downstream)																							ACAAAAAAAAGACTTCAGCAT	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121185053	121185053	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121185053delT								INHBB (75670 upstream) : LOC84931 (36858 downstream)																							acactgggccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121364287	121364287	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121364287delG								LOC84931 (140362 upstream) : GLI2 (128912 downstream)																							CAGGGCATGAGGGAGGGGGTG	0.597													4	3	---	---	---	---	
HS6ST1	9394	broad.mit.edu	37	2	129063690	129063691	+	Intron	INS	-	T	T	rs148141421	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129063690_129063691insT	uc002tpt.3	-							NM_004807	NP_004798	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1						heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity			pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		aacagCGCCCCTGACAGTGAGG	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132775288	132775288	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132775288delC								C2orf27B (216054 upstream) : NCRNA00164 (129876 downstream)																							ATAAAAATGGCATTTTTCTTT	0.299													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133007148	133007149	+	Intron	DEL	TG	-	-	rs144403183		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133007148_133007149delTG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						ggttcaactctgtgagatgaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134405108	134405109	+	IGR	INS	-	A	A	rs61536702		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134405108_134405109insA								NCKAP5 (79077 upstream) : MGAT5 (606721 downstream)																							gaaaggaaaggagggagggagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134765658	134765658	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134765658delG								NCKAP5 (439627 upstream) : MGAT5 (246172 downstream)																							gagggagggaggaaggaagga	0.090													2	4	---	---	---	---	
R3HDM1	23518	broad.mit.edu	37	2	136416641	136416642	+	Intron	INS	-	TA	TA	rs78826211	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136416641_136416642insTA	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		gtgtgtgtgtgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	145398577	145398577	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145398577delA								ZEB2 (120646 upstream) : None (None downstream)																							gggtgttttgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
EPC2	26122	broad.mit.edu	37	2	149532658	149532658	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149532658delA	uc010zbt.1	+							NM_015630	NP_056445	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)		actccctctcaaaaaaaaaaa	0.124													4	4	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153241893	153241894	+	Intron	INS	-	T	T	rs141049527	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153241893_153241894insT	uc002tye.2	+							NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						GCTCAGAGGCCTTTTACGTCTT	0.401													2	4	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153495574	153495574	+	Intron	DEL	T	-	-	rs11345920		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153495574delT	uc002tye.2	+						FMNL2_uc010fob.2_Intron|FMNL2_uc002tyf.2_Intron	NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						CTCCCTGTGATTTTTCACAGC	0.532													3	3	---	---	---	---	
UPP2	151531	broad.mit.edu	37	2	158974800	158974800	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158974800delA	uc002tzp.2	+						UPP2_uc002tzo.2_Intron	NM_173355	NP_775491	O95045	UPP2_HUMAN	uridine phosphorylase 2 isoform a						nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|uridine metabolic process	cytosol|type III intermediate filament	uridine phosphorylase activity				0						GTGTTCAAGTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	159691753	159691754	+	IGR	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159691753_159691754delTG								DAPL1 (19259 upstream) : TANC1 (133392 downstream)																							gtgtgtggcatgtgtgtgtgtg	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164992991	164992992	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164992991_164992992insA								FIGN (400478 upstream) : GRB14 (356341 downstream)																							AGGCTAAAAAGAAAAAAAAATA	0.450													4	2	---	---	---	---	
UBR3	130507	broad.mit.edu	37	2	170826059	170826059	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170826059delT	uc010zdi.1	+						UBR3_uc002ufr.3_Intron|UBR3_uc010fqa.2_Intron|UBR3_uc002uft.3_Intron	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						catttgtgtcttttttttttt	0.000													4	3	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171094875	171094876	+	Intron	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171094875_171094876delTC	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002uga.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						tgtctctctttctctctctctc	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	180164929	180164929	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180164929delT								SESTD1 (35579 upstream) : ZNF385B (141791 downstream)																							tccacctgccttagcctccca	0.020													4	2	---	---	---	---	
GLS	2744	broad.mit.edu	37	2	191761687	191761687	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191761687delA	uc002usf.2	+						GLS_uc002use.2_Intron	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TTGTTAGAGTAATGGTTGGTA	0.303													4	2	---	---	---	---	
STAT1	6772	broad.mit.edu	37	2	191846899	191846900	+	Intron	INS	-	A	A	rs148700873	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191846899_191846900insA	uc002usj.2	-						STAT1_uc010fse.1_Intron|STAT1_uc002usk.2_Intron|STAT1_uc002usl.2_Intron|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription						activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	AGACAATGAGGAACGGATTCAT	0.302													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196253018	196253018	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196253018delC								None (None upstream) : SLC39A10 (268514 downstream)																							ccatcacaggcccaagaggcc	0.000													4	2	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200208979	200208980	+	Intron	DEL	AC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200208979_200208980delAC	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						cacacacacaacacacacacac	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201043520	201043520	+	IGR	DEL	A	-	-	rs35608644		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201043520delA								C2orf47 (214675 upstream) : SPATS2L (127084 downstream)																							cagcattcatacctccatggc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201063233	201063233	+	IGR	DEL	A	-	-	rs113891237		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201063233delA								C2orf47 (234388 upstream) : SPATS2L (107371 downstream)																							caaaagtgccaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	203198467	203198468	+	IGR	DEL	AG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203198467_203198468delAG								NOP58 (30085 upstream) : BMPR2 (42582 downstream)																							aaagagagaaagagagagagag	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	205191838	205191838	+	IGR	DEL	T	-	-	rs139933048		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205191838delT								ICOS (365542 upstream) : PARD3B (218678 downstream)																							tttttctttcttttttttttt	0.050													4	2	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206173813	206173813	+	Intron	DEL	A	-	-	rs34345422		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206173813delA	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TGCAACTTATAAATATGGGAA	0.338													2	4	---	---	---	---	
GLB1L	79411	broad.mit.edu	37	2	220109296	220109297	+	Intron	INS	-	CCTG	CCTG	rs148530231	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220109296_220109297insCCTG	uc002vkm.2	-						GLB1L_uc010zkx.1_5'Flank|GLB1L_uc002vkn.2_Intron|STK16_uc002vko.2_5'Flank|STK16_uc002vks.2_5'Flank|STK16_uc010zky.1_5'Flank|STK16_uc010fwf.2_5'Flank|STK16_uc002vkp.2_5'Flank|STK16_uc002vkr.2_5'Flank|STK16_uc002vkq.2_5'Flank	NM_024506	NP_078782	Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like precursor						carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds				0		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCAGCTTACCCCTGCCTGCCT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	221941266	221941267	+	IGR	INS	-	CT	CT	rs148510815	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221941266_221941267insCT								None (None upstream) : EPHA4 (341482 downstream)																							TATAATAGAGACTCTGGATTTG	0.317													4	2	---	---	---	---	
EPHA4	2043	broad.mit.edu	37	2	222429296	222429297	+	Intron	INS	-	T	T	rs144228279	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222429296_222429297insT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TATTGAGGAAGTTTTTTTTTTG	0.351													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224942561	224942562	+	IGR	INS	-	AG	AG	rs150934763	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224942561_224942562insAG								SERPINE2 (38525 upstream) : FAM124B (300854 downstream)																							atataggagaaagttaattaac	0.000													2	4	---	---	---	---	
INPP5D	3635	broad.mit.edu	37	2	233939333	233939333	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233939333delT	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TTTTTTTGTGTTTTTTTTTTG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236381415	236381417	+	IGR	DEL	ACC	-	-	rs5839592		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236381415_236381417delACC								SH3BP4 (417059 upstream) : AGAP1 (21319 downstream)																							ctccccaaataccacctgacaca	0.118													4	3	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236509649	236509651	+	Intron	DEL	CTC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236509649_236509651delCTC	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						ggtaacgcctctcctcttctcac	0.039													4	3	---	---	---	---	
TRAF3IP1	26146	broad.mit.edu	37	2	239260548	239260549	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239260548_239260549delGT	uc002vye.2	+						TRAF3IP1_uc002vyf.2_Intron	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting							cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		gtgtgtatgcgtgtgtgtgtgt	0.252													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241672187	241672201	+	Intron	DEL	GGGATAAGGGATGAG	-	-	rs140059929		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241672187_241672201delGGGATAAGGGATGAG	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		gaatgagggagggataagggatgaggggataaggg	0.000													3	4	---	---	---	---	
D2HGDH	728294	broad.mit.edu	37	2	242680355	242680356	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242680355_242680356insA	uc002wce.1	+						D2HGDH_uc010zpc.1_Intron|D2HGDH_uc010fzq.1_Intron|D2HGDH_uc002wcg.1_Intron	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor						2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		agtccgtctccaaaaaaaaaaa	0.262													5	3	---	---	---	---	
ARL8B	55207	broad.mit.edu	37	3	5197528	5197529	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5197528_5197529insT	uc003bqg.2	+						ARL8B_uc011asx.1_Intron|ARL8B_uc011asy.1_Intron	NM_018184	NP_060654	Q9NVJ2	ARL8B_HUMAN	ADP-ribosylation factor-like 10C						cell cycle|cell division|chromosome segregation|small GTPase mediated signal transduction	late endosome membrane|lysosomal membrane|midbody|spindle midzone	alpha-tubulin binding|beta-tubulin binding|GDP binding|GTP binding|GTPase activity				0				OV - Ovarian serous cystadenocarcinoma(96;0.0717)|Epithelial(13;0.0777)		ttttctcagtgttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	8233338	8233340	+	IGR	DEL	CTT	-	-	rs34953849		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8233338_8233340delCTT								GRM7 (450120 upstream) : LMCD1 (310171 downstream)																							cttcttcttccttcttcttcttc	0.000													3	3	---	---	---	---	
SLC6A11	6538	broad.mit.edu	37	3	10973738	10973739	+	Intron	DEL	TT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10973738_10973739delTT	uc003bvz.2	+							NM_014229	NP_055044	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)		TCTTTGACACTTTTATTTCCCC	0.505													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14296963	14296963	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14296963delG								LSM3 (57127 upstream) : SLC6A6 (147143 downstream)																							tatgtgtattggggtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14594614	14594614	+	IGR	DEL	T	-	-	rs35902290		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14594614delT								GRIP2 (11026 upstream) : C3orf19 (98639 downstream)																							ttttctttccttttttttttt	0.264													4	2	---	---	---	---	
COLQ	8292	broad.mit.edu	37	3	15504215	15504217	+	Intron	DEL	GGA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15504215_15504217delGGA	uc003bzx.2	-						COLQ_uc003bzv.2_Intron|COLQ_uc003bzz.2_Intron|COLQ_uc010heo.2_Intron|COLQ_uc003cac.1_Intron|COLQ_uc003cae.1_Intron|COLQ_uc003cad.1_Intron	NM_005677	NP_005668	Q9Y215	COLQ_HUMAN	acetylcholinesterase collagen-like tail subunit						acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft					0						cgttaccaatggagaggccataa	0.103													4	2	---	---	---	---	
PLCL2	23228	broad.mit.edu	37	3	17076915	17076916	+	Intron	INS	-	C	C	rs144807695	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17076915_17076916insC	uc011awc.1	+						PLCL2_uc011awd.1_Intron	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4						TGACCAGTTTTCTCTCTTATCT	0.371													4	4	---	---	---	---	
LRRFIP2	9209	broad.mit.edu	37	3	37102900	37102900	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37102900delT	uc003cgp.2	-						MLH1_uc011aye.1_Intron|LRRFIP2_uc011ayf.1_Intron|LRRFIP2_uc003cgr.2_Intron|LRRFIP2_uc003cgs.3_Intron|LRRFIP2_uc003cgt.3_Intron	NM_006309	NP_006300	Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting						Wnt receptor signaling pathway		LRR domain binding			ovary(1)	1						tcttttttccttttttttttt	0.000													4	5	---	---	---	---	
SLC22A13	9390	broad.mit.edu	37	3	38305273	38305273	+	5'Flank	DEL	A	-	-	rs149825		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38305273delA	uc003chz.3	+						SLC22A13_uc011aym.1_5'Flank|SLC22A13_uc011ayn.1_5'Flank	NM_004256	NP_004247	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion							integral to plasma membrane	organic cation transmembrane transporter activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		GAAGTAAACCAAAACATCAGG	0.473													4	2	---	---	---	---	
RHOA	387	broad.mit.edu	37	3	49419006	49419006	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49419006delA	uc003cwu.2	-						RHOA_uc010hku.2_Intron	NM_001664	NP_001655	P61586	RHOA_HUMAN	ras homolog gene family, member A precursor						axon guidance|interspecies interaction between organisms|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of axonogenesis|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of neuron differentiation|positive regulation of NF-kappaB import into nucleus|positive regulation of stress fiber assembly|regulation of cell migration|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|spindle assembly involved in mitosis	cytoskeleton|cytosol|plasma membrane	GTP binding|GTPase activity|myosin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	Atorvastatin(DB01076)|Simvastatin(DB00641)	agactctgtcaaaaaaaaaaa	0.010													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51101634	51101634	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51101634delG	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCTAGGATGTGGTAGAGATAA	0.358													4	2	---	---	---	---	
ALAS1	211	broad.mit.edu	37	3	52239749	52239749	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52239749delT	uc003dcy.1	+						ALAS1_uc003dcz.1_Intron|ALAS1_uc011bec.1_Intron	NM_000688	NP_000679	P13196	HEM1_HUMAN	5-aminolevulinate synthase 1 precursor						heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	AGAGAGTTGCTACATCAACAT	0.403													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	55124835	55124835	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55124835delA								CACNA2D3 (16253 upstream) : WNT5A (374909 downstream)																							AGGTAGGAATAAATctttaag	0.289													4	2	---	---	---	---	
KCTD6	200845	broad.mit.edu	37	3	58485275	58485275	+	Intron	DEL	T	-	-	rs67910376		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58485275delT	uc003dkj.3	+						KCTD6_uc003dki.3_Intron|KCTD6_uc003dkk.3_Intron	NM_001128214	NP_001121686	Q8NC69	KCTD6_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000177)|Kidney(10;0.00229)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.148)		tctttcttccttttttttttt	0.164													4	2	---	---	---	---	
MAGI1	9223	broad.mit.edu	37	3	65922577	65922585	+	Intron	DEL	GTTGTTGTT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65922577_65922585delGTTGTTGTT	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		cagGTTCAAAGTTGTTGTTGTTGTTGTtg	0.043													4	3	---	---	---	---	
GXYLT2	727936	broad.mit.edu	37	3	73024520	73024521	+	3'UTR	INS	-	A	A	rs142458019		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73024520_73024521insA	uc003dpg.2	+	7						NM_001080393	NP_001073862	A0PJZ3	GXLT2_HUMAN	glycosyltransferase 8 domain containing 4						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						TATCTCTAAGGAAAAAAAAAAA	0.317													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75420039	75420040	+	IGR	INS	-	AAA	AAA	rs34802034		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75420039_75420040insAAA								CNTN3 (849696 upstream) : FAM86D (50665 downstream)																							AAAAGACTGAGAAAAAAAAAAA	0.411													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75590823	75590824	+	IGR	DEL	TG	-	-	rs62260253		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75590823_75590824delTG								FAM86D (106557 upstream) : MIR1324 (89090 downstream)																							tatgtatgtatgtgtgtgtgtg	0.238													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75908941	75908942	+	IGR	INS	-	A	A	rs144875585		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75908941_75908942insA								ZNF717 (74271 upstream) : None (None downstream)																							ttgaatcacccaaagacaactt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	95427235	95427238	+	IGR	DEL	AATC	-	-	rs72322171		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95427235_95427238delAATC								LOC255025 (532156 upstream) : None (None downstream)																							gactgtctcaaatcaatcaatcaa	0.044													4	2	---	---	---	---	
EPHA6	285220	broad.mit.edu	37	3	97106161	97106161	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97106161delT	uc010how.1	+							NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						tacaattcagttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	102929306	102929306	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102929306delA								ZPLD1 (730621 upstream) : None (None downstream)																							ggagtctcttaaaaaggtgac	0.000													4	2	---	---	---	---	
ZDHHC23	254887	broad.mit.edu	37	3	113677851	113677851	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113677851delC	uc003eau.2	+						ZDHHC23_uc003eav.2_Intron|ZDHHC23_uc003eaw.1_3'UTR	NM_173570	NP_775841	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC domain containing 23							integral to membrane	acyltransferase activity|zinc ion binding			ovary(2)	2						agccatgtgacccctagctga	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	118371884	118371884	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118371884delT	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																		ACCTCTTTCATTCAAGTCAGC	0.403													4	2	---	---	---	---	
PARP15	165631	broad.mit.edu	37	3	122309997	122309997	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122309997delC	uc003efm.2	+						PARP15_uc003efn.2_Intron	NM_001113523	NP_001106995	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)		AAGGCCAAATCCTTTCAAATC	0.289													4	2	---	---	---	---	
MYLK	4638	broad.mit.edu	37	3	123420085	123420085	+	Intron	DEL	A	-	-	rs67957497		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123420085delA	uc003ego.2	-						MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron|MYLK_uc003egt.2_Intron	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GGGTGTGTGCaaaaaaaaaaa	0.483													5	3	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124499557	124499557	+	Intron	DEL	C	-	-	rs111552815		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124499557delC	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		GCCTTAGTGTCCCCCCCCCCG	0.627													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126824942	126824942	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126824942delT								PLXNA1 (68714 upstream) : TPRA1 (466966 downstream)																							TGAGAAACGGTTTTGTGGGAT	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	129026480	129026480	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129026480delT								C3orf37 (2347 upstream) : H1FX (7135 downstream)																							CATACAGAACttttttttttt	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	129716929	129716932	+	IGR	DEL	CTTT	-	-	rs149253181		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129716929_129716932delCTTT								TRH (20153 upstream) : ALG1L2 (83742 downstream)																							tcctttctccctttctttcttttc	0.015													5	4	---	---	---	---	
TMEM108	66000	broad.mit.edu	37	3	132962108	132962108	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132962108delG	uc003eph.2	+						TMEM108_uc003epi.2_Intron|TMEM108_uc003epj.1_Intron|TMEM108_uc003epk.2_Intron	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4						ATAAACACATGGGGTCACATC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133997977	133997977	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133997977delC								RYK (28391 upstream) : AMOTL2 (72717 downstream)																							aatacagtctccattttatag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	135356496	135356496	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135356496delC								EPHB1 (377191 upstream) : PPP2R3A (328071 downstream)																							TAGTCTCTGGCCCAGCATTAG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	136869268	136869268	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136869268delA								IL20RB (139348 upstream) : SOX14 (614311 downstream)																							aaaaaaaaagaaaaaaagcgt	0.025													5	3	---	---	---	---	
BPESC1	60467	broad.mit.edu	37	3	138821148	138821148	+	5'Flank	DEL	C	-	-	rs3841270		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138821148delC	uc003eta.2	+							NR_026783				Homo sapiens blepharophimosis, epicanthus inversus and ptosis, candidate 1 (BPESC1) mRNA, complete cds.												0						CTGGGTAGAACCTGCAAGCAA	0.532													2	4	---	---	---	---	
MRPS22	56945	broad.mit.edu	37	3	139070005	139070006	+	Intron	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139070005_139070006insG	uc003etb.2	+						MRPS22_uc003etc.2_Intron|MRPS22_uc003etd.2_Intron|MRPS22_uc003ete.2_Intron	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22							mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3						TACAGGGGAAAGGGAAGAGAAA	0.238													8	8	---	---	---	---	
RBP2	5948	broad.mit.edu	37	3	139178676	139178677	+	Intron	DEL	GT	-	-	rs112538385		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139178676_139178677delGT	uc003eth.2	-							NM_004164	NP_004155	P50120	RET2_HUMAN	retinol binding protein 2, cellular						epidermis development|retinoid metabolic process|steroid metabolic process|vitamin A metabolic process	cytosol	retinal binding|retinol binding|transporter activity			skin(1)	1					Vitamin A(DB00162)	gtgtgtgtgagtgtgtgtgtgt	0.431													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139497726	139497726	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139497726delT								NMNAT3 (100886 upstream) : CLSTN2 (156301 downstream)																							CCCTTATTCCTTGGGGGCCTC	0.343													4	2	---	---	---	---	
TFDP2	7029	broad.mit.edu	37	3	141725631	141725632	+	Intron	INS	-	T	T	rs140410813	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141725631_141725632insT	uc003eun.3	-						TFDP2_uc010hur.2_5'Flank|TFDP2_uc003eul.3_Intron|TFDP2_uc011bnf.1_Intron|TFDP2_uc011bng.1_Intron|TFDP2_uc003eum.3_Intron|TFDP2_uc003euo.2_Intron	NM_006286	NP_006277	Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization						cell cycle	transcription factor complex	DNA binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|transcription factor binding			kidney(1)	1						ttttctttttctttttttttga	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	145005752	145005753	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145005752_145005753insA								None (None upstream) : PLOD2 (781475 downstream)																							gtgtcctacggtaatgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148204477	148204479	+	IGR	DEL	TTA	-	-	rs80230908		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148204477_148204479delTTA								None (None upstream) : AGTR1 (211179 downstream)																							cttcttcttcttatttttttcca	0.049													2	5	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	151027485	151027485	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151027485delT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|GPR87_uc003eyt.2_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCTCCAGCTGTTGTATTCTAT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154373315	154373316	+	IGR	DEL	AC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154373315_154373316delAC								GPR149 (225811 upstream) : MME (368597 downstream)																							CTGAACTAATacacacacacac	0.347													4	2	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155281423	155281423	+	Intron	DEL	A	-	-	rs62855961		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155281423delA	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			cacacatgtcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
RSRC1	51319	broad.mit.edu	37	3	157832316	157832316	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157832316delT	uc003fbt.2	+						RSRC1_uc011bou.1_Intron|RSRC1_uc003fbu.1_Intron|RSRC1_uc003fbv.2_Intron	NM_016625	NP_057709	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1						nucleocytoplasmic transport	cytoplasm|nuclear speck	protein binding				0			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			ttttttctgattctgtgaaga	0.000													4	2	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	159140749	159140750	+	Intron	INS	-	ACTC	ACTC	rs145109295	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159140749_159140750insACTC	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			attagttacataagagtagaat	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	159701545	159701546	+	Intron	INS	-	A	A	rs140898242	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159701545_159701546insA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																		caaaacaaaacaaaaAACTACC	0.173													3	4	---	---	---	---	
PRKCI	5584	broad.mit.edu	37	3	169995044	169995044	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169995044delA	uc003fgs.2	+							NM_002740	NP_002731	P41743	KPCI_HUMAN	protein kinase C, iota						anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			ttaaaaaaagaaaaaaaaaag	0.000													3	3	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173538115	173538116	+	Intron	DEL	AA	-	-	rs63318061		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173538115_173538116delAA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TTTTAAATTGAAAATAGCTATT	0.356													4	2	---	---	---	---	
MFN1	55669	broad.mit.edu	37	3	179107622	179107622	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179107622delA	uc003fjs.2	+						MFN1_uc010hxb.2_Intron|MFN1_uc003fjt.2_Intron|MFN1_uc010hxc.2_Intron	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1						mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GAGCCAGGATAAAATGCAGCC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	179353289	179353290	+	IGR	DEL	CA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179353289_179353290delCA								NDUFB5 (11002 upstream) : USP13 (17643 downstream)																							aatatataGTcacacacacaca	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181519538	181519539	+	IGR	INS	-	T	T	rs138805479	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181519538_181519539insT								SOX2OT (60535 upstream) : ATP11B (991752 downstream)																							ctattggatacggatttaatac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184392855	184392856	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184392855_184392856insT								EPHB3 (92660 upstream) : MAGEF1 (35300 downstream)																							agacactatgcttgctgaggat	0.144													4	2	---	---	---	---	
C3orf70	285382	broad.mit.edu	37	3	184800522	184800522	+	3'UTR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184800522delT	uc003fpd.2	-	2						NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382												0						CCTTCAAATCTCCCAGTGAAA	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185580148	185580148	+	IGR	DEL	T	-	-	rs112766931		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185580148delT								IGF2BP2 (37321 upstream) : TRA2B (52212 downstream)																							tttttatttattttttttttt	0.000													4	2	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185961090	185961090	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185961090delG	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TACATCATGTGGACACTGCCC	0.483											OREG0015965	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186412782	186412782	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186412782delA								HRG (16760 upstream) : KNG1 (22338 downstream)																							ATAGGTAGGGAAAAGGGGCTG	0.075													4	2	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186701928	186701931	+	Intron	DEL	TCTC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186701928_186701931delTCTC	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		ccttgactcttctctctctcacac	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186922609	186922610	+	IGR	INS	-	T	T	rs143794872		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186922609_186922610insT								RTP1 (3358 upstream) : MASP1 (13328 downstream)																							ttcttcttctattttttttttt	0.233													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193576272	193576272	+	IGR	DEL	A	-	-	rs144573042		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193576272delA								OPA1 (160673 upstream) : LOC100128023 (134612 downstream)																							tgggtctgataagagattgaa	0.000													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193822134	193822135	+	IGR	DEL	CA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193822134_193822135delCA								LOC100128023 (110107 upstream) : HES1 (31799 downstream)																							cacacacactcacacacacaca	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193845352	193845352	+	IGR	DEL	T	-	-	rs111952203		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193845352delT								LOC100128023 (133325 upstream) : HES1 (8582 downstream)																							CCCATCAGTCttttttttttt	0.229													4	2	---	---	---	---	
ACAP2	23527	broad.mit.edu	37	3	195099240	195099241	+	Intron	INS	-	A	A	rs144772833	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195099240_195099241insA	uc003fun.3	-						ACAP2_uc003fuo.2_Intron	NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						acaaaacaaacaaacaaaaaAA	0.074													5	3	---	---	---	---	
TCTEX1D2	255758	broad.mit.edu	37	3	196022055	196022056	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196022055_196022056delTG	uc003fwi.2	-							NM_152773	NP_689986	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2								protein binding			ovary(1)|breast(1)	2	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		ACCTCTTTTATGTGTGTGTGTG	0.198													3	3	---	---	---	---	
TM4SF19	116211	broad.mit.edu	37	3	196061858	196061858	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196061858delA	uc003fwl.1	-						TM4SF19_uc003fwj.2_Intron|TM4SF19_uc010iad.1_Intron|TM4SF19_uc011btv.1_Intron	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19							integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		ggtgggggttaggagaaggga	0.000													5	3	---	---	---	---	
IQCG	84223	broad.mit.edu	37	3	197677023	197677023	+	5'Flank	DEL	A	-	-	rs28365869		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197677023delA	uc003fyo.2	-						IQCG_uc003fyp.2_Intron|IQCG_uc003fyq.3_5'Flank|RPL35A_uc003fyr.2_5'Flank|RPL35A_uc003fys.2_5'Flank	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		GAGTCGAAAGATGTTTAATCC	0.517													1	7	---	---	---	---	
MAEA	10296	broad.mit.edu	37	4	1290314	1290321	+	Intron	DEL	GCCTTGTG	-	-	rs34298138		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1290314_1290321delGCCTTGTG	uc003gda.2	+						MAEA_uc010ibs.1_Intron|MAEA_uc003gdb.2_Intron|MAEA_uc011bvb.1_Intron|MAEA_uc003gdc.2_Intron|MAEA_uc003gdd.2_Intron	NM_001017405	NP_001017405	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher isoform 1						cell adhesion|cell cycle|cell division|erythrocyte maturation|negative regulation of myeloid cell apoptosis|regulation of mitotic cell cycle	actomyosin contractile ring|integral to plasma membrane|membrane fraction|nuclear matrix|spindle	actin binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0201)			TGTGCCCTTTGCCTTGTGGCTGCTCCTG	0.620													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	1622495	1622497	+	IGR	DEL	CCA	-	-	rs141559552	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1622495_1622497delCCA								CRIPAK (232713 upstream) : FAM53A (19112 downstream)																							aacatcactgccaacaacaacaa	0.000													4	2	---	---	---	---	
RNF4	6047	broad.mit.edu	37	4	2502299	2502300	+	Intron	INS	-	TT	TT	rs150990849	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2502299_2502300insTT	uc003gfb.2	+						RNF4_uc010ici.1_Intron|RNF4_uc010icj.2_Intron|RNF4_uc003gfc.2_Intron	NM_002938	NP_002929	P78317	RNF4_HUMAN	ring finger protein 4						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination|regulation of kinetochore assembly|regulation of spindle assembly|response to arsenic-containing substance	cytoplasm|PML body	androgen receptor binding|DNA binding|nucleosome binding|sequence-specific DNA binding transcription factor activity|SUMO polymer binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(65;0.241)				GTAAGCCTATAACATTAGCAGT	0.411													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3585125	3585127	+	Intron	DEL	CTC	-	-	rs144308608		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3585125_3585127delCTC	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		cagacatcttctcccagtgtgtc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3612748	3612751	+	IGR	DEL	CTAC	-	-	rs113757779		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3612748_3612751delCTAC								LRPAP1 (78524 upstream) : ADRA2C (155324 downstream)																							atccatccatctacccatccaccc	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3618780	3618781	+	IGR	INS	-	C	C	rs151334825	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3618780_3618781insC								LRPAP1 (84556 upstream) : ADRA2C (149294 downstream)																							ctccccctcttccccctccttc	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3620071	3620072	+	IGR	INS	-	A	A	rs142732704	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3620071_3620072insA								LRPAP1 (85847 upstream) : ADRA2C (148003 downstream)																							GGCATTGTTATAACTGTATTTT	0.347													3	3	---	---	---	---	
ZBTB49	166793	broad.mit.edu	37	4	4309330	4309331	+	Intron	INS	-	CCTA	CCTA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4309330_4309331insCCTA	uc003ghu.2	+						ZBTB49_uc003ghv.2_Intron|ZBTB49_uc010icy.2_Intron|ZBTB49_uc010icz.2_Intron	NM_145291	NP_660334	Q6ZSB9	ZBT49_HUMAN	zinc finger protein 509						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						cgCCAGCATTCCCTACCTTGTT	0.322													4	2	---	---	---	---	
AFAP1	60312	broad.mit.edu	37	4	7825174	7825175	+	Intron	INS	-	T	T	rs138783303	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7825174_7825175insT	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						TGTTTTGTGTGTTTTTTAAAGG	0.470													4	3	---	---	---	---	
HTRA3	94031	broad.mit.edu	37	4	8280213	8280213	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8280213delC	uc003gla.2	+						HTRA3_uc003gkz.2_Intron	NM_053044	NP_444272	P83110	HTRA3_HUMAN	HtrA serine peptidase 3 precursor						proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1						TGGAGGTTGTCAAAAACCCCC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8685218	8685218	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8685218delG								CPZ (63732 upstream) : HMX1 (183555 downstream)																							attggttaatgggtggataga	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9730069	9730076	+	IGR	DEL	AGGAAGGG	-	-	rs141577599	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9730069_9730076delAGGAAGGG								MIR548I2 (172132 upstream) : DRD5 (53182 downstream)																							gaaggaaggaaggaagggaggaaagaag	0.034													4	3	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16589221	16589221	+	Intron	DEL	G	-	-	rs33938043		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16589221delG	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc003goy.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						GCAGGAGAGTGGGGGTGCAAC	0.448													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38564763	38564763	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38564763delG								TBC1D1 (423970 upstream) : FLJ13197 (49559 downstream)																							aacaggggaaggaagggtgag	0.010													4	2	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47544511	47544511	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47544511delT	uc003gxk.1	+						ATP10D_uc003gxl.1_Intron|ATP10D_uc003gxj.3_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						GTCTAtttccttttttgagaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49218022	49218022	+	IGR	DEL	A	-	-	rs78904448		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49218022delA								CWH43 (153929 upstream) : None (None downstream)																							aattccccagaaaaaataaca	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49526561	49526561	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49526561delG								CWH43 (462468 upstream) : None (None downstream)																							GGGCGGCCCCGATCTCTCTTC	0.721													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49573452	49573452	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49573452delC								CWH43 (509359 upstream) : None (None downstream)																							acagtgaagaccagccttgta	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56037674	56037675	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56037674_56037675insA								KDR (45912 upstream) : SRD5A3 (174734 downstream)																							cctgtctcaagaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	65002153	65002153	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65002153delT								None (None upstream) : TECRL (142032 downstream)																							CGTTTAAGCCTTTTTTTTTTA	0.209													4	2	---	---	---	---	
MOBKL1A	92597	broad.mit.edu	37	4	71830647	71830648	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71830647_71830648insA	uc003hfw.2	+						MOBKL1A_uc003hfv.1_Intron|MOBKL1A_uc011cba.1_Intron	NM_173468	NP_775739	Q7L9L4	MOL1A_HUMAN	MOB1, Mps One Binder kinase activator-like 1A						hippo signaling cascade|protein autophosphorylation	cytoplasm|nucleus	kinase activator activity|kinase binding|metal ion binding				0		all_hematologic(202;0.21)	Lung(101;0.235)			aactccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	78359435	78359435	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78359435delT								CCNG2 (268225 upstream) : CXCL13 (73472 downstream)																							tttcacactcttttttttttt	0.000													4	2	---	---	---	---	
SPARCL1	8404	broad.mit.edu	37	4	88420032	88420032	+	Intron	DEL	T	-	-	rs33924095		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88420032delT	uc010ikm.2	-						SPARCL1_uc011cdc.1_Intron|SPARCL1_uc003hqs.3_Intron|SPARCL1_uc011cdd.1_Intron|SPARCL1_uc003hqt.2_Intron	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor						signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		ACCCTAAGTAttttttttttt	0.194													5	4	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	94626480	94626480	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94626480delT	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	ttcttttttcttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	141722799	141722799	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141722799delG								TBC1D9 (45328 upstream) : RNF150 (63926 downstream)																							catggcatctggccTTTTcag	0.000													4	2	---	---	---	---	
FHDC1	85462	broad.mit.edu	37	4	153889445	153889446	+	Intron	INS	-	T	T	rs75046217		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153889445_153889446insT	uc003inf.2	+							NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1						actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AGCCTGATATATTTTTTTTTTT	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165401142	165401143	+	IGR	INS	-	TG	TG	rs150497151	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165401142_165401143insTG								MARCH1 (95940 upstream) : TRIM61 (474457 downstream)																							ATGCACGTGGTtgtgtgtgtgt	0.262													4	2	---	---	---	---	
NEK1	4750	broad.mit.edu	37	4	170334799	170334799	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170334799delC	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		ACTAATACGTCCTTCAAAATC	0.129													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173466732	173466732	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173466732delC	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						CTTCCCTTATCCTTCTGGCAC	0.423													4	2	---	---	---	---	
IRF2	3660	broad.mit.edu	37	4	185366809	185366809	+	Intron	DEL	A	-	-	rs36065983		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185366809delA	uc003iwf.3	-							NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2						blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		actccatcacaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	188416181	188416184	+	IGR	DEL	TTGA	-	-	rs67622577		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188416181_188416184delTTGA								FAT1 (768331 upstream) : ZFP42 (500741 downstream)																							GCCGAATTGTTTGATTGGTTGTGA	0.436													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	189299358	189299359	+	IGR	INS	-	CACA	CACA	rs137884351	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189299358_189299359insCACA								TRIML1 (230709 upstream) : None (None downstream)																							GTGCGCGCGTGcacacacacac	0.371													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190194908	190194911	+	IGR	DEL	TTTC	-	-	rs11468068		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190194908_190194911delTTTC								None (None upstream) : FRG1 (667063 downstream)																							TCGTGAAGTATTTCTTTAAGATGT	0.324													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190563629	190563632	+	IGR	DEL	AACA	-	-	rs60870239		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190563629_190563632delAACA								None (None upstream) : FRG1 (298342 downstream)																							acacacacacaacacacacacCCC	0.235													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190572490	190572491	+	IGR	INS	-	TCCAGGCTAGA	TCCAGGCTAGA	rs6148856		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190572490_190572491insTCCAGGCTAGA								None (None upstream) : FRG1 (289483 downstream)																							TGctaggtaccagtcttggcct	0.267													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190821799	190821800	+	Intron	INS	-	T	T	rs140638219	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190821799_190821800insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		TTTTTTGTTTGTTTTTTACTTA	0.317													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	191037516	191037517	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:191037516_191037517insT								LOC653545 (27340 upstream) : None (None downstream)																							aggtaaacagattttttttatg	0.124													3	4	---	---	---	---	
CLPTM1L	81037	broad.mit.edu	37	5	1333412	1333412	+	Intron	DEL	A	-	-	rs68084960		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1333412delA	uc003jch.2	-						CLPTM1L_uc003jcg.2_Intron	NM_030782	NP_110409	Q96KA5	CLP1L_HUMAN	CLPTM1-like						apoptosis	integral to membrane				breast(1)|central_nervous_system(1)	2	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		GGATAAGGGGAGACTACTGTA	0.488													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2015965	2015967	+	IGR	DEL	AAC	-	-	rs10548202		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2015965_2015967delAAC								IRX4 (133085 upstream) : IRX2 (730314 downstream)																							GAGAAGAGTTAACAACAACAACA	0.222													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3132153	3132153	+	IGR	DEL	G	-	-	rs66756443		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3132153delG								C5orf38 (376641 upstream) : IRX1 (464015 downstream)																							CCATGGGGAAGGATCCAGCCT	0.537													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3323990	3323994	+	IGR	DEL	GTATC	-	-	rs148317105	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3323990_3323994delGTATC								C5orf38 (568478 upstream) : IRX1 (272174 downstream)																							gtgtTgtgtggtatctgtggtgtga	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4838810	4838810	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4838810delC								None (None upstream) : LOC340094 (195662 downstream)																							cacgaacccaccgggaggaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4990406	4990406	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4990406delA								None (None upstream) : LOC340094 (44066 downstream)																							ctattgtctgaaaaaggtata	0.000													4	2	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5305440	5305441	+	Intron	INS	-	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5305440_5305441insC	uc003jdl.2	+							NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						cacacacacatccacaccacac	0.000													8	4	---	---	---	---	
FLJ33360	401172	broad.mit.edu	37	5	6313914	6313915	+	Intron	INS	-	T	T	rs139779800	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6313914_6313915insT	uc003jdn.1	-							NM_001001702	NP_001001702			SubName: Full=FLJ33360 protein; SubName: Full=cDNA FLJ33360 fis, clone BRACE2005253;												0						CTCTTGGGGGCCCCACATCCTC	0.609													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6903078	6903079	+	IGR	DEL	AC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6903078_6903079delAC								PAPD7 (145917 upstream) : ADCY2 (493264 downstream)																							AAAGTcacatacacacacacac	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6916283	6916283	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6916283delT								PAPD7 (159122 upstream) : ADCY2 (480060 downstream)																							AGGGAATGGCTTGGACATGAA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8615655	8615656	+	IGR	DEL	AT	-	-	rs71609200		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8615655_8615656delAT								MTRR (714422 upstream) : SEMA5A (419482 downstream)																							acacacacacatacacatacac	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10035589	10035589	+	IGR	DEL	A	-	-	rs140429475		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10035589delA								LOC285692 (131653 upstream) : FAM173B (190849 downstream)																							CATTTATGAGAAAAAAAAAAA	0.403													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10343441	10343442	+	IGR	INS	-	A	A	rs77784857		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10343441_10343442insA								CMBL (35273 upstream) : MARCH6 (10386 downstream)																							actgcactAAGAAAAAAAAAAG	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10553215	10553215	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10553215delT								ROPN1L (88078 upstream) : DAP (126128 downstream)																							CCACACCTGCttttttttttt	0.259													4	2	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16614358	16614359	+	Intron	INS	-	A	A	rs145354465	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16614358_16614359insA	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						AAACATCATAGAAAAAAGTTTG	0.198													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28818561	28818562	+	IGR	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28818561_28818562insG								None (None upstream) : None (None downstream)																							aggaagaggaaaggaagaagga	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34433779	34433780	+	IGR	DEL	TT	-	-	rs141215775		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34433779_34433780delTT								C1QTNF3 (390462 upstream) : RAI14 (222653 downstream)																							tttttcaaggtttttagcttcc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39576729	39576730	+	IGR	DEL	AA	-	-	rs35015613		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39576729_39576730delAA								DAB2 (151394 upstream) : None (None downstream)																							ctctgtctcgaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43051783	43051783	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43051783delA								LOC153684 (6413 upstream) : ZNF131 (69202 downstream)																							gacttcacctaaaaaaaaaaa	0.000													6	3	---	---	---	---	
MGC42105	167359	broad.mit.edu	37	5	43233414	43233415	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43233414_43233415insA	uc003jno.2	+							NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1								ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						GAGTGACACTTAAAAAAAAAAA	0.371													2	4	---	---	---	---	
PPAP2A	8611	broad.mit.edu	37	5	54823677	54823678	+	Intron	INS	-	G	G	rs150439461	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54823677_54823678insG	uc003jqa.2	-						PPAP2A_uc003jpz.2_Intron|PPAP2A_uc003jqb.2_Intron	NM_003711	NP_003702	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|androgen receptor signaling pathway|germ cell migration|negative regulation of cell proliferation|phospholipid dephosphorylation|regulation of lipid metabolic process|sphingolipid metabolic process	integral to plasma membrane|membrane fraction	phosphatidate phosphatase activity|sphingosine-1-phosphate phosphatase activity			ovary(2)	2		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				aactactcacagaacagctttg	0.000													3	4	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	65934930	65934930	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65934930delG	uc003jur.3	+						MAST4_uc010iwz.2_Intron	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		aatgggtcttggcttaatcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67174158	67174159	+	IGR	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67174158_67174159delTC								CD180 (681541 upstream) : PIK3R1 (337445 downstream)																							cataattgcatctctctctctc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67702262	67702263	+	IGR	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67702262_67702263delGT								PIK3R1 (104615 upstream) : SLC30A5 (687555 downstream)																							aggtatacaggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	73551033	73551035	+	IGR	DEL	TAG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73551033_73551035delTAG								RGNEF (313620 upstream) : ENC1 (372200 downstream)																							gaatgattgatagataccagatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	74909978	74909979	+	Intron	INS	-	AG	AG			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74909978_74909979insAG	uc010izt.2	+											Homo sapiens cDNA, FLJ97102.																		acttctggatcagagttgatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77142787	77142788	+	IGR	INS	-	T	T	rs140710216	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77142787_77142788insT								TBCA (70602 upstream) : AP3B1 (155363 downstream)																							GTACGCCTGTCCGTGACTTTAT	0.550													3	3	---	---	---	---	
SEMA6A	57556	broad.mit.edu	37	5	115814626	115814627	+	Intron	DEL	GT	-	-	rs113477307		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115814626_115814627delGT	uc010jck.2	-						SEMA6A_uc003krx.3_Intron|SEMA6A_uc003krw.3_5'Flank|SEMA6A_uc010jcj.2_Intron	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GTGTGAGAGAgtgtgtgtgtgt	0.351													4	2	---	---	---	---	
SNX24	28966	broad.mit.edu	37	5	122199223	122199224	+	Intron	INS	-	T	T	rs112338350		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122199223_122199224insT	uc011cwo.1	+						SNX24_uc003ktf.2_Intron|SNX24_uc010jcy.2_Intron	NM_014035	NP_054754	Q9Y343	SNX24_HUMAN	SBBI31 protein						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)		tttcttttttcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124904106	124904107	+	IGR	INS	-	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124904106_124904107insC								ZNF608 (819606 upstream) : GRAMD3 (791681 downstream)																							tgggggaggggcgcccgccatt	0.000													4	2	---	---	---	---	
C5orf56	441108	broad.mit.edu	37	5	131798117	131798118	+	Intron	DEL	GT	-	-	rs72117426		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131798117_131798118delGT	uc010jds.1	+						C5orf56_uc003kwz.1_Intron|IRF1_uc003kxd.2_Intron			Q8N8D9	CE056_HUMAN	Homo sapiens full length insert cDNA clone ZA99C08.												0						TCTCAAAAAAgtgtgtgtgtgt	0.134													4	2	---	---	---	---	
RAD50	10111	broad.mit.edu	37	5	131964096	131964096	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131964096delA	uc003kxi.2	+						RAD50_uc003kxh.2_Intron	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1						DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			tcaagaatctaatgctatttg	0.000								Homologous_recombination					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	139133404	139133404	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139133404delT								CXXC5 (70724 upstream) : PSD2 (42002 downstream)																							CCCAGAGTTGTTTTTtttttt	0.279													4	2	---	---	---	---	
IRGM	345611	broad.mit.edu	37	5	150224583	150224584	+	5'Flank	INS	-	TGTG	TGTG	rs149634573	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150224583_150224584insTGTG	uc010jhk.2	+							NM_001145805	NP_001139277	A1A4Y4	IRGM_HUMAN	immunity-related GTPase family, M						autophagy|inflammatory response|innate immune response	autophagic vacuole membrane|cell projection|Golgi membrane|phagocytic cup|phagocytic vesicle membrane	GTP binding|hydrolase activity, acting on acid anhydrides				0						TGCAACAGGGATGTATGTATTC	0.312													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	154831112	154831112	+	IGR	DEL	A	-	-	rs112116867		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154831112delA								KIF4B (433427 upstream) : SGCD (303951 downstream)																							GAAGGAGAGGAAAAAAAATCA	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157364376	157364377	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157364376_157364377insA								CLINT1 (78208 upstream) : EBF1 (758547 downstream)																							gagtctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159418997	159418998	+	IGR	DEL	GA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159418997_159418998delGA								ADRA1B (18980 upstream) : TTC1 (17182 downstream)																							CTGATTGAAGGAGAGAGAGAGA	0.480													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	166720981	166720982	+	Intron	INS	-	TG	TG	rs144536230	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166720981_166720982insTG	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		gatgtgagttctgtgtgtgtgt	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	169766906	169766907	+	IGR	INS	-	TG	TG	rs139843262	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169766906_169766907insTG								LOC257358 (4802 upstream) : KCNIP1 (13974 downstream)																							GTATAGgtgtatgtgtgtgtgg	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172653978	172653979	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172653978_172653979insT								BNIP1 (62589 upstream) : NKX2-5 (5159 downstream)																							cCGACAAAACCttttttttttt	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174577609	174577609	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174577609delT								MSX2 (419708 upstream) : DRD1 (290067 downstream)																							tgctaagagcttttttttttt	0.139													3	3	---	---	---	---	
THOC3	84321	broad.mit.edu	37	5	175390080	175390080	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175390080delA	uc003mdg.3	-						THOC3_uc003mdh.2_Intron	NM_032361	NP_115737	Q96J01	THOC3_HUMAN	THO complex 3						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	transcription export complex	RNA binding				0	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		atgattctttaaaaaaaaaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	178836790	178836791	+	IGR	DEL	AG	-	-	rs60767796		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178836790_178836791delAG								ADAMTS2 (64461 upstream) : RUFY1 (140780 downstream)																							ctcaaaaaaaagaaaaaaaaag	0.262													4	2	---	---	---	---	
DUSP22	56940	broad.mit.edu	37	6	298881	298882	+	Intron	INS	-	GAAAGTAAG	GAAAGTAAG	rs139030879	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:298881_298882insGAAAGTAAG	uc003msx.2	+						DUSP22_uc011dhn.1_Intron	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		aagatcagtccgaaagtaagga	0.005													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	361558	361559	+	IGR	INS	-	C	C	rs72551075		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:361558_361559insC								DUSP22 (10205 upstream) : IRF4 (30193 downstream)																							CCAGCTGTGTGCGTACCCCCAC	0.520													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	369456	369459	+	IGR	DEL	AGAA	-	-	rs141252060	byFrequency	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:369456_369459delAGAA								DUSP22 (18103 upstream) : IRF4 (22293 downstream)																							TATTGTCCTTAGAAAGAAGAGGTG	0.299													5	3	---	---	---	---	
BMP6	654	broad.mit.edu	37	6	7864244	7864244	+	Intron	DEL	A	-	-	rs34268569		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7864244delA	uc003mxu.3	+							NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein						BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					gactccatcgaaaaaaaaaaa	0.234													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9307212	9307212	+	IGR	DEL	C	-	-	rs59989172		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9307212delC								HULC (653135 upstream) : None (None downstream)																							acaacaacaacaaaaaaataa	0.124													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18565947	18565948	+	Intron	INS	-	CCTT	CCTT	rs138624874	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18565947_18565948insCCTT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		cttccttcttgccttccttcct	0.000													3	4	---	---	---	---	
DCDC2	51473	broad.mit.edu	37	6	24339132	24339132	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24339132delA	uc003ndx.2	-						DCDC2_uc003ndy.2_Intron	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2						cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				tcagcctcccaaagtgctggg	0.000													4	2	---	---	---	---	
TRIM27	5987	broad.mit.edu	37	6	28884329	28884330	+	Intron	INS	-	A	A	rs141514492		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28884329_28884330insA	uc003nlr.2	-						TRIM27_uc003nls.2_Intron|TRIM27_uc003nlt.1_Intron	NM_006510	NP_006501	P14373	TRI27_HUMAN	ret finger protein						cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding			ovary(1)	1						aactctgcctcaaaaaaaaaaa	0.000			T	RET	papillary thyroid								6	3	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29949173	29949174	+	Intron	INS	-	TG	TG	rs147954486	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29949173_29949174insTG	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						CTCAGGCTGCAtgtgtgtgtgt	0.267													6	4	---	---	---	---	
PPT2	9374	broad.mit.edu	37	6	32123888	32123888	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32123888delT	uc003nzx.2	+						uc003nzv.3_5'Flank|PPT2_uc003nzw.2_Intron|PPT2_uc011dpi.1_Intron|PPT2_uc003nzy.1_Intron|PPT2_uc003nzz.2_Intron|PPT2_uc003oaa.2_Intron|PPT2_uc010jtu.1_Intron	NM_005155	NP_005146	Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2 isoform a						protein modification process	lysosome	palmitoyl-(protein) hydrolase activity				0						CTGTTCAGAAttttttttttt	0.189													4	2	---	---	---	---	
TAPBP	6892	broad.mit.edu	37	6	33280795	33280795	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33280795delG	uc003odx.1	-						TAPBP_uc010jus.1_Intron|TAPBP_uc003ody.2_Intron|TAPBP_uc003odz.2_Intron|TAPBP_uc010jut.1_Intron|TAPBP_uc011drc.1_Intron	NM_003190	NP_003181	O15533	TPSN_HUMAN	tapasin isoform 1 precursor						antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1						TTTTTTTTTTGTTTTTTTTTT	0.308													4	2	---	---	---	---	
LHFPL5	222662	broad.mit.edu	37	6	35778604	35778604	+	Intron	DEL	A	-	-	rs150300168		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35778604delA	uc003olg.1	+							NM_182548	NP_872354	Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5							integral to membrane				skin(1)	1						actccgtctcaaaaaaaaaaa	0.025													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36913164	36913165	+	IGR	DEL	AG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36913164_36913165delAG								C6orf89 (16426 upstream) : PI16 (9044 downstream)																							agacacgaacagacagtccacc	0.005													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	38130598	38130599	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38130598_38130599insT								ZFAND3 (8201 upstream) : BTBD9 (5629 downstream)																							ATGGCTTCCCATTTTTTTTCCC	0.535													4	2	---	---	---	---	
GLP1R	2740	broad.mit.edu	37	6	39053971	39053982	+	3'UTR	DEL	ACACACACACAT	-	-	rs140424730	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39053971_39053982delACACACACACAT	uc003ooj.3	+	13					GLP1R_uc003ooh.2_Intron|GLP1R_uc003ooi.2_Intron	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	acacacacacacacacacacatacaTCCTGCT	0.462													5	3	---	---	---	---	
USP49	25862	broad.mit.edu	37	6	41864119	41864119	+	5'Flank	DEL	A	-	-	rs79335888		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41864119delA	uc003ori.2	-							NM_018561	NP_061031	Q70CQ1	UBP49_HUMAN	ubiquitin thioesterase 49						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AGGTAAGCACAAAAAAAAAAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42100263	42100265	+	IGR	DEL	AAG	-	-	rs9471780	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42100263_42100265delAAG								C6orf132 (27774 upstream) : GUCA1A (22879 downstream)																							aaaaaataataagaagaagaaga	0.044													5	3	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42239997	42239997	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42239997delG	uc003osd.2	-						TRERF1_uc011duq.1_5'Flank|TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GAGCTGAGTTGGTCTGTCCCT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	47063223	47063223	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47063223delA								GPR110 (53141 upstream) : TNFRSF21 (136046 downstream)																							ttcatctcagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ICK	22858	broad.mit.edu	37	6	52924661	52924662	+	Intron	INS	-	TCAT	TCAT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52924661_52924662insTCAT	uc003pbh.2	-						ICK_uc003pbi.2_Intron|ICK_uc003pbj.2_Intron	NM_016513	NP_057597	Q9UPZ9	ICK_HUMAN	intestinal cell kinase						intracellular protein kinase cascade|multicellular organismal development	cytosol|nucleus	ATP binding|cyclin-dependent protein kinase activity|magnesium ion binding			ovary(1)|large_intestine(1)|lung(1)|kidney(1)|central_nervous_system(1)	5	Lung NSC(77;0.103)					AGGGATGCTTCTCATTCattca	0.317													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57415028	57415029	+	Intron	INS	-	T	T	rs145113134		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57415028_57415029insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GAAAATGGACCTAAGTGTGTTA	0.347													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57438823	57438823	+	Intron	DEL	G	-	-	rs145954948		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57438823delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GCAGGTTTGTGGGATATGATG	0.348													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57487051	57487052	+	Intron	INS	-	A	A	rs34396372		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57487051_57487052insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gagactccatctcaaaaaaaag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57519622	57519622	+	IGR	DEL	A	-	-	rs66662983		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57519622delA								PRIM2 (6247 upstream) : GUSBL2 (726537 downstream)																							tcTAGGGGGGAAAAAATAGAC	0.249													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76252666	76252667	+	IGR	DEL	CA	-	-	rs67852641		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76252666_76252667delCA								FILIP1 (49170 upstream) : SENP6 (58955 downstream)																							gactctgtctcacacacacaca	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76863817	76863817	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76863817delT								IMPG1 (81482 upstream) : None (None downstream)																							ggacagtttcttttaggagat	0.000													4	2	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	102212326	102212327	+	Intron	DEL	GA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102212326_102212327delGA	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	gtgtatgtgtgagagagagaga	0.030													4	2	---	---	---	---	
SOBP	55084	broad.mit.edu	37	6	107932001	107932006	+	Intron	DEL	CACACA	-	-	rs76763290		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107932001_107932006delCACACA	uc003prx.2	+							NM_018013	NP_060483	A7XYQ1	SOBP_HUMAN	sine oculis binding protein homolog								metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		TGTGcacacgcacacacacacacaca	0.345													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	133381810	133381811	+	IGR	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133381810_133381811delTG								RPS12 (243108 upstream) : LOC285735 (27408 downstream)																							tgcatgacACtgtgtgtgtgtg	0.005													4	2	---	---	---	---	
VTA1	51534	broad.mit.edu	37	6	142494957	142494957	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142494957delA	uc003qiw.2	+						VTA1_uc011edt.1_Intron|VTA1_uc011edu.1_Intron	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog						cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		TGAACATAGTAACTAGGGCAA	0.343													4	2	---	---	---	---	
TULP4	56995	broad.mit.edu	37	6	158749332	158749332	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158749332delT	uc003qrf.2	+						TULP4_uc011efo.1_Intron|TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1						intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		tattgtcatctttttttttta	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	160250307	160250307	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160250307delT								PNLDC1 (8572 upstream) : MAS1 (77667 downstream)																							ggaggaccacttgagcctggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166655247	166655247	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166655247delG								T (73116 upstream) : PRR18 (63921 downstream)																							TTACAAAACTGGCAGTGGGTT	0.517													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168792932	168792932	+	IGR	DEL	C	-	-	rs35492825		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168792932delC								DACT2 (72530 upstream) : SMOC2 (49099 downstream)																							CTGTCCCCATCCCCCAGCACA	0.637													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169098043	169098043	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169098043delT								SMOC2 (29372 upstream) : THBS2 (517833 downstream)																							GATGTCCATCttttttttttt	0.229													4	2	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	3831768	3831768	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3831768delA	uc003smx.2	+							NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		cctaaataacaaaacaaaata	0.214													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4445280	4445288	+	IGR	DEL	AAGGAGGAA	-	-	rs410609		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4445280_4445288delAAGGAGGAA								SDK1 (136651 upstream) : FOXK1 (238100 downstream)																							ggaggaggagaaggaggaagaggaaaatt	0.019													3	3	---	---	---	---	
RNF216	54476	broad.mit.edu	37	7	5808297	5808297	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5808297delT	uc003soy.1	-						RNF216_uc003sox.1_Intron	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b						apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		agcaactttgttttttttttt	0.000													4	2	---	---	---	---	
ISPD	729920	broad.mit.edu	37	7	16346050	16346050	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16346050delA	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896	A4D126	ISPD_HUMAN	notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1						CTCTTGCTGGAGAGAACAGAG	0.423										Multiple Myeloma(15;0.18)			4	2	---	---	---	---	
NFE2L3	9603	broad.mit.edu	37	7	26192226	26192228	+	In_Frame_Del	DEL	GCC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26192226_26192228delGCC	uc003sxq.2	+	1	380_382	c.108_110delGCC	c.(106-111)CTGCCG>CTG	p.P39del		NM_004289	NP_004280	Q9Y4A8	NF2L3_HUMAN	nuclear factor erythroid 2-like 3	39	Leu-rich.				transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			skin(3)|ovary(1)	4						ACCTGCTGCTGCCGCCGCCCACC	0.724													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	28882624	28882625	+	IGR	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28882624_28882625delTC								CREB5 (17115 upstream) : TRIL (110351 downstream)																							AACTCTtctgtctctctctctc	0.099													4	2	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29414510	29414510	+	Intron	DEL	T	-	-	rs10646008		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29414510delT	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						tctctctttcttttttttttt	0.005													4	4	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29496031	29496032	+	Intron	INS	-	AG	AG	rs146812117	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29496031_29496032insAG	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						ATGGTGAAGAAAGAGAGAGGGG	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	31019353	31019354	+	IGR	INS	-	AAC	AAC	rs150377412	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31019353_31019354insAAC								GHRHR (212 upstream) : ADCYAP1R1 (72788 downstream)																							tctcacaggcaaagagagcatg	0.000													6	4	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	32138494	32138496	+	Intron	DEL	GAG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32138494_32138496delGAG	uc003tco.1	-							NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			gccaggggctgaggaggaggaca	0.039													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37322243	37322243	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37322243delA	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						GAAACAGGGGAAAAAAGGCAG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	44830669	44830669	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44830669delT								ZMIZ2 (19936 upstream) : PPIA (5572 downstream)																							acccagctaatttttgtattc	0.000													4	2	---	---	---	---	
GRB10	2887	broad.mit.edu	37	7	50802162	50802163	+	5'Flank	INS	-	A	A	rs142369593	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50802162_50802163insA	uc003tpi.2	-						GRB10_uc003tpj.2_5'Flank|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					CCACACCCCCCACGCACGCCGC	0.520									Russell-Silver_syndrome				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55348609	55348609	+	IGR	DEL	A	-	-	rs34874919		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55348609delA								EGFR (73579 upstream) : LANCL2 (84532 downstream)																							aacttgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57744855	57744855	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57744855delG								ZNF716 (211590 upstream) : None (None downstream)																							gccagctgcaggggagagatg	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57774292	57774292	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57774292delA								ZNF716 (241027 upstream) : None (None downstream)																							cactatacccagctatttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61859537	61859538	+	IGR	DEL	TG	-	-	rs140811137		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61859537_61859538delTG								None (None upstream) : LOC643955 (892134 downstream)																							ggtttaactctgtgagatgaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62002105	62002105	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62002105delT								None (None upstream) : LOC643955 (749567 downstream)																							agagttgaaattttcttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64895464	64895465	+	IGR	DEL	AT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64895464_64895465delAT								ZNF92 (29467 upstream) : INTS4L2 (217312 downstream)																							cgtggctgacatgtgtgacacg	0.317													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65265442	65265443	+	IGR	DEL	AG	-	-	rs80190425		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65265442_65265443delAG								CCT6P1 (36781 upstream) : VKORC1L1 (72814 downstream)																							TGGGGCTCACAGGGGTACTTTT	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67401850	67401850	+	IGR	DEL	G	-	-	rs35209398		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67401850delG								STAG3L4 (615338 upstream) : None (None downstream)																							GTGATAATATGGGGGGGGGGG	0.214													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67995030	67995030	+	IGR	DEL	A	-	-	rs66509828		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67995030delA								None (None upstream) : None (None downstream)																							AGGGAAAAGGAAAAAAAAAAA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68198342	68198343	+	IGR	INS	-	T	T	rs144242905	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68198342_68198343insT								None (None upstream) : AUTS2 (865562 downstream)																							TTATGCTTCCCTATGCAATCAG	0.436													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68522459	68522460	+	IGR	INS	-	CACA	CACA	rs138981355	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68522459_68522460insCACA								None (None upstream) : AUTS2 (541445 downstream)																							acatatgcatgcacacacacac	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	71966523	71966526	+	IGR	DEL	AAGG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71966523_71966526delAAGG								CALN1 (54387 upstream) : TYW1B (57203 downstream)																							aaggaaaggaaaggaaggagggag	0.078													4	3	---	---	---	---	
GTF2IP1	2970	broad.mit.edu	37	7	72614315	72614316	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72614315_72614316insA	uc003txo.3	+						FKBP6_uc003twz.2_Intron|GTF2IP1_uc011keq.1_Intron	NR_003580				SubName: Full=cDNA FLJ61347, highly similar to General transcription factor II-I;												0						gactctgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75394958	75394959	+	IGR	INS	-	A	A	rs10647256		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75394958_75394959insA								HIP1 (26679 upstream) : CCL26 (3883 downstream)																							gactacatcttaaaaaaaaaaa	0.005													4	2	---	---	---	---	
POR	5447	broad.mit.edu	37	7	75592339	75592339	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75592339delT	uc003udy.2	+							NM_000941	NP_000932	P16435	NCPR_HUMAN	cytochrome P450 reductase						cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)	AAAGATCTCATTTTCCTGAGT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	88345039	88345039	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88345039delA								STEAP4 (408830 upstream) : ZNF804B (43714 downstream)																							AAGCAACATTAAAAAAAAAGG	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93001231	93001232	+	IGR	INS	-	T	T	rs145102650	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93001231_93001232insT								CCDC132 (12894 upstream) : CALCR (52567 downstream)																							tacaatggggatacagacattg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96091871	96091873	+	IGR	DEL	GAA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96091871_96091873delGAA								SLC25A13 (140412 upstream) : SHFM1 (210364 downstream)																							ggccacaccggaagaagaagaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98042093	98042093	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98042093delT								BAIAP2L1 (11666 upstream) : NPTX2 (204504 downstream)																							gcacccagccttttttttttt	0.000													4	2	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102197784	102197784	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102197784delT	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_Intron	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						TCCTACAGtcttttttttttt	0.289													3	3	---	---	---	---	
RASA4	10156	broad.mit.edu	37	7	102259886	102259887	+	5'Flank	INS	-	AA	AA	rs111664704		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102259886_102259887insAA	uc003vae.2	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc010lig.2_5'Flank|RASA4_uc003vaf.2_5'Flank|RASA4_uc011klb.1_Intron|RASA4_uc010lih.2_5'Flank|RASA4_uc011kld.1_Intron	NM_006989	NP_008920	O43374	RASL2_HUMAN	RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						gagacctcgtcaaaaaaaaaaa	0.020													7	4	---	---	---	---	
MDFIC	29969	broad.mit.edu	37	7	114655528	114655528	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114655528delT	uc003vhf.2	+							NM_199072	NP_951038	Q9P1T7	MDFIC_HUMAN	MyoD family inhibitor domain containing protein						activation of JUN kinase activity|interspecies interaction between organisms|negative regulation of protein import into nucleus|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|regulation of Wnt receptor signaling pathway|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleolus|nucleolus|nucleus	cyclin binding|Tat protein binding			ovary(1)	1						CACACAATACTTTTTTTTTTT	0.353													6	3	---	---	---	---	
ST7	7982	broad.mit.edu	37	7	116778444	116778444	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116778444delT	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron|ST7OT2_uc003viw.2_Intron|ST7_uc003vix.1_Intron	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GGCCTCTGTATTTTTTTTTTT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	129444939	129444939	+	IGR	DEL	A	-	-	rs34174233		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129444939delA								MIR183 (30085 upstream) : UBE2H (28056 downstream)																							GCATTAGGGGATGAAGCAGGC	0.677													3	3	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	132248992	132248994	+	Intron	DEL	TCT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132248992_132248994delTCT	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Intron	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						ctcctcctcctcttcctcctcct	0.000													4	3	---	---	---	---	
ATP6V0A4	50617	broad.mit.edu	37	7	138479563	138479564	+	Intron	DEL	CG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138479563_138479564delCG	uc003vug.2	-						ATP6V0A4_uc003vuh.2_Intron	NM_020632	NP_065683	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						TGGTGACACTCGTAAAGTAAAA	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142461985	142461986	+	Intron	INS	-	T	T	rs140493997	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142461985_142461986insT	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CCACCTTCACCTCTGTCCCAAG	0.540													2	5	---	---	---	---	
CNTNAP2	26047	broad.mit.edu	37	7	146922872	146922872	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146922872delA	uc003weu.1	+							NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ggaaggaaggaaggaaggaag	0.100										HNSCC(39;0.1)			4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152099300	152099300	+	Intron	DEL	G	-	-	rs5001258		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152099300delG	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ATAACTAGCAGAGAAATTAAA	0.289			N		medulloblastoma								6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152181963	152181964	+	IGR	INS	-	T	T	rs71198786		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152181963_152181964insT								LOC100128822 (19335 upstream) : XRCC2 (161625 downstream)																							tccttctttccaccctccttcc	0.168													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	153234670	153234671	+	IGR	INS	-	GCA	GCA	rs143897511	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153234670_153234671insGCA								ACTR3B (682207 upstream) : DPP6 (349748 downstream)																							AGCGCACTCAGGCAGGGGCTCA	0.525													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	153293103	153293103	+	IGR	DEL	T	-	-	rs34914774		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153293103delT								ACTR3B (740640 upstream) : DPP6 (291316 downstream)																							tcacagcatgtttttccccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155272378	155272379	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155272378_155272379insT								EN2 (14858 upstream) : CNPY1 (21574 downstream)																							gaaaccctgtcttttttttttt	0.000													5	4	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155473256	155473256	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155473256delT	uc010lqk.1	+						RBM33_uc003wme.2_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CATTGGGTGCTTTTTTTTTTT	0.338													4	2	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158133963	158133964	+	Intron	DEL	CA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158133963_158133964delCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CATTCACACCCACACTCTCACC	0.525													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1114387	1114387	+	IGR	DEL	T	-	-	rs113630482		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1114387delT								ERICH1 (433161 upstream) : DLGAP2 (335182 downstream)																							TCTGTGAGCCTCCCAGGGCCC	0.562													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1153107	1153110	+	IGR	DEL	TTTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1153107_1153110delTTTG								ERICH1 (471881 upstream) : DLGAP2 (296459 downstream)																							TCTTAGGGTTtttgtttgtttgtt	0.436													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9765194	9765195	+	IGR	INS	-	A	A	rs150583502	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9765194_9765195insA								MIR124-1 (4212 upstream) : MSRA (146635 downstream)																							GAGAGAGAAGGAAAAAAgagga	0.262													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9837254	9837254	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9837254delC								MIR124-1 (76272 upstream) : MSRA (74576 downstream)																							GTCTGTGCAGCCCCGGGAGCA	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	10450502	10450502	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10450502delC								PRSS55 (47795 upstream) : RP1L1 (13360 downstream)																							TGAGAGTGCACCTTGTCATGT	0.637													4	2	---	---	---	---	
XKR6	286046	broad.mit.edu	37	8	10942950	10942951	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10942950_10942951delGT	uc003wtk.1	-							NM_173683	NP_775954	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		GGTGAAAGAGgtgtgtgtgtgt	0.366													4	2	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12307239	12307240	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12307239_12307240delTG	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						cacatgtatatGTGTGTGTGTA	0.050													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	12577624	12577624	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12577624delC								FAM66D (153270 upstream) : LONRF1 (1782 downstream)																							tgaggctgaacccgggtgcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	20620030	20620030	+	IGR	DEL	A	-	-	rs145686803		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20620030delA								LZTS1 (507227 upstream) : GFRA2 (929500 downstream)																							gtgaacagttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
RHOBTB2	23221	broad.mit.edu	37	8	22854774	22854776	+	5'Flank	DEL	TGA	-	-	rs10592460		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22854774_22854776delTGA	uc003xcq.2	+						RHOBTB2_uc003xcp.2_Intron|RHOBTB2_uc011kzp.1_Intron	NM_015178	NP_055993	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2 isoform 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			ovary(1)|lung(1)	2		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		GGAGGAACTCTGATGATAAGAGG	0.562													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29364797	29364797	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29364797delT								DUSP4 (156612 upstream) : C8orf75 (213981 downstream)																							taattttgaatttttttttta	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29839086	29839087	+	IGR	DEL	AA	-	-	rs67217093		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29839086_29839087delAA								LOC286135 (27965 upstream) : TMEM66 (81545 downstream)																							TTTTTTTCTTAAAAAAAAAAAA	0.376													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	31416490	31416490	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31416490delT								WRN (385214 upstream) : NRG1 (80778 downstream)																							caagggccccttttgggctaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	32677362	32677363	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32677362_32677363insT								NRG1 (54804 upstream) : FUT10 (550983 downstream)																							ttctaggttccttctttttttt	0.000													4	2	---	---	---	---	
EIF4EBP1	1978	broad.mit.edu	37	8	37903944	37903944	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37903944delG	uc003xks.2	+							NM_004095	NP_004086	Q13541	4EBP1_HUMAN	eukaryotic translation initiation factor 4E						G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|positive regulation of mitotic cell cycle|TOR signaling cascade|translation	cytosol					0	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)				GATGGTTCTTGGTTTCCGTGG	0.428													4	2	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38117795	38117795	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38117795delT	uc003xlb.2	+						DDHD2_uc003xlc.2_Intron|DDHD2_uc003xld.2_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			CTGCTATTCATTTTTAGAGGG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41766026	41766027	+	IGR	INS	-	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41766026_41766027insC								ANK1 (11746 upstream) : MYST3 (20971 downstream)																							ttttcttttttttttttttttt	0.010													5	3	---	---	---	---	
MYST3	7994	broad.mit.edu	37	8	41871008	41871008	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41871008delC	uc010lxb.2	-						MYST3_uc010lxc.2_Intron|MYST3_uc003xon.3_Intron|MYST3_uc010lxd.2_Intron	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic						histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			gccttggcctcccaaagtgct	0.104													4	2	---	---	---	---	
CHRNB3	1142	broad.mit.edu	37	8	42564472	42564473	+	Intron	INS	-	CT	CT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42564472_42564473insCT	uc003xpi.1	+							NM_000749	NP_000740	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta						synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)			AGCCCCGTCACCTCTTCTGAAC	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	47122286	47122286	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47122286delC								None (None upstream) : BEYLA (630222 downstream)																							ggagaagtggcgagaccgcag	0.000													4	2	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48691831	48691831	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48691831delA	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				CTTGAATTTCAATATACCATT	0.299								NHEJ					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49453583	49453583	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49453583delA								UBE2V2 (479131 upstream) : EFCAB1 (169768 downstream)																							ctttgtaagtaaggacttctt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50197198	50197198	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50197198delA								C8orf22 (208557 upstream) : SNTG1 (625151 downstream)																							cctggctcttatggcacccca	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	51952929	51952930	+	IGR	INS	-	T	T	rs35535071		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51952929_51952930insT								SNTG1 (247502 upstream) : PXDNL (279214 downstream)																							ttttggtttcgttttttttttA	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53647105	53647106	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53647105_53647106insT								RB1CC1 (20079 upstream) : NPBWR1 (205362 downstream)																							ctttctttttcttttttttttt	0.153													4	2	---	---	---	---	
XKR4	114786	broad.mit.edu	37	8	56043305	56043306	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56043305_56043306delGT	uc003xsf.2	+							NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			ATATGTGCACGTGTGTGTGTGT	0.411													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	61934077	61934077	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61934077delT								CHD7 (154614 upstream) : CLVS1 (266448 downstream)																							gactggctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	68261960	68261960	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68261960delG								ARFGEF1 (6048 upstream) : CPA6 (72446 downstream)																							ccaaaaaaaagaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	70856283	70856284	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70856283_70856284insA								SLCO5A1 (108984 upstream) : PRDM14 (107741 downstream)																							gactccatctcaaaaaaaaaaa	0.149													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	70945955	70945955	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70945955delA								SLCO5A1 (198656 upstream) : PRDM14 (18070 downstream)																							accgagatcCAaaaataaaaa	0.025													4	2	---	---	---	---	
C8orf84	157869	broad.mit.edu	37	8	73987428	73987429	+	Intron	INS	-	TC	TC	rs139674078	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73987428_73987429insTC	uc003xzf.2	-							NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor						immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						TTTCAGGACTTTCTATCAAGCT	0.312													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	89656351	89656351	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89656351delT								MMP16 (316634 upstream) : None (None downstream)																							ACATGACTGGTTACACCCCAG	0.413													4	2	---	---	---	---	
RNF19A	25897	broad.mit.edu	37	8	101324814	101324814	+	5'Flank	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101324814delT	uc003yjk.1	-							NM_183419	NP_904355	Q9NV58	RN19A_HUMAN	ring finger protein 19						microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			agtgagaccctgtctcaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109520577	109520577	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109520577delA								TTC35 (21441 upstream) : TMEM74 (98503 downstream)																							ctcagtctcgaaaaaaaaaaa	0.154													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125248283	125248283	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125248283delG								FER1L6 (115982 upstream) : TMEM65 (74878 downstream)																							TTGCATATTTGGGGACCCACT	0.478													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131412737	131412738	+	Intron	INS	-	A	A	rs150863722		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131412737_131412738insA	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTGGCATAGGAAAAAAAAAAA	0.134													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	134629256	134629257	+	IGR	INS	-	TGTTCG	TGTTCG	rs111486940		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134629256_134629257insTGTTCG								ST3GAL1 (45073 upstream) : ZFAT (860776 downstream)																							GGtttttttttttttttttttt	0.183													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136037368	136037368	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136037368delT								MIR30D (220180 upstream) : LOC286094 (209006 downstream)																							tgatgttgacttttttttatg	0.000													4	2	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139481455	139481458	+	Intron	DEL	GAAA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139481455_139481458delGAAA	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			agaaagaaaggaaagaaagaaaga	0.216										HNSCC(54;0.14)			3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	139970431	139970432	+	IGR	DEL	TG	-	-	rs34053716		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139970431_139970432delTG								COL22A1 (44195 upstream) : KCNK9 (642650 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140195079	140195079	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140195079delG								COL22A1 (268843 upstream) : KCNK9 (418003 downstream)																							gaaccagggaggaatgacatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140382556	140382556	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140382556delA								COL22A1 (456320 upstream) : KCNK9 (230526 downstream)																							aatctgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141799380	141799380	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141799380delA	uc003yvu.2	-						PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GTCCCATCTTAAAAAAAAAAA	0.259													5	5	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143481401	143481401	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143481401delA	uc003ywk.2	-						TSNARE1_uc003ywl.3_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					cgcctatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143671157	143671169	+	IGR	DEL	CAGGGTCTCTGGA	-	-	rs142869224		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143671157_143671169delCAGGGTCTCTGGA								BAI1 (44790 upstream) : ARC (21241 downstream)																							GTGTGTGTGTCAGGGTCTCTGGAgtgtgtgtgt	0.484													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144263451	144263452	+	IGR	INS	-	TG	TG	rs112348916		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144263451_144263452insTG								LY6H (21398 upstream) : GPIHBP1 (31616 downstream)																							gtgtgtgtctctgtgtgtgtat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144958353	144958353	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144958353delC								EPPK1 (10919 upstream) : PLEC (30968 downstream)																							CCCGCTCATGCCCCCCACAGC	0.751													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	4358711	4358711	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4358711delC								GLIS3 (58676 upstream) : SLC1A1 (131733 downstream)																							AATGGGCACacgtgtgtatgt	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	7978788	7978788	+	IGR	DEL	T	-	-	rs138640585		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7978788delT								C9orf123 (178989 upstream) : PTPRD (335459 downstream)																							tttttccttctttttttttga	0.144													2	4	---	---	---	---	
CHMP5	51510	broad.mit.edu	37	9	33278930	33278931	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33278930_33278931insT	uc003zsl.3	+						SUGT1P1_uc010mjq.1_Intron|CHMP5_uc003zsm.3_Intron|CHMP5_uc011lnv.1_Intron	NM_016410	NP_057494	Q9NZZ3	CHMP5_HUMAN	chromatin modifying protein 5						cellular membrane organization|protein transport	cytosol|endosome membrane	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			aCATGATTGTCtttttttttga	0.020													3	3	---	---	---	---	
ENHO	375704	broad.mit.edu	37	9	34525421	34525422	+	5'Flank	INS	-	T	T	rs10654532		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34525421_34525422insT	uc003zun.1	-						ENHO_uc003zuo.2_5'Flank	NM_198573	NP_940975	Q6UWT2	ENHO_HUMAN	adropin precursor							extracellular region					0						ctcctcctTTCTTTTTTTTTTT	0.302													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	35914382	35914385	+	IGR	DEL	AGTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35914382_35914385delAGTG								LOC158376 (2765 upstream) : OR2S2 (42721 downstream)																							gtatgtgtgtagtgagtgtgtgtg	0.206													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36014787	36014787	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36014787delC								OR2S2 (56636 upstream) : RECK (22123 downstream)																							tcaggtatttctttatatcat	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36549836	36549837	+	IGR	INS	-	T	T	rs148073074	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36549836_36549837insT								RNF38 (148641 upstream) : MELK (23068 downstream)																							aggaaagaatGttttttttttg	0.005													4	2	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36647045	36647045	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36647045delT	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GATTTATCTGTTATTGAACAC	0.353													4	2	---	---	---	---	
FBXO10	26267	broad.mit.edu	37	9	37567146	37567146	+	Intron	DEL	T	-	-	rs111249142		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37567146delT	uc004aab.2	-						FBXO10_uc004aac.2_Intron|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10							ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)		tctttttttcttttttttttt	0.095													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44876306	44876306	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44876306delG								None (None upstream) : FAM27C (113930 downstream)																							gccggtggaagggggaaacgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66815135	66815135	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66815135delG								LOC442421 (312108 upstream) : AQP7P1 (439132 downstream)																							ggtgaaaaatgaaatatcttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67251587	67251587	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67251587delG								LOC442421 (748560 upstream) : AQP7P1 (2680 downstream)																							cggcacacgcgggggcggccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68399323	68399323	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68399323delG								FAM27B (605134 upstream) : MIR1299 (602916 downstream)																							TCTTGCTGTTGGGGTTGGTGG	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68491533	68491534	+	IGR	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68491533_68491534delTC								FAM27B (697344 upstream) : MIR1299 (510705 downstream)																							TATTCCtctttctctctttctt	0.089													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69818218	69818221	+	IGR	DEL	TGTT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69818218_69818221delTGTT								LOC100133920 (153269 upstream) : FOXD4L5 (357488 downstream)																							gggttctgagtgtttgtccctcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69841813	69841813	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69841813delA								LOC100133920 (176864 upstream) : FOXD4L5 (333896 downstream)																							gtctccatctaaaaaaaaaaa	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	77014578	77014578	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77014578delA								None (None upstream) : RORB (97674 downstream)																							TCAGGCAAACAAAAATGGCAT	0.219													4	2	---	---	---	---	
TLE1	7088	broad.mit.edu	37	9	84277276	84277277	+	Intron	INS	-	TG	TG			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84277276_84277277insTG	uc004aly.2	-						TLE1_uc004alz.2_Intron|TLE1_uc011lsr.1_Intron|TLE1_uc004ama.1_Intron|TLE1_uc011lss.1_Intron|TLE1_uc004amb.2_Intron	NM_005077	NP_005068	Q04724	TLE1_HUMAN	transducin-like enhancer protein 1						negative regulation of Wnt receptor signaling pathway|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway		transcription factor binding			ovary(1)|skin(1)	2						TGTGCCTGTTTtgtgtgtgtgt	0.193													4	2	---	---	---	---	
FRMD3	257019	broad.mit.edu	37	9	86138885	86138885	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86138885delA	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						CAGGTGGCATAAAATAACCTG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	86751616	86751617	+	IGR	INS	-	AC	AC	rs148399954	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86751616_86751617insAC								RMI1 (132634 upstream) : SLC28A3 (141475 downstream)																							ggtacacgtgtacacacacaca	0.351													3	3	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94678627	94678628	+	Intron	INS	-	T	T	rs141611312	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94678627_94678628insT	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						gctcccctgactttatattggt	0.322													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	94790207	94790208	+	IGR	DEL	AC	-	-	rs142649131		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94790207_94790208delAC								ROR2 (77763 upstream) : SPTLC1 (3212 downstream)																							ACTAGTAACTACATTTttttga	0.149													4	2	---	---	---	---	
FGD3	89846	broad.mit.edu	37	9	95716793	95716794	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95716793_95716794delTG	uc004asw.2	+							NM_001083536	NP_001077005	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3						actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(1)|breast(1)	2						AGTGACTGGCTGTGACCCTAAT	0.604													4	2	---	---	---	---	
FAM120A	23196	broad.mit.edu	37	9	96288794	96288794	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96288794delT	uc004atw.2	+						FAM120A_uc004atv.2_Intron|FAM120A_uc004atx.2_Intron|FAM120A_uc004aty.2_Intron|FAM120A_uc004atz.2_Intron|FAM120A_uc010mrf.1_Intron	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator							cytoplasm|plasma membrane	RNA binding				0						CCTTATCCCCTTTTTTTTTTC	0.388													3	3	---	---	---	---	
CTSL2	1515	broad.mit.edu	37	9	99819673	99819673	+	Intron	DEL	T	-	-	rs34495874		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99819673delT	uc004awu.2	-									O60911	CATL2_HUMAN	RecName: Full=Cathepsin L2;          EC=3.4.22.43; AltName: Full=Cathepsin V; AltName: Full=Cathepsin U; Flags: Precursor;							lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				TACTGGTGCCttttttttttt	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	100504505	100504507	+	IGR	DEL	GAA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100504505_100504507delGAA								XPA (44814 upstream) : FOXE1 (111030 downstream)																							gaggaagaaggaagaagaagaag	0.064													4	2	---	---	---	---	
NANS	54187	broad.mit.edu	37	9	100830117	100830117	+	Intron	DEL	C	-	-	rs145488817		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100830117delC	uc004ayb.2	+						NANS_uc004ayc.2_Intron	NM_018946	NP_061819	Q9NR45	SIAS_HUMAN	N-acetylneuraminic acid phosphate synthase						lipopolysaccharide biosynthetic process	cytoplasm	N-acetylneuraminate synthase activity|N-acylneuraminate cytidylyltransferase activity|N-acylneuraminate-9-phosphate synthase activity			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				aatcctcccacctcagcctcc	0.000													4	4	---	---	---	---	
SLC44A1	23446	broad.mit.edu	37	9	108024968	108024968	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108024968delA	uc004bcn.2	+						SLC44A1_uc010mtk.1_Intron	NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN	CDW92 antigen							integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)	TCTCATACCTAACTGGGCACA	0.453													4	2	---	---	---	---	
HDHD3	81932	broad.mit.edu	37	9	116139625	116139633	+	5'Flank	DEL	CCGCTGTCT	-	-	rs111298199		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116139625_116139633delCCGCTGTCT	uc004bhi.1	-						HDHD3_uc004bhj.2_5'Flank|HDHD3_uc004bhk.2_5'Flank	NM_031219	NP_112496	Q9BSH5	HDHD3_HUMAN	haloacid dehalogenase-like hydrolase domain								phosphoglycolate phosphatase activity|protein binding				0						CCGCTCCTCACCGCTGTCTCCGCTCCCCA	0.699													5	3	---	---	---	---	
RGS3	5998	broad.mit.edu	37	9	116210304	116210304	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116210304delT	uc004bhq.2	+							NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						tgcccagctattttttatatt	0.000													4	2	---	---	---	---	
C9orf91	203197	broad.mit.edu	37	9	117372023	117372030	+	5'Flank	DEL	GAAAGAAA	-	-	rs76774690		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117372023_117372030delGAAAGAAA	uc004bjd.3	+						C9orf91_uc004bje.3_5'Flank	NM_153045	NP_694590	Q5VZI3	CI091_HUMAN	hypothetical protein LOC203197							integral to membrane				pancreas(1)	1						aggaaggaaggaaagaaagaaagaaaga	0.000													4	5	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119264421	119264422	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119264421_119264422delTG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_Intron|ASTN2_uc004bjq.1_Intron|ASTN2_uc011lxr.1_Intron|ASTN2_uc011lxs.1_Intron|ASTN2_uc011lxt.1_Intron|uc004bju.1_5'Flank	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GATTTCCAAAtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120911627	120911627	+	IGR	DEL	A	-	-	rs75343770		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120911627delA								TLR4 (431863 upstream) : None (None downstream)																							aaagacagggaaaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	122760356	122760356	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122760356delG								DBC1 (628617 upstream) : MIR147 (246901 downstream)																							GCTGCTTCCTGGGGAGAGGCA	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	126829048	126829049	+	IGR	INS	-	A	A	rs142601977	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126829048_126829049insA								LHX2 (33606 upstream) : NEK6 (190837 downstream)																							ggcagtttctcaaaaaacataa	0.000													4	2	---	---	---	---	
LRSAM1	90678	broad.mit.edu	37	9	130221496	130221497	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130221496_130221497insT	uc004brb.1	+						LRSAM1_uc010mxk.1_Intron|LRSAM1_uc004brc.1_Intron|LRSAM1_uc004brd.1_Intron	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif						negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0						GCCCTTTGGGGttttttttttt	0.317													4	3	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131597417	131597418	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131597417_131597418insA	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	ccatctcaaccaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132903768	132903768	+	RNA	DEL	A	-	-	rs11299315		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132903768delA	uc004bzh.1	-	2		c.2379delT								Homo sapiens cDNA FLJ46836 fis, clone UTERU2029660.																		actctgtcttaaaaaaaaaaa	0.204													4	2	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135325663	135325663	+	Intron	DEL	A	-	-	rs112875395		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135325663delA	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						tattccaggcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
C9orf98	158067	broad.mit.edu	37	9	135716239	135716240	+	Intron	INS	-	A	A	rs34922925		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135716239_135716240insA	uc004cbu.1	-						C9orf98_uc010mzx.1_Intron|C9orf98_uc004cbv.1_Intron	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98							cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		gagatcgcgccaAAAAAAAAGT	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138356699	138356699	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138356699delA	uc004cfp.3	-											Homo sapiens cDNA clone IMAGE:5295490.																		gcctctgtctaaaaaaaaaaa	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138450215	138450216	+	IGR	DEL	TT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138450215_138450216delTT								OBP2A (8401 upstream) : PAEP (3388 downstream)																							cttcatcctctttttttttttc	0.000													3	3	---	---	---	---	
SOHLH1	402381	broad.mit.edu	37	9	138588009	138588010	+	Intron	INS	-	C	C	rs138443831	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138588009_138588010insC	uc004cgl.2	-						SOHLH1_uc010nbe.2_Intron	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic						cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			breast(1)|central_nervous_system(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CCAGGATGGGGCAAGTCCCTCT	0.624													5	3	---	---	---	---	
C9orf140	89958	broad.mit.edu	37	9	139956751	139956752	+	3'UTR	INS	-	TTTC	TTTC			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139956751_139956752insTTTC	uc011men.1	-	6						NM_178448	NP_848543	Q86UD0	CI140_HUMAN	tumor specificity and mitosis phase-dependent							cytoplasm|nucleus				skin(1)	1	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;3.02e-05)|Epithelial(140;0.000499)		GGATCTCTCATTTTCTTTCTTt	0.050													4	5	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	520509	520510	+	Intron	INS	-	CTCA	CTCA	rs139169708	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:520509_520510insCTCA	uc001ifp.2	-						DIP2C_uc009xhk.1_Intron	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ggctgtggctgctgtgttggtc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3553143	3553143	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3553143delT	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		cctcccgccctcccatagcct	0.000													4	2	---	---	---	---	
PFKFB3	5209	broad.mit.edu	37	10	6188515	6188516	+	Intron	INS	-	C	C	rs148139818	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6188515_6188516insC	uc010qaw.1	+						PFKFB3_uc001ijd.2_Intron|PFKFB3_uc009xii.2_Intron	NM_001145443	NP_001138915	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(2)|central_nervous_system(1)	3						AGAGTGTCCCTCCCCCCCTACT	0.505													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	9557581	9557584	+	IGR	DEL	GGAA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9557581_9557584delGGAA								None (None upstream) : None (None downstream)																							gaggaaagagggaaggaaggaagg	0.098													3	3	---	---	---	---	
CELF2	10659	broad.mit.edu	37	10	11326463	11326463	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11326463delG	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						AGTGTGTGGTGGGGGATGAGG	0.199													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	12878485	12878488	+	IGR	DEL	CTCT	-	-	rs139234983		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12878485_12878488delCTCT								LOC283070 (941 upstream) : CCDC3 (60137 downstream)																							ATCCCCCTGACTCTCTCTGCCCCC	0.314													4	2	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14564067	14564068	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14564067_14564068insT	uc001imx.1	-						FAM107B_uc001ina.1_Intron|FAM107B_uc010qbu.1_Intron|FAM107B_uc009xjg.1_Intron|FAM107B_uc001imy.1_Intron|FAM107B_uc001imz.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						TAATGGCTACATTTTTTATGAA	0.366													16	8	---	---	---	---	
CDNF	441549	broad.mit.edu	37	10	14863129	14863130	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14863129_14863130insT	uc001inb.1	-						CDNF_uc010qbv.1_Intron|CDNF_uc001inc.1_Intron	NM_001029954	NP_001025125	Q49AH0	CDNF_HUMAN	arginine-rich, mutated in early stage							extracellular region	growth factor activity				0						agttctttttcttttttttttt	0.000													4	2	---	---	---	---	
NEBL	10529	broad.mit.edu	37	10	21436325	21436326	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21436325_21436326insT	uc001iqk.2	-						C10orf113_uc001iqm.2_5'Flank	NM_213569	NP_998734	O76041	NEBL_HUMAN	nebulette non-muscle isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						ttctcctccggttttttttttt	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	28741837	28741837	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28741837delG								MPP7 (149842 upstream) : WAC (79590 downstream)																							agaatattctgatttcgattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30536320	30536323	+	IGR	DEL	TGTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30536320_30536323delTGTG								KIAA1462 (131900 upstream) : MTPAP (62408 downstream)																							gtgtgtggtatgtgtgtgtgtgta	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	32262116	32262116	+	IGR	DEL	T	-	-	rs75905285		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32262116delT								ARHGAP12 (44346 upstream) : KIF5B (35824 downstream)																							ACTTTGTATGttttttttttt	0.169													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34550616	34550617	+	Intron	INS	-	AAAG	AAAG			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34550616_34550617insAAAG	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				gactctgtctcaaagaaagaaa	0.000													4	3	---	---	---	---	
CCNY	219771	broad.mit.edu	37	10	35549107	35549107	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35549107delA	uc001iyu.3	+						CCNY_uc001iyv.3_Intron	NM_181698	NP_859049	Q8ND76	CCNY_HUMAN	cyclin Y isoform 2						cell division|G2/M transition of mitotic cell cycle|positive regulation of cyclin-dependent protein kinase activity|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	cyclin-dependent protein kinase regulator activity|protein kinase binding				0						ATGCTACCTCATCCTTCCTAT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35888312	35888312	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35888312delT								CCNY (27467 upstream) : GJD4 (6026 downstream)																							ttttcttttcttttttttttt	0.159													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42640376	42640377	+	IGR	INS	-	C	C	rs113903996		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42640376_42640377insC								None (None upstream) : LOC441666 (186938 downstream)																							gttttaaactttttgctattgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42673835	42673836	+	IGR	DEL	TT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42673835_42673836delTT								None (None upstream) : LOC441666 (153479 downstream)																							ACTGACCTTATTTTTTTTTTAC	0.287													4	2	---	---	---	---	
ZNF365	22891	broad.mit.edu	37	10	64281284	64281285	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64281284_64281285insT	uc001jmd.1	+						ZNF365_uc001jmc.2_Intron	NM_199452	NP_955524	Q70YC4	TALAN_HUMAN	zinc finger protein 365 isoform D											ovary(1)|skin(1)	2	Prostate(12;0.0297)|all_hematologic(501;0.228)					tgatgtgactgttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	70304123	70304123	+	IGR	DEL	T	-	-	rs71716010		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70304123delT								SLC25A16 (16539 upstream) : TET1 (15994 downstream)																							AAATTTGGTCTTTTTTTTTTA	0.373													4	2	---	---	---	---	
MYST4	23522	broad.mit.edu	37	10	76791169	76791169	+	3'UTR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76791169delT	uc001jwn.1	+	18					MYST4_uc001jwo.1_3'UTR|MYST4_uc001jwp.1_3'UTR	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic						histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					AACCTAGAGCTTTTTTTTTCC	0.393			T	CREBBP	AML								4	2	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	77675923	77675924	+	Intron	DEL	TG	-	-	rs34666507		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77675923_77675924delTG	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GCCAGGCCTAtgtgtgtgtgtg	0.406													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	79732676	79732677	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79732676_79732677insA								LOC100128292 (43094 upstream) : POLR3A (3229 downstream)																							CATACCTCTACAAAAAAACCTG	0.361													4	2	---	---	---	---	
ZCCHC24	219654	broad.mit.edu	37	10	81190025	81190027	+	Intron	DEL	GGA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81190025_81190027delGGA	uc001kak.2	-						ZCCHC24_uc010qlr.1_Intron|ZCCHC24_uc009xrw.2_Intron	NM_153367	NP_699198	Q8N2G6	ZCH24_HUMAN	zinc finger, CCHC domain containing 24								nucleic acid binding|zinc ion binding			breast(1)	1						ACTCATGAAGGGAGGAAGAAGGT	0.360													4	2	---	---	---	---	
EXOC6	54536	broad.mit.edu	37	10	94737434	94737435	+	Intron	DEL	AC	-	-	rs34417481		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94737434_94737435delAC	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron|EXOC6_uc001kih.2_Intron|EXOC6_uc001kii.2_Intron	NM_019053	NP_061926	Q8TAG9	EXOC6_HUMAN	SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)				GTGCTTGCAGacacacacacac	0.282													4	2	---	---	---	---	
NOC3L	64318	broad.mit.edu	37	10	96124254	96124255	+	5'Flank	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96124254_96124255insT	uc001kjq.1	-						NOC3L_uc009xuk.1_5'Flank	NM_022451	NP_071896	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog							nuclear speck|nucleolus	binding			ovary(1)	1		Colorectal(252;0.0897)				AAAAGTACCAATTTCCTGATCC	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110822787	110822788	+	IGR	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110822787_110822788delTG								None (None upstream) : XPNPEP1 (801736 downstream)																							tgagtgtgtatgtgtgtgtgtg	0.208													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	111088310	111088311	+	IGR	INS	-	T	T	rs143836120	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111088310_111088311insT								None (None upstream) : XPNPEP1 (536213 downstream)																							ATCTCCCTGGAttttttttttg	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113234368	113234369	+	IGR	INS	-	A	A	rs147160204	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113234368_113234369insA								ADRA2A (393708 upstream) : GPAM (675253 downstream)																							GTTATACTGATACagttgcaat	0.153													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	114664381	114664381	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114664381delA								LOC143188 (49254 upstream) : TCF7L2 (45628 downstream)																							ccagctactcaggaggctgag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115686266	115686266	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115686266delA								NHLRC2 (17814 upstream) : ADRB1 (117540 downstream)																							CCTCCACCCCAATTTAACCAC	0.507													4	2	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116302340	116302341	+	Intron	INS	-	A	A	rs111712427		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116302340_116302341insA	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		ggaggacgaggaggaggaggaa	0.074													4	2	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116464795	116464795	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116464795delT	uc001lbz.1	-									O14639	ABLM1_HUMAN	Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		GTTCAAGTTCTTTTTTTTTTC	0.448													4	2	---	---	---	---	
C10orf122	387718	broad.mit.edu	37	10	127277162	127277169	+	Intron	DEL	GTTTGTTT	-	-	rs61873467		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127277162_127277169delGTTTGTTT	uc001lij.2	-							NM_001128202	NP_001121674	Q5VZQ5	CJ122_HUMAN	hypothetical protein LOC387718												0						caggctcttggtttgtttgtttgtttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133733499	133733500	+	IGR	DEL	AC	-	-	rs111597604		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133733499_133733500delAC								TCERG1L (623515 upstream) : PPP2R2D (14460 downstream)																							GGGTGGAATGACACAGTGTTTG	0.554													2	4	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133991025	133991026	+	Intron	INS	-	GT	GT	rs4009680		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133991025_133991026insGT	uc001lkx.3	+						JAKMIP3_uc001lky.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCCCTGGGTAGTGTGTGTGTG	0.554													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134702105	134702105	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134702105delT	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		cctgcacccctgccaccttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134811199	134811200	+	IGR	INS	-	TCAT	TCAT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134811199_134811200insTCAT								C10orf93 (55135 upstream) : GPR123 (73233 downstream)																							agacaacacacatgcacacaca	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	359186	359187	+	IGR	DEL	AA	-	-	rs67508911		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:359186_359187delAA								IFITM3 (38272 upstream) : B4GALNT4 (10608 downstream)																							actccctctcaaaaaaaaaaaa	0.218													4	2	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1246984	1246984	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1246984delG	uc009ycr.1	+						MUC5B_uc009yct.1_Intron|MUC5B_uc001ltb.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCCAGGTTCGGGGGTGGGGG	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	3587309	3587309	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3587309delG								LOC650368 (156931 upstream) : TRPC2 (51153 downstream)																							atagatgcatgggtgagtgga	0.095													4	2	---	---	---	---	
SBF2	81846	broad.mit.edu	37	11	9814304	9814306	+	Intron	DEL	TGT	-	-	rs139457063		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9814304_9814306delTGT	uc001mib.2	-						uc001mhz.1_Intron|SBF2_uc001mid.2_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CATGTTTATGTGttgttgttttt	0.099													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11203811	11203812	+	IGR	INS	-	T	T	rs146876469	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11203811_11203812insT								ZBED5 (324191 upstream) : GALNTL4 (88609 downstream)																							TTTGTTTAGACTTTTTTTGTCT	0.436													4	4	---	---	---	---	
GALNTL4	374378	broad.mit.edu	37	11	11527118	11527119	+	Intron	INS	-	CCT	CCT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11527118_11527119insCCT	uc001mjo.2	-							NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		TTGCCTTACCACCTCCTCCCCC	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	18180302	18180303	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18180302_18180303insA								MRGPRX3 (20277 upstream) : MRGPRX4 (14081 downstream)																							aaaggacatccaaaacaaaacc	0.000													4	2	---	---	---	---	
SAA1	6288	broad.mit.edu	37	11	18291027	18291028	+	Intron	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18291027_18291028insG	uc010rda.1	+						SAA1_uc010rdb.1_Intron	NM_000331	NP_000322	P02735	SAA_HUMAN	serum amyloid A1 preproprotein						acute-phase response|elevation of cytosolic calcium ion concentration|innate immune response|lymphocyte chemotaxis|macrophage chemotaxis|negative regulation of inflammatory response|neutrophil chemotaxis|platelet activation|positive regulation of cell adhesion|positive regulation of interleukin-1 secretion	high-density lipoprotein particle	G-protein-coupled receptor binding				0					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	GCTCAGTGTGAGGTCTGAGTGG	0.604													5	3	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20110555	20110555	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20110555delA	uc001mpr.3	+						NAV2_uc001mpp.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhz.2_Intron|NAV2_uc001mpu.2_Intron	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						CAAACCGAAGAAAAAAAAAAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	22097695	22097706	+	IGR	DEL	GTGCGCGTGCGT	-	-	rs72438136		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22097695_22097706delGTGCGCGTGCGT								NELL1 (500468 upstream) : ANO5 (117016 downstream)																							gcgCGCGCGCGTGCGCGTGCGTGTGTGCATGT	0.321													3	3	---	---	---	---	
GAS2	2620	broad.mit.edu	37	11	22796515	22796516	+	Intron	DEL	AG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22796515_22796516delAG	uc009yie.2	+						GAS2_uc001mqm.2_Intron|GAS2_uc001mqn.2_Intron|GAS2_uc001mqo.2_Intron	NM_001143830	NP_001137302	O43903	GAS2_HUMAN	growth arrest-specific 2						cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2						GATGAGGGGAAGAGAGAGAGAG	0.114													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23334641	23334641	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23334641delG								SVIP (483259 upstream) : None (None downstream)																							tggtgttgctgggtctctgct	0.000													4	2	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	32027792	32027792	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32027792delT	uc010rea.1	+							NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					CTCCTCCGCCTTTTCCCCTGC	0.552													4	2	---	---	---	---	
LRRC4C	57689	broad.mit.edu	37	11	41349972	41349973	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41349972_41349973delTG	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				Agtgtgtatatgtgtgtgtgtg	0.361													4	2	---	---	---	---	
TSPAN18	90139	broad.mit.edu	37	11	44923111	44923111	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44923111delG	uc001mye.3	+						TP53I11_uc001myf.1_Intron	NM_130783	NP_570139	Q96SJ8	TSN18_HUMAN	tetraspanin 18 isoform 2							integral to membrane					0						gtcagggcctggcagaggaaa	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44979171	44979171	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44979171delG								TP53I11 (6331 upstream) : LOC221122 (16282 downstream)																							CGACTTCTGTGGGCAACCTCT	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	47937250	47937250	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47937250delC								NUP160 (67193 upstream) : PTPRJ (64860 downstream)																							tcaaccgcctccctgcaaggg	0.000													4	2	---	---	---	---	
PTPRJ	5795	broad.mit.edu	37	11	48083147	48083147	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48083147delC	uc001ngp.3	+						PTPRJ_uc001ngo.3_Intron	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						cctgttcaggccacacactaa	0.149													4	2	---	---	---	---	
OR4C45	403257	broad.mit.edu	37	11	48367741	48367747	+	Intron	DEL	AGGGGTC	-	-	rs72068053		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48367741_48367747delAGGGGTC	uc010rhw.1	-							NM_001005513	NP_001005513			olfactory receptor, family 4, subfamily C,												0						aggaagtacaaggggtcagggagttcc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50158468	50158468	+	IGR	DEL	A	-	-	rs143850750		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50158468delA								OR4C12 (154431 upstream) : LOC441601 (80532 downstream)																							gctgtcaaacaaggacattta	0.000													4	2	---	---	---	---	
C11orf9	745	broad.mit.edu	37	11	61525565	61525565	+	Intron	DEL	G	-	-	rs11297199		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61525565delG	uc001nsc.1	+						DKFZP434K028_uc001nsd.2_5'Flank|C11orf9_uc001nse.1_Intron	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2						central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						CCTGGAGTGAGGGGGGGAGGG	0.622													3	5	---	---	---	---	
FRMD8	83786	broad.mit.edu	37	11	65177537	65177538	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65177537_65177538insA	uc001odu.3	+						FRMD8_uc009yqj.2_Intron|FRMD8_uc010rof.1_Intron	NM_031904	NP_114110	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8							cytoskeleton	binding			lung(1)|pancreas(1)	2						cagcttgtctcaaaaaaaaaaC	0.015													4	2	---	---	---	---	
SNX32	254122	broad.mit.edu	37	11	65601773	65601774	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65601773_65601774delTG	uc001ofr.2	+						SNX32_uc009yqt.2_Intron|SNX32_uc010rop.1_Intron	NM_152760	NP_689973	Q86XE0	SNX32_HUMAN	sorting nexin 6B						cell communication|protein transport		phosphatidylinositol binding				0				READ - Rectum adenocarcinoma(159;0.171)		tgcatatgtctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
CORO1B	57175	broad.mit.edu	37	11	67209168	67209168	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67209168delG	uc001olj.1	-						CORO1B_uc009yrs.1_Intron|CORO1B_uc001olk.1_Intron|CORO1B_uc009yrt.1_Intron|CORO1B_uc009yru.1_Intron|CORO1B_uc001oll.1_Intron|CORO1B_uc010rps.1_Intron|CORO1B_uc009yrv.1_Frame_Shift_Del_p.H164fs	NM_020441	NP_065174	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin filament binding			large_intestine(1)|ovary(1)	2			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			AGGGGTCCGTGGGGGGGGGGA	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68055196	68055196	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68055196delT								C11orf24 (15727 upstream) : LRP5 (24912 downstream)																							aaacaataacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68803250	68803250	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68803250delT								MRGPRF (22400 upstream) : TPCN2 (13100 downstream)																							CCTCCCAGCCTTTTCCCCTCT	0.701													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68804201	68804202	+	IGR	INS	-	TT	TT	rs35143666		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68804201_68804202insTT								MRGPRF (23351 upstream) : TPCN2 (12148 downstream)																							TTAAAACAGCATTTTTTTTTTT	0.322													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68956562	68956567	+	IGR	DEL	CATCAC	-	-	rs76184047		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68956562_68956567delCATCAC								TPCN2 (26655 upstream) : MYEOV (105055 downstream)																							ccatcatcatcatcaccatcatcatc	0.034													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69801539	69801540	+	IGR	DEL	TT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69801539_69801540delTT								FGF3 (167347 upstream) : ANO1 (122868 downstream)																							TCTTTCTTTCTTTTTTTTTTAA	0.361													4	2	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70632315	70632315	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70632315delT	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			CTTCTGTGCCTTTCTCCTCTG	0.532													4	2	---	---	---	---	
P2RY2	5029	broad.mit.edu	37	11	72942335	72942335	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72942335delA	uc001otj.2	+						P2RY2_uc001otk.2_Intron|P2RY2_uc001otl.2_Intron	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	ccacacctgtaatcccagcac	0.149													4	2	---	---	---	---	
UCP2	7351	broad.mit.edu	37	11	73690610	73690610	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73690610delA	uc001oup.1	-						UCP2_uc001ouq.1_Intron	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					acaaacaaacaaaaaaaaacc	0.000													3	3	---	---	---	---	
SLCO2B1	11309	broad.mit.edu	37	11	74888221	74888224	+	Intron	DEL	ACAC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74888221_74888224delACAC	uc001owb.2	+						SLCO2B1_uc010rrq.1_Intron|SLCO2B1_uc010rrr.1_Intron|SLCO2B1_uc010rrs.1_Intron|SLCO2B1_uc001owc.2_Intron|SLCO2B1_uc001owd.2_Intron	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	ccacccctctacacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	77232575	77232575	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77232575delA								PAK1 (47467 upstream) : AQP11 (67861 downstream)																							actccacctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	106319777	106319777	+	IGR	DEL	T	-	-	rs35057176		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106319777delT								AASDHPPT (350358 upstream) : GUCY1A2 (238133 downstream)																							TAGAATACTCttttttttttt	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	111313236	111313237	+	IGR	INS	-	AC	AC			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111313236_111313237insAC								POU2AF1 (63079 upstream) : BTG4 (25021 downstream)																							aaaaaaTGTATacacacacaca	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113652413	113652413	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113652413delC								CLDN25 (1206 upstream) : USP28 (16185 downstream)																							ctcctgactaccccacctcag	0.085													4	2	---	---	---	---	
SIDT2	51092	broad.mit.edu	37	11	117050952	117050953	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117050952_117050953insT	uc001pqh.1	+						SIDT2_uc010rxe.1_Intron|SIDT2_uc001pqg.2_Intron|SIDT2_uc001pqi.1_Intron	NM_001040455	NP_001035545	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2 precursor							integral to membrane|lysosomal membrane					0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		GGGGAATCTGATTTTTTTTCAG	0.510													4	2	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117446562	117446571	+	Intron	DEL	CAAAACAAAA	-	-	rs112052418		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117446562_117446571delCAAAACAAAA	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		aaaaacaacccaaaacaaaacaaaacaaaa	0.157													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	118813267	118813267	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118813267delA								BCL9L (31654 upstream) : UPK2 (13759 downstream)																							accctttctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
LOC399959	399959	broad.mit.edu	37	11	122236496	122236497	+	Intron	INS	-	CACA	CACA	rs146728026	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122236496_122236497insCACA	uc009zbb.1	-											Homo sapiens cDNA FLJ34394 fis, clone HCHON2000676.												0						ACTTGCATGCGcacacacacac	0.401													2	4	---	---	---	---	
UBASH3B	84959	broad.mit.edu	37	11	122563980	122563980	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122563980delT	uc001pyi.3	+							NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		tttgtggatcttcagttgctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	122835878	122835881	+	IGR	DEL	TTCA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122835878_122835881delTTCA								C11orf63 (5449 upstream) : BSX (12477 downstream)																							GATGGAAGACTTCATTCATTCATT	0.377													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132057109	132057114	+	Intron	DEL	GTGTGT	-	-	rs139885203		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132057109_132057114delGTGTGT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						CTCAGATGGCgtgtgtgtgtgtgtgt	0.320													5	3	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	132940257	132940257	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132940257delA	uc001qgu.2	-							NM_001012393	NP_001012393	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		AAGCTCCCGGAACCCCCTTGG	0.488													4	2	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	133027435	133027435	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133027435delA	uc001qgu.2	-							NM_001012393	NP_001012393	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		CTGAGGAGTTATCAGCAATGC	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	829998	829999	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:829998_829999insT								NINJ2 (57243 upstream) : WNK1 (32226 downstream)																							GCCCTGATCCCttttttttttt	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5615305	5615305	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5615305delC								NTF3 (10842 upstream) : ANO2 (56512 downstream)																							tgctttaattcccttcatgaa	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	10511165	10511165	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10511165delG								KLRD1 (41316 upstream) : KLRK1 (13788 downstream)																							aggcacaactggggaaaacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	21870091	21870091	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21870091delG								LDHB (59315 upstream) : KCNJ8 (47799 downstream)																							aatatgacttgggtaaggcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30975240	30975242	+	IGR	DEL	AAA	-	-	rs62891261		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30975240_30975242delAAA								CAPRIN2 (67792 upstream) : TSPAN11 (104120 downstream)																							aataaaaaccaaaaaaaaaaaaa	0.360													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34332570	34332571	+	IGR	INS	-	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34332570_34332571insC								ALG10 (151336 upstream) : None (None downstream)																							cttagacatttttccaacagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43166770	43166771	+	IGR	INS	-	A	A	rs76649619		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43166770_43166771insA								PRICKLE1 (183198 upstream) : ADAMTS20 (581242 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	46014878	46014878	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46014878delA								ANO6 (180691 upstream) : LOC400027 (104932 downstream)																							actctgtctcaaaaaaaaaaa	0.100													4	3	---	---	---	---	
SLC38A2	54407	broad.mit.edu	37	12	46765960	46765960	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46765960delT	uc001rpg.2	-						SLC38A2_uc001rph.2_Intron	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2						cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		CTGGACttaattttttttttt	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47651973	47651973	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47651973delT								FAM113B (21532 upstream) : RPAP3 (403743 downstream)																							aagacattacttgggccagaa	0.100													4	2	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48297898	48297899	+	Intron	INS	-	AGT	AGT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48297898_48297899insAGT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	ggaggaggaggaggaggaggag	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	48838958	48838958	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48838958delA								ZNF641 (93937 upstream) : ANP32D (27490 downstream)																							tccgtctcttaaaaaaaaaaa	0.189													4	2	---	---	---	---	
LOC283332	283332	broad.mit.edu	37	12	50305993	50305993	+	5'Flank	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50305993delC	uc001rvl.2	-						uc001rvm.2_Intron	NR_026948				Homo sapiens cDNA FLJ35896 fis, clone TESTI2009462.												0						TGAGCTGAATCCTAGGAAGAA	0.552													4	2	---	---	---	---	
BIN2	51411	broad.mit.edu	37	12	51681122	51681123	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51681122_51681123insT	uc001ryg.2	-						BIN2_uc009zlz.2_Intron|BIN2_uc001ryh.2_Intron|BIN2_uc010sng.1_Intron	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2							cytoplasm	protein binding			ovary(1)	1						gtttttttttgttttttttttt	0.015													4	2	---	---	---	---	
HELB	92797	broad.mit.edu	37	12	66729340	66729340	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66729340delG	uc001sti.2	+						HELB_uc010ssz.1_Intron|HELB_uc009zqt.1_Intron	NM_033647	NP_387467	Q8NG08	HELB_HUMAN	helicase (DNA) B						DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		gaggacttgtggtcaaggaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69720014	69720014	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69720014delG								CPSF6 (51877 upstream) : LYZ (22120 downstream)																							atatgtagatggcaaatgagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97216901	97216902	+	IGR	DEL	TG	-	-	rs10553724		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97216901_97216902delTG								C12orf63 (57853 upstream) : NEDD1 (84099 downstream)																							tgtgtttgtctgtgtgtgtgtg	0.257													5	3	---	---	---	---	
RIC8B	55188	broad.mit.edu	37	12	107197998	107197998	+	Intron	DEL	T	-	-	rs148649982		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107197998delT	uc001tlx.2	+						RIC8B_uc001tlw.2_Intron|RIC8B_uc001tly.2_Intron|RIC8B_uc001tlz.2_Intron	NM_018157	NP_060627	Q9NVN3	RIC8B_HUMAN	resistance to inhibitors of cholinesterase 8						regulation of G-protein coupled receptor protein signaling pathway	cell cortex|cytosol|plasma membrane	G-protein alpha-subunit binding|guanyl-nucleotide exchange factor activity			ovary(1)	1						cctttctttcttttttttttt	0.000													4	2	---	---	---	---	
BTBD11	121551	broad.mit.edu	37	12	107950789	107950789	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107950789delA	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3						actctgtctcaaaaaaaaaaG	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108757552	108757553	+	IGR	INS	-	TT	TT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108757552_108757553insTT								CMKLR1 (24458 upstream) : FICD (151498 downstream)																							ggtgtggtgtgtgtgtgtacat	0.000													4	2	---	---	---	---	
TRPV4	59341	broad.mit.edu	37	12	110225568	110225568	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110225568delA	uc001tpj.1	-						TRPV4_uc001tpg.1_Intron|TRPV4_uc001tph.1_Intron|TRPV4_uc001tpi.1_Intron|TRPV4_uc001tpk.1_Intron|TRPV4_uc001tpl.1_Intron	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,						actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						CAGTCAAGGTAAACACGGGTG	0.567													4	2	---	---	---	---	
GLTP	51228	broad.mit.edu	37	12	110321005	110321005	+	5'Flank	DEL	T	-	-	rs72177999		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110321005delT	uc001tpm.2	-						GLTP_uc010sxt.1_5'Flank	NM_016433	NP_057517	Q9NZD2	GLTP_HUMAN	glycolipid transfer protein							cytoplasm	glycolipid binding|glycolipid transporter activity				0		Lung NSC(355;2.38e-06)|Breast(359;0.00354)|Myeloproliferative disorder(1001;0.0122)		BRCA - Breast invasive adenocarcinoma(302;0.0025)		tgctaccctattttttttttt	0.000													3	3	---	---	---	---	
C12orf24	29902	broad.mit.edu	37	12	110907908	110907909	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110907908_110907909insT	uc001tqu.3	+						GPN3_uc001tqr.2_5'Flank|GPN3_uc001tqs.2_5'Flank|C12orf24_uc010sxz.1_Intron|C12orf24_uc009zvo.2_Intron|C12orf24_uc001tqt.2_Intron|C12orf24_uc001tqv.3_Intron	NM_013300	NP_037432	Q8WUB2	CL024_HUMAN	hypothetical protein LOC29902												0						CATCCtttttgttttttttttt	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111202524	111202524	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111202524delG								PPP1CC (21767 upstream) : CCDC63 (82287 downstream)																							ttgaactcctggcttcaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115450779	115450779	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115450779delC								TBX3 (328810 upstream) : MED13L (945604 downstream)																							ccctccgtgtccaggtctctT	0.259													4	2	---	---	---	---	
MED13L	23389	broad.mit.edu	37	12	116690184	116690184	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116690184delA	uc001tvw.2	-							NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		tgtctctactaaaaaaaaaaa	0.090													4	2	---	---	---	---	
FBXO21	23014	broad.mit.edu	37	12	117588814	117588814	+	Intron	DEL	G	-	-	rs4078518	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117588814delG	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		tgtgtCGGGCGGGGAGGACTG	0.254											OREG0022165	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
CCDC64	92558	broad.mit.edu	37	12	120508538	120508538	+	Intron	DEL	T	-	-	rs72233478		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120508538delT	uc001txl.1	+						CCDC64_uc001txk.2_Intron|CCDC64_uc009zwv.1_Intron|CCDC64_uc010sze.1_Intron|CCDC64_uc010szf.1_5'Flank	NM_207311	NP_997194	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64						Golgi to secretory granule transport|neuron projection development	centrosome	dynactin binding|Rab GTPase binding			ovary(2)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ggtataactcttttttttttt	0.000													3	3	---	---	---	---	
CABP1	9478	broad.mit.edu	37	12	121097297	121097298	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121097297_121097298insT	uc001tyu.2	+						CABP1_uc001tyv.2_Intron|CABP1_uc001tyw.2_Intron|CABP1_uc001tyx.2_Intron	NM_001033677	NP_001028849	Q9NZU7	CABP1_HUMAN	calcium binding protein 1 isoform 3							cell cortex|cell junction|Golgi apparatus|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|calcium-dependent protein binding|enzyme inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ttctttttttgttttttttttt	0.248													4	2	---	---	---	---	
SCARB1	949	broad.mit.edu	37	12	125277471	125277472	+	Intron	INS	-	T	T	rs151174063	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125277471_125277472insT	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Intron|SCARB1_uc010tbd.1_Intron|SCARB1_uc010tbe.1_Intron|SCARB1_uc001ugp.3_Intron	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CCTCTTCTATCTGGTCACCCAC	0.391													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128360691	128360692	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128360691_128360692insA								None (None upstream) : TMEM132C (538599 downstream)																							gactctgtctcaaaaaaaaaaa	0.079													4	2	---	---	---	---	
TMEM132C	92293	broad.mit.edu	37	12	129123911	129123912	+	Intron	INS	-	ATT	ATT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129123911_129123912insATT	uc001uhs.3	+							NM_001136103	NP_001129575	Q8N3T6	T132C_HUMAN	transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1						agatgatgatggtgataatggt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130456715	130456715	+	IGR	DEL	G	-	-	rs79918307		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130456715delG								TMEM132D (68503 upstream) : LOC100190940 (61284 downstream)																							agcagccactgggggCTCTCA	0.070													0	6	---	---	---	---	
MMP17	4326	broad.mit.edu	37	12	132316849	132316849	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132316849delC	uc001ujc.1	+							NM_016155	NP_057239	Q9ULZ9	MMP17_HUMAN	matrix metalloproteinase 17 preproprotein						proteolysis	anchored to membrane|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)		tggagaggatcggggggacgg	0.124													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19300614	19300615	+	IGR	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19300614_19300615delTG								None (None upstream) : LOC284232 (107928 downstream)																							tgtgtgtgcatgtgtgtgtgtg	0.262													4	2	---	---	---	---	
DKFZp686A1627	266695	broad.mit.edu	37	13	19649682	19649683	+	Intron	INS	-	GA	GA	rs147261735	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19649682_19649683insGA	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0						CGATTTGTCACAATCCACAAAA	0.520													2	4	---	---	---	---	
PSPC1	55269	broad.mit.edu	37	13	20358931	20358932	+	5'Flank	DEL	AA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20358931_20358932delAA	uc001uml.2	-						PSPC1_uc001umj.1_5'Flank|PSPC1_uc001umk.1_5'Flank	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN	paraspeckle protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		aacaAGAGACAAAAAAAAAGGG	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23253536	23253538	+	IGR	DEL	CTT	-	-	rs113089800		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23253536_23253538delCTT								FGF9 (974896 upstream) : SGCG (501522 downstream)																							ccaccaccaccttcaccaccacc	0.059													4	4	---	---	---	---	
MTUS2	23281	broad.mit.edu	37	13	29899722	29899723	+	Intron	INS	-	GAA	GAA	rs139957279	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29899722_29899723insGAA	uc001usl.3	+							NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						aggaggaagaggaagaagaaga	0.139													4	2	---	---	---	---	
HMGB1	3146	broad.mit.edu	37	13	31115126	31115127	+	Intron	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31115126_31115127delGT	uc001usz.2	-							NM_002128	NP_002119	P09429	HMGB1_HUMAN	high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		TCTCTTTTGGGTGTGTGTGTGT	0.376													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31359574	31359574	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31359574delT								ALOX5AP (21018 upstream) : C13orf33 (120738 downstream)																							CATCCTTCCCTTTTTTTTTTT	0.488													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31655314	31655315	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31655314_31655315insA								C13orf26 (106163 upstream) : HSPH1 (55450 downstream)																							gagggatggagaagggatggca	0.000													4	2	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33883808	33883808	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33883808delT	uc001uux.2	-						STARD13_uc010abh.1_Intron	NM_052851	NP_443083	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GTGTTCAGGATTTCCTAGTCC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	43582023	43582023	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43582023delT								EPSTI1 (15646 upstream) : DNAJC15 (15339 downstream)																							gcccagctaatttttgtgttt	0.000													4	2	---	---	---	---	
INTS6	26512	broad.mit.edu	37	13	51977483	51977483	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51977483delC	uc001vfk.2	-						INTS6_uc001vfj.2_Intron|INTS6_uc001vfl.2_Intron	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a						snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		actttgggagcccaaggtcac	0.134													4	2	---	---	---	---	
THSD1P1	374500	broad.mit.edu	37	13	52855275	52855276	+	Intron	INS	-	TG	TG	rs2181567		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52855275_52855276insTG	uc001vgm.1	-											Homo sapiens cDNA FLJ14630 fis, clone NT2RP2000459.												0						actggtgtgcttgtgtgtgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80050112	80050113	+	IGR	DEL	CA	-	-	rs150998999		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80050112_80050113delCA								RBM26 (70189 upstream) : NDFIP2 (5146 downstream)																							acacacacaccacacacacaca	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80365641	80365641	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80365641delG								NDFIP2 (235436 upstream) : SPRY2 (544473 downstream)																							tgggtctgttgcagcatgggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112850189	112850192	+	IGR	DEL	TTCT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112850189_112850192delTTCT								SOX1 (124169 upstream) : C13orf28 (180477 downstream)																							tttcccttccttctttcttccttt	0.000													4	4	---	---	---	---	
MCF2L	23263	broad.mit.edu	37	13	113637164	113637164	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113637164delG	uc001vsu.2	+						MCF2L_uc001vsq.2_Intron|MCF2L_uc010tjr.1_Intron|MCF2L_uc001vsr.2_Intron	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				AGGATGATCAGGGAAATTGCA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114906741	114906742	+	IGR	INS	-	CA	CA	rs144704073	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114906741_114906742insCA								RASA3 (8646 upstream) : CDC16 (93620 downstream)																							acacacacactcacacacacac	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	114995743	114995743	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114995743delC								RASA3 (97648 upstream) : CDC16 (4619 downstream)																							ttgactctgaccccccggcct	0.000													4	2	---	---	---	---	
HNRNPC	3183	broad.mit.edu	37	14	21709416	21709417	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21709416_21709417insA	uc001vzy.2	-						HNRNPC_uc001vzw.2_Intron|HNRNPC_uc001wad.2_Intron|HNRNPC_uc001vzx.2_Intron|HNRNPC_uc001vzz.2_Intron|HNRNPC_uc001waa.2_Intron|HNRNPC_uc010ail.2_Intron|HNRNPC_uc010tlq.1_Intron|HNRNPC_uc001wab.2_Intron|HNRNPC_uc001wac.2_Intron|HNRNPC_uc001waf.2_Intron|HNRNPC_uc001wae.2_Intron	NM_031314	NP_112604	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C							catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding				0	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		gactatgtctcaaaaaaaaaaa	0.129													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22905224	22905225	+	Intron	DEL	AC	-	-	rs35149290		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22905224_22905225delAC	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		AGTGCAGAATacacacacacac	0.361													3	3	---	---	---	---	
HAUS4	54930	broad.mit.edu	37	14	23427534	23427534	+	5'Flank	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23427534delT	uc001whr.2	-						HAUS4_uc001whq.2_5'Flank|HAUS4_uc001whs.2_5'Flank|HAUS4_uc001wht.2_5'Flank|HAUS4_uc001whu.2_5'Flank|HAUS4_uc001whv.2_5'Flank|HAUS4_uc001whw.2_5'Flank|HAUS4_uc001whx.2_5'Flank	NM_017815	NP_060285	Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				ovary(1)	1						TGTCTTAATCttttttttttt	0.050													4	2	---	---	---	---	
IPO4	79711	broad.mit.edu	37	14	24657847	24657847	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24657847delG	uc001wmv.1	-						IPO4_uc001wmu.2_5'UTR|IPO4_uc001wmx.1_Intron|IPO4_uc001wmy.1_Intron|IPO4_uc010tnz.1_Intron|IPO4_uc001wmw.1_Intron|IPO4_uc001wmz.1_Intron	NM_024658	NP_078934	Q8TEX9	IPO4_HUMAN	importin 4						intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity			kidney(1)	1				GBM - Glioblastoma multiforme(265;0.0087)		TCCGTGGCCTGGGGGGAAGCT	0.701													4	2	---	---	---	---	
FOXA1	3169	broad.mit.edu	37	14	38065252	38065252	+	5'Flank	DEL	T	-	-	rs144611453		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38065252delT	uc001wuf.2	-						FOXA1_uc010tpz.1_5'Flank	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1						chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		ATGACATAACTTTTTTTTTTT	0.537													3	5	---	---	---	---	
SOS2	6655	broad.mit.edu	37	14	50655784	50655785	+	Intron	INS	-	AT	AT	rs141877150	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50655784_50655785insAT	uc001wxs.3	-						SOS2_uc010tql.1_Intron	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					ctcCATcacacacacacacaca	0.064													2	4	---	---	---	---	
KIAA0831	22863	broad.mit.edu	37	14	55839024	55839025	+	Intron	INS	-	C	C	rs141913903	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55839024_55839025insC	uc001xbx.1	-						FBXO34_uc001xbv.2_Intron|KIAA0831_uc001xbw.1_Intron	NM_014924	NP_055739	Q6ZNE5	BAKOR_HUMAN	Barkor						autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0						CCCATCTGCCTCCTCTTGCTGG	0.495													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62130805	62130805	+	IGR	DEL	T	-	-	rs145945124		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62130805delT								PRKCH (113110 upstream) : HIF1A (31314 downstream)																							ccCTAAGCTATTTTTTAAAAG	0.104													3	3	---	---	---	---	
GALNTL1	57452	broad.mit.edu	37	14	69739947	69739947	+	Intron	DEL	G	-	-	rs75777292		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69739947delG	uc010aqu.1	+						GALNTL1_uc001xla.1_Intron|GALNTL1_uc001xlb.1_Intron	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		TGATGAAAATGGGTTTTGGAG	0.438													2	4	---	---	---	---	
ZFYVE1	53349	broad.mit.edu	37	14	73471702	73471702	+	Intron	DEL	A	-	-	rs146354108		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73471702delA	uc001xnm.2	-						ZFYVE1_uc010arj.2_Intron	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1							endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		accccgtctcaaaaaaaaaaa	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	75704146	75704147	+	IGR	DEL	CA	-	-	rs35995454		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75704146_75704147delCA								TMED10 (60797 upstream) : FOS (41334 downstream)																							GTGTGTGTACcacacacacaca	0.450													5	3	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	78999420	78999421	+	Intron	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78999420_78999421delTC	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CCAACTGATATCTCTCTCTCTC	0.277													4	2	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81289320	81289320	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81289320delC	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		CAGAATGTCTCCAAAGCTGGA	0.443													4	2	---	---	---	---	
FBLN5	10516	broad.mit.edu	37	14	92408128	92408129	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92408128_92408129insT	uc001xzx.3	-						FBLN5_uc010aud.2_Intron|FBLN5_uc010aue.2_Intron	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				gtaaaatgggggggtatgtacg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	93368729	93368730	+	IGR	DEL	CT	-	-	rs111421122	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93368729_93368730delCT								GOLGA5 (62425 upstream) : CHGA (20715 downstream)																							cctcttcctcctctcctcctcc	0.144													5	6	---	---	---	---	
BDKRB2	624	broad.mit.edu	37	14	96683146	96683151	+	Intron	DEL	AGGAGG	-	-	rs79502372		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96683146_96683151delAGGAGG	uc010avm.1	+						BDKRB2_uc010avl.1_Intron|BDKRB2_uc010twu.1_Intron|BDKRB2_uc001yfg.2_Intron	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2						arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		gagaagaagaaggaggaggaggagga	0.160													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98012545	98012546	+	IGR	INS	-	AA	AA	rs111556153		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98012545_98012546insAA								VRK1 (664595 upstream) : C14orf64 (379401 downstream)																							GAGCTGTAAGGAAAAAAAAAAA	0.421													4	2	---	---	---	---	
BCL11B	64919	broad.mit.edu	37	14	99657740	99657740	+	Intron	DEL	A	-	-	rs35767140		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99657740delA	uc001yga.2	-						BCL11B_uc001ygb.2_Intron	NM_138576	NP_612808	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B isoform 1							nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		ACCTAAATCTaaaaaaaaaaa	0.149			T	TLX3	T-ALL								3	4	---	---	---	---	
CCDC85C	317762	broad.mit.edu	37	14	100010827	100010828	+	Intron	DEL	GT	-	-	rs111754976		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100010827_100010828delGT	uc010avr.2	-							NM_001144995	NP_001138467	A6NKD9	CC85C_HUMAN	coiled-coil domain containing 85C												0						aatttgaaGGgtgtgtgtgtgt	0.178													4	2	---	---	---	---	
TECPR2	9895	broad.mit.edu	37	14	102963693	102963693	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102963693delT	uc001ylw.1	+						TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2								protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						GCCCAGGCCCTTCTGTCCTTT	0.617													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102981791	102981794	+	IGR	DEL	TTTT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102981791_102981794delTTTT								ANKRD9 (5663 upstream) : RCOR1 (77439 downstream)																							GTtctcttgctttttttttttttt	0.181													3	3	---	---	---	---	
TDRD9	122402	broad.mit.edu	37	14	104515484	104515485	+	Intron	DEL	TA	-	-	rs56057606		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104515484_104515485delTA	uc001yom.3	+						TDRD9_uc001yon.3_Intron	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9						cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				tgtgtgtgtgtatgtatgtatg	0.054													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	105975160	105975161	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105975160_105975161insT								C14orf80 (9576 upstream) : TMEM121 (17792 downstream)																							TTTTGACTCTCTTTTTTTTCCA	0.302													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107043268	107043268	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107043268delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						ttacagatggaaaattaccag	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20010729	20010730	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20010729_20010730insT								None (None upstream) : GOLGA6L6 (726364 downstream)																							cttctgtctagtttttttttgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20560992	20560993	+	IGR	INS	-	G	G	rs138749934		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20560992_20560993insG								None (None upstream) : GOLGA6L6 (176101 downstream)																							TCAGGGACGGAGGGGCTTGTTG	0.545													4	2	---	---	---	---	
MIR1268	100302233	broad.mit.edu	37	15	22514406	22514406	+	5'Flank	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22514406delG	hsa-mir-1268|MI0006405	-																							0						GTAACAGTTTGTGGGGGCGCT	0.577													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	24155388	24155388	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24155388delA								NDN (222938 upstream) : PWRN2 (254538 downstream)																							cttgtgggccaaaacttgtat	0.000													4	2	---	---	---	---	
ATP10A	57194	broad.mit.edu	37	15	25965726	25965730	+	Intron	DEL	GGAGA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25965726_25965730delGGAGA	uc010ayu.2	-							NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		gaggaaggagggagaggagaggagg	0.351													5	4	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28517891	28517892	+	Intron	DEL	TA	-	-	rs75694916		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28517891_28517892delTA	uc001zbj.2	-						HERC2_uc001zbl.1_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAAGAAAAGGTAAAGAGAGAGA	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	29941261	29941262	+	IGR	INS	-	AC	AC	rs145826521	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29941261_29941262insAC								FAM189A1 (78334 upstream) : TJP1 (51097 downstream)																							GGGacacatgtacacacacaca	0.188													4	2	---	---	---	---	
ELL3	80237	broad.mit.edu	37	15	44074091	44074092	+	Intron	DEL	TC	-	-	rs35028910		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44074091_44074092delTC	uc001zsx.1	-							NM_025165	NP_079441	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3						positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				ovary(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		TACttcttcttctttttttttt	0.010													3	3	---	---	---	---	
MAP2K1	5604	broad.mit.edu	37	15	66775294	66775294	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66775294delC	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						tatgtgttctctgtcaaagca	0.224									Cardiofaciocutaneous_syndrome				4	2	---	---	---	---	
UACA	55075	broad.mit.edu	37	15	70979772	70979772	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70979772delC	uc002asr.2	-						UACA_uc010uke.1_Intron|UACA_uc002asq.2_Intron|UACA_uc010bin.1_Intron	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and							cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						AAGGGGAGAACCCACAGGAAA	0.468													4	2	---	---	---	---	
MYO9A	4649	broad.mit.edu	37	15	72131741	72131741	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72131741delT	uc002atl.3	-						MYO9A_uc002atj.2_Intron|MYO9A_uc002atk.2_Intron	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						GTGAATCAGGttttttttttc	0.234													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	72741448	72741448	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72741448delA								TMEM202 (40741 upstream) : ARIH1 (25219 downstream)																							aagggttaggaattgggggat	0.000													4	2	---	---	---	---	
HOMER2	9455	broad.mit.edu	37	15	83546615	83546616	+	Intron	INS	-	T	T	rs142362521	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83546615_83546616insT	uc002bjg.2	-						HOMER2_uc002bjh.2_Intron|HOMER2_uc002bjj.2_Intron|HOMER2_uc002bji.2_Intron	NM_199330	NP_955362	Q9NSB8	HOME2_HUMAN	homer 2 isoform 2						metabotropic glutamate receptor signaling pathway	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane					0						GGCGTGGAAAATGGAGATCTAA	0.515													4	2	---	---	---	---	
BLM	641	broad.mit.edu	37	15	91343911	91343911	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91343911delA	uc002bpr.2	+						BLM_uc010uqh.1_Intron|BLM_uc010uqi.1_Intron|BLM_uc010bnx.2_Intron|BLM_uc002bpt.2_Intron	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein						double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			actccatctcaaaaaaaaaag	0.184			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102165238	102165238	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102165238delT								PCSK6 (135051 upstream) : TM2D3 (7942 downstream)																							GAACAGATGGTATAAAAAAAA	0.284													4	2	---	---	---	---	
TMEM8A	58986	broad.mit.edu	37	16	425533	425534	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:425533_425534insT	uc002cgu.3	-						TMEM8A_uc002cgv.3_Intron	NM_021259	NP_067082	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8 (five membrane-spanning						cell adhesion	integral to plasma membrane				central_nervous_system(2)|pancreas(1)	3						TGGTGCCtttcttttttttttt	0.337													8	4	---	---	---	---	
TBC1D24	57465	broad.mit.edu	37	16	2535434	2535434	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2535434delG	uc002cql.2	+						TBC1D24_uc002cqk.2_Intron	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24						neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0						gggcagcaccgtgtccctctc	0.000													4	2	---	---	---	---	
ADCY9	115	broad.mit.edu	37	16	4119943	4119943	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4119943delA	uc002cvx.2	-							NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						ctaaaagtacaaaaaaattag	0.000													4	2	---	---	---	---	
SEC14L5	9717	broad.mit.edu	37	16	5011302	5011303	+	Intron	DEL	AC	-	-	rs144708171	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5011302_5011303delAC	uc002cye.2	+							NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5							integral to membrane|intracellular	transporter activity				0						aacaacaacaacaaAGTTGCTG	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5188597	5188597	+	IGR	DEL	C	-	-	rs142566333		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5188597delC								FAM86A (40808 upstream) : A2BP1 (880535 downstream)																							AGGGAGATGACtttttttttt	0.189													4	2	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	7069640	7069640	+	Intron	DEL	A	-	-	rs112606393		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7069640delA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		CAGGGCTGTGATTCCTAGGCT	0.398													4	2	---	---	---	---	
C16orf72	29035	broad.mit.edu	37	16	9201726	9201726	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9201726delT	uc002czm.2	+						uc002czn.2_5'Flank	NM_014117	NP_054836	Q14CZ0	CP072_HUMAN	hypothetical protein LOC29035											large_intestine(1)	1						GTCTTGGTCCTTTTTTTTTTG	0.448													8	4	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12377067	12377067	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12377067delT	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						TTTCTTACCCTGGGAGCAGCA	0.478													4	2	---	---	---	---	
CPPED1	55313	broad.mit.edu	37	16	12852687	12852689	+	Intron	DEL	GAT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12852687_12852689delGAT	uc002dca.3	-						CPPED1_uc002dcb.3_Intron	NM_018340	NP_060810	Q9BRF8	CPPED_HUMAN	calcineurin-like phosphoesterase domain								hydrolase activity|metal ion binding				0						AATAAGACACgatgatgatgatg	0.266													4	2	---	---	---	---	
ABCC6	368	broad.mit.edu	37	16	16306169	16306170	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16306169_16306170insT	uc002den.3	-						ABCC6_uc010bvo.2_Intron|ABCC6_uc010uzz.1_Intron	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6						response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		CGAACTGTGTAttttttttttt	0.267													5	3	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19021263	19021263	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19021263delA	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						actccagctcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19074994	19074995	+	3'UTR	INS	-	TGTG	TGTG	rs147860485	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19074994_19074995insTGTG	uc002dfq.2	+	16					TMC7_uc010vap.1_3'UTR	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						AGTTTTCTATTtgtgtgtgtgt	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	19140155	19140155	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19140155delT								ITPRIPL2 (7207 upstream) : SYT17 (39483 downstream)																							CTGCTCCAGATTTTAAGCAAT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21890632	21890632	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21890632delA	uc002djr.3	-						uc002djs.3_Intron|uc010vbo.1_RNA	NM_130464	NP_569731			nuclear pore complex interacting protein-like 3																		TTTCTCTTACAAAAAAAAAAA	0.224													11	5	---	---	---	---	
SCNN1B	6338	broad.mit.edu	37	16	23356331	23356332	+	Intron	DEL	AG	-	-	rs112886828		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23356331_23356332delAG	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	ggagagagaaagagagagagag	0.183													4	2	---	---	---	---	
PRKCB	5579	broad.mit.edu	37	16	23917225	23917235	+	Intron	DEL	CTAAGGGTTTC	-	-	rs144150659		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23917225_23917235delCTAAGGGTTTC	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	tcatactcctctaagggtttcctagcattcc	0.000													4	2	---	---	---	---	
C16orf93	90835	broad.mit.edu	37	16	30769871	30769874	+	Intron	DEL	TTTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30769871_30769874delTTTG	uc002dzm.2	-						C16orf93_uc002dzn.2_Intron|C16orf93_uc002dzo.2_Intron	NM_001014979	NP_001014979	A1A4V9	CP093_HUMAN	hypothetical protein LOC90835												0						AGCTGTGCTTtttgtttgtttgtt	0.069													4	2	---	---	---	---	
FBXL19	54620	broad.mit.edu	37	16	30955692	30955692	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30955692delC	uc002eab.2	+						FBXL19_uc002dzz.1_Intron|FBXL19_uc002eaa.1_Intron	NM_001099784	NP_001093254	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19								DNA binding|zinc ion binding			ovary(2)|lung(1)|breast(1)	4						ctgaaaggctccagggtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32113354	32113355	+	IGR	INS	-	T	T	rs149955517		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32113354_32113355insT								ZNF267 (184728 upstream) : HERC2P4 (49255 downstream)																							ttttattatactttaagtttta	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32524502	32524502	+	IGR	DEL	A	-	-	rs112225322		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32524502delA								HERC2P4 (360628 upstream) : TP53TG3B (160339 downstream)																							gtgccgaatcaaaaaaaaatg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32535345	32535345	+	IGR	DEL	T	-	-	rs111821255		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32535345delT								HERC2P4 (371471 upstream) : TP53TG3B (149496 downstream)																							cagcttcatcttggaatattc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32625136	32625136	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32625136delT								HERC2P4 (461262 upstream) : TP53TG3B (59705 downstream)																							ATTGAGCACATTTTTGGCCTC	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33042909	33042909	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33042909delA								SLC6A10P (146446 upstream) : MIR1826 (922599 downstream)																							CTGTTGTGGGAAAACAGGCTT	0.398													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33855145	33855146	+	IGR	INS	-	T	T	rs139175767		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33855145_33855146insT								SLC6A10P (958682 upstream) : MIR1826 (110362 downstream)																							agctgatgagcttaaaaaaaag	0.025													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33907085	33907085	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33907085delA								None (None upstream) : MIR1826 (58423 downstream)																							atcttcatataaaaactagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	47888093	47888094	+	Intron	DEL	AC	-	-	rs117435912	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47888093_47888094delAC	uc002eex.1	-											Homo sapiens cDNA clone IMAGE:5303550.																		cacacctccaacacacacacac	0.025													4	2	---	---	---	---	
CCL22	6367	broad.mit.edu	37	16	57394212	57394212	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57394212delG	uc002elh.2	+							NM_002990	NP_002981	O00626	CCL22_HUMAN	small inducible cytokine A22 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|response to virus|signal transduction	extracellular space	chemokine activity				0						AGAATCCTCTGGTCACCATCC	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58468703	58468705	+	IGR	DEL	TCC	-	-	rs75905683		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58468703_58468705delTCC								GINS3 (28656 upstream) : NDRG4 (28844 downstream)																							CTGCACTGAATCCTCCTGATCAG	0.448													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	58472299	58472302	+	IGR	DEL	GTGT	-	-	rs139162149		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58472299_58472302delGTGT								GINS3 (32252 upstream) : NDRG4 (25247 downstream)																							GTTTGTTCCCGTGTGTGTACCCTG	0.574													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66038548	66038549	+	IGR	DEL	TT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66038548_66038549delTT								LOC283867 (428345 upstream) : CDH5 (361976 downstream)																							TCCTGATTCATTTTTTTTTTTC	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66042889	66042893	+	IGR	DEL	GACTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66042889_66042893delGACTG								LOC283867 (432686 upstream) : CDH5 (357632 downstream)																							atgttggccagactggtcttgaact	0.010													4	2	---	---	---	---	
ATP6V0D1	9114	broad.mit.edu	37	16	67502287	67502288	+	Intron	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67502287_67502288delTC	uc002ete.1	-						ATP6V0D1_uc010vjo.1_Intron	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		gcccaggagttcaagaccagcc	0.000													4	2	---	---	---	---	
CDH1	999	broad.mit.edu	37	16	68795655	68795655	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68795655delA	uc002ewg.1	+						CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding	p.?(1)		breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ctaggtagggaagggtgttct	0.000			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				4	2	---	---	---	---	
CDH1	999	broad.mit.edu	37	16	68823421	68823422	+	Intron	INS	-	T	T	rs78024683		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68823421_68823422insT	uc002ewg.1	+						CDH1_uc010vlj.1_Intron|CDH1_uc010cfg.1_Intron	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein						adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ATTGGCTCATCTTTTTTTTTTt	0.238			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73868806	73868807	+	IGR	INS	-	C	C	rs143170455	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73868806_73868807insC								HTA (741136 upstream) : PSMD7 (461874 downstream)																							aagaaGCGTCTCCCCCCGTGGG	0.262													4	4	---	---	---	---	
GLG1	2734	broad.mit.edu	37	16	74576650	74576651	+	Intron	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74576650_74576651insG	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						gaaggaaggaaggaaggaagga	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81786680	81786680	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81786680delA								CMIP (41315 upstream) : PLCG2 (26250 downstream)																							TGAGCTGTCCAGGGTGCCCCA	0.453													4	2	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701506	85701507	+	Intron	INS	-	GTCCA	GTCCA	rs148610400	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701506_85701507insGTCCA	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						CAACAAAAATGGTCCACGTACC	0.436													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86169124	86169124	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86169124delT								IRF8 (212915 upstream) : LOC732275 (196332 downstream)																							tgtacctgactccagcccaca	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	88372769	88372770	+	IGR	INS	-	A	A	rs150922015	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88372769_88372770insA								BANP (261846 upstream) : ZNF469 (121109 downstream)																							GACAGGGTGGCGGGGGACATGg	0.366													3	4	---	---	---	---	
NXN	64359	broad.mit.edu	37	17	856055	856056	+	Intron	INS	-	G	G	rs67127435		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:856055_856056insG	uc002fsa.2	-							NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		GGTCACACTGTGGGGGGGCTGG	0.639													4	2	---	---	---	---	
PAFAH1B1	5048	broad.mit.edu	37	17	2526862	2526863	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2526862_2526863insT	uc002fuw.3	+						PAFAH1B1_uc010ckb.1_Intron	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,						acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1						aaaaaatgttgtttttttttct	0.000													4	2	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7578213	7578214	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578213_7578214delAA	uc002gim.2	-	6	829_830	c.635_636delTT	c.(634-636)TTTfs	p.F212fs	TP53_uc002gig.1_Frame_Shift_Del_p.F212fs|TP53_uc002gih.2_Frame_Shift_Del_p.F212fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.F80fs|TP53_uc010cng.1_Frame_Shift_Del_p.F80fs|TP53_uc002gii.1_Frame_Shift_Del_p.F80fs|TP53_uc010cnh.1_Frame_Shift_Del_p.F212fs|TP53_uc010cni.1_Frame_Shift_Del_p.F212fs|TP53_uc002gij.2_Frame_Shift_Del_p.F212fs|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Frame_Shift_Del_p.F119fs|TP53_uc002gio.2_Frame_Shift_Del_p.F80fs|TP53_uc010vug.1_Frame_Shift_Del_p.F173fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	212	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		F -> S (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).|F -> V (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.F212fs*3(7)|p.0?(7)|p.F212L(3)|p.F212S(2)|p.F212I(2)|p.D208fs*1(1)|p.T211_F212insX(1)|p.R209_R213delRNTFR(1)|p.D207_R213delDDRNTFR(1)|p.T211fs*28(1)|p.T211_S215delTFRHS(1)|p.K164_P219del(1)|p.D207_V216del10(1)|p.F212fs*4(1)|p.F212Y(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACTATGTCGAAAAGTGTTTCT	0.535		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			29	13	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7667783	7667784	+	Intron	INS	-	T	T	rs148266608		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7667783_7667784insT	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				tcttcttcctcttttttttttt	0.178													4	2	---	---	---	---	
SPDYE4	388333	broad.mit.edu	37	17	8658113	8658113	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8658113delC	uc010cnz.1	-							NM_001128076	NP_001121548	A6NLX3	SPDE4_HUMAN	speedy homolog E4												0						ATGGGTCATTCCCTTCAGATC	0.488													4	2	---	---	---	---	
STX8	9482	broad.mit.edu	37	17	9333967	9333968	+	Intron	DEL	TT	-	-	rs142594050		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9333967_9333968delTT	uc002glx.2	-							NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						TGGTTTTGGCtttttttttttt	0.035													3	3	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	9950053	9950053	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9950053delA	uc002gmg.1	-						GAS7_uc010coh.1_Intron	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						actctgtctcaaaaaaaaaaa	0.000			T	MLL	AML*								4	2	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20772478	20772478	+	Intron	DEL	G	-	-	rs36064579		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20772478delG	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						aagaaaagacggggggtgaaa	0.000													3	5	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21199106	21199106	+	Intron	DEL	G	-	-	rs5819734		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21199106delG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GCTTGGTGAAGGGGGGGCCAC	0.602													3	3	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21210512	21210513	+	Intron	INS	-	C	C	rs142795626		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21210512_21210513insC	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		agcagccccatctgaggctgtc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21248150	21248151	+	IGR	INS	-	C	C	rs142379650		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21248150_21248151insC								MAP2K3 (29601 upstream) : KCNJ12 (31548 downstream)																							ACAACAGTGGTCatacctctgg	0.228													3	4	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21313451	21313451	+	Intron	DEL	C	-	-	rs147481555		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21313451delC	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CTGGCAGTGTCCCCCAGGAGT	0.657										Prostate(3;0.18)			8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25271281	25271282	+	IGR	INS	-	A	A	rs150331412		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25271281_25271282insA								None (None upstream) : WSB1 (349824 downstream)																							CAAGAACTTtggctgtcaaccg	0.054													6	3	---	---	---	---	
C17orf63	55731	broad.mit.edu	37	17	27121241	27121241	+	Intron	DEL	T	-	-	rs67714175		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27121241delT	uc002hct.1	-						C17orf63_uc010wax.1_Intron|C17orf63_uc010way.1_Intron|C17orf63_uc002hcw.2_Intron	NM_018182	NP_060652	Q8WU58	CQ063_HUMAN	hypothetical protein LOC55731											ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)			TGTCttttgcttttttttttt	0.204													4	3	---	---	---	---	
LRRC37B2	147172	broad.mit.edu	37	17	28986110	28986111	+	Intron	INS	-	A	A	rs71897533		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28986110_28986111insA	uc010csj.1	+											Homo sapiens cDNA FLJ90801 fis, clone Y79AA1000207.												0						gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	30589566	30589566	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30589566delC								RHOT1 (36821 upstream) : RHBDL3 (3629 downstream)																							ATCCACCCTTCCCCAGCCCTT	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36989119	36989120	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36989119_36989120insT								CWC25 (7511 upstream) : C17orf98 (2221 downstream)																							cgcaccaagccttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	37078645	37078648	+	5'Flank	DEL	CTGT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37078645_37078648delCTGT	uc002hrb.1	+											Homo sapiens cDNA FLJ33616 fis, clone BRAMY2018785.																		CTGGATAAAGCTGTCTGTAAGGTG	0.431													5	3	---	---	---	---	
GSDMA	284110	broad.mit.edu	37	17	38121480	38121482	+	Intron	DEL	AAG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38121480_38121482delAAG	uc002htl.1	+						GSDMA_uc002htm.1_5'Flank	NM_178171	NP_835465	Q96QA5	GSDMA_HUMAN	gasdermin 1						apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0						gaaagaaagaaagaaggaaggaa	0.064													2	4	---	---	---	---	
TTC25	83538	broad.mit.edu	37	17	40088788	40088789	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40088788_40088789insT	uc002hyj.3	+						TTC25_uc010cxt.2_Intron|TTC25_uc010cxs.1_Intron	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				GGAAACTGttgttttttttttg	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	42407013	42407013	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42407013delT								SLC25A39 (4796 upstream) : GRN (15478 downstream)																							CTAATTACTCTTTTTTTTTTT	0.259													4	2	---	---	---	---	
TBKBP1	9755	broad.mit.edu	37	17	45782170	45782171	+	Intron	INS	-	AA	AA	rs144498682	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45782170_45782171insAA	uc002ilu.2	+							NM_014726	NP_055541	A7MCY6	TBKB1_HUMAN	TBK1 binding protein 1						innate immune response						0						ATCGTTTCCAGAAGTGTGTGAG	0.520													5	3	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47652159	47652159	+	5'Flank	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47652159delC	uc002ipa.2	+						NXPH3_uc010wlw.1_5'Flank	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					TTGGGCCCAGCCCAAGCTGGG	0.607													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49226937	49226937	+	IGR	DEL	T	-	-	rs71355722		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49226937delT								SPAG9 (28711 upstream) : NME1 (3983 downstream)																							catgttgatcttttttttttt	0.000													4	2	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	49993501	49993502	+	Intron	INS	-	AC	AC	rs141187699	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49993501_49993502insAC	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			CGCTGCTGGAAACAGTGTCATT	0.465													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	57530735	57530735	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57530735delT								YPEL2 (51640 upstream) : DHX40 (112151 downstream)																							tttttctttcttttttttttt	0.189													3	3	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59223474	59223475	+	Intron	INS	-	T	T	rs114975714		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59223474_59223475insT	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CTGGttttttgttttttttttt	0.243													2	4	---	---	---	---	
MAP3K3	4215	broad.mit.edu	37	17	61714553	61714553	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61714553delA	uc002jbg.2	+						MAP3K3_uc002jbe.2_Intron|MAP3K3_uc002jbf.2_Intron|MAP3K3_uc002jbh.2_Intron|MAP3K3_uc010wpo.1_Intron|MAP3K3_uc010wpp.1_Intron	NM_002401	NP_002392	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3						MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6						GAGACCAACCAAAAAAAAAAA	0.398													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	61930328	61930328	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61930328delA								SMARCD2 (9977 upstream) : TCAM1P (4048 downstream)																							TTGGTTCGGTAACAAAGAGGA	0.144													4	2	---	---	---	---	
PLEKHM1P	440456	broad.mit.edu	37	17	62814076	62814077	+	Intron	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62814076_62814077insG	uc002jew.3	-						PLEKHM1P_uc002jev.3_Intron|PLEKHM1P_uc010wqe.1_Intron	NR_024386				RecName: Full=Putative pleckstrin homology domain-containing family M member 1P;												0						ataataagggtggcaaagatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63106066	63106066	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63106066delA								GNA13 (53146 upstream) : RGS9 (27483 downstream)																							ctcagcctggaatgctccttt	0.194													4	2	---	---	---	---	
PRKCA	5578	broad.mit.edu	37	17	64340639	64340640	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64340639_64340640insA	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	acaacaacaacaacaaAAAAAC	0.089													4	2	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65398952	65398953	+	Intron	INS	-	TG	TG			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65398952_65398953insTG	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			ccggctaatttttgtgttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70047128	70047128	+	IGR	DEL	A	-	-	rs79107882		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70047128delA								None (None upstream) : SOX9 (70033 downstream)																							aaagaagaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72442590	72442591	+	Intron	INS	-	A	A	rs78718914		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72442590_72442591insA	uc002jks.2	+						GPRC5C_uc002jkp.2_Intron|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Intron|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_Intron	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						gactccgtctcaaaaaaaaaaa	0.233													4	2	---	---	---	---	
CD300A	11314	broad.mit.edu	37	17	72462028	72462029	+	5'Flank	INS	-	GT	GT	rs147548600	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72462028_72462029insGT	uc002jkv.2	+						CD300A_uc002jkw.2_5'Flank|CD300A_uc010dfr.2_5'Flank|CD300A_uc010dfs.2_5'Flank	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen						cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						ggtgagtgtgagtgtgtgtatg	0.030													2	5	---	---	---	---	
CD300A	11314	broad.mit.edu	37	17	72476878	72476881	+	Intron	DEL	CTTT	-	-	rs67018651		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72476878_72476881delCTTT	uc002jkv.2	+						CD300A_uc002jkw.2_Intron|CD300A_uc010dfr.2_Intron|CD300A_uc010dfs.2_Intron	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen						cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						GCTTTCTttcctttctttctttct	0.250													5	4	---	---	---	---	
MGAT5B	146664	broad.mit.edu	37	17	74863653	74863664	+	5'Flank	DEL	GCCAGGCTGCAG	-	-	rs75770756		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74863653_74863664delGCCAGGCTGCAG	uc002jtg.3	+						MGAT5B_uc002jth.2_5'Flank			Q3V5L5	MGT5B_HUMAN	Homo sapiens GnT-IX mRNA for N-Acetylglucosaminyltransferase IX, complete cds.							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						CCTCGCATAAGCCAGGCTGCAGCATCGTGGCC	0.613													4	2	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76020882	76020882	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76020882delT	uc002jud.2	+						TNRC6C_uc002juc.2_Intron|TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			gtattgatacttttttttttt	0.000													6	3	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77292878	77292879	+	Intron	INS	-	TCT	TCT	rs148773857	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77292878_77292879insTCT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			cctctccctcctcttttcctcc	0.000													4	4	---	---	---	---	
HRNBP3	146713	broad.mit.edu	37	17	77319538	77319538	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77319538delT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044	A6NFN3	RFOX3_HUMAN	hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)			AGAGGTCCACTGTTTTGTGAA	0.527													6	4	---	---	---	---	
CCDC40	55036	broad.mit.edu	37	17	78063308	78063311	+	Intron	DEL	TCTC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78063308_78063311delTCTC	uc010dht.2	+						CCDC40_uc002jxm.3_Intron|CCDC40_uc002jxn.3_Intron	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ATATCCCTGTtctctctctctctg	0.181													5	3	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674482	78674483	+	Intron	INS	-	TGA	TGA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674482_78674483insTGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gatgatggaggtggtggtgatg	0.000													7	5	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78904126	78904131	+	Intron	DEL	CTCATC	-	-	rs71886122		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78904126_78904131delCTCATC	uc002jyt.1	+						RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						ctcagctcagctcatcctcagctcat	0.000													6	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80532198	80532198	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80532198delT	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			ACtctctctcttttttttttt	0.219													2	4	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80787184	80787184	+	Intron	DEL	C	-	-	rs3834573		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80787184delC	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AATGTGCACACCCCCCCCACA	0.303													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	3232330	3232330	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3232330delA								MYOM1 (12224 upstream) : MYL12A (15198 downstream)																							tccatcatggaaaaaaaaaaa	0.095													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	7379402	7379402	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7379402delC								LRRC30 (147361 upstream) : PTPRM (187912 downstream)																							TCTGTACCCTCACACGAGTGT	0.627													4	2	---	---	---	---	
RAB31	11031	broad.mit.edu	37	18	9809053	9809054	+	Intron	DEL	GC	-	-	rs4366777	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9809053_9809054delGC	uc002kog.2	+							NM_006868	NP_006859	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						gtgtgtgtgtgcgcgcgcacgc	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15390788	15390789	+	IGR	DEL	TT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15390788_15390789delTT								LOC644669 (64870 upstream) : None (None downstream)																							gtgtgcattcttctcagagagt	0.040													4	3	---	---	---	---	
ESCO1	114799	broad.mit.edu	37	18	19112763	19112766	+	Intron	DEL	ACAG	-	-	rs34046635		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19112763_19112766delACAG	uc002kth.1	-						ESCO1_uc002kti.1_Intron	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						TTTttaggaaacagacaatctgga	0.176													3	4	---	---	---	---	
CABLES1	91768	broad.mit.edu	37	18	20826229	20826230	+	Intron	INS	-	A	A	rs111345466		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20826229_20826230insA	uc002kuc.2	+						C18orf45_uc010xaq.1_Intron|CABLES1_uc002kub.2_Intron|CABLES1_uc002kud.2_Intron	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1 isoform 2						blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					gactccatctcaaaaaaaaaaa	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	32733688	32733688	+	IGR	DEL	A	-	-	rs34582401		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32733688delA								MAPRE2 (11311 upstream) : ZNF397 (87310 downstream)																							tcgtctcgggaaaaaaaaaaa	0.169													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	44933078	44933079	+	Intron	INS	-	TCC	TCC	rs138141930	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44933078_44933079insTCC	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																		TGAAAATACTGTCCTGCTTACA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49191251	49191252	+	IGR	INS	-	GTAA	GTAA	rs142245937	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49191251_49191252insGTAA								MEX3C (467561 upstream) : DCC (675319 downstream)																							GTTCCCTCAGTGTAAGGATCAG	0.302													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50627340	50627340	+	Intron	DEL	G	-	-	rs34282615		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50627340delG	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCCAGACCATGGGGGAGGAAG	0.418													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60271185	60271185	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60271185delG								ZCCHC2 (17223 upstream) : PHLPP1 (111549 downstream)																							gagatttggagggggtaaagg	0.000													4	2	---	---	---	---	
PHLPP1	23239	broad.mit.edu	37	18	60541891	60541892	+	Intron	DEL	CA	-	-	rs71340125		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60541891_60541892delCA	uc002lis.2	+							NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein						apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						cgcacgcgcgcacacacacaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	66324264	66324265	+	IGR	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66324264_66324265delTG								None (None upstream) : TMX3 (16662 downstream)																							ataacaaatctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
SOCS6	9306	broad.mit.edu	37	18	67964218	67964218	+	Intron	DEL	T	-	-	rs34243307		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67964218delT	uc002lkr.1	+							NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6						defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)|lung(1)	2		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				ttttcttagcttttttctcca	0.095													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	68318191	68318191	+	IGR	DEL	A	-	-	rs140374856		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68318191delA								SOCS6 (320757 upstream) : None (None downstream)																							GGTTGAAATGAAAAAAAAAAA	0.428													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	74521698	74521698	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74521698delA								LOC284276 (249915 upstream) : ZNF236 (14418 downstream)																							ATCAGCCTTCAAAATCCAGGG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76069302	76069302	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76069302delG								None (None upstream) : SALL3 (670973 downstream)																							AGCGGGAAGAGGGGGGACGTT	0.617													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76581016	76581017	+	IGR	INS	-	CT	CT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76581016_76581017insCT								None (None upstream) : SALL3 (159258 downstream)																							TCTGTTACAGACTCTACCCAGC	0.505													4	2	---	---	---	---	
PARD6G	84552	broad.mit.edu	37	18	77969830	77969830	+	Intron	DEL	A	-	-	rs71338094		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77969830delA	uc002lny.2	-						PARD6G_uc010xfp.1_Intron	NM_032510	NP_115899	Q9BYG4	PAR6G_HUMAN	PAR-6 gamma protein						cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		tgagttttacaagatgaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	481410	481411	+	IGR	INS	-	G	G	rs143502854		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:481410_481411insG								ODF3L2 (6427 upstream) : MADCAM1 (15079 downstream)																							ggaaggatgatgggaaggatga	0.000													2	4	---	---	---	---	
C19orf6	91304	broad.mit.edu	37	19	1014538	1014547	+	Intron	DEL	CGTGATGGGG	-	-	rs143052245		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1014538_1014547delCGTGATGGGG	uc002lqr.1	-						C19orf6_uc002lqq.1_5'Flank|C19orf6_uc002lqs.1_Intron	NM_001033026	NP_001028198	Q4ZIN3	MBRL_HUMAN	membralin isoform 1							cytoplasm|integral to membrane				pancreas(2)|breast(1)	3		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.0252)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGGCCTACGTGATGGGGCGTGATGGGG	0.681													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3322385	3322388	+	IGR	DEL	GATG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3322385_3322388delGATG								CELF5 (25314 upstream) : NFIC (37228 downstream)																							tgagtagagtgatggatggatgga	0.000													4	2	---	---	---	---	
RAX2	84839	broad.mit.edu	37	19	3772010	3772011	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3772010_3772011delTG	uc002lys.2	-						RAX2_uc010dtp.1_Splice_Site|RAX2_uc002lyr.2_Splice_Site	NM_032753	NP_116142	Q96IS3	RAX2_HUMAN	retina and anterior neural fold homeobox 2						response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCACGGCCTGTGTGTGTGTG	0.619													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	4070108	4070110	+	IGR	DEL	TTT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4070108_4070110delTTT								ZBTB7A (3292 upstream) : MAP2K2 (20219 downstream)																							atccggctaattttttttttttt	0.000													4	2	---	---	---	---	
EBI3	10148	broad.mit.edu	37	19	4227950	4227953	+	5'Flank	DEL	TCTG	-	-	rs147517935		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4227950_4227953delTCTG	uc002lzu.2	+							NM_005755	NP_005746	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3 precursor						humoral immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of interferon-gamma biosynthetic process|T-helper 1 type immune response	extracellular space|plasma membrane	cytokine activity|cytokine receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		tctctcttcctctgtctgtctgct	0.000													2	6	---	---	---	---	
HDGFRP2	84717	broad.mit.edu	37	19	4480020	4480020	+	Intron	DEL	G	-	-	rs5826850		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4480020delG	uc002mao.2	+						HDGFRP2_uc002map.2_Intron|HDGFRP2_uc010dtz.1_Intron	NM_001001520	NP_001001520	Q7Z4V5	HDGR2_HUMAN	hepatoma-derived growth factor-related protein 2						transcription, DNA-dependent	nucleus	DNA binding|protein binding				0						GAGTATAGCAGtgacagttgg	0.249													4	6	---	---	---	---	
PLIN5	440503	broad.mit.edu	37	19	4529622	4529623	+	Intron	INS	-	ACAC	ACAC	rs147345372	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4529622_4529623insACAC	uc002mas.2	-						PLIN5_uc002mat.1_3'UTR	NM_001013706	NP_001013728	Q00G26	PLIN5_HUMAN	lipid storage droplet protein 5							lipid particle					0						catatatgtatacacacacaca	0.045													9	5	---	---	---	---	
TICAM1	148022	broad.mit.edu	37	19	4823158	4823158	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4823158delC	uc002mbi.2	-							NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1						apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		atggtgaaatcccgtcttcac	0.000													4	2	---	---	---	---	
UHRF1	29128	broad.mit.edu	37	19	4949134	4949135	+	Intron	DEL	AA	-	-	rs148081660		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4949134_4949135delAA	uc002mbo.2	+						UHRF1_uc010xik.1_Intron|UHRF1_uc010duf.2_Intron|UHRF1_uc002mbp.2_Intron	NM_001048201	NP_001041666	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains						cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		gtgacagagcaaaaaaaaaaaa	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5363973	5363973	+	IGR	DEL	A	-	-	rs112268087		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5363973delA								PTPRS (23159 upstream) : ZNRF4 (91453 downstream)																							CTTGAAAGGCAAAAAAAAATG	0.323													1	8	---	---	---	---	
RFX2	5990	broad.mit.edu	37	19	6070230	6070231	+	Intron	INS	-	T	T	rs144470704		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6070230_6070231insT	uc002meb.2	-						RFX2_uc002mec.2_Intron|RFX2_uc010xiy.1_Intron	NM_000635	NP_000626	P48378	RFX2_HUMAN	regulatory factor X2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			breast(4)|ovary(1)|skin(1)	6						gggatgggatgggatgggatgg	0.000													4	3	---	---	---	---	
ACSBG2	81616	broad.mit.edu	37	19	6141284	6141284	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6141284delT	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						AGACCCAGACTTTATATTCTA	0.403													4	2	---	---	---	---	
CD70	970	broad.mit.edu	37	19	6585359	6585360	+	Intron	DEL	TT	-	-	rs71960153		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6585359_6585360delTT	uc010xjf.1	-							NM_001252	NP_001243	P32970	CD70_HUMAN	tumor necrosis factor ligand superfamily, member						cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to membrane of membrane fraction|integral to plasma membrane	cytokine activity|protease binding|tumor necrosis factor receptor binding				0						AAAACAGAACtttttttttttt	0.183													4	2	---	---	---	---	
CD70	970	broad.mit.edu	37	19	6585690	6585691	+	Intron	INS	-	T	T	rs146524509	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6585690_6585691insT	uc010xjf.1	-							NM_001252	NP_001243	P32970	CD70_HUMAN	tumor necrosis factor ligand superfamily, member						cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to membrane of membrane fraction|integral to plasma membrane	cytokine activity|protease binding|tumor necrosis factor receptor binding				0						AACCAAGAACAttttttttttc	0.074													2	4	---	---	---	---	
XAB2	56949	broad.mit.edu	37	19	7689643	7689643	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7689643delA	uc002mgx.2	-							NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2						transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						ATAGGTGGCCAAAAACCCCCC	0.592								Direct_reversal_of_damage|NER					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	8101807	8101808	+	IGR	INS	-	TCCT	TCCT	rs145632930	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8101807_8101808insTCCT								ELAVL1 (31278 upstream) : CCL25 (15838 downstream)																							cctttatttcctccttccttcc	0.000													4	2	---	---	---	---	
ZNF699	374879	broad.mit.edu	37	19	9415598	9415598	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9415598delA	uc002mlc.1	-							NM_198535	NP_940937	Q32M78	ZN699_HUMAN	zinc finger protein 699						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						actctgtctcaaaaaaaaaaa	0.060													3	3	---	---	---	---	
ELAVL3	1995	broad.mit.edu	37	19	11573777	11573777	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11573777delA	uc002mry.1	-						ELAVL3_uc002mrx.1_Intron	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						actccgtctcaaaaaaaaaaa	0.149													4	3	---	---	---	---	
ZNF709	163051	broad.mit.edu	37	19	12579660	12579661	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12579660_12579661insT	uc002mtv.3	-						ZNF709_uc002mtw.3_Intron|ZNF709_uc002mtx.3_Intron	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTGTACGAGAttttttttttt	0.183													5	3	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14739742	14739743	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14739742_14739743insT	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						ttctttttctcttttttttttg	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16302871	16302872	+	IGR	INS	-	T	T	rs148359177		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16302871_16302872insT								FAM32A (16 upstream) : AP1M1 (5793 downstream)																							TGAGTGtcttcttttttttttt	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17576703	17576706	+	IGR	DEL	AGAA	-	-	rs72122849		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17576703_17576706delAGAA								NXNL1 (4978 upstream) : SLC27A1 (4594 downstream)																							agagagagagagaaagaaagaaag	0.181													4	2	---	---	---	---	
FAM129C	199786	broad.mit.edu	37	19	17641138	17641139	+	Intron	INS	-	A	A	rs141427301	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17641138_17641139insA	uc010xpr.1	+						FAM129C_uc010xpq.1_Intron|FAM129C_uc010xps.1_Intron|FAM129C_uc010xpt.1_Intron	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a												0						aaacaaaaaacaaaaaacaaaa	0.000													3	3	---	---	---	---	
B3GNT3	10331	broad.mit.edu	37	19	17910079	17910079	+	Intron	DEL	T	-	-	rs67081588		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17910079delT	uc002nhk.1	+						B3GNT3_uc002nhl.1_Intron|B3GNT3_uc010ebd.1_Intron|B3GNT3_uc010ebe.1_Intron	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal						protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						CCATTCCAGCttttttttttt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	18416717	18416717	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18416717delA								JUND (24285 upstream) : LSM4 (1001 downstream)																							actccgtctcaaaaaaaaaaa	0.299													4	4	---	---	---	---	
LSM4	25804	broad.mit.edu	37	19	18434875	18434875	+	5'Flank	DEL	T	-	-	rs11321384		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18434875delT	uc002niq.2	-							NM_012321	NP_036453	Q9Y4Z0	LSM4_HUMAN	U6 snRNA-associated Sm-like protein 4						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|mRNA processing|RNA splicing	cytosol|U6 snRNP	protein binding|RNA binding				0						tttttttttcttttttttttt	0.000													4	2	---	---	---	---	
PGPEP1	54858	broad.mit.edu	37	19	18470319	18470319	+	Intron	DEL	T	-	-	rs34626308		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18470319delT	uc002nis.1	+						PGPEP1_uc002nir.1_Intron|PGPEP1_uc002nit.1_Intron|PGPEP1_uc010xqg.1_Intron	NM_017712	NP_060182	Q9NXJ5	PGPI_HUMAN	pyroglutamyl-peptidase I								cysteine-type peptidase activity				0						ctttccagtcttttttttttt	0.000													4	2	---	---	---	---	
SFRS14	10147	broad.mit.edu	37	19	19102867	19102867	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19102867delT	uc002nkx.2	-							NM_014884	NP_055699	Q8IX01	SUGP2_HUMAN	splicing factor, arginine/serine-rich 14						mRNA processing|RNA splicing	nucleus	RNA binding				0			OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)			CAGGAtttccttttttttttt	0.284													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20990906	20990909	+	IGR	DEL	ACTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20990906_20990909delACTG								ZNF626 (146504 upstream) : ZNF85 (115171 downstream)																							atggagtctcactgattgctagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21768194	21768195	+	Intron	INS	-	T	T	rs149308036	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21768194_21768195insT	uc002nqe.2	-						uc002nqf.1_5'Flank					full-length cDNA clone CS0DH004YH18 of T cells (Jurkat cell line) of Homo sapiens (human).																		ACAGATGTGGGAACCCCACCTC	0.530													4	2	---	---	---	---	
ZNF91	7644	broad.mit.edu	37	19	23529915	23529916	+	Intron	INS	-	C	C	rs149583442	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23529915_23529916insC	uc002nrd.2	-									Q05481	ZNF91_HUMAN	Homo sapiens, Similar to hypothetical protein FLJ31526, clone IMAGE:4526544, mRNA.							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ctatagtgtcaccccccctaca	0.000													4	7	---	---	---	---	
ZNF91	7644	broad.mit.edu	37	19	23554823	23554824	+	Intron	DEL	TA	-	-	rs80336084		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23554823_23554824delTA	uc002nre.2	-						ZNF91_uc010xrj.1_Intron	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGGAATACATTATGTTATTATT	0.297													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23652406	23652408	+	IGR	DEL	TCG	-	-	rs56712769		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23652406_23652408delTCG								ZNF91 (74137 upstream) : ZNF675 (183301 downstream)																							ctttttctcttcgtcttctcctc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23652460	23652462	+	IGR	DEL	TCT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23652460_23652462delTCT								ZNF91 (74191 upstream) : ZNF675 (183247 downstream)																							cctctactcctcttctcctcctc	0.000													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24415073	24415073	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24415073delA								LOC100101266 (68824 upstream) : None (None downstream)																							aaagatagggaaaaaacagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27754711	27754712	+	IGR	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27754711_27754712insG								None (None upstream) : LOC148189 (526690 downstream)																							taaaaaccagacagaagcattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27906535	27906536	+	IGR	INS	-	G	G	rs142567221	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27906535_27906536insG								None (None upstream) : LOC148189 (374866 downstream)																							aactgctcattcaaagaaaggt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29095387	29095387	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29095387delA	uc002nsa.1	-											Homo sapiens cDNA clone IMAGE:5297319, with apparent retained intron.																		tactttctgcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29621924	29621925	+	IGR	INS	-	C	C	rs150331215	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29621924_29621925insC								LOC148145 (161869 upstream) : UQCRFS1 (76242 downstream)																							gagaaagccctaggaagggcct	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29725952	29725952	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29725952delA								UQCRFS1 (21816 upstream) : VSTM2B (291539 downstream)																							CTTAAAAAACAAAAAAAAGAa	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31530574	31530574	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31530574delG								ZNF536 (481609 upstream) : DKFZp566F0947 (110209 downstream)																							aggttagtctgggttgtggga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32434515	32434516	+	IGR	INS	-	G	G	rs138915572	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32434515_32434516insG								TSHZ3 (594325 upstream) : ZNF507 (401998 downstream)																							AGCCCGGCAGAGGGAAGGTGGC	0.520													3	3	---	---	---	---	
DPY19L3	147991	broad.mit.edu	37	19	32973823	32973823	+	3'UTR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32973823delA	uc002ntg.2	+	19					DPY19L3_uc002nth.1_3'UTR|DPY19L3_uc002nti.1_RNA|DPY19L3_uc002ntj.1_3'UTR	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3							integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					CTGGGCACAGAAAAGTGTTAC	0.239													4	2	---	---	---	---	
RHPN2	85415	broad.mit.edu	37	19	33501291	33501292	+	Intron	INS	-	T	T	rs71340518		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33501291_33501292insT	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					tttttaggttgttttttttttt	0.208													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34019404	34019405	+	IGR	DEL	AC	-	-	rs74174671		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34019404_34019405delAC								PEPD (6603 upstream) : CHST8 (93456 downstream)																							GAGAACCTGGACACAGTGGTTA	0.094													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35049646	35049646	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35049646delA								WTIP (57562 upstream) : LOC643719 (17993 downstream)																							agagaaattcaagacctgggg	0.000													4	2	---	---	---	---	
COX6B1	1340	broad.mit.edu	37	19	36142935	36142935	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36142935delT	uc002oav.2	+							NM_001863	NP_001854	P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1						respiratory electron transport chain	mitochondrial inner membrane|mitochondrial intermembrane space	cytochrome-c oxidase activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ccctgccttcttttttttttt	0.000													6	4	---	---	---	---	
ZNF566	84924	broad.mit.edu	37	19	36973407	36973408	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36973407_36973408insA	uc002oea.3	-						ZNF566_uc010xte.1_Intron|ZNF566_uc010xtf.1_Intron|ZNF566_uc002oeb.3_Intron|ZNF566_uc002oec.3_Intron|ZNF566_uc010xtg.1_Intron	NM_032838	NP_116227	Q969W8	ZN566_HUMAN	zinc finger protein 566 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					aaaaatgtaagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
YIF1B	90522	broad.mit.edu	37	19	38796578	38796579	+	Intron	INS	-	C	C	rs150691531	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38796578_38796579insC	uc002ohz.2	-						YIF1B_uc002ohw.2_Intron|YIF1B_uc002ohx.2_Intron|YIF1B_uc010xtx.1_Intron|YIF1B_uc010xty.1_Intron|YIF1B_uc002oia.2_Intron|YIF1B_uc002ohy.2_Intron	NM_001039672	NP_001034761	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B isoform 5							integral to membrane					0	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			gtgcgttggctcacgcctgtaa	0.193													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	40683421	40683421	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40683421delG								ZNF780A (86576 upstream) : MAP3K10 (14230 downstream)																							tttcattcctgacccaaccac	0.000													4	2	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41071171	41071171	+	Intron	DEL	A	-	-	rs71972087		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41071171delA	uc002ony.2	+						SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			actttatctcaaaaaaaaaaa	0.169													8	4	---	---	---	---	
ITPKC	80271	broad.mit.edu	37	19	41240686	41240687	+	Intron	INS	-	T	T	rs141800127		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41240686_41240687insT	uc002oot.2	+							NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C							cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			gctaattgttgttttttttttt	0.000													3	3	---	---	---	---	
XRCC1	7515	broad.mit.edu	37	19	44064126	44064126	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44064126delG	uc002owt.2	-						XRCC1_uc010xwp.1_Intron	NM_006297	NP_006288	P18887	XRCC1_HUMAN	X-ray repair cross complementing protein 1						base-excision repair|single strand break repair	nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(2)|large_intestine(1)|prostate(1)|breast(1)	7		Prostate(69;0.0153)				ctggctacttgggaggctgag	0.000								Other_BER_factors					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	46237336	46237337	+	IGR	INS	-	G	G			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46237336_46237337insG								FBXO46 (3185 upstream) : SIX5 (30707 downstream)																							GAGCCTGATTTGGGGCAACTGA	0.436													4	2	---	---	---	---	
CCDC61	729440	broad.mit.edu	37	19	46513061	46513062	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46513061_46513062delTG	uc002pdw.2	+							NM_001080402	NP_001073871			coiled-coil domain containing 61											ovary(1)	1		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		GCTCTCAGGCtgtgtgtgtgtg	0.485											OREG0025564	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47141196	47141197	+	RNA	INS	-	CTGT	CTGT	rs144076797	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47141196_47141197insCTGT	uc002pez.1	-	1		c.1222_1223insACAG								Homo sapiens cDNA FLJ10148 fis, clone HEMBA1003370.																		GCCAACACAGACTGACACTCAC	0.426													3	4	---	---	---	---	
C5AR1	728	broad.mit.edu	37	19	47814422	47814422	+	Intron	DEL	T	-	-	rs75798874		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47814422delT	uc002pgj.1	+							NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1						activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CTTCTTCTTCTTTTTTTTTTT	0.343													5	3	---	---	---	---	
GLTSCR2	29997	broad.mit.edu	37	19	48263219	48263220	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48263219_48263220delTG	uc010elk.1	+									Q9NZM5	GSCR2_HUMAN	Homo sapiens HSPC271 mRNA, partial cds.							nucleolus				central_nervous_system(1)	1		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		GGAAAACAGCTGTGTGTGTGTG	0.426													4	2	---	---	---	---	
IGLON5	402665	broad.mit.edu	37	19	51821980	51821981	+	Intron	DEL	CT	-	-	rs144752970		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51821980_51821981delCT	uc002pwc.2	+							NM_001101372	NP_001094842	A6NGN9	IGLO5_HUMAN	IgLON family member 5 precursor							extracellular region					0						cagagcgagactctgtctcaaa	0.198													2	4	---	---	---	---	
ZNF534	147658	broad.mit.edu	37	19	52933209	52933209	+	5'Flank	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52933209delT	uc002pzk.2	+						ZNF534_uc002pzj.1_Intron|ZNF534_uc010epo.1_5'Flank|ZNF534_uc002pzl.2_5'Flank	NM_001143939	NP_001137411	Q76KX8	ZN534_HUMAN	zinc finger protein 534 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						catgtaacccttttttttttc	0.000													4	2	---	---	---	---	
ZNF808	388558	broad.mit.edu	37	19	53055957	53055957	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53055957delT	uc010epq.1	+						ZNF808_uc002pzq.2_Intron|ZNF808_uc010epr.1_5'Flank	NM_001039886	NP_001034975	Q8N4W9	ZN808_HUMAN	zinc finger protein 808						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TGTTGTGTGGTTTTTTTTTTT	0.269													4	2	---	---	---	---	
ZNF347	84671	broad.mit.edu	37	19	53651143	53651144	+	Intron	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53651143_53651144delTC	uc002qbb.1	-						ZNF347_uc010eql.1_Intron|ZNF347_uc002qbc.1_Intron	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		attcatcacatcaacagaatca	0.000													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54387922	54387923	+	Intron	DEL	AG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54387922_54387923delAG	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		aagctgaggcagagagagagag	0.109													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54637513	54637514	+	IGR	DEL	CT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54637513_54637514delCT								PRPF31 (2363 upstream) : CNOT3 (3935 downstream)																							ctctccctccctctctccACCT	0.168													7	5	---	---	---	---	
FCAR	2204	broad.mit.edu	37	19	55386627	55386627	+	Intron	DEL	A	-	-	rs76511783		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55386627delA	uc002qhr.1	+						FCAR_uc002qhq.2_Intron|FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Intron|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Intron|FCAR_uc002qhw.1_Intron|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Intron|FCAR_uc002qhz.1_Intron|FCAR_uc002qia.1_Intron	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		actctgtctcaaaaaaaaaaa	0.040													7	5	---	---	---	---	
RDH13	112724	broad.mit.edu	37	19	55575054	55575054	+	5'Flank	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55575054delG	uc002qio.3	-						RDH13_uc002qip.2_Intron|RDH13_uc010yfq.1_5'Flank|RDH13_uc002qiq.1_RNA	NM_001145971	NP_001139443	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 isoform 1								binding|oxidoreductase activity			large_intestine(1)|ovary(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	ctgggtccgagggaggagggc	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57485133	57485133	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57485133delT								MIMT1 (125211 upstream) : USP29 (146376 downstream)																							TGTTTTGTTCTTTTCCTGAGC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	58679548	58679548	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58679548delT								ZNF329 (13071 upstream) : ZNF274 (14848 downstream)																							CACATGTAAATTTTTTTTTTT	0.045													4	2	---	---	---	---	
PTPRA	5786	broad.mit.edu	37	20	2851388	2851388	+	5'Flank	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2851388delT	uc010zqb.1	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_5'Flank|PTPRA_uc002whk.2_5'Flank|PTPRA_uc010zqd.1_5'Flank|PTPRA_uc002whl.2_5'Flank|PTPRA_uc002whm.2_5'Flank			P18433	PTPRA_HUMAN	SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						CCTGATCCTCTCCTTTGCTCA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	5033406	5033407	+	IGR	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5033406_5033407delTG								SLC23A2 (42467 upstream) : C20orf30 (15723 downstream)																							TGCCTTTATTtgtgtgtgtgtg	0.144													7	5	---	---	---	---	
TRMT6	51605	broad.mit.edu	37	20	5921479	5921479	+	Intron	DEL	T	-	-	rs11335317		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5921479delT	uc002wmh.1	-						TRMT6_uc010zra.1_Intron	NM_015939	NP_057023	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6						regulation of translational initiation|tRNA processing	nucleus	protein binding|translation initiation factor activity			pancreas(1)	1						aatttatgtatttttttttgt	0.000													6	3	---	---	---	---	
PLCB4	5332	broad.mit.edu	37	20	9330584	9330584	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9330584delA	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TGGCAAAATTAAAAACTGGAT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16592990	16592990	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16592990delA								KIF16B (38912 upstream) : SNRPB2 (117639 downstream)																							CTCAAATCTTAAAATGGACAG	0.433													4	2	---	---	---	---	
CSRP2BP	57325	broad.mit.edu	37	20	18123085	18123085	+	5'UTR	DEL	T	-	-	rs111860252		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18123085delT	uc002wqj.2	+	2					CSRP2BP_uc002wqk.2_5'Flank	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein						histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						TATCTTCATCTTTTTTTTTGG	0.363													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25889453	25889454	+	IGR	INS	-	T	T	rs148292572	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25889453_25889454insT								FAM182B (40667 upstream) : LOC100134868 (100981 downstream)																							cacccagctaattttttgtttt	0.000													2	5	---	---	---	---	
FAM182A	284800	broad.mit.edu	37	20	26061767	26061768	+	Intron	DEL	TC	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26061767_26061768delTC	uc010gdq.2	+							NR_026713				Homo sapiens cDNA FLJ38374 fis, clone FEBRA2002552.												0						CTCATGGctttctctctctctc	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29462348	29462349	+	IGR	INS	-	AA	AA	rs140899401	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29462348_29462349insAA								None (None upstream) : FRG1B (149530 downstream)																							CCTCAGGCAAGAAAAAAACATT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	34341926	34341928	+	IGR	DEL	TTG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34341926_34341928delTTG								RBM39 (11733 upstream) : PHF20 (17995 downstream)																							ctttTTTTACTTGTTGTTGTTGT	0.039													4	2	---	---	---	---	
DLGAP4	22839	broad.mit.edu	37	20	34984630	34984630	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34984630delA	uc002xff.2	+							NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				agtacaccacaaatccagaca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36272213	36272213	+	IGR	DEL	T	-	-	rs5841271		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36272213delT								BLCAP (115910 upstream) : CTNNBL1 (50221 downstream)																							acaggagtgattttttttcaa	0.159													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	40602515	40602523	+	IGR	DEL	TGAGCCTAG	-	-	rs11471203		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40602515_40602523delTGAGCCTAG								CHD6 (355382 upstream) : PTPRT (98870 downstream)																							atggacagactgagcctagagaagagaag	0.033													4	2	---	---	---	---	
GDAP1L1	78997	broad.mit.edu	37	20	42889853	42889853	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42889853delA	uc002xlq.2	+						GDAP1L1_uc002xlp.1_Intron|GDAP1L1_uc010zwl.1_Intron|GDAP1L1_uc010zwm.1_Intron|GDAP1L1_uc010zwn.1_Intron	NM_024034	NP_076939	Q96MZ0	GD1L1_HUMAN	ganglioside-induced differentiation-associated											large_intestine(1)	1		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCGACCCCTTAATCAGTCTCA	0.602													4	2	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45295112	45295114	+	Intron	DEL	TTG	-	-	rs140336123		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45295112_45295114delTTG	uc002xsg.1	-						SLC13A3_uc010gho.1_Intron|SLC13A3_uc002xsi.3_Intron	NM_001011554	NP_001011554	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform b							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ttttgttgctttgttgttgttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45417941	45417942	+	IGR	DEL	GG	-	-	rs72258663		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45417941_45417942delGG								SLC2A10 (52958 upstream) : EYA2 (105321 downstream)																							TATTGGATGTGGgtgtgtgggt	0.025													4	2	---	---	---	---	
NCOA3	8202	broad.mit.edu	37	20	46258075	46258076	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46258075_46258076insT	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron|NCOA3_uc010zyc.1_Intron	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						ATGGATGTTACttttttttttt	0.149													4	2	---	---	---	---	
ARFGEF2	10564	broad.mit.edu	37	20	47558848	47558848	+	Intron	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47558848delT	uc002xtx.3	+							NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			ATACAGCCTCTtttttatttt	0.159													4	2	---	---	---	---	
BCAS4	55653	broad.mit.edu	37	20	49445749	49445749	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49445749delC	uc002xvq.2	+						BCAS4_uc002xvp.1_Intron|BCAS4_uc002xvr.2_Intron|BCAS4_uc002xvs.2_Intron	NM_017843	NP_060313	Q8TDM0	BCAS4_HUMAN	breast carcinoma amplified sequence 4 isoform a							cytoplasm					0						TGAAAGGCTTCCCCCAGGAGA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	50630638	50630639	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50630638_50630639insA								SALL4 (211590 upstream) : ZFP64 (69912 downstream)																							ccagctaatttaaaaaatttgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55449774	55449775	+	IGR	INS	-	AG	AG	rs139223336	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55449774_55449775insAG								TFAP2C (235438 upstream) : BMP7 (294034 downstream)																							GAAGAGAATGCAGAGAGAGAGC	0.317													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56641670	56641671	+	IGR	INS	-	A	A	rs145171345	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56641670_56641671insA								PMEPA1 (355129 upstream) : C20orf85 (84312 downstream)																							TGTTCTGCTTTAAAAAAAAAAG	0.371													6	3	---	---	---	---	
NPEPL1	79716	broad.mit.edu	37	20	57283249	57283250	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57283249_57283250insA	uc010zzs.1	+						NPEPL1_uc010zzr.1_Intron|NPEPL1_uc002xzn.2_Intron|NPEPL1_uc010gjo.1_Intron|NPEPL1_uc002xzp.2_Intron	NM_024663	NP_078939	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1						proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			ACTTGAAATGGAAAAACAAAAA	0.530													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60495384	60495387	+	Intron	DEL	TGTG	-	-	rs72205789		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60495384_60495387delTGTG	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GTGGTGTGATTGTGTGGAAGCGTG	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10421787	10421788	+	IGR	INS	-	CT	CT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10421787_10421788insCT								None (None upstream) : TPTE (484955 downstream)																							gattctcctgcctcagcctcct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10775702	10775703	+	IGR	INS	-	ATGGA	ATGGA	rs62219479		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10775702_10775703insATGGA								None (None upstream) : TPTE (131040 downstream)																							aacggaaaggcatggaatggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10843980	10843987	+	IGR	DEL	AATAAAAA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10843980_10843987delAATAAAAA								None (None upstream) : TPTE (62756 downstream)																							aattgaatggaataaaaaaatggaatgg	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10894886	10894887	+	IGR	DEL	CC	-	-	rs139640653		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10894886_10894887delCC								None (None upstream) : TPTE (11856 downstream)																							ttccttctttccttctttcttt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14356733	14356733	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14356733delA								None (None upstream) : C21orf99 (53754 downstream)																							tgcacacatcacaaagaagtt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14888736	14888736	+	IGR	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14888736delG								C21orf99 (398167 upstream) : POTED (93762 downstream)																							ttgggtagctggggggtaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	18655652	18655653	+	IGR	INS	-	AG	AG			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18655652_18655653insAG								C21orf34 (673558 upstream) : CXADR (229677 downstream)																							aaacacactttagagtcatcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33156717	33156718	+	IGR	INS	-	ATCA	ATCA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33156717_33156718insATCA								SFRS15 (52286 upstream) : HUNK (88910 downstream)																							ccaccaccatcaccgccaccac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33422267	33422268	+	IGR	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33422267_33422268insA								HUNK (45891 upstream) : NCRNA00159 (30361 downstream)																							gactccatctcaaaaaaaaaaa	0.252													4	2	---	---	---	---	
KCNJ6	3763	broad.mit.edu	37	21	39085044	39085044	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39085044delC	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	cccttctcctcctctccttcc	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42256009	42256009	+	IGR	DEL	A	-	-	rs35418693		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42256009delA								DSCAM (36970 upstream) : C21orf130 (257418 downstream)																							agaaaGACAGAAAAAAAAAAA	0.244													4	3	---	---	---	---	
MX2	4600	broad.mit.edu	37	21	42755044	42755044	+	Intron	DEL	G	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42755044delG	uc002yzf.1	+						MX2_uc011aer.1_Intron	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2						response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				ccaacactttgggaggccaag	0.154													4	2	---	---	---	---	
MX1	4599	broad.mit.edu	37	21	42791224	42791225	+	5'Flank	INS	-	ATGTC	ATGTC			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42791224_42791225insATGTC	uc002yzh.2	+							NM_001144925	NP_001138397	P20591	MX1_HUMAN	myxovirus resistance protein 1						induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				caagagaggggatgtcatgtca	0.015													5	3	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43226690	43226691	+	Intron	INS	-	C	C	rs139658125	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43226690_43226691insC	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						catcaccaccaccatcactacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	43447811	43447812	+	IGR	DEL	GT	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43447811_43447812delGT								C21orf121 (2751 upstream) : UMODL1 (35256 downstream)																							tgtgtttgtggtgtgtgtgtgg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44345059	44345059	+	Intron	DEL	T	-	-	rs140015718		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44345059delT	uc002zco.2	-											Homo sapiens chromosome 21 open reading frame 105, mRNA (cDNA clone IMAGE:3840937), partial cds.																		caccttagcattttttttttt	0.000													4	2	---	---	---	---	
COL18A1	80781	broad.mit.edu	37	21	46899207	46899208	+	Intron	DEL	AT	-	-	rs67843080		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46899207_46899208delAT	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		cattacacacatgtgtgcacac	0.020													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16859854	16859856	+	IGR	DEL	ATG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16859854_16859856delATG								OR11H1 (410050 upstream) : CCT8L2 (211792 downstream)																							tggaatcatcatggaatggaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17828569	17828571	+	IGR	DEL	CAA	-	-	rs34939641		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17828569_17828571delCAA								CECR1 (125831 upstream) : CECR2 (12268 downstream)																							gactctgtctcaacaacaacaac	0.217													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	19304825	19304825	+	IGR	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19304825delA								CLTCL1 (25586 upstream) : HIRA (13399 downstream)																							accctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PIWIL3	440822	broad.mit.edu	37	22	25153594	25153595	+	Intron	INS	-	AA	AA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25153594_25153595insAA	uc003abd.1	-						PIWIL3_uc011ajx.1_Intron|PIWIL3_uc011ajy.1_Intron|PIWIL3_uc010gut.1_Intron	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3						cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						cacacacacacacacacacaca	0.000													4	2	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31214650	31214651	+	Intron	DEL	TG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31214650_31214651delTG	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						ATTTGTTGAATGTGTGTGTGTG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32906972	32906975	+	IGR	DEL	GTGT	-	-	rs34634876		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32906972_32906975delGTGT								FBXO7 (12155 upstream) : SYN3 (1567 downstream)																							TTGTCCAGGCgtgtgtgtgtgtgt	0.333													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34224384	34224409	+	Intron	DEL	GAAGTGCCACTGCAGAGTTCAGAAAA	-	-	rs144640681		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34224384_34224409delGAAGTGCCACTGCAGAGTTCAGAAAA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				tcaatggcatgaagtgccactgcagagttcagaaaagatgaggata	0.000													4	3	---	---	---	---	
ISX	91464	broad.mit.edu	37	22	35473603	35473611	+	Intron	DEL	CATCATCAT	-	-	rs113622288		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35473603_35473611delCATCATCAT	uc003anj.2	+						ISX_uc011amg.1_Intron	NM_001008494	NP_001008494	Q2M1V0	ISX_HUMAN	intestine-specific homeobox							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)	5						ACAAGCACAAcatcatcatcatcatcatc	0.344													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35859447	35859448	+	IGR	INS	-	CATT	CATT			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35859447_35859448insCATT								MCM5 (38953 upstream) : RASD2 (77904 downstream)																							atccacccatccactcatccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35860039	35860039	+	IGR	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35860039delC								MCM5 (39545 upstream) : RASD2 (77313 downstream)																							TGCTCTAGGTCAAGAAGAAGA	0.453													4	2	---	---	---	---	
PLA2G6	8398	broad.mit.edu	37	22	38573466	38573467	+	Intron	DEL	TT	-	-	rs147595555		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38573466_38573467delTT	uc003auy.1	-						PLA2G6_uc003auz.1_Intron|PLA2G6_uc003ava.1_Intron|PLA2G6_uc003avb.2_Intron|PLA2G6_uc010gxk.1_Intron|PLA2G6_uc011ano.1_Intron	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a						cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	AAATTGCCACtttttttttttt	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39693610	39693619	+	IGR	DEL	CAGGGGAGGG	-	-	rs11276882		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39693610_39693619delCAGGGGAGGG								PDGFB (52653 upstream) : RPL3 (15269 downstream)																							AGAGGAGTCTcaggggagggcaggggaggg	0.562													4	2	---	---	---	---	
SCUBE1	80274	broad.mit.edu	37	22	43677565	43677566	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43677565_43677566insT	uc003bdt.1	-						SCUBE1_uc003bdu.1_Intron|uc003bdv.2_Intron	NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1						adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				tgtcacctccccctcagccacc	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	44779741	44779742	+	IGR	INS	-	GGAG	GGAG	rs139917405	by1000genomes	TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44779741_44779742insGGAG								KIAA1644 (71010 upstream) : LDOC1L (108708 downstream)																							CACACAGTTCTGGAGGGAGGGA	0.584													4	2	---	---	---	---	
FBLN1	2192	broad.mit.edu	37	22	45935085	45935086	+	Intron	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45935085_45935086insT	uc003bgj.1	+						FBLN1_uc003bgg.1_Intron|FBLN1_uc003bgh.2_Intron|FBLN1_uc010gzz.2_Intron|FBLN1_uc003bgi.1_Intron	NM_006486	NP_006477	P23142	FBLN1_HUMAN	fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ttcttttcttcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	442685	442693	+	IGR	DEL	GGAGGAAGG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:442685_442693delGGAGGAAGG								PPP2R3B (95058 upstream) : SHOX (142386 downstream)																							ggaaggagacggaggaaggagagggagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	685596	685597	+	IGR	INS	-	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:685596_685597insC								SHOX (65451 upstream) : CRLF2 (629290 downstream)																							GCAGGGACCCTCCCCACCTGAG	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	685891	685892	+	IGR	INS	-	C	C			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:685891_685892insC								SHOX (65746 upstream) : CRLF2 (628995 downstream)																							GCAGTGACCCTCCCCACCTGAG	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2000102	2000103	+	IGR	INS	-	GAA	GAA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2000102_2000103insGAA								ASMT (238129 upstream) : DHRSX (137454 downstream)																							aagaaaaagagggaaggaagga	0.000													4	3	---	---	---	---	
DHRSX	207063	broad.mit.edu	37	X	2326917	2326918	+	Intron	INS	-	A	A			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2326917_2326918insA	uc004cqf.3	-							NM_145177	NP_660160	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked								binding|oxidoreductase activity				0		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CTATTAACTGCAAAAAAAAAAA	0.347													7	4	---	---	---	---	
KLF8	11279	broad.mit.edu	37	X	56296838	56296839	+	Intron	DEL	AG	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56296838_56296839delAG	uc004dur.2	+						KLF8_uc011mop.1_Intron|KLF8_uc010nkh.2_Intron	NM_007250	NP_009181	O95600	KLF8_HUMAN	Kruppel-like factor 8 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						agagaggggcagagagagagag	0.252													3	3	---	---	---	---	
TNMD	64102	broad.mit.edu	37	X	99849459	99849459	+	Intron	DEL	C	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99849459delC	uc004efy.3	+						TNMD_uc004efz.2_Intron	NM_022144	NP_071427	Q9H2S6	TNMD_HUMAN	tenomodulin							integral to membrane				central_nervous_system(1)	1						ctttgattctccaacaacctt	0.060													4	2	---	---	---	---	
TRPC5	7224	broad.mit.edu	37	X	111161307	111161307	+	Intron	DEL	A	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111161307delA	uc004epl.1	-						TRPC5_uc004epm.1_Intron	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						tagacaagggaaagagggggc	0.119													4	2	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155238831	155238834	+	Intron	DEL	TGTA	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155238831_155238834delTGTA	uc004fnv.1	+						IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tgtttatgtgtgtatgtctgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9951124	9951124	+	IGR	DEL	G	-	-	rs111917836		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9951124delG								TTTY22 (300270 upstream) : None (None downstream)																							gatgaaaaaagttattccatg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9957929	9957929	+	IGR	DEL	T	-	-			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9957929delT								TTTY22 (307075 upstream) : None (None downstream)																							aatcaggaggtggacgttgca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10039767	10039767	+	IGR	DEL	A	-	-	rs112066494		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10039767delA								TTTY22 (388913 upstream) : None (None downstream)																							gaatgcatacaaaacggttgc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13402059	13402060	+	IGR	INS	-	T	T			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13402059_13402060insT								None (None upstream) : None (None downstream)																							agaggccttcgttttttcctct	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13447249	13447250	+	IGR	INS	-	TCCAC	TCCAC			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13447249_13447250insTCCAC								None (None upstream) : None (None downstream)																							tcccattccattccactcaatt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13451188	13451191	+	IGR	DEL	CTTT	-	-	rs79763190		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13451188_13451191delCTTT								None (None upstream) : None (None downstream)																							cactccactcctttcattccattc	0.020													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13693145	13693149	+	IGR	DEL	GATAC	-	-	rs145389114		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13693145_13693149delGATAC								None (None upstream) : None (None downstream)																							gaatggaatggatacgaatggaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13867242	13867243	+	IGR	INS	-	AGTTGGAGTA	AGTTGGAGTA			TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13867242_13867243insAGTTGGAGTA								None (None upstream) : TTTY15 (907055 downstream)																							ggaatggcatcgaatggaatgg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59029077	59029077	+	IGR	DEL	G	-	-	rs58964262		TCGA-18-3407-01A-01D-0983-08	TCGA-18-3407-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59029077delG								None (None upstream) : None (None downstream)																							ctggagaacagtggtgctatc	0.000													6	4	---	---	---	---	
