Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ZNF683	257101	broad.mit.edu	37	1	26688385	26688385	+	Silent	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26688385G>A	uc001bmg.1	-	7	1450	c.1332C>T	c.(1330-1332)CAC>CAT	p.H444H	ZNF683_uc001bmh.1_Silent_p.H424H|ZNF683_uc009vsj.1_Silent_p.H424H	NM_173574	NP_775845	Q8IZ20	ZN683_HUMAN	zinc finger protein 683	444	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		GCAGCCGATGGTGCAGCTTCA	0.667													13	21	---	---	---	---	PASS
SFN	2810	broad.mit.edu	37	1	27190282	27190282	+	Silent	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27190282G>A	uc001bnc.1	+	1	650	c.579G>A	c.(577-579)CTG>CTA	p.L193L	uc010ofi.1_RNA	NM_006142	NP_006133	P31947	1433S_HUMAN	stratifin	193					DNA damage response, signal transduction resulting in induction of apoptosis|negative regulation of caspase activity|release of cytochrome c from mitochondria	cytoplasm|extracellular space|nucleus	protein domain specific binding|protein kinase C inhibitor activity				0		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		CCATCTCTCTGGCCAAGACCA	0.607													7	66	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879369	144879369	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879369G>T	uc001elw.3	-	27	4372	c.4081C>A	c.(4081-4083)CTG>ATG	p.L1361M	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.L1317M|PDE4DIP_uc001elv.3_Missense_Mutation_p.L368M	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1361	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGGGCCTTCAGATCTTTGATG	0.488			T	PDGFRB	MPD								19	124	---	---	---	---	PASS
ANKRD34A	284615	broad.mit.edu	37	1	145473602	145473602	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145473602G>T	uc001enq.1	+	4	1567	c.274G>T	c.(274-276)GCG>TCG	p.A92S	NBPF10_uc001emp.3_Intron	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34	92	ANK 3.										0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGGGGGCGCCGCGGTGGCCTC	0.716													11	43	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160097339	160097339	+	Intron	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160097339C>T	uc001fvc.2	+						ATP1A2_uc001fvb.2_Intron|ATP1A2_uc010piz.1_Intron|ATP1A2_uc001fvd.2_5'Flank|ATP1A2_uc009wtg.1_5'Flank	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein						ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CACCATGTTGCAGGCACTGCC	0.592													18	51	---	---	---	---	PASS
PBX1	5087	broad.mit.edu	37	1	164761954	164761954	+	Silent	SNP	G	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164761954G>C	uc001gct.2	+	3	747	c.489G>C	c.(487-489)ACG>ACC	p.T163T	PBX1_uc010pku.1_Silent_p.T163T|PBX1_uc010pkv.1_Silent_p.T80T|PBX1_uc001gcs.2_Silent_p.T163T|PBX1_uc010pkw.1_Silent_p.T53T	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	163					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						TCTACCATACGGAGCTGGAGA	0.502			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								8	33	---	---	---	---	PASS
TDRD5	163589	broad.mit.edu	37	1	179561770	179561770	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179561770T>C	uc001gnf.1	+	2	270	c.20T>C	c.(19-21)ATA>ACA	p.I7T	TDRD5_uc010pnp.1_Missense_Mutation_p.I7T|uc010pno.1_5'Flank	NM_173533	NP_775804	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	7					DNA methylation involved in gamete generation|P granule organization|spermatid development	chromatoid body|pi-body	nucleic acid binding			ovary(2)|skin(2)|central_nervous_system(1)	5						CAAGAGCGTATACAGGAATGT	0.448													42	127	---	---	---	---	PASS
LAD1	3898	broad.mit.edu	37	1	201353941	201353941	+	Missense_Mutation	SNP	G	A	A	rs138044157		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201353941G>A	uc001gwm.2	-	5	1389	c.1154C>T	c.(1153-1155)TCG>TTG	p.S385L	LAD1_uc009wzu.1_Missense_Mutation_p.S407L	NM_005558	NP_005549	O00515	LAD1_HUMAN	ladinin 1	385						basement membrane	structural molecule activity				0						GGTTGTTTCCGAGTTTTCTTT	0.542													7	185	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216011348	216011348	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216011348C>A	uc001hku.1	-	47	9743	c.9356G>T	c.(9355-9357)CGT>CTT	p.R3119L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3119	Extracellular (Potential).|Fibronectin type-III 18.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTGATGCCACGAATTGTGGG	0.393										HNSCC(13;0.011)			22	27	---	---	---	---	PASS
ZNF238	10472	broad.mit.edu	37	1	244218490	244218490	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244218490G>T	uc001iae.2	+	1	1909	c.1387G>T	c.(1387-1389)GAG>TAG	p.E463*	ZNF238_uc001iad.3_Nonsense_Mutation_p.E472*|ZNF238_uc001iaf.1_3'UTR	NM_006352	NP_006343	Q99592	ZN238_HUMAN	zinc finger protein 238 isoform 2	463					negative regulation of transcription from RNA polymerase II promoter|skeletal muscle tissue development	nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|pancreas(2)	5	all_cancers(71;6.42e-05)|all_epithelial(71;7e-05)|Breast(184;0.0333)|Ovarian(71;0.0619)|all_lung(81;0.089)|all_neural(11;0.101)|Lung NSC(105;0.123)		all cancers(7;1.35e-08)|GBM - Glioblastoma multiforme(7;1e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00223)			GCACACCCGCGAGAAGCCGCA	0.612													19	73	---	---	---	---	PASS
VN1R5	317705	broad.mit.edu	37	1	247420223	247420223	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247420223G>T	uc010pyu.1	+	2	850	c.850G>T	c.(850-852)GAC>TAC	p.D284Y		NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	vomeronasal 1 receptor 5	284	Helical; Name=6; (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	OV - Ovarian serous cystadenocarcinoma(106;0.00854)			ATACTGGGTGGACTTTACGTT	0.493													14	158	---	---	---	---	PASS
SLC3A1	6519	broad.mit.edu	37	2	44507894	44507894	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44507894T>C	uc002ruc.3	+	2	548	c.470T>C	c.(469-471)ATA>ACA	p.I157T	SLC3A1_uc002rty.2_Missense_Mutation_p.I157T|SLC3A1_uc002rtz.2_Missense_Mutation_p.I157T|SLC3A1_uc002rua.2_Missense_Mutation_p.I157T|SLC3A1_uc002rub.2_Missense_Mutation_p.I157T	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	157	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	GCTTTAAATATAAAAACTGTT	0.313													10	18	---	---	---	---	PASS
C2orf3	6936	broad.mit.edu	37	2	75919142	75919142	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75919142C>T	uc002sno.2	-	7	1235	c.1105G>A	c.(1105-1107)GAA>AAA	p.E369K	C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Missense_Mutation_p.E200K|C2orf3_uc010fft.2_Missense_Mutation_p.E44K	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936	369					negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						TGTTTTAATTCATCTTGCCTG	0.299													4	3	---	---	---	---	PASS
UGT1A7	54577	broad.mit.edu	37	2	234591377	234591377	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234591377T>A	uc002vut.2	+	1	794	c.794T>A	c.(793-795)GTG>GAG	p.V265E	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Missense_Mutation_p.V265E	NM_019077	NP_061950	Q9HAW7	UD17_HUMAN	UDP glycosyltransferase 1 family, polypeptide A7	265					drug metabolic process|negative regulation of fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	drug binding|enzyme inhibitor activity|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|retinoic acid binding			ovary(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;8.93e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000412)|Lung(119;0.00333)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CCCAAACCCGTGATGCCCAAT	0.433													31	66	---	---	---	---	PASS
METTL6	131965	broad.mit.edu	37	3	15466468	15466468	+	Nonsense_Mutation	SNP	A	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15466468A>T	uc003bzs.1	-	3	612	c.354T>A	c.(352-354)TAT>TAA	p.Y118*	METTL6_uc011avp.1_Intron|METTL6_uc003bzt.1_Nonsense_Mutation_p.Y118*	NM_152396	NP_689609	Q8TCB7	METL6_HUMAN	methyltransferase like 6	118							methyltransferase activity				0						CAACCTTAACATATTCAATGG	0.393													29	18	---	---	---	---	PASS
BSN	8927	broad.mit.edu	37	3	49691576	49691576	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49691576G>T	uc003cxe.3	+	5	4701	c.4587G>T	c.(4585-4587)ATG>ATT	p.M1529I		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1529					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CATCACCTATGGTAGCCCAGG	0.612													42	32	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77651403	77651403	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77651403C>T	uc003dpy.3	+	20	3540	c.2897C>T	c.(2896-2898)ACG>ATG	p.T966M	ROBO2_uc003dpz.2_Missense_Mutation_p.T970M|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.T970M|ROBO2_uc003dqa.2_Missense_Mutation_p.T93M	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	966	Cytoplasmic (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AAAACAGCAACGATGCTCTCA	0.458													8	50	---	---	---	---	PASS
ZXDC	79364	broad.mit.edu	37	3	126180727	126180727	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126180727T>C	uc003eiv.2	-	6	1832	c.1778A>G	c.(1777-1779)CAG>CGG	p.Q593R	ZXDC_uc010hsh.2_RNA|ZXDC_uc003eix.2_Missense_Mutation_p.Q593R	NM_025112	NP_079388	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C isoform 1	593	Required for transcriptional activation.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|LRR domain binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.155)		GAAGCTGCCCTGCTGCAGAAC	0.602													44	38	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167510549	167510549	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167510549A>G	uc003ffa.3	+	4	851	c.653A>G	c.(652-654)TAT>TGT	p.Y218C	SERPINI1_uc003ffb.3_Missense_Mutation_p.Y218C	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	218					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						CCAATGATGTATCAGCAAGGA	0.328													7	38	---	---	---	---	PASS
ACTL6A	86	broad.mit.edu	37	3	179301162	179301162	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179301162G>A	uc003fjw.2	+	12	1221	c.1048G>A	c.(1048-1050)GTG>ATG	p.V350M	ACTL6A_uc003fjx.2_Missense_Mutation_p.V308M|ACTL6A_uc003fjy.2_Missense_Mutation_p.V308M	NM_004301	NP_004292	O96019	ACL6A_HUMAN	actin-like 6A isoform 1	350					chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			CAGTGTAATAGTGGCAGGAGG	0.343													10	22	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87622769	87622769	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87622769C>G	uc003hpz.2	+	7	1490	c.1010C>G	c.(1009-1011)CCT>CGT	p.P337R	PTPN13_uc003hpy.2_Missense_Mutation_p.P337R|PTPN13_uc003hqa.2_Missense_Mutation_p.P337R|PTPN13_uc003hqb.2_Missense_Mutation_p.P337R	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	337						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TCAACTACTCCTAGAAAAAAG	0.463													20	43	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123160881	123160881	+	Silent	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123160881T>C	uc003ieh.2	+	27	4089	c.4044T>C	c.(4042-4044)AGT>AGC	p.S1348S	KIAA1109_uc003iei.1_Silent_p.S1101S|KIAA1109_uc010ins.1_Silent_p.S691S|KIAA1109_uc003iek.2_5'UTR	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1348					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						TCTCTCGAAGTGATGAGAATG	0.433													11	14	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126373089	126373089	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126373089G>A	uc003ifj.3	+	9	10918	c.10918G>A	c.(10918-10920)GAT>AAT	p.D3640N	FAT4_uc011cgp.1_Missense_Mutation_p.D1938N|FAT4_uc003ifi.1_Missense_Mutation_p.D1118N	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3640	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GAAGCCACAGGATCCAGATGT	0.463													10	24	---	---	---	---	PASS
CCDC111	201973	broad.mit.edu	37	4	185580549	185580549	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185580549T>G	uc003iwk.2	+	4	669	c.236T>G	c.(235-237)CTT>CGT	p.L79R	CCDC111_uc010isd.1_RNA|CCDC111_uc003iwj.2_Missense_Mutation_p.L79R|CCDC111_uc003iwl.2_Missense_Mutation_p.L79R|CCDC111_uc003iwm.2_5'UTR|CCDC111_uc003iwn.2_5'UTR	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111	79					DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		CGTATTTACCTTGTGACAACC	0.368													14	24	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189065213	189065213	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189065213G>T	uc003izm.1	+	5	897	c.782G>T	c.(781-783)TGT>TTT	p.C261F	TRIML1_uc003izn.1_5'UTR	NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	261					multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TTGCTTCAGTGTCCAGAGGCC	0.547													21	26	---	---	---	---	PASS
SLC9A3	6550	broad.mit.edu	37	5	480068	480068	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:480068G>T	uc003jbe.2	-	10	1642	c.1530C>A	c.(1528-1530)TTC>TTA	p.F510L	SLC9A3_uc011clx.1_Missense_Mutation_p.F501L|uc011cly.1_RNA	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen	510	Cytoplasmic (Potential).					cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			ACTTCCTGTCGAAGTGGGACC	0.617													16	102	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7706958	7706958	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7706958A>G	uc003jdz.1	+	8	1278	c.1211A>G	c.(1210-1212)GAT>GGT	p.D404G	ADCY2_uc011cmo.1_Missense_Mutation_p.D224G	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	404	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						TGGCAATATGATGTGTGGTCA	0.512													35	64	---	---	---	---	PASS
MIER3	166968	broad.mit.edu	37	5	56219584	56219584	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56219584G>C	uc003jrd.1	-	12	1154	c.1129C>G	c.(1129-1131)CGG>GGG	p.R377G	MIER3_uc003jqz.1_Missense_Mutation_p.R314G|MIER3_uc003jra.1_Missense_Mutation_p.R376G|MIER3_uc003jrb.1_Missense_Mutation_p.R201G|MIER3_uc003jrc.1_Missense_Mutation_p.R382G	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family	377					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		GGCTCAGGCCGGTTAGAAGTT	0.423													20	8	---	---	---	---	PASS
KIF3A	11127	broad.mit.edu	37	5	132039185	132039185	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132039185T>C	uc003kxo.2	-	10	1509	c.1355A>G	c.(1354-1356)GAG>GGG	p.E452G	KIF3A_uc003kxm.2_Missense_Mutation_p.E34G|KIF3A_uc003kxn.2_Missense_Mutation_p.E437G|KIF3A_uc011cxf.1_Missense_Mutation_p.E479G|KIF3A_uc003kxp.2_Missense_Mutation_p.E455G	NM_007054	NP_008985	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	452	Potential.				blood coagulation|organelle organization|plus-end-directed vesicle transport along microtubule	centrosome|cytosol|kinesin II complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|protein binding			pancreas(1)	1		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTCCCGTTTCTCTAATTCAGC	0.328													9	7	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140502858	140502858	+	Silent	SNP	G	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140502858G>C	uc003lip.1	+	1	1278	c.1278G>C	c.(1276-1278)GGG>GGC	p.G426G		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	426	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGACTTGGGGACACCCAGGC	0.542													51	36	---	---	---	---	PASS
HLA-DPA1	3113	broad.mit.edu	37	6	33037649	33037649	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33037649T>A	uc003ocs.1	-	2	146	c.115A>T	c.(115-117)ACT>TCT	p.T39S	HLA-DPA1_uc010juk.2_Missense_Mutation_p.T39S|HLA-DPA1_uc003oct.1_Missense_Mutation_p.T39S	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	39	Alpha-1.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						GCGGCATAAGTTGACACATGG	0.398													15	40	---	---	---	---	PASS
VPS52	6293	broad.mit.edu	37	6	33235042	33235042	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33235042G>A	uc003odm.1	-	11	1258	c.1048C>T	c.(1048-1050)CGC>TGC	p.R350C	VPS52_uc003odn.1_Intron	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	350					protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						ACAGAGCCGCGGGTTCCTAGG	0.557													25	37	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123588862	123588862	+	Silent	SNP	A	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123588862A>G	uc003pzj.1	-	32	1795	c.1773T>C	c.(1771-1773)TCT>TCC	p.S591S	TRDN_uc010kem.1_Silent_p.S92S	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	591	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		CTGTTTTTATAGATGGAGGTT	0.269													3	1	---	---	---	---	PASS
RPS6KA2	6196	broad.mit.edu	37	6	166944708	166944708	+	Intron	SNP	C	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166944708C>G	uc003qvb.1	-						RPS6KA2_uc011ego.1_Intron|RPS6KA2_uc010kkl.1_Intron|RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCGGCCCTTCCGAAGCTCTTA	0.473													14	126	---	---	---	---	PASS
SUN1	23353	broad.mit.edu	37	7	894552	894552	+	Intron	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:894552C>T	uc011jvp.1	+						GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Intron|SUN1_uc011jvr.1_Intron|SUN1_uc003sji.2_Intron|SUN1_uc003sjk.2_Intron	NM_001130965	NP_001124437	O94901	SUN1_HUMAN	unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0						CTTCTCTTTCCTAAGACTGAC	0.398													15	30	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41729508	41729508	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41729508C>T	uc003thq.2	-	2	1256	c.1021G>A	c.(1021-1023)GCT>ACT	p.A341T	INHBA_uc003thr.2_Missense_Mutation_p.A341T	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	341					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						CCAGAGGGAGCAATGATCCAG	0.537										TSP Lung(11;0.080)			21	49	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82538245	82538245	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82538245T>C	uc003uhx.2	-	8	13674	c.13385A>G	c.(13384-13386)AAA>AGA	p.K4462R	PCLO_uc003uhv.2_Missense_Mutation_p.K4462R	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4393					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTCCGGCAGTTTTCGGTCCAG	0.423													4	14	---	---	---	---	PASS
PCOLCE	5118	broad.mit.edu	37	7	100204242	100204242	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100204242C>A	uc003uvo.2	+	6	1127	c.929C>A	c.(928-930)CCT>CAT	p.P310H	uc011kjy.1_5'Flank|PCOLCE_uc010lhb.1_RNA|PCOLCE_uc003uvp.1_RNA	NM_002593	NP_002584	Q15113	PCOC1_HUMAN	procollagen C-endopeptidase enhancer	310					multicellular organismal development	extracellular space	collagen binding|heparin binding|peptidase activator activity				0	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GAGGAATCTCCTTCAGCCCCT	0.512													4	41	---	---	---	---	PASS
AKR1D1	6718	broad.mit.edu	37	7	137792169	137792169	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137792169T>A	uc003vtz.2	+	7	767	c.698T>A	c.(697-699)GTT>GAT	p.V233D	AKR1D1_uc011kqe.1_Missense_Mutation_p.V233D|AKR1D1_uc011kqf.1_Missense_Mutation_p.V192D|AKR1D1_uc010lmy.1_RNA	NM_005989	NP_005980	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	233					androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding			skin(1)	1						AGGGTGAATGTTTCTTCTCCA	0.378													13	19	---	---	---	---	PASS
ADCK2	90956	broad.mit.edu	37	7	140373931	140373931	+	Silent	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140373931C>A	uc003vvy.1	+	1	979	c.801C>A	c.(799-801)CTC>CTA	p.L267L	ADCK2_uc003vvz.2_Silent_p.L267L	NM_052853	NP_443085	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	267	Protein kinase.					integral to membrane	ATP binding|protein serine/threonine kinase activity				0	Melanoma(164;0.00956)					CAGAAAATCTCGCAGACCAGT	0.577													4	89	---	---	---	---	PASS
DLGAP2	9228	broad.mit.edu	37	8	1497207	1497207	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1497207C>A	uc003wpl.2	+	2	445	c.348C>A	c.(346-348)TTC>TTA	p.F116L	DLGAP2_uc003wpm.2_Missense_Mutation_p.F116L	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	195					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TGGACCAGTTCGAGAAGCAGC	0.697													5	3	---	---	---	---	PASS
TNFRSF10B	8795	broad.mit.edu	37	8	22887122	22887122	+	Splice_Site	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22887122C>A	uc003xcu.2	-	4	769	c.476_splice	c.e4+1	p.G159_splice	TNFRSF10B_uc003xcs.1_5'Flank|TNFRSF10B_uc003xct.2_Splice_Site_p.G159_splice|TNFRSF10B_uc011kzq.1_Splice_Site_p.G8_splice|TNFRSF10B_uc003xcv.2_Splice_Site_p.G57_splice	NM_003842	NP_003833	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily,						activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cell surface receptor linked signaling pathway|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|positive regulation of I-kappaB kinase/NF-kappaB cascade	plasma membrane	caspase activator activity|receptor activity|TRAIL binding				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		TCCTGTCTCACCCTGTGCGGC	0.592													10	16	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	28988133	28988133	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28988133G>T	uc003xhh.3	-	24	3051	c.2992C>A	c.(2992-2994)CAG>AAG	p.Q998K	uc003xhi.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	998					microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TTCTCATTCTGTTCCAAGATT	0.403													10	25	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41845059	41845059	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41845059A>G	uc010lxb.2	-	4	1167	c.623T>C	c.(622-624)ATC>ACC	p.I208T	MYST3_uc010lxc.2_Missense_Mutation_p.I208T|MYST3_uc003xon.3_Missense_Mutation_p.I208T|MYST3_uc010lxd.2_Missense_Mutation_p.I208T	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	208	PHD-type 1.				histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			GAAACTACAGATGGGGATTGG	0.383													6	179	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763156	77763156	+	Silent	SNP	T	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763156T>G	uc003yav.2	+	10	4251	c.3864T>G	c.(3862-3864)GGT>GGG	p.G1288G	ZFHX4_uc003yau.1_Silent_p.G1333G|ZFHX4_uc003yaw.1_Silent_p.G1288G	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1288						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCATGGCAGGTCTCGAGGATT	0.368										HNSCC(33;0.089)			8	18	---	---	---	---	PASS
LRRC6	23639	broad.mit.edu	37	8	133623603	133623603	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133623603C>A	uc003ytk.2	-	9	1055	c.981G>T	c.(979-981)ATG>ATT	p.M327I	LRRC6_uc003ytl.2_RNA	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6	327	CS.					cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			AAGAGGTATCCATATACCTTC	0.299													3	11	---	---	---	---	PASS
ZC3H3	23144	broad.mit.edu	37	8	144621138	144621138	+	Silent	SNP	A	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144621138A>C	uc003yyd.2	-	2	428	c.399T>G	c.(397-399)TCT>TCG	p.S133S		NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	133					mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			TGGCAGAGCCAGACTTTGATG	0.602													6	76	---	---	---	---	PASS
C9orf128	392307	broad.mit.edu	37	9	35826091	35826091	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35826091T>C	uc010mlc.2	-	2	353	c.68A>G	c.(67-69)AAG>AGG	p.K23R	C9orf128_uc003zyj.2_RNA|C9orf128_uc011lpg.1_Missense_Mutation_p.K23R	NM_001012446	NP_001012448	A6H8Z2	CI128_HUMAN	hypothetical protein LOC392307	23											0	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			AGAGGGGTCCTTTGAAGGGGG	0.502											OREG0019180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	47	---	---	---	---	PASS
RALGPS1	9649	broad.mit.edu	37	9	129958917	129958917	+	Intron	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129958917G>A	uc004bqo.1	+						RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						CTAGGTAAGCGTCTCCGGCCT	0.612													38	84	---	---	---	---	PASS
FAM171A1	221061	broad.mit.edu	37	10	15255479	15255479	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15255479G>A	uc001iob.2	-	8	2115	c.2108C>T	c.(2107-2109)CCG>CTG	p.P703L		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor	703	Cytoplasmic (Potential).					integral to membrane				ovary(2)|breast(1)|skin(1)	4						CCGGGGGTGCGGAAGCGGCTT	0.567													31	37	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73491744	73491744	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73491744G>A	uc001jrx.3	+	31	4093	c.3716G>A	c.(3715-3717)GGG>GAG	p.G1239E	CDH23_uc001jrz.2_Missense_Mutation_p.G855E|C10orf105_uc001jsb.1_Intron|CDH23_uc001jsc.1_Missense_Mutation_p.G47E	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1239	Cadherin 12.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CCTCCTACAGGGGATGGTGGC	0.592													12	31	---	---	---	---	PASS
JAKMIP3	282973	broad.mit.edu	37	10	133967422	133967422	+	Silent	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133967422G>T	uc001lkx.3	+	18	2142	c.2142G>T	c.(2140-2142)CTG>CTT	p.L714L	JAKMIP3_uc009yba.1_Silent_p.L151L	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TTCAGGAGCTGTTCAGTAAGC	0.612													4	89	---	---	---	---	PASS
STK32C	282974	broad.mit.edu	37	10	134040467	134040467	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134040467G>A	uc001lle.1	-	4	616	c.476C>T	c.(475-477)TCC>TTC	p.S159F	STK32C_uc001lld.1_Missense_Mutation_p.S42F|STK32C_uc010quu.1_Missense_Mutation_p.S172F|STK32C_uc009ybc.1_Missense_Mutation_p.S42F|STK32C_uc009ybd.1_Missense_Mutation_p.S42F|STK32C_uc001llb.2_5'UTR|STK32C_uc001llc.1_RNA	NM_173575	NP_775846	Q86UX6	ST32C_HUMAN	serine/threonine kinase 32C	159	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GTCCTGGAAGGAGTACCTGTG	0.627													11	28	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	134981751	134981751	+	Intron	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134981751C>A	uc001llz.1	+						KNDC1_uc001lma.1_Intron	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		TCTCTCTCCTCCCCAAGACGA	0.632													7	179	---	---	---	---	PASS
IGF2	3481	broad.mit.edu	37	11	2156585	2156585	+	Intron	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2156585C>T	uc009yde.2	-						IGF2_uc001lvf.2_5'Flank|IGF2_uc001lvg.2_Intron|IGF2_uc009ydf.2_Intron|IGF2_uc001lvh.2_Intron|INS-IGF2_uc001lvi.2_Intron|MIR483_hsa-mir-483|MI0002467_5'Flank	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1						glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		GAAGCCCCTCCCAGCTACTTA	0.647													4	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	5068701	5068701	+	IGR	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068701C>A								OR52J3 (19 upstream) : OR52E2 (11180 downstream)																							AGACTCTTACCATGTTATTTT	0.383													3	7	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406376	55406376	+	Silent	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406376T>C	uc010rij.1	+	1	543	c.543T>C	c.(541-543)CCT>CCC	p.P181P		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						ATGTGTATCCTTTGCTGAAAT	0.388													9	2	---	---	---	---	PASS
OR4D11	219986	broad.mit.edu	37	11	59271853	59271853	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59271853A>C	uc001noa.1	+	1	805	c.805A>C	c.(805-807)AAG>CAG	p.K269Q		NM_001004706	NP_001004706	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCCCACAGAAAAGGCCATCTC	0.527													64	88	---	---	---	---	PASS
INTS5	80789	broad.mit.edu	37	11	62414975	62414975	+	Silent	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62414975C>T	uc001nud.2	-	2	2630	c.2577G>A	c.(2575-2577)GAG>GAA	p.E859E	GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	859	Helical; (Potential).				snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						GCTTTAACAGCTCAAAGAGCA	0.677													14	24	---	---	---	---	PASS
KLC2	64837	broad.mit.edu	37	11	66030426	66030426	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66030426C>T	uc010rov.1	+	5	914	c.671C>T	c.(670-672)GCA>GTA	p.A224V	KLC2_uc010row.1_Missense_Mutation_p.A224V|KLC2_uc009yra.2_Missense_Mutation_p.A224V|KLC2_uc001ohb.2_Missense_Mutation_p.A224V|KLC2_uc010rox.1_Missense_Mutation_p.A147V|KLC2_uc001ohc.2_Missense_Mutation_p.A224V|KLC2_uc001ohd.2_Missense_Mutation_p.A147V|KLC2_uc001ohe.1_Missense_Mutation_p.A85V	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN	kinesin light chain 2 isoform 1	224	TPR 1.				blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0						TGCAAGCAGGCACTCGAAGAC	0.622													22	55	---	---	---	---	PASS
FOLR3	2352	broad.mit.edu	37	11	71850518	71850518	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71850518G>A	uc001ory.1	+	4	661	c.611G>A	c.(610-612)TGG>TAG	p.W204*	FOLR3_uc001orx.1_Nonsense_Mutation_p.W162*			P41439	FOLR3_HUMAN	SubName: Full=FOLR3 protein; Flags: Fragment;	160					folic acid transport	extracellular region|extrinsic to membrane|membrane fraction	folic acid binding|receptor activity				0					Folic Acid(DB00158)	GGCTGGAATTGGACCTCAGGT	0.572													10	19	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134244883	134244883	+	Silent	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134244883G>A	uc001qhp.2	+	19	2030	c.1842G>A	c.(1840-1842)GAG>GAA	p.E614E	GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	614					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		TTTTTGAGGAGACGATGGCGG	0.627													4	18	---	---	---	---	PASS
GALNT8	26290	broad.mit.edu	37	12	4854615	4854615	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4854615G>A	uc001qne.1	+	5	973	c.881G>A	c.(880-882)CGG>CAG	p.R294Q		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	294	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						ATCTTGGCTCGGATTCAGGAG	0.478													13	18	---	---	---	---	PASS
CCDC38	120935	broad.mit.edu	37	12	96292183	96292183	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96292183C>G	uc001tek.1	-	7	828	c.594G>C	c.(592-594)ATG>ATC	p.M198I		NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	198	Potential.									skin(1)	1						CTTGTACCTCCATGCTTGCTT	0.418													24	59	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111891561	111891561	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111891561T>C	uc001tsj.2	-	24	3995	c.3833A>G	c.(3832-3834)CAG>CGG	p.Q1278R	ATXN2_uc001tsh.2_Missense_Mutation_p.Q1038R|ATXN2_uc001tsi.2_Missense_Mutation_p.Q971R|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Intron|ATXN2_uc001tsl.1_3'UTR	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2	1278					cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						GAGGGCGGCCTGGGGACCGCC	0.567													10	22	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19753543	19753543	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19753543T>G	uc009zzj.2	-	2	213	c.164A>C	c.(163-165)GAG>GCG	p.E55A		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	55					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		AGCTCCAGTCTCACTGAAGAA	0.552													10	110	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19753544	19753544	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19753544C>A	uc009zzj.2	-	2	212	c.163G>T	c.(163-165)GAG>TAG	p.E55*		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	55					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GCTCCAGTCTCACTGAAGAAC	0.552													11	110	---	---	---	---	PASS
ADAM21	8747	broad.mit.edu	37	14	70925106	70925106	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70925106T>C	uc001xmd.2	+	1	890	c.890T>C	c.(889-891)ATG>ACG	p.M297T		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	297	Peptidase M12B.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GCTGCACATATGTTCATAAAA	0.383													24	38	---	---	---	---	PASS
PLD4	122618	broad.mit.edu	37	14	105396392	105396392	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105396392C>G	uc001ypu.1	+	6	808	c.667C>G	c.(667-669)CGG>GGG	p.R223G	PLD4_uc010tyl.1_Missense_Mutation_p.R230G	NM_138790	NP_620145	Q96BZ4	PLD4_HUMAN	phospholipase D4	223	PLD phosphodiesterase 1.				lipid catabolic process	integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity			central_nervous_system(1)|skin(1)	2		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)		Choline(DB00122)	TGTGGATGGACGGCACATATA	0.602													22	50	---	---	---	---	PASS
BRF1	2972	broad.mit.edu	37	14	105692499	105692499	+	Splice_Site	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105692499C>A	uc001yqp.2	-	10	1319	c.956_splice	c.e10-1	p.G319_splice	BRF1_uc010tyo.1_Splice_Site_p.G204_splice|BRF1_uc010typ.1_Splice_Site_p.G204_splice|BRF1_uc001yql.2_Splice_Site_p.G115_splice|BRF1_uc001yqo.2_Splice_Site_p.G81_splice|BRF1_uc010axg.1_Splice_Site_p.G292_splice|BRF1_uc001yqn.2_Splice_Site|BRF1_uc010axh.1_Splice_Site	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1						positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		GATATTTCACCTGAAGTCATA	0.438													5	94	---	---	---	---	PASS
UBE2Q2	92912	broad.mit.edu	37	15	76152255	76152255	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76152255T>C	uc002bbg.2	+	3	705	c.319T>C	c.(319-321)TGC>CGC	p.C107R	UBE2Q2_uc002bbh.2_Intron|UBE2Q2_uc010umn.1_Missense_Mutation_p.C91R|UBE2Q2_uc002bbi.2_5'UTR	NM_173469	NP_775740	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q 2 isoform 1	107					protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2						ATGTGAACTCTGCAGTTTATA	0.378													7	13	---	---	---	---	PASS
CHD2	1106	broad.mit.edu	37	15	93536215	93536215	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93536215A>T	uc002bsp.2	+	28	4157	c.3582A>T	c.(3580-3582)GAA>GAT	p.E1194D	CHD2_uc002bso.1_Missense_Mutation_p.E1194D	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1194					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AGCTGAAAGAAAATGCCAGCG	0.502													17	26	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3808000	3808000	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3808000C>T	uc002cvv.2	-	18	3623	c.3419G>A	c.(3418-3420)CGG>CAG	p.R1140Q	CREBBP_uc002cvw.2_Missense_Mutation_p.R1102Q	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1140	Bromo.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTCCAGCTTCCGCTTGATGGT	0.463			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				23	27	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70896017	70896017	+	Missense_Mutation	SNP	A	G	G	rs57797337		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70896017A>G	uc002ezr.2	-	69	11836	c.11708T>C	c.(11707-11709)ATT>ACT	p.I3903T	HYDIN_uc010cfy.2_RNA	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3904										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GAACTTCTGAATCTTCCCCAC	0.547													6	16	---	---	---	---	PASS
LRRC50	123872	broad.mit.edu	37	16	84193349	84193349	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84193349C>T	uc002fhl.3	+	6	992	c.811C>T	c.(811-813)CGA>TGA	p.R271*	LRRC50_uc010chi.1_RNA|LRRC50_uc010vnw.1_Nonsense_Mutation_p.R19*	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	271	LRRCT.				axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						AGTCACTGTACGACTAAAGCA	0.388									Kartagener_syndrome				24	41	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263352	263352	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263352G>A	uc002frh.2	+	3	764	c.748G>A	c.(748-750)GAG>AAG	p.E250K	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	270	7.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1						CCCCGACCCCGAGGCCCTCAA	0.726													4	1	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577556	7577556	+	Missense_Mutation	SNP	C	A	A	rs121912655		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577556C>A	uc002gim.2	-	7	919	c.725G>T	c.(724-726)TGC>TTC	p.C242F	TP53_uc002gig.1_Missense_Mutation_p.C242F|TP53_uc002gih.2_Missense_Mutation_p.C242F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C110F|TP53_uc010cng.1_Missense_Mutation_p.C110F|TP53_uc002gii.1_Missense_Mutation_p.C110F|TP53_uc010cnh.1_Missense_Mutation_p.C242F|TP53_uc010cni.1_Missense_Mutation_p.C242F|TP53_uc002gij.2_Missense_Mutation_p.C242F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C149F|TP53_uc002gio.2_Missense_Mutation_p.C110F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	242	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).	Zinc.	C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C242F(63)|p.C242Y(37)|p.C242S(25)|p.C242fs*5(16)|p.C242R(11)|p.C242W(7)|p.0?(7)|p.N239_C242delNSSC(3)|p.C242*(3)|p.C242C(2)|p.C242G(2)|p.C242fs*20(1)|p.C242fs*23(1)|p.Y236_M243delYMCNSSCM(1)|p.C242_M246>L(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*98(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.S241_G245delSCMGG(1)|p.N239_C242del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCCGCCCATGCAGGAACTGTT	0.577		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			59	21	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10307778	10307778	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10307778C>T	uc002gmm.2	-	22	2652	c.2557G>A	c.(2557-2559)GCC>ACC	p.A853T	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	853	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TTCATGGTGGCCATCTCTTTC	0.458									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				12	30	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21318712	21318712	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21318712C>A	uc002gyv.1	+	3	763	c.58C>A	c.(58-60)CTG>ATG	p.L20M		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	20	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	GGAGGACGGGCTGCACCTGGT	0.687										Prostate(3;0.18)			5	35	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27062332	27062332	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27062332G>A	uc002hcp.2	+	4	561	c.561G>A	c.(559-561)TGG>TGA	p.W187*		NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	187	Protein kinase.					cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					GTGACATCTGGGCCCTGGGCT	0.577													9	24	---	---	---	---	PASS
MYO1D	4642	broad.mit.edu	37	17	30965835	30965835	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30965835C>A	uc002hho.1	-	20	2626	c.2614G>T	c.(2614-2616)GTG>TTG	p.V872L	MYO1D_uc002hhp.1_Missense_Mutation_p.V872L	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	872						myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			CTGTCTTCCACCTTACTAAAT	0.358													5	11	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33690215	33690215	+	Silent	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33690215G>A	uc010ctp.2	-	4	1054	c.612C>T	c.(610-612)ATC>ATT	p.I204I	SLFN11_uc010ctq.2_Silent_p.I204I|SLFN11_uc002hjh.3_Silent_p.I204I|SLFN11_uc002hjg.3_Silent_p.I204I|SLFN11_uc010ctr.2_Silent_p.I204I	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	204						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAAAAGGCAGGATTTCACCAT	0.413													18	44	---	---	---	---	PASS
AOC2	314	broad.mit.edu	37	17	40997603	40997603	+	Silent	SNP	A	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40997603A>G	uc002ibu.2	+	1	995	c.960A>G	c.(958-960)CAA>CAG	p.Q320Q	AOC2_uc002ibt.2_Silent_p.Q320Q	NM_009590	NP_033720	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 isoform b	320					catecholamine metabolic process|visual perception	cytoplasm|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|electron carrier activity|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			ovary(2)	2		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		ACAGTGTGCAAGGAAACCTGG	0.547													45	58	---	---	---	---	PASS
GJC1	10052	broad.mit.edu	37	17	42882110	42882110	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42882110T>C	uc002ihj.2	-	2	1587	c.1076A>G	c.(1075-1077)CAA>CGA	p.Q359R	GJC1_uc002ihk.2_Missense_Mutation_p.Q359R|GJC1_uc002ihl.2_Missense_Mutation_p.Q359R|GJC1_uc010czx.2_Missense_Mutation_p.Q359R|GJC1_uc010czy.1_Missense_Mutation_p.Q220R	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	359	Cytoplasmic (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				AGGGTTGTTTTGGTGACTGTA	0.572													41	45	---	---	---	---	PASS
STH	246744	broad.mit.edu	37	17	44076726	44076726	+	Silent	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44076726C>T	uc002ijy.2	+	1	111	c.81C>T	c.(79-81)TGC>TGT	p.C27C	MAPT_uc010dau.2_Intron|MAPT_uc002ijr.3_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_001007532	NP_001007533	Q8IWL8	STH_HUMAN	saitohin	27						cytoplasm|nucleus					0						tcattgaatgCGGGGTTAATT	0.254													7	74	---	---	---	---	PASS
SFRS1	6426	broad.mit.edu	37	17	56083253	56083253	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56083253C>A	uc002ivi.2	-	3	670	c.461G>T	c.(460-462)CGA>CTA	p.R154L	SFRS1_uc002ivj.2_Missense_Mutation_p.R154L	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform	154	RRM 2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		AGTGCCATCTCGGTAAACATC	0.413													4	65	---	---	---	---	PASS
IMPACT	55364	broad.mit.edu	37	18	22007976	22007976	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22007976G>C	uc002kvh.3	+	2	242	c.130G>C	c.(130-132)GAT>CAT	p.D44H	IMPACT_uc002kvg.3_Missense_Mutation_p.D26H	NM_018439	NP_060909	Q9P2X3	IMPCT_HUMAN	Impact homolog	44	RWD.										0	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					AATTAGCGACGATATAGATGA	0.408													38	86	---	---	---	---	PASS
MED16	10025	broad.mit.edu	37	19	879947	879947	+	Missense_Mutation	SNP	C	T	T	rs139117438	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:879947C>T	uc002lqd.1	-	8	1494	c.1343G>A	c.(1342-1344)AGC>AAC	p.S448N	MED16_uc010drw.1_Missense_Mutation_p.S273N|MED16_uc002lqe.2_Missense_Mutation_p.S437N|MED16_uc002lqf.2_Missense_Mutation_p.S437N|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Missense_Mutation_p.S437N|MED16_uc010xfx.1_Missense_Mutation_p.S293N|MED16_uc010xfy.1_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	448					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCCCGTGGCTGTCAATCCC	0.667													3	26	---	---	---	---	PASS
UHRF1	29128	broad.mit.edu	37	19	4929420	4929420	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4929420G>T	uc002mbo.2	+	3	508	c.340G>T	c.(340-342)GCC>TCC	p.A114S	UHRF1_uc010xik.1_Intron|UHRF1_uc010duf.2_RNA|UHRF1_uc002mbp.2_Missense_Mutation_p.A127S	NM_001048201	NP_001041666	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains	114					cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		CGGTGAGGCGGCCGCCGAGAC	0.652													26	20	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10270421	10270421	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10270421G>C	uc002mng.2	-	16	1325	c.1145C>G	c.(1144-1146)ACA>AGA	p.T382R	DNMT1_uc010xlc.1_Missense_Mutation_p.T398R|DNMT1_uc002mnh.2_Missense_Mutation_p.T277R|DNMT1_uc010xld.1_Missense_Mutation_p.T382R	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	382	DNA replication foci-targeting sequence (By similarity).|Homodimerization.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	CTTCTCATTTGTCAGCATCTG	0.547													6	134	---	---	---	---	PASS
HOOK2	29911	broad.mit.edu	37	19	12874185	12874185	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12874185G>T	uc002muy.2	-	23	2242	c.2071C>A	c.(2071-2073)CTG>ATG	p.L691M	HOOK2_uc010xmq.1_Missense_Mutation_p.L96M|HOOK2_uc002muz.2_Missense_Mutation_p.L689M	NM_013312	NP_037444	Q96ED9	HOOK2_HUMAN	hook homolog 2 isoform 1	691	Sufficient for interaction with CEP110.|Required for localization to the centrosome and induction of aggresome formation.				early endosome to late endosome transport|endocytosis|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|protein transport	centrosome|FHF complex|microtubule	identical protein binding|microtubule binding			ovary(1)|breast(1)|skin(1)	3						TGCTGTGCCAGGAATGACTGG	0.637													5	51	---	---	---	---	PASS
PDE4C	5143	broad.mit.edu	37	19	18333041	18333041	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18333041G>A	uc010xqc.1	-	2	815	c.335C>T	c.(334-336)CCG>CTG	p.P112L	PDE4C_uc002nik.3_Missense_Mutation_p.P112L|PDE4C_uc002nil.3_Missense_Mutation_p.P112L|PDE4C_uc002nif.3_5'Flank|PDE4C_uc002nig.3_5'Flank|PDE4C_uc002nih.3_5'Flank|PDE4C_uc010ebk.2_Missense_Mutation_p.P6L|PDE4C_uc002nii.3_Missense_Mutation_p.P80L|PDE4C_uc010ebl.2_5'UTR|PDE4C_uc010xqd.1_5'UTR|PDE4C_uc010ebm.1_5'Flank|PDE4C_uc002nim.1_Missense_Mutation_p.P112L	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	112					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)	CTGGCTGTGCGGGACTGGAGC	0.627													12	27	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38989785	38989785	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38989785G>T	uc002oit.2	+	43	7059	c.6929G>T	c.(6928-6930)TGC>TTC	p.C2310F	RYR1_uc002oiu.2_Missense_Mutation_p.C2310F|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2310	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CTCCAGAGCTGCCCCATGCTT	0.622													19	42	---	---	---	---	PASS
BBC3	27113	broad.mit.edu	37	19	47725088	47725088	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47725088G>A	uc002pgf.3	-	4	834	c.553C>T	c.(553-555)CAC>TAC	p.H185Y	BBC3_uc010xyl.1_Missense_Mutation_p.P219L|BBC3_uc010eky.2_Missense_Mutation_p.H123Y|BBC3_uc010ekz.2_Missense_Mutation_p.P59L	NM_014417	NP_055232	Q9BXH1	BBC3_HUMAN	BCL2 binding component 3 isoform 4	185					activation of caspase activity|activation of pro-apoptotic gene products|cellular response to hypoxia|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of growth|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|positive regulation of thymocyte apoptosis|protein insertion into mitochondrial membrane involved in induction of apoptosis|reduction of endoplasmic reticulum calcium ion concentration|release of cytochrome c from mitochondria|release of sequestered calcium ion into cytosol	cytosol|mitochondrial outer membrane	protein binding|protein binding				0		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.000179)|OV - Ovarian serous cystadenocarcinoma(262;0.00029)|Epithelial(262;0.0103)|GBM - Glioblastoma multiforme(486;0.0234)		GGGGCTCTGTGGCCCCTGGGT	0.667													7	15	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55179342	55179342	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55179342C>T	uc002qgp.2	+	12	1581	c.1219C>T	c.(1219-1221)CCC>TCC	p.P407S	LILRB4_uc002qgq.2_Missense_Mutation_p.P406S|LILRB4_uc002qgr.2_Missense_Mutation_p.P449S|LILRB4_uc010ert.2_Missense_Mutation_p.P448S|LILRB4_uc010eru.2_Missense_Mutation_p.P437S	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	407	Cytoplasmic (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		ATCTGAAGCCCCCCAGGATGT	0.647													4	72	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55447727	55447727	+	Silent	SNP	C	T	T	rs141917868		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55447727C>T	uc002qih.3	-	6	2278	c.2202G>A	c.(2200-2202)ACG>ACA	p.T734T	NLRP7_uc002qig.3_Silent_p.T706T|NLRP7_uc002qii.3_Silent_p.T734T|NLRP7_uc010esk.2_Silent_p.T734T|NLRP7_uc010esl.2_Silent_p.T762T	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	734							ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		GGGTCAGGTGCGTGAGGGTCT	0.517													16	32	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55670653	55670653	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55670653G>A	uc002qji.1	-	12	1437	c.1403C>T	c.(1402-1404)GCT>GTT	p.A468V	TNNI3_uc002qjg.3_5'Flank|TNNI3_uc010yft.1_5'Flank|C19orf51_uc002qjh.1_Missense_Mutation_p.A283V|C19orf51_uc002qjj.1_Missense_Mutation_p.A515V|C19orf51_uc002qjk.1_Missense_Mutation_p.A414V|C19orf51_uc002qjl.1_Missense_Mutation_p.A535V			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	468											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GGGTTCCACAGCTGGGACAGT	0.632													5	50	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31671225	31671225	+	Silent	SNP	A	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31671225A>G	uc010zue.1	+	3	237	c.222A>G	c.(220-222)GTA>GTG	p.V74V		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	74						cytoplasm|extracellular region	lipid binding				0						CCCCCCCAGTATATACCAACG	0.488													57	110	---	---	---	---	PASS
TOMM34	10953	broad.mit.edu	37	20	43585127	43585127	+	Splice_Site	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43585127C>A	uc002xmy.2	-	2	268	c.128_splice	c.e2-1	p.G43_splice	PABPC1L_uc002xmx.2_Intron|TOMM34_uc002xmz.2_Splice_Site	NM_006809	NP_006800	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34						protein targeting to mitochondrion	integral to membrane|mitochondrial outer membrane	heat shock protein binding|signal sequence binding				0		Myeloproliferative disorder(115;0.0122)				TCTGAAGAACCTGCCCAGATA	0.468													6	109	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47444188	47444188	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47444188G>T	uc002xtw.1	-	1	233	c.210C>A	c.(208-210)TTC>TTA	p.F70L		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	70	DH.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCGACTGCAAGAAGCGCAAGG	0.632													8	6	---	---	---	---	PASS
KRTAP12-2	353323	broad.mit.edu	37	21	46086489	46086489	+	Silent	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46086489G>A	uc002zfu.2	-	1	356	c.315C>T	c.(313-315)TGC>TGT	p.C105C	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_181684	NP_859012	P59991	KR122_HUMAN	keratin associated protein 12-2	105	23 X 5 AA approximate repeats.|18.					keratin filament					0						TCACAGGCACGCACAGGGAGG	0.652													17	42	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22782086	22782086	+	Intron	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22782086C>A	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						AGCCACCTTCCTCCTCCGCAT	0.537													87	32	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32506092	32506092	+	Silent	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32506092G>A	uc003amc.2	+	15	2119	c.1887G>A	c.(1885-1887)AAG>AAA	p.K629K	SLC5A1_uc011alz.1_Silent_p.K502K	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	629	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						AAGCCATGAAGATGAAGATGA	0.483													66	35	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40060851	40060851	+	Silent	SNP	C	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40060851C>T	uc003ayc.2	+	21	3774	c.3774C>T	c.(3772-3774)TCC>TCT	p.S1258S	CACNA1I_uc003ayd.2_Silent_p.S1223S|CACNA1I_uc003aye.2_Silent_p.S1173S|CACNA1I_uc003ayf.2_Silent_p.S1138S	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	1258	Helical; Name=S3 of repeat III; (Potential).|III.				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	TCGTGGTGTCCCTGGCCTCAG	0.652													23	35	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40807497	40807497	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40807497G>T	uc003ayv.1	-	12	2900	c.2693C>A	c.(2692-2694)CCC>CAC	p.P898H	MKL1_uc003ayw.1_Missense_Mutation_p.P898H|MKL1_uc010gye.1_3'UTR|MKL1_uc010gyf.1_Missense_Mutation_p.P848H	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	898					positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GCTCAGCACGGGACCACCTGA	0.612			T	RBM15	acute megakaryocytic leukemia								5	43	---	---	---	---	PASS
PRPS2	5634	broad.mit.edu	37	X	12817407	12817407	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12817407G>T	uc004cvb.2	+	2	328	c.204G>T	c.(202-204)ATG>ATT	p.M68I	PRPS2_uc004cva.2_Missense_Mutation_p.M68I|PRPS2_uc010nec.2_Missense_Mutation_p.M1I	NM_002765	NP_002756	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	68					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0						ACAACCTGATGGAACTCCTCA	0.493													5	73	---	---	---	---	PASS
TLR7	51284	broad.mit.edu	37	X	12904135	12904135	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12904135G>T	uc004cvc.2	+	3	647	c.508G>T	c.(508-510)GAA>TAA	p.E170*		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	170	LRR 5.|Extracellular (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	GAATCTAACAGAACTGGCCAA	0.418													5	35	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39932857	39932857	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39932857G>T	uc004den.3	-	4	2034	c.1742C>A	c.(1741-1743)ACC>AAC	p.T581N	BCOR_uc004dep.3_Missense_Mutation_p.T581N|BCOR_uc004deo.3_Missense_Mutation_p.T581N|BCOR_uc004dem.3_Missense_Mutation_p.T581N|BCOR_uc004deq.3_Missense_Mutation_p.T581N	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	581					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GCTGGTTTTGGTGCCATCTGC	0.617													7	58	---	---	---	---	PASS
FAM120C	54954	broad.mit.edu	37	X	54099692	54099692	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54099692A>T	uc004dsz.3	-	16	3148	c.3065T>A	c.(3064-3066)CTG>CAG	p.L1022Q	FAM120C_uc011moh.1_Missense_Mutation_p.W885R	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954	1022										ovary(1)|central_nervous_system(1)	2						ATGAAGCTCCAGGGATTTAGA	0.463													8	25	---	---	---	---	PASS
CDX4	1046	broad.mit.edu	37	X	72673420	72673420	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72673420G>T	uc011mqk.1	+	2	570	c.570G>T	c.(568-570)AAG>AAT	p.K190N		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	190	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)					AGCTGGAAAAGGAATTCCATT	0.403													3	9	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73963358	73963358	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73963358C>A	uc004eby.2	-	3	1651	c.1034G>T	c.(1033-1035)TGC>TTC	p.C345F		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	345					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						TCGCTTGGGGCAGGTAGTAAA	0.463													19	20	---	---	---	---	PASS
ARL13A	392509	broad.mit.edu	37	X	100242388	100242388	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100242388T>A	uc004ego.2	+	6	612	c.496T>A	c.(496-498)TCA>ACA	p.S166T	ARL13A_uc011mrf.1_Missense_Mutation_p.S166T|ARL13A_uc010nng.2_Missense_Mutation_p.S166T	NM_001012990	NP_001013008	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13 isoform a	166							GTP binding			ovary(1)	1						GGAGCCATGTTCAGCCATCAG	0.512													5	23	---	---	---	---	PASS
MIR890	100126303	broad.mit.edu	37	X	145075861	145075861	+	RNA	SNP	G	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145075861G>A	hsa-mir-890|MI0005533	-			c.9G>A																				0						TTCCAAGTAGGGCACTTCCCA	0.483													7	99	---	---	---	---	PASS
C1orf170	84808	broad.mit.edu	37	1	911962	911964	+	In_Frame_Del	DEL	TTC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:911962_911964delTTC	uc001ach.2	-	4	1884_1886	c.1848_1850delGAA	c.(1846-1851)CAGAAT>CAT	p.616_617QN>H	C1orf170_uc001acg.2_RNA	NR_027693				RecName: Full=Uncharacterized protein C1orf170;												0						GCACATGTCATTCTGGCTGAAGG	0.611													2	4	---	---	---	---	
UBE2J2	118424	broad.mit.edu	37	1	1200945	1200946	+	Intron	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1200945_1200946delGT	uc001adn.2	-						UBE2J2_uc001adm.2_Intron|UBE2J2_uc001ado.2_Intron|UBE2J2_uc001adp.2_Intron|UBE2J2_uc001adq.2_Intron|UBE2J2_uc001adr.2_Intron|UBE2J2_uc001ads.2_Intron	NM_194458	NP_919440	Q8N2K1	UB2J2_HUMAN	ubiquitin conjugating enzyme E2, J2 isoform 3						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		GTTTTCTCTCgtgtgtgtgtgt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2942499	2942500	+	IGR	INS	-	G	G	rs141913407		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2942499_2942500insG								ACTRT2 (3034 upstream) : FLJ42875 (33683 downstream)																							gacatggtggtgtgatcatgat	0.000													3	3	---	---	---	---	
KIAA0495	57212	broad.mit.edu	37	1	3661614	3661614	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3661614delC	uc009vlm.2	-						KIAA0495_uc001akt.3_Intron	NM_207306	NP_997189			hypothetical protein LOC57212 precursor												0	all_cancers(77;0.0338)|Ovarian(185;0.0634)|Lung NSC(156;0.172)|all_lung(157;0.182)	all_epithelial(116;1.83e-21)|all_lung(118;2e-08)|Lung NSC(185;7.5e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;1.27e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.204)		gcccatcatgccccactggcc	0.184													4	2	---	---	---	---	
LRRC47	57470	broad.mit.edu	37	1	3707679	3707679	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3707679delA	uc001akx.1	-							NM_020710	NP_065761	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47						translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GGAGAAGCCCACCCACCCCGG	0.647													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	8407786	8407786	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8407786delC								SLC45A1 (3560 upstream) : RERE (4680 downstream)																							aggtatcattcccccatttga	0.134													4	2	---	---	---	---	
SPSB1	80176	broad.mit.edu	37	1	9364412	9364412	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9364412delA	uc010oae.1	+							NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		cagcctccataaccgatgagc	0.015													4	2	---	---	---	---	
PLOD1	5351	broad.mit.edu	37	1	12019988	12019989	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12019988_12019989insT	uc001atm.2	+						PLOD1_uc010obb.1_Intron	NM_000302	NP_000293	Q02809	PLOD1_HUMAN	lysyl hydroxylase 1 precursor						epidermis development|hydroxylysine biosynthetic process|protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein homodimerization activity			ovary(2)|breast(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Minoxidil(DB00350)|Succinic acid(DB00139)|Vitamin C(DB00126)	Gttgtttttccttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	13143165	13143166	+	IGR	INS	-	T	T	rs112205639		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13143165_13143166insT								PRAMEF5 (25414 upstream) : LOC440563 (39795 downstream)																							aaCAAGATAACttttttttttt	0.015													4	2	---	---	---	---	
CROCCL2	114819	broad.mit.edu	37	1	16818894	16818894	+	5'Flank	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16818894delA	uc001ays.2	-						CROCCL2_uc001ayt.2_RNA					Homo sapiens mRNA for KIAA1922 protein, partial cds.												0						actttgtctcaaaaaaaaaaa	0.219													4	2	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16919855	16919856	+	Intron	INS	-	T	T	rs149255660		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16919855_16919856insT	uc009vos.1	-						NBPF1_uc010oce.1_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CTCAGCTTTCACCCCACCTAGG	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17054247	17054247	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17054247delG								ESPNP (7595 upstream) : CROCC (12521 downstream)																							GAGAAGCTGCGGGCAGGACAG	0.572													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17850803	17850804	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17850803_17850804insA								RCC2 (84583 upstream) : ARHGEF10L (15526 downstream)																							tccgtctcaagaaaaaaaaaaa	0.015													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	23590766	23590767	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23590766_23590767insT								HTR1D (69544 upstream) : HNRNPR (45510 downstream)																							TCCTTCCTTCCttttttttttt	0.173													5	6	---	---	---	---	
RUNX3	864	broad.mit.edu	37	1	25230458	25230458	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25230458delC	uc001bjq.2	-						RUNX3_uc010oen.1_Intron|RUNX3_uc009vrj.2_Intron|RUNX3_uc001bjr.2_Intron|RUNX3_uc001bjs.2_5'Flank	NM_004350	NP_004341	Q13761	RUNX3_HUMAN	runt-related transcription factor 3 isoform 2						cell proliferation|induction of apoptosis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|protein phosphorylation|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		gagcaggggtccaTGAGGCTT	0.289													4	2	---	---	---	---	
GPN2	54707	broad.mit.edu	37	1	27210531	27210531	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27210531delA	uc001bnd.1	-							NM_018066	NP_060536	Q9H9Y4	GPN2_HUMAN	ATP binding domain 1 family, member B								GTP binding				0						actccatctcaaaaaaaaaaa	0.209													4	2	---	---	---	---	
MECR	51102	broad.mit.edu	37	1	29541181	29541182	+	Intron	DEL	TT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29541181_29541182delTT	uc001brq.1	-						MECR_uc001brp.1_Intron|MECR_uc001brr.1_Intron|MECR_uc001brs.1_Intron|MECR_uc001brt.1_Intron|MECR_uc010ofz.1_Intron	NM_016011	NP_057095	Q9BV79	MECR_HUMAN	trans-2-enoyl-CoA reductase, mitochondrial						fatty acid biosynthetic process	mitochondrion	trans-2-enoyl-CoA reductase (NADPH) activity|zinc ion binding			ovary(1)	1		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		ccccaacttctttttttaaagc	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30533706	30533707	+	IGR	INS	-	G	G	rs142034478	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30533706_30533707insG								PTPRU (880391 upstream) : MATN1 (650419 downstream)																							agatgggagctggggagaagct	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31107402	31107403	+	IGR	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31107402_31107403delTG								None (None upstream) : MATN1 (76723 downstream)																							tgtgcctctatgtgtgtgtgtg	0.035													3	3	---	---	---	---	
LCK	3932	broad.mit.edu	37	1	32714661	32714662	+	5'Flank	DEL	TT	-	-	rs35387366		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32714661_32714662delTT	uc001bux.2	+							NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase						activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	CTTCTGCttctttttttttttt	0.198			T	TRB@	T-ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	38690895	38690896	+	IGR	INS	-	TG	TG	rs141621767	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38690895_38690896insTG								POU3F1 (178445 upstream) : RRAGC (614119 downstream)																							atgtgtgtgtatgtgtgtgtat	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	61517961	61517961	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61517961delT								C1orf87 (978535 upstream) : NFIA (24985 downstream)																							AGAGACCGCATTTCCTACCAC	0.473													4	2	---	---	---	---	
COL24A1	255631	broad.mit.edu	37	1	86246999	86246999	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86246999delA	uc001dlj.2	-						COL24A1_uc001dli.2_Intron|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		TAGTATAATTAAAAAAAAAAA	0.338													6	3	---	---	---	---	
BTBD8	284697	broad.mit.edu	37	1	92557952	92557952	+	Intron	DEL	A	-	-	rs113504750		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92557952delA	uc001doo.2	+						BTBD8_uc010otc.1_Intron	NM_183242	NP_899065	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8							nucleus				ovary(1)	1		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		ggctatctccaaaaaaaaaaa	0.000													3	3	---	---	---	---	
C1orf183	55924	broad.mit.edu	37	1	112292066	112292071	+	Intron	DEL	GTGCGC	-	-	rs58362318		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112292066_112292071delGTGCGC	uc001ebp.1	-						uc001ebr.2_Intron	NM_198926	NP_945120	Q9NTI7	CA183_HUMAN	hypothetical protein LOC55924 isoform 2											ovary(2)	2		all_cancers(81;7.29e-06)|all_epithelial(167;4.98e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.16e-05)		Lung(183;0.0155)|Colorectal(144;0.0289)|all cancers(265;0.0592)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0852)|COAD - Colon adenocarcinoma(174;0.113)		gtgtgtgtgtgtgCGCGCGCGCGCGT	0.437													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142663441	142663442	+	Intron	INS	-	A	A	rs147458002		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663441_142663442insA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		TCACTACAGGTCATTTCCCCTG	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144011657	144011658	+	Intron	INS	-	G	G	rs139895110		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144011657_144011658insG	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		GGttcttttttttgttgtttgt	0.228													6	6	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144533512	144533514	+	Intron	DEL	AAG	-	-	rs66523280		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144533512_144533514delAAG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						cgtatgtgaaaagaaccgttttt	0.172													5	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145197036	145197037	+	Intron	INS	-	A	A	rs142617464	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145197036_145197037insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						gggagcaagagggggggggtgt	0.000													5	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145434970	145434970	+	Intron	DEL	A	-	-	rs34678804		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145434970delA	uc001emp.3	+							NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ccctatgtggaaaaaaaaaaa	0.149													4	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145604303	145604303	+	Intron	DEL	T	-	-	rs72127681		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145604303delT	uc001emp.3	+						POLR3C_uc001eog.2_Intron|POLR3C_uc001eoh.2_Intron|POLR3C_uc001eoi.2_Intron|POLR3C_uc009wix.2_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		acccaatttcttttttttttt	0.000													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145622420	145622421	+	Intron	INS	-	G	G	rs145691857	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145622420_145622421insG	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ttttgttttttgtttttttttg	0.178													4	4	---	---	---	---	
LOC728989	728989	broad.mit.edu	37	1	146494077	146494078	+	Intron	INS	-	CA	CA	rs67982109		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146494077_146494078insCA	uc001epd.2	-							NR_024442				SubName: Full=cDNA FLJ59595, highly similar to Homo sapiens phosphodiesterase 4D interacting protein, transcript variant 1, mRNA;												0						CTAAAAAGGCTGTTTCATGGGG	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	146979527	146979528	+	Intron	DEL	CT	-	-	rs72506253		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146979527_146979528delCT	uc001epp.2	-											Homo sapiens cDNA clone IMAGE:5266739.																		GATTCATCCCCTGACATTCTTC	0.441													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149224409	149224423	+	IGR	DEL	GCAGCAGCAGGTGGG	-	-	rs11276062		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149224409_149224423delGCAGCAGCAGGTGGG								LOC645166 (271355 upstream) : LOC388692 (55053 downstream)																							CCTTCGTGGCGCAGCAGCAGGTGGGGAAGCAGCAG	0.605													13	9	---	---	---	---	
RPRD2	23248	broad.mit.edu	37	1	150338073	150338074	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150338073_150338074insT	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1						TCCAGTTCCTCtttttttttga	0.188													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	150878100	150878100	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150878100delC								ARNT (28914 upstream) : SETDB1 (20715 downstream)																							AGAACCTCTTCCAAATCTCAT	0.224													3	5	---	---	---	---	
CGN	57530	broad.mit.edu	37	1	151489019	151489019	+	Intron	DEL	T	-	-	rs113562915		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151489019delT	uc009wmw.2	+							NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin							myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAGTGGCACttttttttttt	0.274													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152672915	152672915	+	IGR	DEL	G	-	-	rs71752235		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152672915delG								LCE2A (999 upstream) : LCE4A (8608 downstream)																							GGCACCACTAGGGGAATTAAA	0.468													2	4	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154753267	154753267	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154753267delC	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron|KCNN3_uc009wox.1_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			GGTAAAATTACCAGTCAGCAA	0.483													1	5	---	---	---	---	
DCST2	127579	broad.mit.edu	37	1	154994042	154994043	+	Intron	INS	-	AAC	AAC	rs147730808	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154994042_154994043insAAC	uc001fgm.2	-						DCST2_uc009wpb.2_Intron	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			gtctctaacttaaccccccaaa	0.015													1	5	---	---	---	---	
SEMA4A	64218	broad.mit.edu	37	1	156146086	156146087	+	Intron	INS	-	A	A	rs77230341		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156146086_156146087insA	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					gaacctgcctcaaaaaaaaaaa	0.163													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	158498912	158498912	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158498912delA								OR10R2 (48238 upstream) : OR6Y1 (18008 downstream)																							atcgaggcagaaaactatcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159835617	159835617	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159835617delT								VSIG8 (3170 upstream) : CCDC19 (6539 downstream)																							GGCCCCTTGCTTTTTCCTAAG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164156561	164156562	+	IGR	DEL	CT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164156561_164156562delCT								NUF2 (831008 upstream) : PBX1 (372240 downstream)																							atttcccaagctctctctgtgg	0.203													4	2	---	---	---	---	
TBX19	9095	broad.mit.edu	37	1	168212517	168212518	+	Intron	INS	-	AGC	AGC	rs138223678		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168212517_168212518insAGC	uc001gfj.3	+							NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					GGAAAGAACAGAGCAGCAGCAG	0.426													4	2	---	---	---	---	
NME7	29922	broad.mit.edu	37	1	169120397	169120397	+	Intron	DEL	A	-	-	rs5778603		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169120397delA	uc001gfu.2	-						NME7_uc010plq.1_Intron|NME7_uc001gft.2_Intron	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a						CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					GAGGGGGCCCAGGCTGATGCC	0.537													0	6	---	---	---	---	
C1orf112	55732	broad.mit.edu	37	1	169793341	169793341	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169793341delA	uc001ggp.2	+						C1orf112_uc001ggj.2_Intron|C1orf112_uc001ggq.2_Intron|C1orf112_uc009wvt.2_Intron|C1orf112_uc010plu.1_Intron|C1orf112_uc009wvu.1_Intron|C1orf112_uc001ggr.2_Intron|C1orf112_uc010plv.1_Intron	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732												0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					tgtttcctctaacacatctac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181324724	181324728	+	IGR	DEL	AAACA	-	-	rs4048546		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181324724_181324728delAAACA								IER5 (264747 upstream) : CACNA1E (127988 downstream)																							actccatctcaaacaaaacaaaaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	182110514	182110518	+	IGR	DEL	TTTCT	-	-	rs59737553		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182110514_182110518delTTTCT								ZNF648 (79667 upstream) : GLUL (241151 downstream)																							CAGAGATTCCTTTCttttttttttt	0.220													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	191312620	191312620	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191312620delT								FAM5C (865861 upstream) : RGS18 (814972 downstream)																							cagaccctcctggtgagtgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	193969435	193969435	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193969435delT								CDC73 (745495 upstream) : None (None downstream)																							GCATTTCTACTTTACATGATT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199975916	199975916	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199975916delA								None (None upstream) : NR5A2 (20854 downstream)																							CCCAGAAGGGAAAGTCCTTAC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201090957	201090957	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201090957delA								CACNA1S (9263 upstream) : TMEM9 (12944 downstream)																							accctgtctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201641270	201641271	+	Intron	INS	-	T	T	rs148611377	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201641270_201641271insT	uc001gwu.2	+							NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						TAtttgaaacgttttttctccc	0.208													3	5	---	---	---	---	
NAV1	89796	broad.mit.edu	37	1	201792498	201792499	+	3'UTR	INS	-	TA	TA	rs140203725	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201792498_201792499insTA	uc001gwu.2	+	29					NAV1_uc001gwx.2_3'UTR	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						ctgcgtgtgtgtgtgtgtgtgt	0.327													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201944669	201944669	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201944669delC								TIMM17A (4882 upstream) : RNPEP (7097 downstream)																							gcctcggcctcccaaaatgct	0.000													6	3	---	---	---	---	
LGR6	59352	broad.mit.edu	37	1	202173448	202173450	+	Intron	DEL	CCT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202173448_202173450delCCT	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						ccaacacacacctcctcctaaca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204033284	204033285	+	IGR	INS	-	CACA	CACA	rs10900545	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204033284_204033285insCACA								C1orf157 (22892 upstream) : SOX13 (8961 downstream)																							tctctctctctcacacacacac	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204385990	204385994	+	IGR	DEL	AAGGA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204385990_204385994delAAGGA								PPP1R15B (5046 upstream) : PIK3C2B (5765 downstream)																							gaaaaggaagaaggaaaggaaagga	0.000													3	5	---	---	---	---	
LRRN2	10446	broad.mit.edu	37	1	204629706	204629709	+	Intron	DEL	CACT	-	-	rs138876993	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204629706_204629709delCACT	uc001hbe.1	-						MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Intron|LRRN2_uc009xbf.1_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor						cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			cacacacacacactctctctctct	0.377													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	205572698	205572698	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205572698delG								MFSD4 (653 upstream) : ELK4 (12537 downstream)																							cacagggtgaggggtaatgta	0.000													6	3	---	---	---	---	
CR1L	1379	broad.mit.edu	37	1	207831652	207831653	+	Intron	INS	-	AA	AA	rs142704619	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207831652_207831653insAA	uc001hga.3	+						CR1L_uc001hfz.2_Intron	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm|extracellular region|membrane					0						actgagaagagaaaaaaaaata	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209367516	209367517	+	IGR	INS	-	TT	TT	rs35991547		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209367516_209367517insTT								PLXNA2 (949851 upstream) : LOC642587 (234651 downstream)																							TATAAGGTGAAttttttttttt	0.139													3	3	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210829750	210829750	+	Intron	DEL	C	-	-	rs66521649		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210829750delC	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		AGCACACATACCCCCCCCGTC	0.597													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212445567	212445568	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212445567_212445568delGT								DTL (167381 upstream) : PPP2R5A (13311 downstream)																							TGCAGGgtgagtgtgtgtgtgt	0.347													3	3	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214623820	214623820	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214623820delA	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		gtctcaaattaaaaaaaaaaa	0.095													2	4	---	---	---	---	
KCNK2	3776	broad.mit.edu	37	1	215218138	215218139	+	Intron	INS	-	CG	CG	rs150179184	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215218138_215218139insCG	uc001hko.2	+						KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron	NM_001017424	NP_001017424	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2 isoform								outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)	GGATAAgtgtatgtgtgtgtgt	0.307													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218866432	218866433	+	IGR	INS	-	A	A	rs142357955	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218866432_218866433insA								TGFB2 (248473 upstream) : LYPLAL1 (480759 downstream)																							tagctttagtgattgacagaat	0.114													1	5	---	---	---	---	
ITPKB	3707	broad.mit.edu	37	1	226826755	226826756	+	Intron	INS	-	TT	TT	rs34561047		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226826755_226826756insTT	uc010pvo.1	-							NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B								ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				GTGCCCTTGACttttttttttt	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229335121	229335121	+	IGR	DEL	G	-	-	rs112985675		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229335121delG								RHOU (452712 upstream) : RAB4A (71758 downstream)																							AGAAACTAACGTGGAAGACTA	0.527													5	5	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236710980	236710981	+	Intron	INS	-	G	G	rs150744640	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236710980_236710981insG	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ATCGGCGAGGAGGGGCAGCACT	0.589													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	237199220	237199223	+	IGR	DEL	TCCT	-	-	rs66520854		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237199220_237199223delTCCT								MTR (131940 upstream) : RYR2 (6479 downstream)																							tcctgcttgctccttccttccttc	0.000													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237278537	237278537	+	Intron	DEL	C	-	-	rs149962018		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237278537delC	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAAACCACACCCCCCCCCTT	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	238247766	238247767	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238247766_238247767insT								LOC100130331 (156149 upstream) : LOC339535 (395919 downstream)																							ttatgaaggtgttttttttgtt	0.000													5	3	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239613034	239613035	+	Intron	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239613034_239613035delGT	uc001hyo.1	+									P20309	ACM3_HUMAN	Homo sapiens clone N10 NTera2D1 teratocarcinoma, m3 muscarinic acetylcholine receptor mRNA, partial cds.						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	TCACATTCTGgtgtgtgtgtgt	0.153													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242089870	242089870	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242089870delG								EXO1 (36823 upstream) : MAP1LC3C (68922 downstream)																							GTGAGAGGGTGGGAGGGGAGG	0.483													4	2	---	---	---	---	
SMYD3	64754	broad.mit.edu	37	1	246224156	246224156	+	Intron	DEL	A	-	-	rs34784543		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246224156delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		AGTGTACACTAACTGGCTGAC	0.333													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	246842483	246842490	+	IGR	DEL	TGGCCTGA	-	-	rs142844259	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246842483_246842490delTGGCCTGA								CNST (10600 upstream) : SCCPDH (44888 downstream)																							ACTGGGGCCTTGGCCTGATGCACGCCTT	0.486													2	4	---	---	---	---	
SNTG2	54221	broad.mit.edu	37	2	961044	961045	+	Intron	INS	-	T	T	rs36164535		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:961044_961045insT	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		agtcctcctcctggtccccaat	0.168													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1601818	1601821	+	IGR	DEL	CACA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1601818_1601821delCACA								TPO (55320 upstream) : PXDN (33839 downstream)																							catacacatgcacacacaatcata	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2736692	2736692	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2736692delG								MYT1L (401647 upstream) : TSSC1 (456049 downstream)																							CCGTGCAGCCGTCAGGACCGG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2882220	2882220	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2882220delG								MYT1L (547175 upstream) : TSSC1 (310521 downstream)																							agccttttttgggtacccaca	0.000													4	2	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3327565	3327566	+	Intron	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3327565_3327566delAC	uc002qxj.2	-							NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		gggatttccaacagtgtctgct	0.267													3	4	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7164326	7164326	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7164326delT	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		TTCTGGTTAAttttttttttc	0.229													5	3	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7171472	7171474	+	Intron	DEL	CTT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7171472_7171474delCTT	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		cagatgtgtccttctacggaact	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7867990	7867991	+	IGR	DEL	AG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7867990_7867991delAG								RNF144A (683683 upstream) : LOC339788 (194567 downstream)																							ctcCAGAGACAGAGAGAGAGAG	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11657631	11657632	+	IGR	INS	-	A	A	rs146621871	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11657631_11657632insA								E2F6 (51334 upstream) : GREB1 (16610 downstream)																							ctgtagacttGAAAAAAAAAAG	0.233													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	14884753	14884756	+	IGR	DEL	ATGG	-	-	rs147192682		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14884753_14884756delATGG								FAM84A (93820 upstream) : NBAS (422276 downstream)																							GAAGACAGCCatggatggatggat	0.304													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16112632	16112633	+	IGR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16112632_16112633delAC								MYCN (25504 upstream) : FAM49A (621268 downstream)																							GATTGCCAAAACACACACACAC	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16179658	16179659	+	IGR	INS	-	T	T	rs149953801		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16179658_16179659insT								MYCN (92530 upstream) : FAM49A (554242 downstream)																							ctttccttttctttctttcttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	18448669	18448670	+	IGR	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18448669_18448670delTG								KCNS3 (334445 upstream) : NT5C1B (287321 downstream)																							tgtgtgtgcatgtgtgtgtgtg	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19093209	19093210	+	IGR	DEL	GA	-	-	rs148631940		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19093209_19093210delGA								NT5C1B (322371 upstream) : OSR1 (458037 downstream)																							ggtgctgagtgaggggaaagtt	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	25422262	25422262	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25422262delA								POMC (30703 upstream) : DNMT3A (33584 downstream)																							aactccatctaaaaaaaaaag	0.010													4	2	---	---	---	---	
CAPN14	440854	broad.mit.edu	37	2	31413004	31413005	+	Intron	DEL	TC	-	-	rs5830200		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31413004_31413005delTC	uc010yms.1	-						CAPN14_uc002rnt.1_Intron	NM_001145122	NP_001138594	A8MX76	CAN14_HUMAN	calpain 14						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0						TGATTCATATtctctctctctc	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	31513968	31513968	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31513968delG								EHD3 (22709 upstream) : XDH (43220 downstream)																							gaacccggtagatggaggttg	0.030													4	2	---	---	---	---	
MTA3	57504	broad.mit.edu	37	2	42913662	42913662	+	Intron	DEL	A	-	-	rs113862613		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42913662delA	uc002rso.1	+						MTA3_uc002rsp.1_Intron|MTA3_uc002rsq.2_Intron|MTA3_uc002rsr.2_Intron	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						tctgcctcttaaaaaaaaaaa	0.015													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43227282	43227283	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43227282_43227283delGT								HAAO (207531 upstream) : ZFP36L2 (222259 downstream)																							gtgtgtgtgcgtgtgtgtgtgt	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	48000159	48000159	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48000159delA								MSH2 (93651 upstream) : MSH6 (10062 downstream)																							tctcaagaggaaaaaaaaaaa	0.174													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54225674	54225674	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54225674delG								PSME4 (27697 upstream) : ACYP2 (116736 downstream)																							atttccagctgggcacagtgg	0.040													4	2	---	---	---	---	
COMMD1	150684	broad.mit.edu	37	2	62268445	62268446	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62268445_62268446insT	uc002sbp.2	+							NM_152516	NP_689729	Q8N668	COMD1_HUMAN	MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			ACTACTTGTGGTTTTTTTTTCG	0.248													4	2	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66659919	66659920	+	5'Flank	INS	-	AT	AT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66659919_66659920insAT	uc002sdu.2	+						MEIS1_uc002sdt.2_5'Flank	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						cacacacacacacacacacaca	0.347													4	2	---	---	---	---	
CYP26B1	56603	broad.mit.edu	37	2	72363208	72363208	+	Intron	DEL	C	-	-	rs3835744		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72363208delC	uc002sih.1	-						CYP26B1_uc010yra.1_Intron|CYP26B1_uc010yrb.1_Intron	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,						cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						GGCTGCGCAGCCCCCCTTGCC	0.602													6	3	---	---	---	---	
GNLY	10578	broad.mit.edu	37	2	85924235	85924236	+	Intron	INS	-	C	C	rs148797582	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85924235_85924236insC	uc002sql.3	+						GNLY_uc010fgp.2_Intron|GNLY_uc010ysx.1_Intron	NM_006433	NP_006424	P22749	GNLY_HUMAN	granulysin isoform NKG5						cellular defense response|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0						CACACCTCCCACCCCACCAGTC	0.550													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	88294230	88294231	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88294230_88294231insA								RMND5A (255464 upstream) : KRCC1 (32493 downstream)																							aatggttaaggaaaaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	88653760	88653760	+	IGR	DEL	A	-	-	rs74322069		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88653760delA								THNSL2 (167615 upstream) : FOXI3 (93966 downstream)																							atctgaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90450239	90450239	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90450239delC	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CGGCTTTTTGCCCCCCTGCCG	0.706													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90451278	90451278	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90451278delT	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		ACTGACCTTATTTTTTTTTAC	0.139													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91784574	91784579	+	IGR	DEL	TTAACT	-	-	rs67885824		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91784574_91784579delTTAACT								None (None upstream) : LOC654342 (20613 downstream)																							acttaatacattaactttaaatcccg	0.073													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106914483	106914483	+	IGR	DEL	C	-	-	rs111485973		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106914483delC								UXS1 (103688 upstream) : PLGLA (88286 downstream)																							tttataacaacaaaaaaagga	0.055													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	112318430	112318430	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112318430delA								LOC541471 (65738 upstream) : ANAPC1 (208211 downstream)																							ggaaggaaggaaagagaaaga	0.050													4	2	---	---	---	---	
ZC3H6	376940	broad.mit.edu	37	2	113046863	113046863	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113046863delC	uc002thq.1	+							NM_198581	NP_940983	P61129	ZC3H6_HUMAN	zinc finger CCCH-type domain containing 6								nucleic acid binding|zinc ion binding			ovary(3)|central_nervous_system(1)	4						gcatgagccacccgtgccagg	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114259755	114259755	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114259755delA								FOXD4L1 (1029 upstream) : FAM138B (75204 downstream)																							GTTTGGAAACAAACTGAGAAT	0.567													6	6	---	---	---	---	
TMEM177	80775	broad.mit.edu	37	2	120451857	120451858	+	Intron	DEL	CA	-	-	rs113320688		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120451857_120451858delCA	uc002tme.2	+									Q53S58	TM177_HUMAN	Homo sapiens cDNA FLJ32751 fis, clone TESTI2001621.							integral to membrane				ovary(1)	1	Colorectal(110;0.196)					TGTGGTATACcacacacacaca	0.144													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	130534490	130534490	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130534490delC								None (None upstream) : LOC389033 (145945 downstream)																							GGTTTTTTGTCCACAGAGGGT	0.468													4	2	---	---	---	---	
ARHGEF4	50649	broad.mit.edu	37	2	131795250	131795250	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131795250delC	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc010fmx.1_Intron|ARHGEF4_uc002tsc.1_5'Flank	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		AGAAACAGATCCCATGTTAGG	0.607													6	6	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133013261	133013261	+	Intron	DEL	C	-	-	rs112748116		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133013261delC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						gtcactacctccccgtgtcag	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133036892	133036892	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133036892delG								NCRNA00164 (21350 upstream) : GPR39 (137255 downstream)																							gatcgtcaaagcccagctttc	0.000													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	136944307	136944307	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136944307delT								CXCR4 (68582 upstream) : THSD7B (578808 downstream)																							TCCTTATGGCttttttttttg	0.224													4	2	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161282846	161282846	+	Intron	DEL	A	-	-	rs138498508	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161282846delA	uc002ubo.2	-						RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						ggaaggaaggaaaggaaggaa	0.100													4	4	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161350902	161350903	+	5'Flank	INS	-	AC	AC			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161350902_161350903insAC	uc002ubo.2	-						RBMS1_uc002ubn.2_5'Flank|RBMS1_uc002ubi.3_5'Flank|RBMS1_uc002ubm.2_5'Flank|RBMS1_uc002ubp.2_5'Flank|RBMS1_uc010fox.2_5'Flank	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						AGcacatacatacatacacaca	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	165125344	165125344	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165125344delT								FIGN (532831 upstream) : GRB14 (223989 downstream)																							gacttttgagttaatgctgaa	0.000													4	2	---	---	---	---	
WIPF1	7456	broad.mit.edu	37	2	175438619	175438620	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175438619_175438620insT	uc002uiy.2	-						uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Intron|WIPF1_uc010fqt.1_Intron|WIPF1_uc002ujc.1_Intron|WIPF1_uc002uiz.2_Intron|WIPF1_uc002ujb.1_Intron|WIPF1_uc010zep.1_Intron	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1						actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						Ctttcttcttcttttttttttt	0.020													4	2	---	---	---	---	
EVX2	344191	broad.mit.edu	37	2	176949462	176949463	+	5'Flank	DEL	AG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176949462_176949463delAG	uc010zeu.1	-							NM_001080458	NP_001073927	Q03828	EVX2_HUMAN	even-skipped homeobox 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	READ - Rectum adenocarcinoma(9;0.0678)|Colorectal(32;0.115)		agtgagagaaagagagagagag	0.287													4	2	---	---	---	---	
HOXD9	3235	broad.mit.edu	37	2	176985110	176985110	+	5'Flank	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176985110delT	uc010zex.1	+							NM_014213	NP_055028	P28356	HXD9_HUMAN	homeobox D9							nucleus	sequence-specific DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		ATCTTGGTGATTTCTGGCTGG	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177317481	177317481	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177317481delA								MTX2 (114730 upstream) : MIR1246 (148227 downstream)																							aagactctttaaaaaaaaaaT	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	200368883	200368884	+	IGR	INS	-	A	A	rs112462961		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200368883_200368884insA								FLJ32063 (27225 upstream) : C2orf69 (407095 downstream)																							gactctgactcaaaaaaaaaaa	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201689730	201689730	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201689730delT								BZW1 (1171 upstream) : CLK1 (28002 downstream)																							ataaattttattaccatagat	0.000													4	2	---	---	---	---	
ALS2CR8	79800	broad.mit.edu	37	2	203820802	203820802	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203820802delT	uc002uzo.2	+						ALS2CR8_uc002uzn.2_Intron|ALS2CR8_uc002uzm.2_Intron|ALS2CR8_uc010zhy.1_Intron|ALS2CR8_uc010zhz.1_Intron|ALS2CR8_uc010ftu.1_Intron|ALS2CR8_uc010zia.1_Intron|ALS2CR8_uc010zib.1_Intron|ALS2CR8_uc010zic.1_Intron|ALS2CR8_uc002uzp.2_Intron	NM_001104586	NP_001098056	Q8N187	AL2S8_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)											large_intestine(1)|ovary(1)	2						CTTGCACTTATTTTTTTTTTT	0.313													4	2	---	---	---	---	
NHEJ1	79840	broad.mit.edu	37	2	219994767	219994767	+	Intron	DEL	T	-	-	rs35802430		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219994767delT	uc002vjp.3	-						NHEJ1_uc002vjq.3_Intron	NM_024782	NP_079058	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1						B cell differentiation|central nervous system development|DNA recombination|double-strand break repair via nonhomologous end joining|positive regulation of ligase activity|response to ionizing radiation|T cell differentiation	nonhomologous end joining complex|nucleus	DNA binding|identical protein binding			lung(1)	1		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		ATGTCCCTTCTTTTTTTTTTT	0.353								Direct_reversal_of_damage|NHEJ					2	5	---	---	---	---	
WDFY1	57590	broad.mit.edu	37	2	224807902	224807902	+	Intron	DEL	A	-	-	rs150630942		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224807902delA	uc002vnq.2	-							NM_020830	NP_065881	Q8IWB7	WDFY1_HUMAN	WD repeat and FYVE domain containing 1							cytosol|early endosome|nucleus	1-phosphatidylinositol binding|zinc ion binding			lung(1)	1		all_lung(227;0.00682)|Lung NSC(271;0.00859)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;5.34e-10)|all cancers(144;1.67e-07)|Lung(261;0.00807)|LUSC - Lung squamous cell carcinoma(224;0.00843)		cctccatcttaaaaaaaaaaa	0.209													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	226884529	226884529	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226884529delT								KIAA1486 (289058 upstream) : IRS1 (711505 downstream)																							gcccccatgattcaattacct	0.005													4	2	---	---	---	---	
WDR69	164781	broad.mit.edu	37	2	228782899	228782899	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228782899delC	uc002vpn.1	+						WDR69_uc010zlw.1_Intron|WDR69_uc002vpo.1_Intron	NM_178821	NP_849143	Q8N136	WDR69_HUMAN	WD repeat domain 69											breast(1)	1		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)		atccatccatccatccatcca	0.055													4	3	---	---	---	---	
FBXO36	130888	broad.mit.edu	37	2	230890108	230890108	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230890108delT	uc010fxi.1	+							NM_174899	NP_777559	Q8NEA4	FBX36_HUMAN	F-box protein 36											ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		acctgctatcttttttttttt	0.000													4	2	---	---	---	---	
DIS3L2	129563	broad.mit.edu	37	2	233134464	233134465	+	Intron	INS	-	AGAG	AGAG	rs144542975	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233134464_233134465insAGAG	uc010fxz.2	+						DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vso.2_Intron	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.								exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GTGTAGGGTGCAGAGAGAGAGA	0.505													4	2	---	---	---	---	
ALPP	250	broad.mit.edu	37	2	233246899	233246899	+	3'UTR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233246899delT	uc002vsq.2	+	11					ALPP_uc002vsr.2_RNA	NM_001632	NP_001623	P05187	PPB1_HUMAN	placental alkaline phosphatase preproprotein							anchored to membrane|cell surface|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		CCTGTGGGACTTGAGGACTCG	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	233311534	233311535	+	IGR	INS	-	CC	CC	rs151169190	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233311534_233311535insCC								ALPPL2 (36112 upstream) : ALPI (9298 downstream)																							GCTCACCCAGACCCTTCCTGAG	0.649													5	6	---	---	---	---	
ECEL1	9427	broad.mit.edu	37	2	233353980	233353981	+	5'Flank	DEL	TT	-	-	rs35444098		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233353980_233353981delTT	uc002vsv.2	-						ECEL1_uc010fya.1_5'Flank|ECEL1_uc010fyb.1_5'Flank	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1						neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		AAAGTGGCTCTTTGTGCTTTTA	0.455													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236331035	236331037	+	IGR	DEL	ACA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236331035_236331037delACA								SH3BP4 (366679 upstream) : AGAP1 (71699 downstream)																							aaTAATAATGACAACAACAACAA	0.222													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	237021060	237021060	+	Intron	DEL	G	-	-	rs66477731		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237021060delG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						attccatctcgaaaaaaaaaa	0.174													4	2	---	---	---	---	
ESPNL	339768	broad.mit.edu	37	2	239027448	239027448	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239027448delA	uc002vxq.3	+						ESPNL_uc010fyw.2_Intron	NM_194312	NP_919288	Q6ZVH7	ESPNL_HUMAN	espin-like											pancreas(1)	1		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		atggaggaggaatggatggag	0.075													9	4	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240111871	240111871	+	Intron	DEL	G	-	-	rs74761897		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240111871delG	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc002vyl.1_Intron|HDAC4_uc010fyy.2_5'Flank	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TTCACGGGGCGGGGGGGGGGT	0.627													4	2	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242433012	242433013	+	Intron	INS	-	T	T	rs113589065		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242433012_242433013insT	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GCAATGCtttgttttttttttt	0.243													9	4	---	---	---	---	
ING5	84289	broad.mit.edu	37	2	242657739	242657742	+	Intron	DEL	CCTC	-	-	rs112407089		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242657739_242657742delCCTC	uc002wcd.2	+						ING5_uc002wcc.1_Intron	NM_032329	NP_115705	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5						DNA replication|histone H3 acetylation|negative regulation of cell proliferation|negative regulation of growth|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		ttcctcccttcctccctccctccc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	243009092	243009093	+	IGR	INS	-	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243009092_243009093insC								C2orf85 (193610 upstream) : LOC728323 (21751 downstream)																							tcagtctgtcaccaggctggag	0.099													4	2	---	---	---	---	
LOC285375	285375	broad.mit.edu	37	3	13723620	13723625	+	Intron	DEL	TGTGCG	-	-	rs6770634		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13723620_13723625delTGTGCG	uc003byd.1	+							NR_027103				Homo sapiens, clone IMAGE:5742174, mRNA.												0						tgcatgtgtatgtgcgtgtgcgtgtg	0.248													9	7	---	---	---	---	
ULK4	54986	broad.mit.edu	37	3	41923876	41923876	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41923876delA	uc003ckv.3	-						ULK4_uc003ckw.2_Intron|ULK4_uc003ckx.1_Intron	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		gggTGGTCGTAGTATTCTTTT	0.055													4	2	---	---	---	---	
SLC6A20	54716	broad.mit.edu	37	3	45813354	45813354	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45813354delT	uc011bai.1	-						SLC6A20_uc003cow.2_5'UTR|SLC6A20_uc011baj.1_Intron	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1						cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		TCATAGGCAGTTACTGCACAG	0.542													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	50820007	50820008	+	Intron	INS	-	GT	GT	rs145578993	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50820007_50820008insGT	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTATTTTTTGAgtgtgtgtgtg	0.045													4	3	---	---	---	---	
FOXP1	27086	broad.mit.edu	37	3	71027024	71027030	+	Frame_Shift_Del	DEL	TGGGTCC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71027024_71027030delTGGGTCC	uc003dol.2	-	11	1620_1626	c.1297_1303delGGACCCA	c.(1297-1305)GGACCCATCfs	p.G433fs	FOXP1_uc003dom.2_Frame_Shift_Del_p.G357fs|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Frame_Shift_Del_p.G433fs|FOXP1_uc003dop.2_Frame_Shift_Del_p.G433fs|FOXP1_uc003doq.1_Frame_Shift_Del_p.G432fs|FOXP1_uc003doi.2_Frame_Shift_Del_p.G333fs|FOXP1_uc003doj.2_Frame_Shift_Del_p.G333fs|FOXP1_uc003dok.2_Frame_Shift_Del_p.G246fs|FOXP1_uc003dor.1_Frame_Shift_Del_p.G211fs	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	433_435					cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CGCCTGCGGATGGGTCCCACCGTGTGC	0.546			T	PAX5	ALL								25	12	---	---	---	---	
FOXP1	27086	broad.mit.edu	37	3	71509381	71509384	+	Intron	DEL	TTTG	-	-	rs10555493		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71509381_71509384delTTTG	uc003dop.2	-						FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		GAGTAAAGGCtttgtttgtttgtt	0.098			T	PAX5	ALL								3	3	---	---	---	---	
CHMP2B	25978	broad.mit.edu	37	3	87294578	87294578	+	Intron	DEL	T	-	-	rs77725272		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87294578delT	uc003dqp.3	+						CHMP2B_uc011bgn.1_Intron	NM_014043	NP_054762	Q9UQN3	CHM2B_HUMAN	chromatin modifying protein 2B						cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane|mitochondrion|nucleus	protein domain specific binding			skin(2)|ovary(1)	3	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		ttggatagtcttttttttttt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	112115760	112115760	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112115760delA								CD200 (34104 upstream) : BTLA (67055 downstream)																							gcctttgcttaaagttgccca	0.000													4	2	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124499519	124499521	+	Intron	DEL	CCT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124499519_124499521delCCT	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		CATACACTCACCTCCTCTCATCG	0.635													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126239991	126239991	+	IGR	DEL	A	-	-	rs112401943		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126239991delA								UROC1 (3397 upstream) : CHST13 (3185 downstream)																							TTCCTCCATGAAAAAAAAAAA	0.318													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126268092	126268093	+	IGR	INS	-	C	C	rs139453118	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126268092_126268093insC								CHST13 (5959 upstream) : C3orf22 (427 downstream)																							CTCCTCATCCACGCCCCCCCCC	0.391													7	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128302939	128302939	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128302939delT								C3orf27 (8010 upstream) : RPN1 (35874 downstream)																							TCAGGGGACATTTTACCTAAG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	132600984	132600985	+	IGR	DEL	TG	-	-	rs71931303		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132600984_132600985delTG								NCRNA00119 (7934 upstream) : TMEM108 (156186 downstream)																							tggtgtgtgatgtgtgtgtgtg	0.000													4	4	---	---	---	---	
TF	7018	broad.mit.edu	37	3	133469302	133469303	+	Intron	INS	-	CCTCCTCTAC	CCTCCTCTAC	rs149021148	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133469302_133469303insCCTCCTCTAC	uc003epu.1	+						TF_uc011bls.1_Intron|TF_uc011blt.1_Intron|TF_uc003epw.1_Intron|TF_uc003epv.1_Intron	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	GCTGGGGTTTTCCGTGTCTTTC	0.396													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140423052	140423056	+	IGR	DEL	TGGGC	-	-	rs112273879		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140423052_140423056delTGGGC								TRIM42 (3061 upstream) : SLC25A36 (237606 downstream)																							tatcaccccttgggctgggctggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147090930	147090930	+	IGR	DEL	A	-	-	rs149042891		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147090930delA								PLSCR5 (766927 upstream) : ZIC4 (12907 downstream)																							CAAAGGAGCTAAAAAAAAAAA	0.438													3	3	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149364148	149364148	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149364148delA	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ctcaccacacaagagtgacac	0.000													4	2	---	---	---	---	
SELT	51714	broad.mit.edu	37	3	150337321	150337321	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150337321delA	uc011bnx.1	+							NM_016275	NP_057359	P62341	SELT_HUMAN	selenoprotein T precursor						cell redox homeostasis|selenocysteine incorporation		selenium binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			agactgtctcaaaaaaaagaa	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151356104	151356105	+	IGR	INS	-	CC	CC			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151356104_151356105insCC								IGSF10 (179607 upstream) : AADACL2 (95599 downstream)																							tctctctccccctctctcaatc	0.193													5	4	---	---	---	---	
KCNAB1	7881	broad.mit.edu	37	3	156005525	156005525	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156005525delG	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			agaattgcctgaacccaggag	0.030													4	2	---	---	---	---	
VEPH1	79674	broad.mit.edu	37	3	157124161	157124161	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157124161delG	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CCATTTCTCAGGATGTTATTC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	159818044	159818044	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159818044delT	uc003fcw.1	-						uc003fcz.1_5'Flank					Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																		GAATGAGTGCTTTTTTTTTTT	0.323													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161961287	161961287	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161961287delT								OTOL1 (739559 upstream) : None (None downstream)																							gcttggctaattttttgtatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162759152	162759153	+	Intron	INS	-	A	A	rs142434525	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162759152_162759153insA	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																		tacaaatagataaaaaggcttt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164420593	164420593	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164420593delG								MIR720 (361355 upstream) : SI (276094 downstream)																							tggctcactcgggaagcacaa	0.000													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165869894	165869897	+	IGR	DEL	TGTG	-	-	rs68016047		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165869894_165869897delTGTG								BCHE (314641 upstream) : None (None downstream)																							CAGTAAAGTTtgtgtgtgtgtgtg	0.240													4	3	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169893711	169893712	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169893711_169893712insA	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron|PHC3_uc003fgm.2_Intron|PHC3_uc003fgo.1_Intron|PHC3_uc003fgp.3_Intron|PHC3_uc003fgq.3_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			gactcagtctcaaaaaaaaaaa	0.015													4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	171089725	171089725	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171089725delA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTTCTTAACTAAAAAAAAAAT	0.393													4	2	---	---	---	---	
TNIK	23043	broad.mit.edu	37	3	171177478	171177479	+	Intron	INS	-	ACACACAA	ACACACAA			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171177478_171177479insACACACAA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron|TNIK_uc003fhq.2_Intron	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			cacacacacacacacacacaca	0.441													29	20	---	---	---	---	
PLD1	5337	broad.mit.edu	37	3	171509560	171509561	+	Intron	INS	-	T	T	rs147004357	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171509560_171509561insT	uc003fhs.2	-						PLD1_uc003fht.2_Intron	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TCTTTCACTCCTTTTTTTTTGT	0.391													4	10	---	---	---	---	
ECT2	1894	broad.mit.edu	37	3	172507789	172507789	+	Intron	DEL	T	-	-	rs35091912		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172507789delT	uc003fii.2	+						ECT2_uc010hwv.1_Intron|ECT2_uc003fih.2_Intron|ECT2_uc003fij.1_Intron|ECT2_uc003fik.1_Intron|ECT2_uc003fil.1_Intron	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			gattcacaaatttttttTTTT	0.224													4	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	176028431	176028432	+	IGR	INS	-	TG	TG	rs140263874	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176028431_176028432insTG								NAALADL2 (505005 upstream) : TBL1XR1 (710111 downstream)																							TTtgtatgtgttgtgtgtgtgt	0.173													8	5	---	---	---	---	
KCNMB2	10242	broad.mit.edu	37	3	178453122	178453122	+	Intron	DEL	C	-	-	rs67542562		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178453122delC	uc003fjd.2	+						uc003fjb.1_Intron|uc003fjc.1_Intron|KCNMB2_uc003fje.2_Intron|KCNMB2_uc003fjf.2_Intron	NM_181361	NP_852006	Q9Y691	KCMB2_HUMAN	calcium-activated potassium channel beta 2						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)			CTCCAGGGTGCCAAGAAAGGC	0.448													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178863031	178863032	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178863031_178863032insT	uc003fjj.2	-											Homo sapiens cDNA clone IMAGE:4821793.																		TGGGTGTATGGTTTTTTTTTTT	0.094													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183762384	183762384	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183762384delT								HTR3D (5228 upstream) : HTR3C (8451 downstream)																							actgagcaagttttttttttg	0.000													4	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184404784	184404784	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184404784delA								EPHB3 (104589 upstream) : MAGEF1 (23372 downstream)																							cgaaaaatacaaaaaaaatta	0.000													5	12	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184747356	184747356	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184747356delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron|VPS8_uc010hye.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AACATGTATCttttttttttt	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184788988	184788989	+	IGR	INS	-	CT	CT	rs142431406	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184788988_184788989insCT								VPS8 (18586 upstream) : C3orf70 (6851 downstream)																							GGGGATGGAAACTCGCCCAGCT	0.663													7	14	---	---	---	---	
C3orf70	285382	broad.mit.edu	37	3	184868285	184868286	+	Intron	INS	-	ATATAT	ATATAT	rs140532064	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184868285_184868286insATATAT	uc003fpd.2	-							NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382												0						tgtgtccaaaaatataagtgtg	0.104													6	4	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188686882	188686883	+	Intron	INS	-	TT	TT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188686882_188686883insTT	uc003frv.1	+							NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		ACCAATCTTGCTTTTTTTTTTT	0.223													4	2	---	---	---	---	
C3orf59	151963	broad.mit.edu	37	3	192548031	192548034	+	Intron	DEL	GTGT	-	-	rs113287706		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192548031_192548034delGTGT	uc011bsp.1	-							NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963												0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		gtgtgtgtgagtgtgtgtgtgtgt	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193110882	193110883	+	IGR	INS	-	A	A	rs147884233	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193110882_193110883insA								ATP13A5 (14368 upstream) : ATP13A4 (8984 downstream)																							aactctgcctcaaaaaaaagaa	0.198													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	196079843	196079843	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196079843delT								TM4SF19 (14585 upstream) : UBXN7 (528 downstream)																							CACGTGGCAATTTTACTTTCA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197037620	197037620	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197037620delG								DLG1 (11477 upstream) : BDH1 (199035 downstream)																							ttacaggtgtgagccatcgtg	0.149													4	2	---	---	---	---	
LRCH3	84859	broad.mit.edu	37	3	197606703	197606703	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197606703delT	uc011bul.1	+						LRCH3_uc011bum.1_Intron|LRCH3_uc011bun.1_Intron|LRCH3_uc003fyk.2_Intron	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)							extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TCTGACCTACTTTTTTTTTTT	0.433													4	3	---	---	---	---	
SH3BP2	6452	broad.mit.edu	37	4	2809315	2809315	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2809315delC	uc003gfi.3	+						SH3BP2_uc010icn.2_Intron	NM_001122681	NP_001116153	P78314	3BP2_HUMAN	SH3-domain binding protein 2 isoform a						signal transduction		SH3 domain binding|SH3/SH2 adaptor activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		CGTTTGGTTTCCATGTGGAGG	0.567									Cherubism				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3591606	3591607	+	RNA	INS	-	ACAC	ACAC	rs139255858		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3591606_3591607insACAC	uc003ghj.1	+	3		c.1377_1378insACAC			uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																		TACATGGAAATacacacacact	0.054													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3608063	3608068	+	IGR	DEL	GTGAGT	-	-	rs36227767		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3608063_3608068delGTGAGT								LRPAP1 (73839 upstream) : ADRA2C (160007 downstream)																							gaatgaatgagtgagtgagcaaatga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4336324	4336325	+	IGR	INS	-	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4336324_4336325insC								ZBTB49 (12812 upstream) : D4S234E (13544 downstream)																							actattaaaaaaaaagtaaaaa	0.089													3	3	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6513247	6513252	+	Intron	DEL	TGGTGA	-	-	rs138281243		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6513247_6513252delTGGTGA	uc011bwd.1	-						PPP2R2C_uc011bwe.1_Intron	NM_181876	NP_870991	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						gtggtggtggtggtgatggtggtggt	0.000													5	4	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7364675	7364677	+	Intron	DEL	CAT	-	-	rs62635991		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7364675_7364677delCAT	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ccaacatcaccatcaccaccatc	0.049													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8524427	8524428	+	IGR	INS	-	ATGA	ATGA	rs149413019		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8524427_8524428insATGA								C4orf23 (29169 upstream) : GPR78 (57863 downstream)																							agcacagagagatgaatgaatg	0.233													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	8854713	8854714	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8854713_8854714insA								CPZ (233227 upstream) : HMX1 (14059 downstream)																							taaggatggccaaaaaaaaaaa	0.089													4	2	---	---	---	---	
MIR572	693157	broad.mit.edu	37	4	11369539	11369539	+	5'Flank	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11369539delT	hsa-mir-572|MI0003579	+																							0						CCAACATCTATTTTAGATGGA	0.323													4	2	---	---	---	---	
FAM184B	27146	broad.mit.edu	37	4	17651701	17651702	+	Intron	INS	-	TCCA	TCCA	rs145609518	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17651701_17651702insTCCA	uc003gpm.3	-							NM_015688	NP_056503	Q9ULE4	F184B_HUMAN	hypothetical protein LOC27146											central_nervous_system(1)	1						ttgtctgtctgtccatccatcc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	23913892	23913892	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23913892delG								PPARGC1A (22192 upstream) : MIR573 (607923 downstream)																							cctggcttctgacagtgacct	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26175113	26175113	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26175113delA								C4orf52 (243613 upstream) : RBPJ (146219 downstream)																							GGTGGGAGATACAGACAAAAA	0.318													2	4	---	---	---	---	
TMEM156	80008	broad.mit.edu	37	4	38985966	38985975	+	Intron	DEL	TCTCTGTGTG	-	-	rs141878511	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38985966_38985975delTCTCTGTGTG	uc003gto.2	-						TMEM156_uc010ifj.2_Intron	NM_024943	NP_079219	Q8N614	TM156_HUMAN	transmembrane protein 156							integral to membrane				skin(1)	1						tctctctctctctctgtgtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	42210739	42210740	+	IGR	INS	-	T	T	rs138224839	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42210739_42210740insT								BEND4 (55844 upstream) : SHISA3 (189116 downstream)																							cgcctggttaatttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45169962	45169963	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45169962_45169963insA								GNPDA2 (441350 upstream) : GABRG1 (867826 downstream)																							tgatgttgagcttttttcatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45535154	45535154	+	IGR	DEL	A	-	-	rs35177109		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45535154delA								GNPDA2 (806542 upstream) : GABRG1 (502635 downstream)																							gcagggggagaaaaaaaaaca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49561238	49561238	+	5'Flank	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49561238delG	uc011bzm.1	+						uc003gza.1_5'Flank					DQ582260																		tcttgtcagtggggaccaggt	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	58099668	58099668	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58099668delA								IGFBP7 (123129 upstream) : None (None downstream)																							tacagtaaacaagttttcaat	0.179													4	2	---	---	---	---	
PPEF2	5470	broad.mit.edu	37	4	76788349	76788349	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76788349delA	uc003hix.2	-						PPEF2_uc003hiy.2_Intron|PPEF2_uc003hiz.1_Intron	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with						detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGATATAGCCAAAGGGAACTT	0.303													4	2	---	---	---	---	
ART3	419	broad.mit.edu	37	4	77021782	77021783	+	Intron	INS	-	A	A	rs11289247		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77021782_77021783insA	uc003hjo.2	+						ART3_uc003hjk.2_Intron|ART3_uc003hjn.2_Intron|ART3_uc003hjp.2_Intron|ART3_uc010ijb.2_Intron|ART3_uc003hjq.2_Intron|ART3_uc003hjr.2_Intron|ART3_uc010ijc.2_Intron|ART3_uc010ijd.2_Intron	NM_001130016	NP_001123488	Q13508	NAR3_HUMAN	ADP-ribosyltransferase 3 isoform a						protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity			ovary(2)	2			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ggctccgtctcaaaaaaaaaaa	0.153													5	3	---	---	---	---	
CCNI	10983	broad.mit.edu	37	4	77996638	77996640	+	5'UTR	DEL	TCC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77996638_77996640delTCC	uc003hkm.2	-	1					CCNI_uc011ccb.1_In_Frame_Del_p.19_20EE>E	NM_006835	NP_006826	Q14094	CCNI_HUMAN	cyclin I						spermatogenesis					ovary(1)	1						ctcctcctcttcctcctcctcct	0.542													4	3	---	---	---	---	
C4orf37	285555	broad.mit.edu	37	4	98726369	98726369	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98726369delT	uc003htt.1	-							NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		TTTATTTACCtttttttgaga	0.020													4	2	---	---	---	---	
ARSJ	79642	broad.mit.edu	37	4	114900260	114900261	+	5'UTR	INS	-	A	A	rs146140248	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114900260_114900261insA	uc003ibq.1	-	1					ARSJ_uc010imu.1_5'Flank|ARSJ_uc010imv.1_Intron	NM_024590	NP_078866	Q5FYB0	ARSJ_HUMAN	arylsulfatase J precursor							extracellular region	arylsulfatase activity|metal ion binding			ovary(1)	1		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		TTCCACCAAGGAAAAAAAAAAG	0.460													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138816489	138816489	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138816489delG								PCDH18 (362841 upstream) : SLC7A11 (268759 downstream)																							cgctaggggagggatagcatt	0.000													4	2	---	---	---	---	
NR3C2	4306	broad.mit.edu	37	4	149245020	149245021	+	Intron	INS	-	T	T	rs144759427	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149245020_149245021insT	uc003ilj.3	-						NR3C2_uc003ilk.3_Intron|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	agctgtggaccggagctgttcc	0.089													3	4	---	---	---	---	
TMEM192	201931	broad.mit.edu	37	4	166023937	166023937	+	Intron	DEL	T	-	-	rs11363030		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166023937delT	uc003iqz.3	-							NM_001100389	NP_001093859	Q8IY95	TM192_HUMAN	transmembrane protein 192							Golgi apparatus|integral to membrane|late endosome|lysosomal membrane|nucleus				skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		gtgtacgtacTTTTTTTTTTT	0.075													4	2	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173872437	173872437	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173872437delC	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						aatctgatatccagcatggat	0.000													4	2	---	---	---	---	
AHRR	57491	broad.mit.edu	37	5	320423	320424	+	Intron	DEL	CT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:320423_320424delCT	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|AHRR_uc010isz.2_5'Flank	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			caaagcaagactctgtcccaaa	0.238													2	4	---	---	---	---	
ZDHHC11	79844	broad.mit.edu	37	5	842413	842414	+	Intron	INS	-	G	G	rs143640098	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:842413_842414insG	uc011cma.1	-						ZDHHC11_uc003jbj.2_Intron|ZDHHC11_uc010itd.1_RNA|ZDHHC11_uc003jbk.2_Intron	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GACTTGCTACTGGGGGAGAAGA	0.624													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1045053	1045054	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1045053_1045054delGT								NKD2 (6128 upstream) : SLC12A7 (5437 downstream)																							gaatgagagggtgtgtgaacga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1048204	1048205	+	IGR	INS	-	GTTA	GTTA	rs149059976	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1048204_1048205insGTTA								NKD2 (9279 upstream) : SLC12A7 (2286 downstream)																							tgaatgagggggtgtgtgaacg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2101423	2101423	+	IGR	DEL	A	-	-	rs11365231		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2101423delA								IRX4 (218543 upstream) : IRX2 (644858 downstream)																							ttaccatagcaaaaaaAAAAA	0.154													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2129867	2129867	+	IGR	DEL	C	-	-	rs34325154		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2129867delC								IRX4 (246987 upstream) : IRX2 (616414 downstream)																							CACAATAAATCCAGTGCCGTC	0.557													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2402151	2402152	+	IGR	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2402151_2402152insG								IRX4 (519271 upstream) : IRX2 (344129 downstream)																							gtggcttcagagggtgcaagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3275696	3275697	+	IGR	INS	-	A	A	rs149066322	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3275696_3275697insA								C5orf38 (520184 upstream) : IRX1 (320471 downstream)																							TGGACATTCTGATAATGATGAG	0.455													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3382101	3382102	+	IGR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3382101_3382102delAC								C5orf38 (626589 upstream) : IRX1 (214066 downstream)																							ACCCCCCAAAacacacacacac	0.213													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3445911	3445912	+	Intron	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3445911_3445912insG	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																		gtggtgatggtatgatggtgat	0.000													4	6	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5296672	5296672	+	Intron	DEL	A	-	-	rs79033403	byFrequency	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5296672delA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						GTTACATTTCAAAAATCGTGT	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5890550	5890550	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5890550delT								KIAA0947 (400213 upstream) : FLJ33360 (420004 downstream)																							CAAGGAAGGGTTTTGCTGTGT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	9982379	9982381	+	IGR	DEL	GAG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9982379_9982381delGAG								LOC285692 (78443 upstream) : FAM173B (244057 downstream)																							ggaggaggatgaggaggaggagg	0.000													4	2	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10392073	10392073	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10392073delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						TACACAGGCCttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	12798317	12798317	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12798317delA	uc003jfb.1	+						uc010itv.1_Intron					Homo sapiens TAG1 mRNA, complete sequence.																		GATGCAGAGCAAGGCCGTGGT	0.507													4	3	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14286200	14286200	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14286200delT	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					aagctggcacttttttttttt	0.149													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16699931	16699932	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16699931_16699932insA	uc003jft.3	-						MYO10_uc011cnc.1_5'Flank|MYO10_uc011cnd.1_Intron|MYO10_uc011cne.1_Intron|MYO10_uc010itx.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						aaaGGAAAAAGAAAAAAAACAA	0.178													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16809115	16809115	+	Intron	DEL	A	-	-	rs11360576		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16809115delA	uc003jft.3	-						MYO10_uc003jfu.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						GACAAGGAAGAAAAAAAAAAA	0.244													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28818501	28818502	+	IGR	INS	-	AGG	AGG	rs150622037	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28818501_28818502insAGG								None (None upstream) : None (None downstream)																							ggaggaggagaaggagggggag	0.000													5	3	---	---	---	---	
ADAMTS12	81792	broad.mit.edu	37	5	33770906	33770908	+	Intron	DEL	CTT	-	-	rs34039298		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33770906_33770908delCTT	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron|ADAMTS12_uc003jib.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						ccttctcctccttcttcttcttc	0.025										HNSCC(64;0.19)			3	3	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38459409	38459410	+	Intron	DEL	TT	-	-	rs112663041		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38459409_38459410delTT	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_Intron|EGFLAM_uc003jlf.1_Intron|EGFLAM_uc003jlg.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					acctggccACTTTTTTTTTTTT	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56409729	56409729	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56409729delT								MIER3 (142228 upstream) : GPBP1 (60046 downstream)																							tgctcttgacttttcaatgga	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	57777368	57777368	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57777368delA								PLK2 (21455 upstream) : GAPT (9962 downstream)																							CAGCATGTATAGGGGTGACAG	0.522													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	84126086	84126087	+	IGR	INS	-	G	G	rs142999133	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84126086_84126087insG								EDIL3 (445475 upstream) : None (None downstream)																							gtggatcccgtggggggccgca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126962316	126962319	+	IGR	DEL	TGTC	-	-	rs148367753		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126962316_126962319delTGTC								PRRC1 (71538 upstream) : CTXN3 (22394 downstream)																							gtgagatgtgtgtctgtgtgagtg	0.000													1	5	---	---	---	---	
CHSY3	337876	broad.mit.edu	37	5	129241649	129241649	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129241649delG	uc003kvd.2	+							NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3							Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CTAAACCAAAGGCCATTCCCA	0.557													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	133015239	133015239	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133015239delG								FSTL4 (67016 upstream) : C5orf15 (275960 downstream)																							CCATCACTTCGGGGAAGCCAA	0.517													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137318234	137318235	+	Intron	INS	-	ACC	ACC	rs144814480	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137318234_137318235insACC	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						caacaacaacaaccttcattcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	163048791	163048792	+	IGR	INS	-	AAC	AAC	rs147902897	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163048791_163048792insAAC								MAT2B (102458 upstream) : None (None downstream)																							ctgtctcaaaaaacaacaacaa	0.104													4	3	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178768716	178768720	+	Intron	DEL	AAAAA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178768716_178768720delAAAAA	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		actccgtctcaaaaaaaaaaaaaaa	0.210													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165976	180165977	+	IGR	INS	-	C	C	rs150261063	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165976_180165977insC								FLT4 (89352 upstream) : OR2Y1 (146 downstream)																							gaaactctgttccccccgccac	0.178													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3662123	3662124	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3662123_3662124insA								SLC22A23 (205330 upstream) : C6orf145 (60712 downstream)																							GCTAATGAAAGAAAAAAAAGCT	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3866447	3866447	+	IGR	DEL	A	-	-	rs34848743		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3866447delA								FAM50B (14897 upstream) : PRPF4B (155122 downstream)																							cgtatcaaacaaaaaaaaaaa	0.189													4	2	---	---	---	---	
NRN1	51299	broad.mit.edu	37	6	6008479	6008479	+	5'Flank	DEL	A	-	-	rs68104105		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6008479delA	uc003mwu.2	-							NM_016588	NP_057672	Q9NPD7	NRN1_HUMAN	neuritin precursor							anchored to membrane|plasma membrane					0	Ovarian(93;0.0816)	all_hematologic(90;0.151)		OV - Ovarian serous cystadenocarcinoma(45;0.00415)		CACCAAACAGAAAAAAAAAAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8225157	8225164	+	IGR	DEL	GTGTGTGT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8225157_8225164delGTGTGTGT								EEF1E1 (122329 upstream) : SLC35B3 (186569 downstream)																							acaatggtaagtgtgtgtgtgtgtgtgt	0.000													2	4	---	---	---	---	
PAK1IP1	55003	broad.mit.edu	37	6	10702473	10702474	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10702473_10702474insA	uc003mzg.2	+							NM_017906	NP_060376	Q9NWT1	PK1IP_HUMAN	PAK1 interacting protein 1						negative regulation of signal transduction	nucleolus|plasma membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.117)				aaccctgcctcaaaaaaaaaaa	0.109													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	13754039	13754040	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13754039_13754040insT								RANBP9 (42243 upstream) : CCDC90A (36981 downstream)																							CTCATTCAttcttttttttttc	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14037400	14037401	+	IGR	INS	-	CT	CT	rs149559524	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14037400_14037401insCT								RNF182 (57167 upstream) : CD83 (80464 downstream)																							aatctctcttcctctctctctc	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14997615	14997615	+	IGR	DEL	A	-	-	rs11339035		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14997615delA								CD83 (860469 upstream) : JARID2 (248119 downstream)																							GTTTTTCATTAAAAAAAAAAA	0.403													5	4	---	---	---	---	
GMPR	2766	broad.mit.edu	37	6	16242564	16242565	+	Intron	DEL	TT	-	-	rs36064390		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16242564_16242565delTT	uc003nbs.2	+							NM_006877	NP_006868	P36959	GMPR1_HUMAN	guanosine monophosphate reductase						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				cactaattACTTTTTTTTTTTT	0.168													4	2	---	---	---	---	
GRM4	2914	broad.mit.edu	37	6	34039900	34039901	+	Intron	DEL	AT	-	-	rs139555716		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34039900_34039901delAT	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	cacaccacacatagacacacat	0.000													4	4	---	---	---	---	
FKBP5	2289	broad.mit.edu	37	6	35575766	35575766	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35575766delA	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_Intron	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						GACTTGAAATAAAAAAAAAAa	0.254													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35762097	35762097	+	IGR	DEL	G	-	-	rs67661036		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35762097delG								C6orf127 (6257 upstream) : CLPS (663 downstream)																							ctctgtttcagaaaaaaaaaa	0.109													3	3	---	---	---	---	
CLPS	1208	broad.mit.edu	37	6	35764725	35764726	+	Intron	INS	-	G	G	rs138101300	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35764725_35764726insG	uc003ole.1	-						CLPS_uc003olf.1_Intron	NM_001832	NP_001823	P04118	COL_HUMAN	colipase preproprotein						lipid catabolic process|lipid digestion|retinoid metabolic process|steroid metabolic process	extracellular region					0						gaaaaaaaagaaaaaaaaGGTC	0.277													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40255169	40255173	+	IGR	DEL	ATAAG	-	-	rs145203698		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40255169_40255173delATAAG								MOCS1 (352915 upstream) : TDRG1 (90990 downstream)																							tgatgcccttataagagaggaagat	0.000													3	4	---	---	---	---	
LRFN2	57497	broad.mit.edu	37	6	40456668	40456668	+	Intron	DEL	A	-	-	rs140230475		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40456668delA	uc003oph.1	-							NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGACTCAGTCAAAAAAAAAGT	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40721950	40721952	+	IGR	DEL	ATG	-	-	rs138201909		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40721950_40721952delATG								LRFN2 (166824 upstream) : UNC5CL (272820 downstream)																							taaatAAataatgatgatgatga	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40756773	40756773	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40756773delC								LRFN2 (201647 upstream) : UNC5CL (237999 downstream)																							TCACTCTTTTCCGTGGCTGTT	0.473													4	2	---	---	---	---	
CLIC5	53405	broad.mit.edu	37	6	45888577	45888579	+	Intron	DEL	TGC	-	-	rs141489316		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45888577_45888579delTGC	uc003oxv.3	-						CLIC5_uc003oxu.3_Intron|CLIC5_uc003oxw.2_Intron|CLIC5_uc003oxx.2_Intron	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2						GAAATGTAGATGCTGCTATAACG	0.542													3	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51936800	51936801	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51936800_51936801insA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ATTTATATTTTAAAAAAACAGA	0.366													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57384216	57384216	+	Intron	DEL	A	-	-	rs112288407		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57384216delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		atcaggagacagggtttttga	0.000													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57507455	57507458	+	Intron	DEL	AGAC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57507455_57507458delAGAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		caccactaatagacagagacccaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57557438	57557439	+	IGR	INS	-	C	C	rs140134047		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57557438_57557439insC								PRIM2 (44063 upstream) : GUSBL2 (688720 downstream)																							GGTATgctccacccccaggtaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	76928259	76928260	+	IGR	DEL	CA	-	-	rs59427850	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76928259_76928260delCA								IMPG1 (145924 upstream) : None (None downstream)																							cacgcgcgcgcacacacacaca	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	78660213	78660213	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78660213delA								HTR1B (487093 upstream) : IRAK1BP1 (916976 downstream)																							AAGGGATGGCAAAGAAGTGTA	0.244													4	2	---	---	---	---	
FBXL4	26235	broad.mit.edu	37	6	99341285	99341286	+	Intron	INS	-	TGTCTTCACA	TGTCTTCACA	rs147424229	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99341285_99341286insTGTCTTCACA	uc003ppf.1	-						FBXL4_uc003ppg.1_Intron|FBXL4_uc003pph.1_Intron|FBXL4_uc010kcp.2_Intron	NM_012160	NP_036292	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4						ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex				skin(2)	2		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		tcttcttccattgtcttcacat	0.000													4	2	---	---	---	---	
OSTM1	28962	broad.mit.edu	37	6	108388779	108388780	+	Intron	INS	-	A	A	rs149774668	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108388779_108388780insA	uc003psd.2	-							NM_014028	NP_054747	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1							integral to membrane				central_nervous_system(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		ctcacgcctgtatcccaatact	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	120685176	120685177	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120685176_120685177insA								None (None upstream) : C6orf170 (715450 downstream)																							aagtggaaagcaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	127925269	127925269	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127925269delT								C6orf58 (12311 upstream) : THEMIS (104077 downstream)																							tgctttgatcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134741423	134741423	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134741423delA								SGK1 (102227 upstream) : ALDH8A1 (497106 downstream)																							agactgtctcaaaaaaaaaag	0.129													4	2	---	---	---	---	
PDE7B	27115	broad.mit.edu	37	6	136359323	136359324	+	Intron	INS	-	AGC	AGC	rs150803314	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136359323_136359324insAGC	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_5'UTR	NM_018945	NP_061818	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)	TCCCCTGTGGTagcagcagcag	0.396													4	2	---	---	---	---	
PPP1R14C	81706	broad.mit.edu	37	6	150494473	150494473	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150494473delT	uc003qnt.2	+							NM_030949	NP_112211	Q8TAE6	PP14C_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of phosphorylation	cytoplasm|membrane					0		Ovarian(120;0.0284)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;9.14e-12)		ATCCTTACCCTTTTTTTTTTC	0.373													3	3	---	---	---	---	
CNKSR3	154043	broad.mit.edu	37	6	154734274	154734287	+	Intron	DEL	ACACACACACACAC	-	-	rs113546547		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154734274_154734287delACACACACACACAC	uc003qpy.2	-							NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		AATTTATGGTacacacacacacacacacacacac	0.220													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	157085280	157085280	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157085280delG								MIR1202 (817267 upstream) : ARID1B (13806 downstream)																							CTGTGGGCTTGGGGTTCCCTA	0.537													4	2	---	---	---	---	
TULP4	56995	broad.mit.edu	37	6	158740449	158740450	+	Intron	INS	-	TTACTTAG	TTACTTAG	rs138565727	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158740449_158740450insTTACTTAG	uc003qrf.2	+						TULP4_uc011efo.1_Intron|TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1						intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CATCTCTGCCCTTACCTTATCT	0.396													3	3	---	---	---	---	
SLC22A3	6581	broad.mit.edu	37	6	160807025	160807025	+	Intron	DEL	T	-	-	rs11339242		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160807025delT	uc003qti.2	+						SLC22A3_uc011efx.1_Intron	NM_021977	NP_068812	O75751	S22A3_HUMAN	solute carrier family 22 member 3							integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)		TCTTATTTTGTTATTGTGCAT	0.443													5	3	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162435840	162435841	+	Intron	INS	-	T	T	rs147375398	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162435840_162435841insT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		cacctttcgtattttttttttc	0.045													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165331664	165331664	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165331664delG								None (None upstream) : C6orf118 (361491 downstream)																							gtgttcaattggtgataccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	165624191	165624191	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165624191delT								None (None upstream) : C6orf118 (68964 downstream)																							TCCCGAGATGTTTTCCACCCA	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166140298	166140298	+	IGR	DEL	A	-	-	rs71814366		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166140298delA								PDE10A (64714 upstream) : C6orf176 (197238 downstream)																							TCAGCGTCTTAACCAGCCCAG	0.597													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166330806	166330806	+	Intron	DEL	G	-	-	rs68170621		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166330806delG	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																		ccaagagcatggccatggctg	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168087667	168087668	+	Intron	INS	-	CG	CG	rs145980662	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168087667_168087668insCG	uc003qvy.1	-											Homo sapiens cDNA FLJ32038 fis, clone NTONG2000583.																		gtgtatattcatgcatgtgtgt	0.079													3	3	---	---	---	---	
FRMD1	79981	broad.mit.edu	37	6	168481134	168481134	+	5'Flank	DEL	C	-	-	rs67921577		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168481134delC	uc003qwo.3	-							NM_024919	NP_079195	Q8N878	FRMD1_HUMAN	FERM domain containing 1 isoform 1							cytoskeleton	binding			ovary(1)	1		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCAAAAAAACCACAAAAAAA	0.522													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169240742	169240743	+	IGR	DEL	CG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169240742_169240743delCG								SMOC2 (172071 upstream) : THBS2 (375133 downstream)																							ctgatgaggacgcggtgctgat	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169266808	169266809	+	IGR	INS	-	G	G	rs141673599	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169266808_169266809insG								SMOC2 (198137 upstream) : THBS2 (349067 downstream)																							GGTGCAGGCCCTCGGCTGGGTA	0.639													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169714749	169714750	+	IGR	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169714749_169714750delCA								THBS2 (60612 upstream) : WDR27 (142557 downstream)																							cacactcattcacacacacaca	0.248													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	160014	160015	+	IGR	INS	-	G	G	rs148077793	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:160014_160015insG								None (None upstream) : FAM20C (32954 downstream)																							CGGACCCTCACGGGCCCCGGCG	0.708													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	571190	571201	+	IGR	DEL	GAGGTGAGCCAC	-	-	rs112947561	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:571190_571201delGAGGTGAGCCAC								PDGFA (11709 upstream) : PRKAR1B (18186 downstream)																							ggtgagcagggaggtgagccacgaggtggggg	0.075													5	5	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	623311	623312	+	Intron	INS	-	CT	CT	rs113190637		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:623311_623312insCT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		acacccacacacaACCCACACG	0.139													2	4	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	651407	651410	+	Intron	DEL	ATGG	-	-	rs145313415		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:651407_651410delATGG	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		agacgaatgaatggatggatggat	0.000													9	4	---	---	---	---	
GET4	51608	broad.mit.edu	37	7	931484	931485	+	Intron	DEL	AG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:931484_931485delAG	uc003sjl.1	+						GET4_uc003sjj.1_Intron	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608						tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0						CTGGGCTGACAGGGGCCCTGCC	0.634													4	4	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	949495	949496	+	Intron	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:949495_949496insG	uc003sjo.3	-						ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						TGGTGTGGGGTGGGGGGGGTTC	0.480													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	999289	999290	+	Intron	INS	-	T	T	rs76965413		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:999289_999290insT	uc010ksc.2	-							NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						ttccttttctcttttttttttt	0.000													4	3	---	---	---	---	
C7orf50	84310	broad.mit.edu	37	7	1071138	1071139	+	Intron	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1071138_1071139insG	uc003sju.2	-						C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		cagagtggtccgggggggcaga	0.277													4	5	---	---	---	---	
C7orf50	84310	broad.mit.edu	37	7	1105893	1105894	+	Intron	INS	-	ACGATC	ACGATC	rs149125341	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1105893_1105894insACGATC	uc003sju.2	-						C7orf50_uc011jvt.1_Intron|C7orf50_uc011jvu.1_Intron	NM_032350	NP_115726	Q9BRJ6	CG050_HUMAN	hypothetical protein LOC84310								protein binding				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		GAAAAATACCGACAAACGCAGC	0.673											OREG0017819	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
TMEM184A	202915	broad.mit.edu	37	7	1587914	1587914	+	Intron	DEL	T	-	-	rs10715883		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1587914delT	uc003skv.3	-						TMEM184A_uc003skt.3_Intron|TMEM184A_uc003skw.3_Intron	NM_001097620	NP_001091089	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A							integral to membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		AGGAAACACCTGGTGTGGCCT	0.682													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	1634356	1634359	+	IGR	DEL	CATC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1634356_1634359delCATC								KIAA1908 (5097 upstream) : TFAMP1 (19747 downstream)																							tccatccatgcatccatccatcca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	3337336	3337338	+	IGR	DEL	GAG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3337336_3337338delGAG								CARD11 (253757 upstream) : SDK1 (3742 downstream)																							agtggaagaagaggaggaggagg	0.094													6	3	---	---	---	---	
FOXK1	221937	broad.mit.edu	37	7	4759953	4759954	+	Intron	INS	-	C	C	rs145183508	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4759953_4759954insC	uc003snc.1	+						FOXK1_uc003sna.1_Intron|FOXK1_uc003snb.1_Intron	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN	forkhead box K1						cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		ggattcagtgacatgcatggga	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	5277942	5277942	+	IGR	DEL	C	-	-	rs7455764	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5277942delC								WIPI2 (4457 upstream) : SLC29A4 (44619 downstream)																							aacaaacaaacaaaaaaacct	0.030													4	2	---	---	---	---	
ZNF815	401303	broad.mit.edu	37	7	5893640	5893641	+	Intron	INS	-	C	C	rs34824484		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5893640_5893641insC	uc003spc.2	+						ZNF815_uc003spd.2_Intron	NR_023382				Homo sapiens cDNA FLJ38969 fis, clone NT2RI2002359.												0						gaaaaaaaaaaaaaaaCGTGAG	0.139													4	3	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20788762	20788763	+	Intron	INS	-	CCTC	CCTC	rs147891276	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20788762_20788763insCCTC	uc003suw.3	+						ABCB5_uc010kuh.2_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						ccctttcttttcctccctccct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	30575276	30575276	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30575276delT	uc003tbd.2	-											Homo sapiens full length insert cDNA clone ZC66C07.																		ctttttcttcttttttttttt	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35786605	35786605	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35786605delG								HERPUD2 (51833 upstream) : SEPT7 (54022 downstream)																							ggaagagtttgggggtaaggg	0.000													4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38626613	38626616	+	Intron	DEL	ACAC	-	-	rs113399829		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38626613_38626616delACAC	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TTGTGTAAATacacacacacacac	0.196													4	3	---	---	---	---	
C7orf44	55744	broad.mit.edu	37	7	43723233	43723233	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43723233delA	uc003tin.1	-						C7orf44_uc003til.2_Intron|C7orf44_uc003tii.2_Intron|C7orf44_uc003tij.2_Intron|C7orf44_uc010kxu.1_Intron|C7orf44_uc003tik.2_Intron|C7orf44_uc003tim.1_Intron|C7orf44_uc003tio.1_Intron|C7orf44_uc003tiq.1_Intron|C7orf44_uc003tip.1_Intron	NM_018224	NP_060694	Q9GZY4	CG044_HUMAN	hypothetical protein LOC55744							integral to membrane				ovary(1)	1						actctgtctcaaaaaaaaaaC	0.055													4	3	---	---	---	---	
ADCY1	107	broad.mit.edu	37	7	45650487	45650489	+	Intron	DEL	TGG	-	-	rs72117112		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45650487_45650489delTGG	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	gggaaggtgatggtggaggtggg	0.005													8	6	---	---	---	---	
TNS3	64759	broad.mit.edu	37	7	47511047	47511048	+	Intron	INS	-	G	G	rs145685346	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47511047_47511048insG	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						ATGGAATGGAAGGGGGTCTTCC	0.609													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	47702201	47702201	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47702201delG								C7orf65 (955 upstream) : PKD1L1 (112089 downstream)																							TGAATTTGTAGGGAAAAGACC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	49500915	49500935	+	IGR	DEL	AGGAAGGAAGGCCTGGAAGGA	-	-	rs140184305	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49500915_49500935delAGGAAGGAAGGCCTGGAAGGA								CDC14C (533866 upstream) : VWC2 (312322 downstream)																							taaggaaggcaggaaggaaggcctggaaggaaggaaggaag	0.072													4	2	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51114322	51114323	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51114322_51114323insT	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					GTGCAGGAGACTTTTTTtttct	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54883208	54883208	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54883208delT								SEC61G (56269 upstream) : EGFR (203517 downstream)																							aattttaggattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55294510	55294510	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55294510delT								EGFR (19480 upstream) : LANCL2 (138631 downstream)																							caatttttgcttttgttgtaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	55353052	55353053	+	IGR	INS	-	CG	CG	rs142364576	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55353052_55353053insCG								EGFR (78022 upstream) : LANCL2 (80088 downstream)																							aagctctaccttaccccacttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56194009	56194009	+	IGR	DEL	C	-	-	rs77303885		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56194009delC								PSPH (9919 upstream) : DKFZp434L192 (369907 downstream)																							GCTTTTTCCTCGTCTTGCTTC	0.299													10	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56864437	56864438	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56864437_56864438insT								DKFZp434L192 (299460 upstream) : ZNF479 (322890 downstream)																							aaaggaagaacaaagaaaagga	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57429839	57429840	+	IGR	INS	-	CT	CT	rs145370316	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57429839_57429840insCT								ZNF479 (222268 upstream) : ZNF716 (80043 downstream)																							acagagtgagactgtcgcaaaa	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57701099	57701099	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57701099delT								ZNF716 (167834 upstream) : None (None downstream)																							ctggccCAAGTTTTTTTCTAT	0.244													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57768423	57768423	+	IGR	DEL	C	-	-	rs113395775		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57768423delC								ZNF716 (235158 upstream) : None (None downstream)																							CACTTTGTAACCTGGCAGTCA	0.408													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57768830	57768831	+	IGR	INS	-	T	T	rs144648722		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57768830_57768831insT								ZNF716 (235565 upstream) : None (None downstream)																							ATAATATCTTATTCTTTCTGAC	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64555301	64555301	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64555301delC								ZNF117 (88180 upstream) : INTS4L1 (46302 downstream)																							ttttacttttcttttttttgg	0.139													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64564900	64564904	+	IGR	DEL	GAATT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64564900_64564904delGAATT								ZNF117 (97779 upstream) : INTS4L1 (36699 downstream)																							atttattcaagaattgaggactttt	0.171													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65249215	65249216	+	IGR	INS	-	T	T	rs55769457		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65249215_65249216insT								CCT6P1 (20554 upstream) : VKORC1L1 (89041 downstream)																							CAACCATCAGGCTGCAAAATAT	0.203													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65249514	65249514	+	IGR	DEL	T	-	-	rs112984746		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65249514delT								CCT6P1 (20853 upstream) : VKORC1L1 (88743 downstream)																							acccggctgattttttttttt	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65268568	65268570	+	IGR	DEL	CTT	-	-	rs75342027		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65268568_65268570delCTT								CCT6P1 (39907 upstream) : VKORC1L1 (69687 downstream)																							CCTCTTTTTCCTTCttttttaaa	0.365													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65272069	65272071	+	IGR	DEL	TTC	-	-	rs112209765		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65272069_65272071delTTC								CCT6P1 (43408 upstream) : VKORC1L1 (66186 downstream)																							gttcaagcaattcttctgcctca	0.000													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65276074	65276075	+	IGR	DEL	GG	-	-	rs72009009		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65276074_65276075delGG								CCT6P1 (47413 upstream) : VKORC1L1 (62182 downstream)																							aaaaTTTGTTGGGGAAAAAAAA	0.252													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65282622	65282624	+	IGR	DEL	TGT	-	-	rs141228588		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65282622_65282624delTGT								CCT6P1 (53961 upstream) : VKORC1L1 (55633 downstream)																							GAAGAACCCAtgtttctctctac	0.094													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65285505	65285507	+	IGR	DEL	AGG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65285505_65285507delAGG								CCT6P1 (56844 upstream) : VKORC1L1 (52750 downstream)																							taaaggcgttaggaggaaactcc	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68196071	68196072	+	IGR	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68196071_68196072delCA								None (None upstream) : AUTS2 (867833 downstream)																							CTCTCTCTCTcacacacacaca	0.302													4	3	---	---	---	---	
MLXIPL	51085	broad.mit.edu	37	7	73024763	73024763	+	Intron	DEL	C	-	-	rs71962373		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73024763delC	uc003tyn.1	-						MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCCCCCTCCTCCATGACTGGG	0.398													12	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	73681291	73681292	+	IGR	DEL	TG	-	-	rs111645563		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73681291_73681292delTG								RFC2 (12553 upstream) : CLIP2 (22513 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.153													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75482737	75482737	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75482737delA								CCL24 (39704 upstream) : RHBDD2 (25580 downstream)																							cccatctcttaaaaaaaaaaa	0.000													5	3	---	---	---	---	
MDH2	4191	broad.mit.edu	37	7	75690960	75690961	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75690960_75690961insA	uc003ueo.2	+						MDH2_uc003uep.2_Intron|MDH2_uc011kgh.1_Intron	NM_005918	NP_005909	P40926	MDHM_HUMAN	mitochondrial malate dehydrogenase precursor						gluconeogenesis|malate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus|plasma membrane	binding|L-malate dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					NADH(DB00157)	cctgtctctttaaaaaaaaaaa	0.252													8	4	---	---	---	---	
SRRM3	222183	broad.mit.edu	37	7	75838923	75838923	+	Intron	DEL	T	-	-	rs34602617		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75838923delT	uc010ldi.2	+							NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0						AGAGTTGGAAttttttttttt	0.075													4	2	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76655246	76655246	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76655246delA	uc011kgn.1	+											Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						agtctgtctcaaaaaaaaaaa	0.209													7	4	---	---	---	---	
PCLO	27445	broad.mit.edu	37	7	82785720	82785720	+	Intron	DEL	A	-	-	rs141422942		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82785720delA	uc003uhx.2	-						PCLO_uc003uhv.2_Intron	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TAGAAGAGTTAAAAAAAAAAA	0.333													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	96741956	96741956	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96741956delA								DLX5 (87813 upstream) : ACN9 (3949 downstream)																							TCGAGGAGGCAAAAAAAAGAG	0.189													4	2	---	---	---	---	
LMTK2	22853	broad.mit.edu	37	7	97745702	97745703	+	Intron	INS	-	TG	TG	rs149963682	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97745702_97745703insTG	uc003upd.1	+							NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor						early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					CAgtgtgtgtctgtgtgtgtgt	0.257													4	2	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99032217	99032218	+	Intron	INS	-	A	A	rs149310419		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99032217_99032218insA	uc003uqh.2	-						PTCD1_uc011kiw.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			tccgtctcTACaaaaaaaaaaa	0.208													6	3	---	---	---	---	
GATS	352954	broad.mit.edu	37	7	99862902	99862902	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99862902delT	uc003uua.3	-						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc010lgu.2_Intron	NM_178831	NP_849153	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGATCCTAGCttttttttttt	0.055													4	3	---	---	---	---	
EPHB4	2050	broad.mit.edu	37	7	100426612	100426612	+	5'Flank	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100426612delT	uc003uwn.1	-						EPHB4_uc010lhj.1_5'Flank|EPHB4_uc011kkf.1_5'Flank|EPHB4_uc011kkg.1_5'Flank|EPHB4_uc011kkh.1_5'Flank	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CGGGGACAGAttttttttttt	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100608467	100608468	+	Intron	INS	-	T	T	rs139602002	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100608467_100608468insT	uc003uxl.1	+						uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_5'Flank					SubName: Full=Intestinal mucin; Flags: Fragment;																		AGGGAGAGACCTTTGCGGGAGG	0.624													18	9	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101084256	101084257	+	Intron	INS	-	A	A	rs111474364		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101084256_101084257insA	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					gactccgtctcaaaaaaaaaaa	0.178													4	3	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	104973212	104973212	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104973212delA	uc003vcv.2	-						SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						actctatctcaaaaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125473324	125473324	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125473324delA								POT1 (903287 upstream) : GRM8 (605328 downstream)																							ctaaaaatacaaaaaattagt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131311854	131311857	+	IGR	DEL	AAAT	-	-	rs3996281		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131311854_131311857delAAAT								PODXL (70478 upstream) : PLXNA4 (496235 downstream)																							cttggaagacaaataaaatgacac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149061924	149061925	+	IGR	INS	-	TG	TG	rs147505073	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149061924_149061925insTG								ZNF212 (109243 upstream) : ZNF777 (66536 downstream)																							cactgggaaactttatgggagt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	149731732	149731732	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149731732delC								ATP6V0E2 (153946 upstream) : ACTR3C (212570 downstream)																							tgccttcggacccgtcggatc	0.030													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152110681	152110681	+	Intron	DEL	A	-	-	rs66519558		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152110681delA	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TTAAAATTACAAAAACTggcc	0.139			N		medulloblastoma								7	4	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154555066	154555067	+	Intron	DEL	GA	-	-	rs34214003		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154555066_154555067delGA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			aggaaggaaggagagagagaga	0.099													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155582333	155582333	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155582333delT								RBM33 (8154 upstream) : SHH (10403 downstream)																							CATCGGtttgttttgttttgt	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	156289644	156289645	+	IGR	INS	-	AA	AA	rs72449141		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156289644_156289645insAA								SHH (684677 upstream) : C7orf4 (43540 downstream)																							Tacacacacacacacacacaca	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	156731519	156731519	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156731519delT								LMBR1 (45617 upstream) : NOM1 (10898 downstream)																							tactatagcatttttttttag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158949970	158949971	+	IGR	INS	-	T	T	rs67954138		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158949970_158949971insT								VIPR2 (12321 upstream) : None (None downstream)																							CCCATGTAACGGGGGTTTCAGT	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	1232069	1232069	+	IGR	DEL	T	-	-	rs33932695		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1232069delT								ERICH1 (550843 upstream) : DLGAP2 (217500 downstream)																							AACCCAGCACTCTGAACCATC	0.572													3	3	---	---	---	---	
DLGAP2	9228	broad.mit.edu	37	8	1501662	1501663	+	Intron	INS	-	GTA	GTA	rs143562806	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1501662_1501663insGTA	uc003wpl.2	+						DLGAP2_uc003wpm.2_Intron	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2						neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGTGTTCACGGGCAGCCCCGTT	0.554													4	3	---	---	---	---	
DLGAP2	9228	broad.mit.edu	37	8	1647277	1647277	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1647277delT	uc003wpl.2	+						DLGAP2_uc003wpm.2_Intron	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2						neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CGTACTGAAGTTAGCCCAGGT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2195494	2195495	+	IGR	INS	-	G	G	rs111274980		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2195494_2195495insG								MYOM2 (102115 upstream) : CSMD1 (597381 downstream)																							GAGGAGGAGCCGGGGAAGGTGG	0.644													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2215990	2215990	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2215990delG								MYOM2 (122611 upstream) : CSMD1 (576886 downstream)																							GTGACCTCGTGGGGTGTTGGG	0.592													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2724646	2724646	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2724646delG								MYOM2 (631267 upstream) : CSMD1 (68230 downstream)																							tggccaacatggtgaaacccc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	5926168	5926169	+	IGR	INS	-	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5926168_5926169insC								None (None upstream) : MCPH1 (337952 downstream)																							ttccttctcctctccttccttc	0.064													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6554309	6554309	+	IGR	DEL	C	-	-	rs67703545		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6554309delC								MCPH1 (48284 upstream) : AGPAT5 (11569 downstream)																							tggtttgtttcttttttacat	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6630832	6630832	+	IGR	DEL	G	-	-	rs71535989		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6630832delG								AGPAT5 (11813 upstream) : XKR5 (35211 downstream)																							GGAGTCCTCCGCACAGTCCTG	0.637													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11435291	11435292	+	IGR	INS	-	TGGC	TGGC	rs140471203	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11435291_11435292insTGGC								BLK (13184 upstream) : GATA4 (99176 downstream)																							TGGGGTAGGGGTGGCTGATCCC	0.574													6	4	---	---	---	---	
SLC18A1	6570	broad.mit.edu	37	8	20010729	20010730	+	Intron	INS	-	T	T	rs138977633	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20010729_20010730insT	uc011kyq.1	-						SLC18A1_uc003wzl.2_Intron|SLC18A1_uc003wzm.2_Intron|SLC18A1_uc011kyr.1_Intron|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_Intron|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		gtggttgtgcgttttttttgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	21894850	21894850	+	IGR	DEL	C	-	-	rs71299319		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21894850delC								NPM2 (443 upstream) : FGF17 (5578 downstream)																							CCGTTAGGGGCCAGCTCATCT	0.542											OREG0018603	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
SLC25A37	51312	broad.mit.edu	37	8	23409096	23409096	+	Intron	DEL	A	-	-	rs113815996		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23409096delA	uc003xdo.2	+						SLC25A37_uc003xdn.1_Intron|SLC25A37_uc003xdp.2_Intron|SLC25A37_uc010ltz.2_Intron	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37						ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		TATCCAAAGGAAAAAAAAAAA	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	24863579	24863580	+	IGR	INS	-	AGGG	AGGG	rs143114548	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24863579_24863580insAGGG								NEFL (49448 upstream) : DOCK5 (178707 downstream)																							agaaggaaggaagggagggagg	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26600372	26600373	+	IGR	INS	-	A	A	rs67030250		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26600372_26600373insA								DPYSL2 (84679 upstream) : ADRA1A (5294 downstream)																							ggctctgtctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
MAK16	84549	broad.mit.edu	37	8	33343022	33343028	+	Intron	DEL	GCTGTCA	-	-	rs72058969		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33343022_33343028delGCTGTCA	uc003xjj.2	+						C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898	Q9BXY0	MAK16_HUMAN	MAK16 homolog							nucleolus				ovary(1)	1						GTCGCGTCATGCTGTCAGCTGTCAGCT	0.628													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33510770	33510771	+	IGR	INS	-	GT	GT	rs144509233	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33510770_33510771insGT								DUSP26 (53331 upstream) : None (None downstream)																							AGGTAAGAGGGGTGTGTGTGTG	0.371													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	33655928	33655928	+	IGR	DEL	T	-	-	rs147329338		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33655928delT								DUSP26 (198489 upstream) : None (None downstream)																							CACTGCTCACttttttttttt	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37207230	37207230	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37207230delT								KCNU1 (413589 upstream) : ZNF703 (346071 downstream)																							TCATCTCATCttttttttttt	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37240282	37240283	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37240282_37240283delGT								KCNU1 (446641 upstream) : ZNF703 (313018 downstream)																							ACCTGAgtgcgtgtgtgtgtgt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37868299	37868299	+	IGR	DEL	T	-	-	rs111714497		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37868299delT								ADRB3 (44115 upstream) : EIF4EBP1 (19721 downstream)																							gtcatacagctttttttatta	0.020													6	3	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40634445	40634445	+	Intron	DEL	T	-	-	rs146405280		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40634445delT	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			GATTTCTTTCTTTTTTTTTTT	0.393													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43414071	43414071	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43414071delA								POTEA (195743 upstream) : None (None downstream)																							agagaaattcacaacctgggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49616089	49616090	+	IGR	DEL	CA	-	-	rs142076729		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49616089_49616090delCA								UBE2V2 (641637 upstream) : EFCAB1 (7261 downstream)																							TTGCCTTGAGCACACACACTCC	0.376													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56544379	56544379	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56544379delA								XKR4 (105671 upstream) : TMEM68 (106941 downstream)																							aatgccaaagaaaaaaaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58312165	58312166	+	IGR	INS	-	T	T	rs145912967	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58312165_58312166insT								C8orf71 (114877 upstream) : FAM110B (594947 downstream)																							ccctccttctctttttttcttt	0.000													3	3	---	---	---	---	
TOX	9760	broad.mit.edu	37	8	59955760	59955761	+	Intron	INS	-	TGTG	TGTG	rs148858507	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59955760_59955761insTGTG	uc003xtw.1	-							NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				ACTTTCTTTTCtgtgtgtgtgt	0.163													4	3	---	---	---	---	
TRIM55	84675	broad.mit.edu	37	8	67073064	67073064	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67073064delG	uc003xvv.2	+						TRIM55_uc003xvu.2_Intron|TRIM55_uc003xvw.2_Intron|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1							cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			tttgagaattgtctgttcatg	0.000													4	2	---	---	---	---	
SGK3	23678	broad.mit.edu	37	8	67640487	67640487	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67640487delT	uc003xwr.2	+						SGK3_uc003xwp.2_Intron	NM_001033578	NP_001028750	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase 3 isoform						cell communication|response to stress	cytoplasmic membrane-bounded vesicle|early endosome	ATP binding|phosphatidylinositol binding|protein serine/threonine kinase activity			ovary(1)|large_intestine(1)|lung(1)|breast(1)	4	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			atatatgatcttttgtgagtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81308492	81308493	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81308492_81308493insA								TPD52 (224656 upstream) : ZBTB10 (89361 downstream)																							acaacaacaacaacaaaaaaaa	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81485097	81485097	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81485097delT								ZBTB10 (50489 upstream) : ZNF704 (65672 downstream)																							AATCAGTCAATTTTTTTTTGC	0.408													3	3	---	---	---	---	
MMP16	4325	broad.mit.edu	37	8	89249911	89249912	+	Intron	INS	-	AC	AC	rs141799250		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89249911_89249912insAC	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						caacaacaacaaaaaacaacTG	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	92959808	92959809	+	IGR	INS	-	TTT	TTT	rs36058476		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92959808_92959809insTTT								SLC26A7 (549428 upstream) : RUNX1T1 (11343 downstream)																							ATTGCCTTGACTTTTTTTTTTT	0.495													3	4	---	---	---	---	
C8orf38	137682	broad.mit.edu	37	8	95979306	95979307	+	Intron	DEL	AA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95979306_95979307delAA	uc003yhi.2	+						C8orf38_uc003yhe.1_Intron|C8orf38_uc003yhf.2_Intron	NM_152416	NP_689629	Q330K2	CH038_HUMAN	hypothetical protein LOC137682 precursor						biosynthetic process	mitochondrion	transferase activity				0	Breast(36;3.32e-06)					TAGGCAGAAGAAAGAAAAAAAG	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96237951	96237953	+	IGR	DEL	GCT	-	-	rs71303428	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96237951_96237953delGCT								PLEKHF2 (69040 upstream) : C8orf37 (20282 downstream)																							TTCCAAGTGAGCTTTCAGCTGAA	0.591													4	4	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100503803	100503804	+	Intron	DEL	TC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100503803_100503804delTC	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			cactcttttttctcttatcttg	0.000													4	2	---	---	---	---	
SPAG1	6674	broad.mit.edu	37	8	101247426	101247427	+	Intron	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101247426_101247427delTG	uc003yjh.1	+						SPAG1_uc003yji.1_Intron	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1						single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		gccttccctctgtgtgtgtgtg	0.000													3	3	---	---	---	---	
COL14A1	7373	broad.mit.edu	37	8	121140459	121140460	+	Intron	INS	-	GCGC	GCGC	rs141192017	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121140459_121140460insGCGC	uc003yox.2	+							NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			tgtgtgtgtgtgcgcgcgcgtg	0.188													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126436029	126436030	+	IGR	DEL	TT	-	-	rs71853587		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126436029_126436030delTT								NSMCE2 (56662 upstream) : TRIB1 (6533 downstream)																							AATATGttcctttttttttttt	0.069													4	3	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133174844	133174844	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133174844delA	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			CGATCTCCTCAAAGGCCCTTA	0.468													4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	134113826	134113833	+	Intron	DEL	AAATTGCC	-	-	rs111641214	byFrequency	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134113826_134113833delAAATTGCC	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAATTGCAGTAAATTGCCACATCCACCT	0.351													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136444252	136444253	+	IGR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136444252_136444253delAC								LOC286094 (132293 upstream) : KHDRBS3 (25463 downstream)																							acacacacaaacacacacacac	0.069													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140339769	140339769	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140339769delT								COL22A1 (413533 upstream) : KCNK9 (273313 downstream)																							cagcTGAGGATTACCCATCCC	0.264													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141016006	141016006	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141016006delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						gaccctgtctaaaaaaaaaaa	0.095													6	3	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141117975	141117976	+	Intron	INS	-	A	A	rs146527628	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141117975_141117976insA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						GTGAAACATTTAAGTCTGGCAG	0.535													4	5	---	---	---	---	
EIF2C2	27161	broad.mit.edu	37	8	141554675	141554680	+	Intron	DEL	CAGGCC	-	-	rs138742836		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141554675_141554680delCAGGCC	uc003yvn.2	-						EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Intron	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1						mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			ggctgggGCTCAGGCCCAGGCCCAGG	0.218													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143107224	143107224	+	IGR	DEL	A	-	-	rs11333404		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143107224delA								MIR1302-7 (239550 upstream) : NCRNA00051 (172493 downstream)																							GCTGATTTGTAAAAAAAAAAG	0.473													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143211511	143211512	+	IGR	INS	-	CCAG	CCAG	rs142432498	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143211511_143211512insCCAG								MIR1302-7 (343837 upstream) : NCRNA00051 (68205 downstream)																							CCAGACGCCACCCAGCCGTGGT	0.589													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143252492	143252492	+	IGR	DEL	G	-	-	rs74316941		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143252492delG								MIR1302-7 (384818 upstream) : NCRNA00051 (27225 downstream)																							TTGAGGGTCCGGGGGGATGAG	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143890452	143890453	+	IGR	INS	-	GA	GA	rs2920273		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143890452_143890453insGA								LY6D (22444 upstream) : GML (25764 downstream)																							CGAgtgtgtgtgtgtgtgagtg	0.045													4	4	---	---	---	---	
LOC100133669	100133669	broad.mit.edu	37	8	144088069	144088069	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144088069delT	uc011ljz.1	-							NR_026913				Homo sapiens, clone IMAGE:3342869, mRNA.												0						tgttagctgattattatgcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	145144027	145144027	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145144027delT								GPAA1 (2909 upstream) : CYC1 (5915 downstream)																							agtgtccatcttttttttttt	0.025													4	2	---	---	---	---	
ARHGAP39	80728	broad.mit.edu	37	8	145828018	145828019	+	Intron	DEL	GT	-	-	rs72329063		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145828018_145828019delGT	uc003zdt.1	-						ARHGAP39_uc011llk.1_Intron|ARHGAP39_uc003zds.1_Intron	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						gcgtggaggcgtgtgtgtgctc	0.000													7	6	---	---	---	---	
SMARCA2	6595	broad.mit.edu	37	9	2051281	2051282	+	Intron	INS	-	CTT	CTT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2051281_2051282insCTT	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		TGCGCTTTGTACTTCTTGCCTC	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	4373292	4373292	+	IGR	DEL	A	-	-	rs75899561		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4373292delA								GLIS3 (73257 upstream) : SLC1A1 (117152 downstream)																							CCCTTCACCTAAATcagtagt	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	6697497	6697498	+	IGR	DEL	AA	-	-	rs71487855		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6697497_6697498delAA								GLDC (51805 upstream) : KDM4C (18997 downstream)																							actccatctcaaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	14982645	14982645	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14982645delC								FREM1 (71652 upstream) : LOC389705 (10680 downstream)																							TCATACATTTCCCATACACTG	0.254													4	2	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18845271	18845272	+	Intron	INS	-	AA	AA	rs142976307	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18845271_18845272insAA	uc003zne.3	+						ADAMTSL1_uc003znf.3_Intron	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		AGGCACATGTCAGCCCCACAGA	0.480													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32916118	32916119	+	IGR	INS	-	CA	CA	rs148568075	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32916118_32916119insCA								TMEM215 (126921 upstream) : APTX (56490 downstream)																							CAGCACACATCCAGTCTCCATT	0.520													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	33743986	33743987	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33743986_33743987delGT								PTENP1 (66568 upstream) : PRSS3 (6528 downstream)																							acatatgtgcgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
UNC13B	10497	broad.mit.edu	37	9	35161893	35161893	+	5'Flank	DEL	G	-	-	rs66519915		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35161893delG	uc003zwq.2	+						UNC13B_uc010mkl.1_5'Flank|UNC13B_uc003zwr.2_5'Flank	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ACGTGCTCGCGGGGGGGGGCG	0.677													2	4	---	---	---	---	
CLTA	1211	broad.mit.edu	37	9	36298969	36298969	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36298969delC	uc003zzf.1	+							NM_001833		P09496	CLCA_HUMAN	clathrin, light polypeptide A isoform a						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol	structural molecule activity			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)			GGCAATAGGGCTTGCCGTCCA	0.303													4	2	---	---	---	---	
SHB	6461	broad.mit.edu	37	9	38058313	38058314	+	Intron	INS	-	AG	AG			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38058313_38058314insAG	uc004aax.2	-							NM_003028	NP_003019	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein						angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		CCCCAGAGGGCAGAGAGTGTCC	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	38072650	38072650	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38072650delT								SHB (3440 upstream) : ALDH1B1 (320052 downstream)																							cttcttcttcttttttttttt	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66487084	66487085	+	IGR	DEL	TT	-	-	rs77536868		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66487084_66487085delTT								FAM74A4 (992698 upstream) : LOC442421 (9385 downstream)																							GATTGTTTCCTTTTATTTATTT	0.465													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66491022	66491022	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66491022delA								FAM74A4 (996636 upstream) : LOC442421 (5448 downstream)																							agaaagacacaaactaccaaa	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67318703	67318705	+	IGR	DEL	TTT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67318703_67318705delTTT								AQP7P1 (29211 upstream) : FAM27B (474225 downstream)																							cagaaacttctttgtgatgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67830824	67830824	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67830824delC								FAM27B (36635 upstream) : None (None downstream)																							cacacacacacaaaggaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68406657	68406658	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68406657_68406658insT								FAM27B (612468 upstream) : MIR1299 (595581 downstream)																							aaaacaaaaaaccctattaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69825970	69825970	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69825970delG								LOC100133920 (161021 upstream) : FOXD4L5 (349739 downstream)																							ATCAACATATGGTCATCAGTC	0.448													4	2	---	---	---	---	
TJP2	9414	broad.mit.edu	37	9	71778552	71778552	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71778552delT	uc011lrs.1	+						TJP2_uc004ahb.1_Intron|TJP2_uc011lrt.1_Intron	NM_201629	NP_963923	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)						cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						agaccctgtctccaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74910295	74910296	+	IGR	INS	-	GAC	GAC	rs148911499	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74910295_74910296insGAC								GDA (41818 upstream) : ZFAND5 (56045 downstream)																							tgggaagtcgagactgcagtga	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	77988600	77988601	+	IGR	DEL	AT	-	-	rs34987438		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77988600_77988601delAT								OSTF1 (226487 upstream) : PCSK5 (516959 downstream)																							acacacacacatgcgtgcacac	0.277													4	2	---	---	---	---	
PCSK5	5125	broad.mit.edu	37	9	78524242	78524242	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78524242delA	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						actccatctcaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	86680051	86680051	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86680051delC	uc004ant.2	+											Homo sapiens mRNA; cDNA DKFZp779O1559 (from clone DKFZp779O1559).																		gtcctccccacccactctggt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	86819293	86819297	+	IGR	DEL	AGAGA	-	-	rs111636813		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86819293_86819297delAGAGA								RMI1 (200311 upstream) : SLC28A3 (73795 downstream)																							aagagaagagagagaagagaagaga	0.302													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89733216	89733216	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89733216delC								LOC440173 (76175 upstream) : C9orf170 (30343 downstream)																							gccacagcctcccaaagtact	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90936969	90936970	+	IGR	INS	-	T	T	rs61626679		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90936969_90936970insT								CDK20 (347302 upstream) : SPIN1 (65870 downstream)																							GCAGATTCAAAttttttttttt	0.243													3	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	91984781	91984782	+	Intron	INS	-	TGTGTG	TGTGTG	rs149822470	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91984781_91984782insTGTGTG	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqm.2_5'Flank	NM_001142287	NP_001135759	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						taagtcaacaatgtgtgtgtgt	0.064													4	2	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	92055415	92055416	+	Intron	INS	-	ACCCTCC	ACCCTCC	rs150973420	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92055415_92055416insACCCTCC	uc004aqo.1	-						SEMA4D_uc011ltm.1_Intron|SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqp.1_Intron	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						CCCTGAGCCCTACCCTCCGCTT	0.594													3	3	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94581935	94581936	+	Intron	INS	-	GTGTCTGTGTCTTTCA	GTGTCTGTGTCTTTCA	rs72437050		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94581935_94581936insGTGTCTGTGTCTTTCA	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						ctgtgttctctgtgtctgtgtc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	95679142	95679143	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95679142_95679143insA								ANKRD19 (28169 upstream) : FGD3 (30458 downstream)																							ctacatctcagaaaaaaaaaaa	0.198													4	2	---	---	---	---	
SUSD3	203328	broad.mit.edu	37	9	95836113	95836114	+	Intron	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95836113_95836114delTG	uc004atb.2	+						SUSD3_uc004atc.2_Intron	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3							integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6						agatgcattttgTGTGTGTGTC	0.084													4	2	---	---	---	---	
C9orf21	195827	broad.mit.edu	37	9	99415509	99415509	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99415509delA	uc004awm.2	-							NM_153698	NP_714542	Q7RTV5	CI021_HUMAN	hypothetical protein LOC195827								antioxidant activity|oxidoreductase activity			large_intestine(1)	1		Acute lymphoblastic leukemia(62;0.0559)				actccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	103159543	103159544	+	IGR	INS	-	T	T	rs112981473		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103159543_103159544insT								TEX10 (44284 upstream) : C9orf30 (30098 downstream)																							tctttctttccttttttttttt	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111056087	111056088	+	IGR	INS	-	CT	CT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111056087_111056088insCT								KLF4 (804040 upstream) : ACTL7B (560783 downstream)																							cgtttcaacacctctggcaggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	114636799	114636800	+	IGR	INS	-	CT	CT	rs142442703	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114636799_114636800insCT								C9orf84 (79576 upstream) : UGCG (22406 downstream)																							catttttacccgtttgtaggtc	0.000													1	6	---	---	---	---	
TNC	3371	broad.mit.edu	37	9	117787666	117787667	+	Intron	INS	-	T	T	rs147141640	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117787666_117787667insT	uc004bjj.3	-						TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor						cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						CTCAGCCTGGCTTTGGCAACCT	0.455													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	118824513	118824528	+	IGR	DEL	TCCCTCCCTCCCTCCC	-	-	rs147693884	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118824513_118824528delTCCCTCCCTCCCTCCC								C9orf27 (137136 upstream) : PAPPA (91543 downstream)																							cttccttccttccctccctccctccctccttccttc	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	120750075	120750076	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120750075_120750076insT								TLR4 (270311 upstream) : None (None downstream)																							agttccactgctttttttttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	127606612	127606613	+	IGR	INS	-	T	T	rs146593799		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127606612_127606613insT								OLFML2A (29455 upstream) : WDR38 (9142 downstream)																							ctcaaaaaaaaaaacaacaaca	0.198													1	6	---	---	---	---	
FAM125B	89853	broad.mit.edu	37	9	129250046	129250046	+	Intron	DEL	A	-	-	rs72574721		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129250046delA	uc004bqh.1	+						FAM125B_uc011lzy.1_Intron|FAM125B_uc010mxd.2_Intron	NM_033446	NP_258257	Q9H7P6	F125B_HUMAN	hypothetical protein LOC89853 isoform 1						protein transport	late endosome membrane					0						actccgtctcaaaaaaaaaaa	0.149													3	4	---	---	---	---	
PPP2R4	5524	broad.mit.edu	37	9	131882541	131882541	+	Intron	DEL	A	-	-	rs147061188		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131882541delA	uc004bxm.1	+						PPP2R4_uc004bxl.1_Intron|PPP2R4_uc011mbo.1_Intron|PPP2R4_uc010myr.1_Intron|PPP2R4_uc004bxn.1_Intron|PPP2R4_uc004bxo.1_Intron|PPP2R4_uc011mbp.1_Intron|PPP2R4_uc011mbq.1_Intron|PPP2R4_uc010mys.1_Intron	NM_178001	NP_821068	Q15257	PTPA_HUMAN	protein phosphatase 2A, regulatory subunit B'						ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		tgtctcaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132203209	132203210	+	IGR	INS	-	G	G	rs138691594	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132203209_132203210insG								C9orf106 (118327 upstream) : C9orf50 (171296 downstream)																							TCAGCCTCCTTAATACAGGCTC	0.520													8	4	---	---	---	---	
FNBP1	23048	broad.mit.edu	37	9	132705124	132705125	+	Intron	INS	-	T	T	rs146100203	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132705124_132705125insT	uc004byw.1	-						FNBP1_uc011mbv.1_Intron|FNBP1_uc011mbw.1_Intron|FNBP1_uc004bza.2_Intron|FNBP1_uc004byz.1_Intron|FNBP1_uc004byx.1_Intron|FNBP1_uc004byy.1_Intron	NM_015033	NP_055848	Q96RU3	FNBP1_HUMAN	formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)		TTTTTTCTTTCTTTTTTTTTTC	0.272			T	MLL	AML								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133242320	133242321	+	IGR	INS	-	G	G	rs150403986	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133242320_133242321insG								NCS1 (242737 upstream) : ASS1 (77773 downstream)																							agctaggaagcgggaaagatgt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	134698792	134698793	+	IGR	INS	-	C	C	rs143583995	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134698792_134698793insC								RAPGEF1 (83575 upstream) : MED27 (36706 downstream)																							ctgtgcttttgagggagagagt	0.297													6	4	---	---	---	---	
TTF1	7270	broad.mit.edu	37	9	135253075	135253076	+	Intron	INS	-	GT	GT	rs138099361		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135253075_135253076insGT	uc004cbl.2	-						TTF1_uc011mcp.1_Intron|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase						negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		gaatgcatgtggtgtgagtgca	0.025													3	3	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135323565	135323566	+	Intron	DEL	CA	-	-	rs67302172		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135323565_135323566delCA	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						cgcacacatgcacacacacaca	0.322													4	2	---	---	---	---	
C9orf9	11092	broad.mit.edu	37	9	135758907	135758908	+	Intron	DEL	GT	-	-	rs113858963		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135758907_135758908delGT	uc004cbx.1	+						C9orf9_uc004cby.1_Intron|C9orf9_uc004cbz.1_Intron	NM_018956	NP_061829	Q96E40	CI009_HUMAN	Rsb-66 protein									p.?(1)			0				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		acacgcgtgcgtgtgtgtgtgt	0.257													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	135962752	135962755	+	IGR	DEL	TCTT	-	-	rs10616973		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135962752_135962755delTCTT								CELP (274 upstream) : RALGDS (10353 downstream)																							CTGTCTGGCGTCTTTCTTTGCTCT	0.529													3	7	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137577353	137577354	+	Intron	INS	-	C	C	rs143525729		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137577353_137577354insC	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		catccatccatcaccatccatc	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137860671	137860671	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137860671delA								FCN1 (50862 upstream) : OLFM1 (106418 downstream)																							GCTCGGTTCCAAAAACAGTCC	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138016485	138016486	+	IGR	INS	-	AAGA	AAGA	rs147997959	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138016485_138016486insAAGA								OLFM1 (3454 upstream) : KIAA0649 (355162 downstream)																							agaaaagaaagaagaaagaaag	0.000													5	3	---	---	---	---	
NACC2	138151	broad.mit.edu	37	9	138988340	138988341	+	5'Flank	DEL	AC	-	-	rs141442569		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138988340_138988341delAC	uc004cgw.2	-						NACC2_uc010nbh.2_5'Flank	NM_144653	NP_653254	Q96BF6	NACC2_HUMAN	BTB (POZ) domain containing 14A						negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization	nuclear body					0						TGCGTCCAGAacacacacacac	0.505													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138998604	138998605	+	IGR	INS	-	C	C	rs139364610	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138998604_138998605insC								NACC2 (11473 upstream) : C9orf69 (7823 downstream)																							CCTGGAGACAGCCCCCACCAGG	0.559													2	4	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140260056	140260057	+	Intron	DEL	CA	-	-	rs151125151		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140260056_140260057delCA	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron|EXD3_uc004cmq.1_RNA|EXD3_uc010ncg.1_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						cacacacatgcacacacacgca	0.000													4	3	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140273840	140273840	+	Intron	DEL	G	-	-	rs35680530		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140273840delG	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncg.1_Intron|EXD3_uc004cmr.2_Intron|EXD3_uc004cms.2_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CGAGGGGAATGGGGGCGTCTG	0.677													4	2	---	---	---	---	
TUBBP5	643224	broad.mit.edu	37	9	141060061	141060061	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141060061delC	uc010ncq.2	+							NR_027156				Homo sapiens cDNA, FLJ98407.												0						tgagtgagttcccataagacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	141072115	141072116	+	IGR	INS	-	AG	AG			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141072115_141072116insAG								TUBBP5 (231 upstream) : FAM157B (34521 downstream)																							CCTGTTCCTGAAGGCAAGCCTT	0.574													6	4	---	---	---	---	
DIP2C	22982	broad.mit.edu	37	10	592473	592473	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:592473delT	uc001ifp.2	-							NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C							nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ctatatacagttaggaagaag	0.000													6	4	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1687973	1687974	+	Intron	INS	-	T	T	rs145844069	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1687973_1687974insT	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		TGCCTCTCCTCCTGGAGTTCAC	0.490													4	2	---	---	---	---	
PITRM1	10531	broad.mit.edu	37	10	3183470	3183470	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3183470delG	uc010qah.1	-						PITRM1_uc001igr.1_Intron|PITRM1_uc001igs.1_Intron|PITRM1_uc001igt.1_Intron|PITRM1_uc009xhv.1_Intron|PITRM1_uc001igu.1_Intron|PITRM1_uc010qai.1_Intron|uc001igv.1_5'Flank			E7ES23	E7ES23_HUMAN	SubName: Full=cDNA FLJ54065, moderately similar to Mus musculus pitrilysin metallepetidase 1 (Pitrm1), mRNA;						proteolysis		metalloendopeptidase activity|zinc ion binding			pancreas(1)	1						TCAAACAGTTGGCTTAGATTA	0.318													5	3	---	---	---	---	
ITIH2	3698	broad.mit.edu	37	10	7752884	7752884	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7752884delT	uc001ijs.2	+							NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						GTTTTCCTTCTtttttttttt	0.129													4	2	---	---	---	---	
PTER	9317	broad.mit.edu	37	10	16489913	16489914	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16489913_16489914insT	uc001iog.1	+						PTER_uc001ioh.1_Intron|PTER_uc001ioi.1_Intron|PTER_uc009xjp.1_Intron	NM_030664	NP_109589	Q96BW5	PTER_HUMAN	phosphotriesterase related						catabolic process		hydrolase activity, acting on ester bonds|zinc ion binding			ovary(2)	2						acataacttacttgtgtcttca	0.000													4	2	---	---	---	---	
VIM	7431	broad.mit.edu	37	10	17278155	17278155	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17278155delC	uc001iou.2	+						VIM_uc001iov.1_Intron|VIM_uc001iow.1_Intron|VIM_uc001iox.1_Intron|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_Intron|VIM_uc001ipb.1_Intron|VIM_uc009xjv.1_Intron|VIM_uc001ipc.1_Intron	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin						cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						ACAGAGACTACCCTAAAATTA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	19025266	19025268	+	IGR	DEL	CAA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19025266_19025268delCAA								ARL5B (58326 upstream) : None (None downstream)																							atctgtacagcaacaacaacaac	0.113													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	21585759	21585760	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21585759_21585760insT								NEBL (122643 upstream) : C10orf114 (197662 downstream)																							gctaatttttctttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	22498484	22498485	+	IGR	INS	-	AGA	AGA	rs140751641	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22498484_22498485insAGA								DNAJC1 (205834 upstream) : COMMD3 (106814 downstream)																							CAATGCCTATCAGATCACAGCA	0.455													8	5	---	---	---	---	
BMI1	648	broad.mit.edu	37	10	22609272	22609274	+	5'Flank	DEL	TTA	-	-	rs72529488		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22609272_22609274delTTA	uc001irh.2	+						BMI1_uc009xkg.2_Intron	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene						hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						AGTTCGTGTGTTATTACTTTGTG	0.379													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30196399	30196399	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30196399delT								SVIL (170535 upstream) : KIAA1462 (105330 downstream)																							tccttctttctcttccttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33656692	33656692	+	IGR	DEL	G	-	-	rs35341972		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33656692delG								NRP1 (32686 upstream) : PARD3 (743406 downstream)																							AGTTTGCTTTGGCTAAGTAGC	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	34302793	34302793	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34302793delC								NRP1 (678787 upstream) : PARD3 (97305 downstream)																							GTCCCTGCATCCAATCTGTTG	0.473													4	2	---	---	---	---	
CREM	1390	broad.mit.edu	37	10	35416782	35416783	+	Intron	INS	-	T	T	rs113667555		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35416782_35416783insT	uc001iyb.2	+						CREM_uc001ixx.2_Intron|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ATTAAACATACttttttttttt	0.223													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36377293	36377293	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36377293delT								FZD8 (446931 upstream) : None (None downstream)																							ctttctttccttttttttttt	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	50432901	50432901	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50432901delG								C10orf128 (36494 upstream) : C10orf71 (74286 downstream)																							gcccatggttgggcaaaatca	0.000													4	2	---	---	---	---	
DRGX	644168	broad.mit.edu	37	10	50584928	50584928	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50584928delT	uc010qgq.1	-							NM_001080520	NP_001073989	A6NNA5	DRGX_HUMAN	dorsal root ganglia homeobox						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TTGTATGCCATTGTTTGCTTC	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	63251406	63251413	+	Intron	DEL	GAAGGAAG	-	-	rs146589500	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63251406_63251413delGAAGGAAG	uc001jlr.2	+											Homo sapiens, clone IMAGE:5222445, mRNA.																		aggagggaaagaaggaaggaaggaagga	0.106													4	2	---	---	---	---	
REEP3	221035	broad.mit.edu	37	10	65318385	65318385	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65318385delA	uc001jmt.2	+						REEP3_uc009xpl.1_Intron	NM_001001330	NP_001001330	Q6NUK4	REEP3_HUMAN	receptor accessory protein 3							integral to membrane					0	Prostate(12;0.0119)|all_hematologic(501;0.191)					ccctctctacaaaaaaataca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71551733	71551753	+	IGR	DEL	CCACCACCGTCACCACCATCT	-	-	rs117342078	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71551733_71551753delCCACCACCGTCACCACCATCT								C10orf35 (158386 upstream) : COL13A1 (9891 downstream)																							atcaccaccaccaccaccgtcaccaccatctccaccaccat	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	72053568	72053569	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72053568_72053569insT								NPFFR1 (27420 upstream) : LRRC20 (5160 downstream)																							ttttttctttcttttttttttt	0.005													4	2	---	---	---	---	
ADAMTS14	140766	broad.mit.edu	37	10	72496029	72496029	+	Intron	DEL	G	-	-	rs113152690		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72496029delG	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron|ADAMTS14_uc001jri.1_Intron	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						GTGCTGGGGTGGGGGGGGTCT	0.597													3	3	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73533809	73533810	+	Intron	DEL	CA	-	-	rs144716313		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73533809_73533810delCA	uc001jrx.3	+						C10orf54_uc001jsd.2_5'Flank|C10orf54_uc001jse.2_5'Flank|C10orf54_uc009xqm.2_5'Flank|C10orf54_uc001jsf.1_5'Flank	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TGCGCGCGCGcacacacacaca	0.411													5	4	---	---	---	---	
CCDC109A	90550	broad.mit.edu	37	10	74451958	74451960	+	In_Frame_Del	DEL	GGC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74451958_74451960delGGC	uc001jtc.2	+	1	70_72	c.49_51delGGC	c.(49-51)GGCdel	p.G22del	CCDC109A_uc009xqp.1_RNA|CCDC109A_uc009xqq.1_RNA|CCDC109A_uc010qjy.1_RNA|CCDC109A_uc009xqr.2_In_Frame_Del_p.G22del|CCDC109A_uc001jtd.2_5'Flank	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A	22	Mitochondrial matrix (Potential).				elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					CTCCTCTCGGggcggcggcggcg	0.616													4	2	---	---	---	---	
CAMK2G	818	broad.mit.edu	37	10	75624052	75624053	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75624052_75624053insA	uc001jvv.1	-						CAMK2G_uc001jvm.1_Intron|CAMK2G_uc001jvo.1_Intron|CAMK2G_uc001jvq.1_Intron|CAMK2G_uc001jvr.1_Intron|CAMK2G_uc001jvp.1_Intron|CAMK2G_uc001jvs.1_Intron|CAMK2G_uc001jvt.1_Intron|CAMK2G_uc001jvu.1_Intron|CAMK2G_uc010qkv.1_Intron	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II						insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					cagagcaagtcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	79385782	79385782	+	Intron	DEL	T	-	-	rs113992356		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79385782delT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	tgattttctattttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	79431339	79431340	+	IGR	INS	-	GT	GT	rs146884366	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79431339_79431340insGT								KCNMA1 (33762 upstream) : DLG5 (119211 downstream)																							catgtgcgtgagtgtgtgtgtg	0.406													0	8	---	---	---	---	
ZMIZ1	57178	broad.mit.edu	37	10	81029213	81029214	+	Intron	INS	-	ACAC	ACAC	rs145365615	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81029213_81029214insACAC	uc001kaf.2	+						ZMIZ1_uc001kag.2_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			ACCTCCCCCCAacacacacaca	0.465													5	4	---	---	---	---	
MMRN2	79812	broad.mit.edu	37	10	88717693	88717693	+	5'Flank	DEL	G	-	-	rs33979898		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88717693delG	uc001kea.2	-						MMRN2_uc010qmn.1_5'Flank|MMRN2_uc009xtb.2_5'Flank|SNCG_uc001keb.2_5'Flank	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor							extracellular space				large_intestine(1)	1						CATCCACACTGCTGGCCAGGA	0.597													7	4	---	---	---	---	
LIPK	643414	broad.mit.edu	37	10	90495941	90495941	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90495941delA	uc010qmv.1	+							NM_001080518	NP_001073987	Q5VXJ0	LIPK_HUMAN	lipase, family member K precursor						lipid catabolic process	extracellular region	hydrolase activity			ovary(2)	2		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		gagaagacagaaggaagagga	0.129													4	2	---	---	---	---	
LOC100188947	100188947	broad.mit.edu	37	10	93326384	93326384	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93326384delT	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0						tgtttgtttgttttgagacag	0.000													4	2	---	---	---	---	
DHDPSL	112817	broad.mit.edu	37	10	99371766	99371767	+	3'UTR	INS	-	T	T	rs147990739	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99371766_99371767insT	uc001kny.2	+	7					DHDPSL_uc001knz.2_3'UTR|PI4K2A_uc010qoy.1_Intron	NM_138413	NP_612422	Q86XE5	HOGA1_HUMAN	DHDPS-like protein isoform 1						glyoxylate catabolic process	mitochondrion	4-hydroxy-2-oxoglutarate aldolase activity				0						CAGTAAGGGAAttttcttttct	0.233													0	7	---	---	---	---	
PI4K2A	55361	broad.mit.edu	37	10	99421285	99421286	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99421285_99421286insT	uc001kog.1	+						PI4K2A_uc010qoy.1_Intron|PI4K2A_uc009xvw.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		tttcctttctgttttttttttg	0.000													4	2	---	---	---	---	
DNMBP	23268	broad.mit.edu	37	10	101697048	101697049	+	Intron	DEL	GC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101697048_101697049delGC	uc001kqj.2	-						NCRNA00093_uc001kqk.1_Intron	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein						intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AGCAGCAGCAGCAACAGCCCAG	0.262													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102619066	102619066	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102619066delT								PAX2 (29369 upstream) : FAM178A (53260 downstream)																							TTCTTCACCCTTTTAGGctct	0.363													4	2	---	---	---	---	
KCNIP2	30819	broad.mit.edu	37	10	103602943	103602944	+	Intron	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103602943_103602944delCA	uc001kub.2	-						KCNIP2_uc009xwu.2_Intron|KCNIP2_uc009xwv.2_Intron|KCNIP2_uc001kuc.2_Intron|KCNIP2_uc001kue.2_Intron|KCNIP2_uc001kud.2_Intron|KCNIP2_uc001kuf.2_Intron|KCNIP2_uc001kua.2_Intron|KCNIP2_uc009xww.2_Intron|KCNIP2_uc010qqi.1_Intron	NM_173191	NP_775283	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2 isoform 2						clustering of voltage-gated potassium channels|detection of calcium ion|muscle contraction|regulation of heart contraction|signal transduction|synaptic transmission	cytoplasm|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|calcium ion binding|ER retention sequence binding|identical protein binding|protein N-terminus binding				0		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		GGTGCGCGCGcacacacacaca	0.530													5	3	---	---	---	---	
TMEM180	79847	broad.mit.edu	37	10	104226408	104226409	+	Intron	INS	-	A	A	rs146323546	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104226408_104226409insA	uc001kvt.2	+						TMEM180_uc001kvs.2_Intron|TMEM180_uc010qql.1_Intron|TMEM180_uc010qqm.1_Intron|TMEM180_uc001kvu.2_5'Flank	NM_024789	NP_079065	Q14CX5	TM180_HUMAN	transmembrane protein 180							integral to membrane				ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		tccatctcattaACCTTTGAGG	0.287													4	5	---	---	---	---	
SUFU	51684	broad.mit.edu	37	10	104279285	104279286	+	Intron	DEL	AA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104279285_104279286delAA	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		actctgtctcaaaaaaaaaaaa	0.149			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113586244	113586244	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113586244delG								ADRA2A (745584 upstream) : GPAM (323378 downstream)																							AATAAGAAGAGGATAAGCATA	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	114189277	114189277	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114189277delC								ACSL5 (1140 upstream) : ZDHHC6 (783 downstream)																							CTTCCCTTATCCTCAACTATT	0.393													4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114844986	114844986	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114844986delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		catctggctattttttttttt	0.000													4	2	---	---	---	---	
TCF7L2	6934	broad.mit.edu	37	10	114846765	114846766	+	Intron	INS	-	A	A	rs966227	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114846765_114846766insA	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		ACACACACAAGAAAAAAAAAAG	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115504346	115504346	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115504346delC								CASP7 (13684 upstream) : C10orf81 (6867 downstream)																							tcctaccccaccccAGCcccc	0.010													4	2	---	---	---	---	
HSPA12A	259217	broad.mit.edu	37	10	118532807	118532808	+	Intron	INS	-	AGT	AGT	rs145616435	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118532807_118532808insAGT	uc001lcu.2	-							NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)		GTCCACTGAGCAGTACATGGTA	0.574													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119192947	119192948	+	IGR	INS	-	CGCGCG	CGCGCG	rs144706220	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119192947_119192948insCGCGCG								PDZD8 (58010 upstream) : EMX2OS (50857 downstream)																							AAacacacacacgcgcgcacac	0.302													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119455421	119455421	+	IGR	DEL	A	-	-	rs67393014		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119455421delA								EMX2 (146365 upstream) : RAB11FIP2 (309008 downstream)																							tcccctacgcatttttttttc	0.000													2	4	---	---	---	---	
PRDX3	10935	broad.mit.edu	37	10	120937393	120937394	+	Intron	INS	-	TT	TT	rs57559661		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120937393_120937394insTT	uc001lec.2	-							NM_006793	NP_006784	P30048	PRDX3_HUMAN	peroxiredoxin 3 isoform a precursor						cell redox homeostasis|hydrogen peroxide catabolic process|mitochondrion organization|myeloid cell differentiation|negative regulation of kinase activity|positive regulation of cell proliferation|positive regulation of NF-kappaB transcription factor activity|regulation of mitochondrial membrane potential|response to lipopolysaccharide	early endosome|mitochondrion	alkyl hydroperoxide reductase activity|caspase inhibitor activity|peroxidase activity|peroxiredoxin activity|protein C-terminus binding|protein kinase binding				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0245)		GTTTACTCAACttttttttttt	0.238													5	3	---	---	---	---	
BTBD16	118663	broad.mit.edu	37	10	124054067	124054068	+	Intron	INS	-	CA	CA	rs144614162	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124054067_124054068insCA	uc001lgc.1	+						BTBD16_uc001lgd.1_Intron	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16											skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				GCATGTGTATGCACACACACGC	0.525													2	4	---	---	---	---	
LHPP	64077	broad.mit.edu	37	10	126210438	126210439	+	Intron	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126210438_126210439delAC	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		acttacacgtacacacacacac	0.465													3	4	---	---	---	---	
LHPP	64077	broad.mit.edu	37	10	126235445	126235446	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126235445_126235446insT	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		TACAGGTAGAATTCGGTATTCT	0.431													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	127394567	127394568	+	RNA	INS	-	A	A	rs71029267		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127394567_127394568insA	uc001lim.1	-	5		c.1818_1819insT			uc001lil.2_Intron					Homo sapiens cDNA FLJ37035 fis, clone BRACE2011545.																		CCTCAGGCTTCACGACCCTTCC	0.545													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132033193	132033193	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132033193delC								GLRX3 (50409 upstream) : TCERG1L (857463 downstream)																							AGGGGCCTTGCCCCTGGAACT	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132139158	132139158	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132139158delC								GLRX3 (156374 upstream) : TCERG1L (751498 downstream)																							ttggggtccaccatttagccc	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132677433	132677434	+	IGR	INS	-	AGT	AGT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132677433_132677434insAGT								GLRX3 (694649 upstream) : TCERG1L (213222 downstream)																							GGAGTGGAAGGAGGACGCGATG	0.391													4	2	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	133021955	133021958	+	Intron	DEL	ACAG	-	-	rs143883413		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133021955_133021958delACAG	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		cctcacgcatacagacacacacac	0.186													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133284804	133284805	+	IGR	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133284804_133284805delTG								TCERG1L (174820 upstream) : PPP2R2D (463155 downstream)																							attatgtgtatgtgtgtttatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133579200	133579205	+	IGR	DEL	CTTCTG	-	-	rs139218299	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133579200_133579205delCTTCTG								TCERG1L (469216 upstream) : PPP2R2D (168755 downstream)																							cctgctcctccttctgctcctccttc	0.209													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134240360	134240360	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134240360delG								PWWP2B (9009 upstream) : C10orf91 (18354 downstream)																							ataaagccctgggatggctgg	0.000													4	2	---	---	---	---	
ODF3	113746	broad.mit.edu	37	11	196062	196062	+	5'Flank	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:196062delT	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGGGGGGACCTTGGTGAGGGG	0.672													5	3	---	---	---	---	
MUC6	4588	broad.mit.edu	37	11	1037569	1037569	+	5'Flank	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1037569delC	uc001lsw.2	-							NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric						maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACTGGGATGACCAGGGGGCCT	0.706													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	2877402	2877403	+	IGR	DEL	TT	-	-	rs35873500		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2877402_2877403delTT								KCNQ1 (7063 upstream) : KCNQ1DN (13860 downstream)																							TGCCCTGGACtttttttttttt	0.282													1	5	---	---	---	---	
OSBPL5	114879	broad.mit.edu	37	11	3152821	3152822	+	Intron	INS	-	CATC	CATC	rs149476927	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3152821_3152822insCATC	uc001lxk.2	-						OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron|OSBPL5_uc001lxm.1_5'Flank	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		atccacccattcatccatccat	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	6393600	6393600	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6393600delT								PRKCDBP (51860 upstream) : SMPD1 (18055 downstream)																							aaatatagtcttttttttttt	0.000													5	3	---	---	---	---	
OVCH2	341277	broad.mit.edu	37	11	7720159	7720160	+	Intron	INS	-	T	T	rs140781651	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7720159_7720160insT	uc010rbf.1	-							NM_198185	NP_937828			ovochymase 2 precursor												0				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		GGCATAATGGCTGTAGGTGCTC	0.475													4	2	---	---	---	---	
ST5	6764	broad.mit.edu	37	11	8782570	8782571	+	Intron	INS	-	C	C	rs145629310	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8782570_8782571insC	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Intron	NM_213618	NP_998783	P78524	ST5_HUMAN	suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CCAACCCTCCTCCTCAAAGAAA	0.406													5	4	---	---	---	---	
AMPD3	272	broad.mit.edu	37	11	10478525	10478525	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10478525delT	uc001mio.1	+						AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Intron|AMPD3_uc009yfw.1_Intron|AMPD3_uc009yfx.1_Intron|AMPD3_uc009yfz.2_Intron|AMPD3_uc001mip.1_Intron	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B						AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		TGtttcttgcttttttttttt	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11268679	11268680	+	IGR	DEL	TC	-	-	rs139881785	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11268679_11268680delTC								ZBED5 (389059 upstream) : GALNTL4 (23741 downstream)																							tccccgtgtgtctctctctctc	0.089													6	3	---	---	---	---	
IGSF22	283284	broad.mit.edu	37	11	18743073	18743073	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18743073delC	uc009yht.2	-						IGSF22_uc001mpa.2_Intron	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22											ovary(4)|large_intestine(2)|kidney(1)	7						TTGGGCTTGGCCCCCGCACCT	0.617											OREG0020822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	113	51	---	---	---	---	
LUZP2	338645	broad.mit.edu	37	11	24792499	24792500	+	Intron	INS	-	A	A	rs139242910	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24792499_24792500insA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						CAGGCTCCAGCACCACACACCC	0.351													0	7	---	---	---	---	
LUZP2	338645	broad.mit.edu	37	11	25083729	25083731	+	Intron	DEL	AGG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25083729_25083731delAGG	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						aggaggaggaagggagagagaga	0.133													4	2	---	---	---	---	
WT1	7490	broad.mit.edu	37	11	32444167	32444167	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32444167delG	uc001mtn.1	-						WT1_uc001mtl.1_Intron|WT1_uc001mtm.1_Intron|WT1_uc001mto.1_Intron|WT1_uc001mtp.1_Intron|WT1_uc001mtq.1_Intron|WT1_uc009yjs.1_Intron	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D						adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ACTGAGTTATGGAACCCAAGA	0.408			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				4	2	---	---	---	---	
LRRC4C	57689	broad.mit.edu	37	11	41447663	41447663	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41447663delG	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				AGATCTGGATGGTCCCTTCAG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44431094	44431094	+	IGR	DEL	T	-	-	rs66810036		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44431094delT								ALX4 (99378 upstream) : CD82 (156047 downstream)																							GAAGTCATTATTTTTGCTGCC	0.478													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45581639	45581642	+	IGR	DEL	ACAT	-	-	rs149213188		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45581639_45581642delACAT								SYT13 (273755 upstream) : CHST1 (88785 downstream)																							acacacagtcacatacacacacac	0.299													2	4	---	---	---	---	
CHST1	8534	broad.mit.edu	37	11	45679126	45679126	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45679126delT	uc001mys.1	-							NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)						galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		gaactcgtcctcaagactttg	0.000													4	2	---	---	---	---	
GYLTL1B	120071	broad.mit.edu	37	11	45945560	45945575	+	Intron	DEL	AAAAAAAAAAAAAAAG	-	-	rs60577963		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45945560_45945575delAAAAAAAAAAAAAAAG	uc001nbv.1	+						GYLTL1B_uc001nbw.1_Intron|GYLTL1B_uc001nbx.1_Intron|GYLTL1B_uc001nby.1_5'Flank	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B						muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		aaaaaaaaaaaaaaaaaaaaaaaaaGAACATCCTGA	0.301													4	2	---	---	---	---	
CKAP5	9793	broad.mit.edu	37	11	46852385	46852385	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46852385delG	uc001ndi.1	-						CKAP5_uc001ndj.1_Intron	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein						cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						aggccaaggtgggggcggatc	0.075													4	2	---	---	---	---	
C11orf49	79096	broad.mit.edu	37	11	47173148	47173149	+	Intron	INS	-	G	G	rs147521376	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47173148_47173149insG	uc001ndp.2	+						C11orf49_uc001nds.2_Intron|C11orf49_uc001ndq.2_Intron|C11orf49_uc001ndr.2_Intron|C11orf49_uc010rgx.1_Intron|C11orf49_uc010rgy.1_Intron|C11orf49_uc010rgz.1_Intron	NM_024113	NP_077018	Q9H6J7	CK049_HUMAN	hypothetical protein LOC79096 isoform 3												0						cagagggtggcggggggaagtt	0.054													1	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48363139	48363140	+	IGR	INS	-	G	G	rs143199863	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48363139_48363140insG								OR4C3 (15659 upstream) : OR4C45 (3762 downstream)																							TTCATGTTATTGTCCCTTTGTA	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55124266	55124267	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55124266_55124267insT								OR4A16 (12605 upstream) : OR4A15 (11093 downstream)																							acacactgcaatcaccatatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	60575408	60575409	+	IGR	INS	-	A	A	rs141660646	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60575408_60575409insA								MS4A10 (6630 upstream) : CCDC86 (34020 downstream)																							TCCAGGGAGTGAAAAAATcaac	0.139													4	2	---	---	---	---	
CD5	921	broad.mit.edu	37	11	60867642	60867643	+	5'Flank	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60867642_60867643delAC	uc009ynk.2	+							NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor						cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		catggagattacacacacacat	0.045													4	2	---	---	---	---	
FADS2	9415	broad.mit.edu	37	11	61594921	61594921	+	5'Flank	DEL	T	-	-	rs3834458		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61594921delT	uc001nsl.1	+						FADS2_uc001nsj.2_Intron|FADS2_uc010rlo.1_Intron|FADS2_uc001nsk.2_5'Flank	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2						electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)	AATTCTTTTCTAAGATTGTCT	0.572													4	2	---	---	---	---	
TTC9C	283237	broad.mit.edu	37	11	62504168	62504168	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62504168delA	uc001nuy.2	+						TTC9C_uc001nux.2_Intron	NM_173810	NP_776171	Q8N5M4	TTC9C_HUMAN	tetratricopeptide repeat domain 9C								binding			ovary(1)|pancreas(1)	2						tccgtctcggaaaaaaaaaaa	0.000													3	3	---	---	---	---	
NAALADL1	10004	broad.mit.edu	37	11	64827596	64827597	+	5'Flank	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64827596_64827597delGT	uc001ocn.2	-						NAALADL1_uc010rnw.1_5'Flank	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic						proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						AGGGCAGAGCgtgtgtgtgtgt	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	66096519	66096519	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66096519delT								CD248 (12004 upstream) : RIN1 (3023 downstream)																							tgttgtttgattttttttttt	0.209													4	2	---	---	---	---	
RBM14	10432	broad.mit.edu	37	11	66386915	66386916	+	Intron	DEL	AT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66386915_66386916delAT	uc001oit.2	+						RBM14_uc009yrh.2_Intron|RBM14_uc009yri.2_Intron|RBM4_uc009yrj.2_Intron|RBM4_uc009yrk.2_Intron	NM_006328	NP_006319	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14						DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|histone deacetylation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus	mediator complex|ribonucleoprotein complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|protein binding, bridging|RNA binding|RNA polymerase II transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TTCCGGAAACATGTACAGACTT	0.396													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	67513469	67513469	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67513469delC								ALDH3B2 (64784 upstream) : LOC645332 (45771 downstream)																							ATCTCTGTGTCCCCATGTACA	0.488													4	2	---	---	---	---	
TCIRG1	10312	broad.mit.edu	37	11	67813024	67813024	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67813024delT	uc001one.2	+						TCIRG1_uc001ong.2_Intron|TCIRG1_uc001onh.2_Intron|TCIRG1_uc001oni.2_Intron	NM_006019	NP_006010	Q13488	VPP3_HUMAN	T-cell, immune regulator 1 isoform a						ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity			ovary(1)	1						GTTGCACAGCttttttttttt	0.194													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68412088	68412089	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68412088_68412089insA								SAPS3 (29289 upstream) : GAL (39894 downstream)																							aagaaggaaggaaggaaagaag	0.000													4	2	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69928320	69928321	+	Intron	INS	-	CATT	CATT	rs145945927	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69928320_69928321insCATT	uc001opj.2	+							NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						acacatgcctgcattcattcat	0.312													3	4	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72357345	72357345	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72357345delA	uc010rrc.1	-						PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron|PDE2A_uc001osq.2_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	TGTTCCTaataaaaatgacac	0.299													4	2	---	---	---	---	
CHRDL2	25884	broad.mit.edu	37	11	74420637	74420639	+	Intron	DEL	CTC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74420637_74420639delCTC	uc001ovi.2	-						CHRDL2_uc001ovg.2_Intron|CHRDL2_uc001ovh.2_Intron|CHRDL2_uc001ovk.1_Intron			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;						cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					TAAGTAGTCACTCCTCATTATTT	0.360													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	76509495	76509498	+	IGR	DEL	CTGT	-	-	rs5792739		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76509495_76509498delCTGT								TSKU (298 upstream) : ACER3 (62419 downstream)																							GCCCTCACCCCTGTCTCTCAACCT	0.578													5	5	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	78686408	78686408	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78686408delG	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						CATGGGATGTGGGAGAGAGGA	0.517													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	79124420	79124421	+	Intron	INS	-	TAGCCTT	TAGCCTT	rs150574515	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79124420_79124421insTAGCCTT	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						CTTGGACTCCATAGCCTTTTCC	0.569													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	88150260	88150260	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88150260delA								CTSC (79319 upstream) : GRM5 (87485 downstream)																							ctccacctggaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90004388	90004388	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90004388delA								CHORDC1 (47856 upstream) : MIR1261 (597901 downstream)																							ggaagggaggaagggaggaag	0.000													4	2	---	---	---	---	
ENDOD1	23052	broad.mit.edu	37	11	94855753	94855754	+	Intron	INS	-	AC	AC	rs143507497	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94855753_94855754insAC	uc001pfh.2	+							NM_015036	NP_055851	O94919	ENDD1_HUMAN	endonuclease domain containing 1 precursor							extracellular region	endonuclease activity|metal ion binding|nucleic acid binding				0		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.00824)				GCATTTAAGTTacacacacaca	0.173													4	3	---	---	---	---	
ELMOD1	55531	broad.mit.edu	37	11	107533996	107533996	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107533996delG	uc010rvs.1	+						ELMOD1_uc001pjm.2_Intron|ELMOD1_uc010rvt.1_Intron	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1						phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		GTAGGGTGATGGTTGGTGTGT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	116586782	116586782	+	IGR	DEL	C	-	-	rs5795050		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116586782delC								None (None upstream) : BUD13 (32106 downstream)																							agtctcggctcactgcaacct	0.010													4	2	---	---	---	---	
DSCAML1	57453	broad.mit.edu	37	11	117331786	117331787	+	Intron	INS	-	G	G	rs141490339	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117331786_117331787insG	uc001prh.1	-							NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AATATCAACACTGAAACTAGAA	0.312													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	118722408	118722411	+	IGR	DEL	TCAA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118722408_118722411delTCAA								DDX6 (60436 upstream) : CXCR5 (32130 downstream)																							agactccgtctcaatcaatcaatc	0.000													4	2	---	---	---	---	
CBL	867	broad.mit.edu	37	11	119163084	119163084	+	Intron	DEL	T	-	-	rs113418701		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119163084delT	uc001pwe.2	+							NM_005188	NP_005179	P22681	CBL_HUMAN	Cas-Br-M (murine) ecotropic retroviral						epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		tgctgatgtcttttttttttt	0.020									CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	122907005	122907005	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122907005delG								LOC341056 (16687 upstream) : HSPA8 (21196 downstream)																							caagccgggtggatcacctga	0.075													4	2	---	---	---	---	
KIRREL3	84623	broad.mit.edu	37	11	126480195	126480195	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126480195delC	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		gcatgttcgtcaggctggtct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	129910143	129910150	+	IGR	DEL	AAACAAAC	-	-	rs111794722		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129910143_129910150delAAACAAAC								NCRNA00167 (34762 upstream) : APLP2 (29566 downstream)																							ccgtttcaaaaaacaaacaaacaaacaa	0.058													6	3	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131911365	131911365	+	Intron	DEL	T	-	-	rs11342929		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131911365delT	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						GTATTCAGAATTAACCTTAAG	0.343													3	3	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	132032082	132032083	+	Intron	INS	-	GTGTGTATGTGG	GTGTGTATGTGG	rs139198512	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132032082_132032083insGTGTGTATGTGG	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						TTTTGGGGGGAGTGTGTATGTG	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	134343418	134343419	+	Intron	INS	-	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134343418_134343419insC	uc001qhs.2	+											Homo sapiens cDNA FLJ37762 fis, clone BRHIP2024347, weakly similar to GALECTIN-3.																		CTGGCTCCATGCCCCCCAGCAA	0.292													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2755918	2755919	+	Intron	DEL	GA	-	-	rs72522035		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2755918_2755919delGA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc010sea.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	atgcctgtatgagagagagaga	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	2830230	2830231	+	IGR	DEL	AG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2830230_2830231delAG								CACNA1C (23115 upstream) : FKBP4 (73877 downstream)																							agacacacacagagacacacac	0.000													5	3	---	---	---	---	
CCND2	894	broad.mit.edu	37	12	4405871	4405872	+	Intron	DEL	GA	-	-	rs66968722		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4405871_4405872delGA	uc001qmo.2	+							NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GCCTCTTGGGGAAAAAAAAAAA	0.421			T	IGL@	NHL,CLL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5084503	5084503	+	IGR	DEL	A	-	-	rs113543985		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5084503delA								KCNA1 (57083 upstream) : KCNA5 (68582 downstream)																							GAATGAAATTAAAAAAAAAAA	0.398													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6295936	6295937	+	IGR	INS	-	A	A	rs150455201	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6295936_6295937insA								VWF (62100 upstream) : CD9 (12936 downstream)																							ccagagaatttaaaaaaatgca	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6296622	6296625	+	IGR	DEL	GAAG	-	-	rs113312184		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6296622_6296625delGAAG								VWF (62786 upstream) : CD9 (12248 downstream)																							aaaggaagaagaaggaaggaagga	0.093													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9477111	9477112	+	IGR	INS	-	T	T	rs141809156	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9477111_9477112insT								LOC642846 (10427 upstream) : DDX12 (93176 downstream)																							aatttcctaccttctcctggcg	0.000													5	3	---	---	---	---	
AEBP2	121536	broad.mit.edu	37	12	19592829	19592840	+	In_Frame_Del	DEL	GGCGGCGGAGGC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19592829_19592840delGGCGGCGGAGGC	uc001ref.2	+	1	222_233	c.196_207delGGCGGCGGAGGC	c.(196-207)GGCGGCGGAGGCdel	p.GGGG70del	AEBP2_uc001ree.2_In_Frame_Del_p.GGGG70del|AEBP2_uc001reg.1_5'Flank	NM_001114176	NP_001107648	Q6ZN18	AEBP2_HUMAN	AE binding protein 2 isoform b	70_73	Glu-rich.|Gly-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					cagcggtgggggcggcggaggcggcggcggAG	0.387													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22867834	22867835	+	IGR	DEL	CT	-	-	rs10617750		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22867834_22867835delCT								ETNK1 (24227 upstream) : SOX5 (817397 downstream)																							GACCTTTGCCCTCTCTCAACTA	0.371													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	26078135	26078135	+	IGR	DEL	A	-	-	rs75082036		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26078135delA								IFLTD1 (276647 upstream) : RASSF8 (33834 downstream)																							actccgtctcaaaaaaaaaaa	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	30666571	30666572	+	IGR	DEL	GT	-	-	rs112541578		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30666571_30666572delGT								TMTC1 (728879 upstream) : IPO8 (115351 downstream)																							GTATTAATTGgtgtgtgtgtgt	0.015													4	2	---	---	---	---	
DNM1L	10059	broad.mit.edu	37	12	32846523	32846523	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32846523delT	uc001rld.2	+						DNM1L_uc010skf.1_Intron|DNM1L_uc010skg.1_Intron|DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Intron|DNM1L_uc001rlg.2_Intron|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Intron	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					taattcagtgttttttttagc	0.020													3	3	---	---	---	---	
SLC2A13	114134	broad.mit.edu	37	12	40247409	40247410	+	Intron	INS	-	TT	TT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40247409_40247410insTT	uc010skm.1	-						C12orf40_uc009zjv.1_Intron|SLC2A13_uc001rme.1_Intron	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				ttctttctttcttttttttttt	0.178										HNSCC(50;0.14)			4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	41015169	41015169	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41015169delA								LRRK2 (252085 upstream) : CNTN1 (71189 downstream)																							ataagagaataaaagcaggct	0.000													4	2	---	---	---	---	
RPAP3	79657	broad.mit.edu	37	12	48083445	48083445	+	Intron	DEL	C	-	-	rs77474314		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48083445delC	uc001rpr.2	-						RPAP3_uc010slk.1_Intron|RPAP3_uc001rps.2_Intron	NM_024604	NP_078880	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3 isoform								binding			ovary(1)	1	Lung SC(27;0.192)					TTCTTCTTCTCCCCCCAGGGC	0.289													6	5	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48272667	48272667	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48272667delA	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_5'UTR	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	AGGAGATGTGAAAAATGCAAG	0.542													17	11	---	---	---	---	
RHEBL1	121268	broad.mit.edu	37	12	49463357	49463374	+	Intron	DEL	CCAATCCTCCACTCTTCC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463357_49463374delCCAATCCTCCACTCTTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2						ACCAACTCTTCCAATCCTCCACTCTTCCATTCCTCCAC	0.569													10	7	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54744006	54744007	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54744006_54744007insT	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						CAGTAACTCCCTTTTTTTTTTT	0.436													6	3	---	---	---	---	
CAND1	55832	broad.mit.edu	37	12	67661205	67661206	+	5'Flank	INS	-	TGTG	TGTG	rs143880177	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67661205_67661206insTGTG	uc001stn.2	+							NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein						cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		ACCTGCTTCTTtgtgtgtgtgt	0.327													4	6	---	---	---	---	
TPH2	121278	broad.mit.edu	37	12	72402730	72402731	+	Intron	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72402730_72402731delTG	uc009zrw.1	+						TPH2_uc001swy.2_Intron	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	GCAGTGTGCATGTGTGTGTGTG	0.386													4	2	---	---	---	---	
KCNC2	3747	broad.mit.edu	37	12	75602882	75602882	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75602882delT	uc001sxg.1	-						KCNC2_uc009zry.2_5'Flank|KCNC2_uc001sxe.2_Intron|KCNC2_uc001sxf.2_Intron|KCNC2_uc010stw.1_Intron	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel						energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						CATCTCTACATTCCTATTGCG	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80372744	80372745	+	IGR	INS	-	C	C			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80372744_80372745insC								PPP1R12A (43509 upstream) : PTPRQ (465381 downstream)																							cttccttccttccttccttcgt	0.079													5	3	---	---	---	---	
MRPL42	28977	broad.mit.edu	37	12	93873089	93873090	+	Intron	INS	-	A	A	rs34328828		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93873089_93873090insA	uc001tcr.2	+						MRPL42_uc001tcq.2_Intron|MRPL42_uc001tcs.2_Intron|MRPL42_uc001tct.2_Intron	NM_172177	NP_751917	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42 isoform a						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome			ovary(2)	2						gagtccatctcaaaaaaaaaaa	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93983866	93983866	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93983866delA								SOCS2 (13888 upstream) : CRADD (87285 downstream)																							catctctaccaaaaatacaaa	0.000													4	2	---	---	---	---	
CRADD	8738	broad.mit.edu	37	12	94071949	94071949	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94071949delG	uc001tda.2	+						CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	NM_003805	NP_003796	P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with						apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging			ovary(1)	1						ATTGTAGACTGGGCACAAACA	0.423													4	2	---	---	---	---	
CRADD	8738	broad.mit.edu	37	12	94153729	94153729	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94153729delT	uc001tda.2	+						CRADD_uc010sur.1_Intron|CRADD_uc010sus.1_Intron	NM_003805	NP_003796	P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with						apoptosis|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|signal transduction	intracellular	death domain binding|protease binding|protein binding, bridging			ovary(1)	1						CATCTGATGGTGGGGTGTGGC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95730868	95730869	+	IGR	INS	-	TG	TG	rs151044094	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95730868_95730869insTG								MIR331 (28579 upstream) : METAP2 (136953 downstream)																							CTGAAAATAGAtgtgtgtgtgt	0.282													3	5	---	---	---	---	
TCP11L2	255394	broad.mit.edu	37	12	106730393	106730394	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106730393_106730394insA	uc001tln.2	+							NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2											ovary(3)	3						tgcagtggcgcaatctcagctc	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	108419422	108419422	+	IGR	DEL	C	-	-	rs67282782		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108419422delC								ASCL4 (249002 upstream) : WSCD2 (104089 downstream)																							AGATTTTTTTCCCTCCATCAC	0.433													3	3	---	---	---	---	
SSH1	54434	broad.mit.edu	37	12	109191066	109191067	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109191066_109191067insT	uc001tnm.2	-						SSH1_uc001tnl.2_Intron|SSH1_uc010sxg.1_Intron|SSH1_uc001tnn.3_Intron	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1						actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						ccacgctgggcttttttttttt	0.010													3	3	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109691642	109691642	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109691642delT	uc001tob.2	+						ACACB_uc001toc.2_Intron|ACACB_uc010sxl.1_Intron|ACACB_uc001tod.2_Intron|ACACB_uc010sxm.1_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CAAGTGCCCCTTTTCCCCATC	0.418													4	2	---	---	---	---	
MYO1H	283446	broad.mit.edu	37	12	109879690	109879691	+	Intron	DEL	AA	-	-	rs35111481		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109879690_109879691delAA	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron			Q8N1T3	MYO1H_HUMAN	SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0						catctcaactaaaatacaaaat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110801761	110801762	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110801761_110801762insT								ATP2A2 (12866 upstream) : ANAPC7 (8943 downstream)																							CATCTGTTACAttttttttttt	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115746401	115746401	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115746401delT								TBX3 (624432 upstream) : MED13L (649982 downstream)																							AAATTACATAttttatttttg	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116307901	116307901	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116307901delG								None (None upstream) : MED13L (88482 downstream)																							aagagggagtggggcttaaag	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	117122640	117122640	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117122640delG								MAP1LC3B2 (108215 upstream) : C12orf49 (30956 downstream)																							aggattcagtgggatgatgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	117886625	117886625	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117886625delT								NOS1 (87043 upstream) : KSR2 (4192 downstream)																							ctaagtggtgttttggccacg	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120396905	120396905	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120396905delT								CIT (81813 upstream) : CCDC64 (30743 downstream)																							tgactcaatcttttttttttt	0.000													3	3	---	---	---	---	
RAB35	11021	broad.mit.edu	37	12	120550238	120550238	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120550238delT	uc001txm.1	-						RAB35_uc009zww.1_Intron|RAB35_uc010szh.1_Intron	NM_006861	NP_006852	Q15286	RAB35_HUMAN	RAB35, member RAS oncogene family						cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)		GTTCTCGATAttttttttttt	0.274													4	2	---	---	---	---	
TCTN2	79867	broad.mit.edu	37	12	124178015	124178016	+	Intron	INS	-	C	C	rs149883037		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124178015_124178016insC	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		tttttttttttttgagatggat	0.099													3	3	---	---	---	---	
SCARB1	949	broad.mit.edu	37	12	125306024	125306025	+	Intron	DEL	TC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125306024_125306025delTC	uc001ugo.3	-						SCARB1_uc001ugn.3_Intron|SCARB1_uc001ugm.3_Intron|SCARB1_uc010tbd.1_Intron|SCARB1_uc010tbe.1_Intron|SCARB1_uc001ugp.3_Intron	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1						adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CATGTCTCAAtctctctctctc	0.465													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128058142	128058142	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128058142delA								None (None upstream) : TMEM132C (841149 downstream)																							TCTTTGACACAGAGCCTTCTT	0.284													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128866586	128866586	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128866586delT								None (None upstream) : TMEM132C (32705 downstream)																							TGTTATTCGCTTTTTTTTTTT	0.453													4	2	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	130920991	130920992	+	Intron	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130920991_130920992delCA	uc001uil.2	-						RIMBP2_uc001uim.2_Intron|RIMBP2_uc001uin.1_Intron	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		tatttacatgcaCACACACACA	0.282													4	2	---	---	---	---	
RIMBP2	23504	broad.mit.edu	37	12	131143612	131143613	+	Intron	INS	-	A	A	rs144426540	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131143612_131143613insA	uc001uim.2	-									O15034	RIMB2_HUMAN	RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCCCTTTGTGGAAAGACTGAAG	0.238													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132119328	132119329	+	IGR	INS	-	CATC	CATC	rs143466307	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132119328_132119329insCATC								LOC116437 (421853 upstream) : SFRS8 (76306 downstream)																							tctcttccatgcatccatccat	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132145061	132145062	+	IGR	INS	-	A	A	rs146457817	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132145061_132145062insA								LOC116437 (447586 upstream) : SFRS8 (50573 downstream)																							AGCTCTGAAACAAAAGCACACC	0.500													8	4	---	---	---	---	
LOC100101938	100101938	broad.mit.edu	37	13	19921378	19921379	+	5'Flank	INS	-	CA	CA	rs28739543		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19921378_19921379insCA	uc010tck.1	-							NR_027248				Homo sapiens cDNA clone IMAGE:5265638.												0						CCAAGTGCGCGcacacacacac	0.401													4	3	---	---	---	---	
LATS2	26524	broad.mit.edu	37	13	21568155	21568155	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21568155delA	uc009zzs.2	-						LATS2_uc001unr.3_Intron	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN	LATS, large tumor suppressor, homolog 2						cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TTAACCCAGTACCTGTTGACT	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22300190	22300195	+	IGR	DEL	TACCAT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22300190_22300195delTACCAT								FGF9 (21550 upstream) : None (None downstream)																							ccatcaccactaccatcaccatcacc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	22572188	22572189	+	IGR	INS	-	T	T	rs150065388	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22572188_22572189insT								FGF9 (293548 upstream) : None (None downstream)																							aactgatttcctttTGGATGAA	0.228													4	3	---	---	---	---	
TNFRSF19	55504	broad.mit.edu	37	13	24185266	24185267	+	Intron	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24185266_24185267delCA	uc001uov.1	+						TNFRSF19_uc001uot.2_Intron|TNFRSF19_uc010tcu.1_Intron|TNFRSF19_uc001uow.2_Intron	NM_018647	NP_061117	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily,						apoptosis|induction of apoptosis|JNK cascade	integral to membrane|mitochondrion	tumor necrosis factor receptor activity			kidney(1)|skin(1)	2		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		cacacatgtgcacacacacaca	0.386													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	26824078	26824081	+	IGR	DEL	CCAT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26824078_26824081delCCAT								RNF6 (27570 upstream) : CDK8 (4675 downstream)																							atctatGTCAccatccatccatcc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27100228	27100229	+	IGR	DEL	CA	-	-	rs36110441		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27100228_27100229delCA								CDK8 (121659 upstream) : WASF3 (31611 downstream)																							acacacacaccacacacacaca	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28469017	28469018	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28469017_28469018insA	uc001urs.1	-											full-length cDNA clone CS0DJ004YL04 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).																		cgaggcaggagaatcacttgaa	0.064													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	29113132	29113132	+	IGR	DEL	A	-	-	rs11314622		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29113132delA								FLT1 (43867 upstream) : POMP (120109 downstream)																							GAGAAGCCTGAAAATGAGAGT	0.458													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31270778	31270780	+	IGR	DEL	AGG	-	-	rs149322606		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31270778_31270780delAGG								USPL1 (37092 upstream) : ALOX5AP (16835 downstream)																							GCCAATGTCAAGGAGAAGAAAAG	0.478													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31361985	31361992	+	IGR	DEL	AGGGAGTA	-	-	rs140684576		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31361985_31361992delAGGGAGTA								ALOX5AP (23429 upstream) : C13orf33 (118320 downstream)																							CTCCAGCAGCAGGGAGTAAGGGCAGAGC	0.625													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31984673	31984674	+	IGR	INS	-	GGTGTGA	GGTGTGA	rs140502448	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31984673_31984674insGGTGTGA								B3GALTL (78264 upstream) : RXFP2 (329005 downstream)																							GAGGGCCCTGCGGTGGGAGGTG	0.574													4	2	---	---	---	---	
ENOX1	55068	broad.mit.edu	37	13	43912531	43912531	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43912531delG	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron|ENOX1_uc010tfm.1_Intron	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		GCAAATGGACGGGTTAAGAAA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	45869247	45869247	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45869247delG								GTF2F2 (11010 upstream) : TPT1 (42057 downstream)																							cacaggtaatggaaatcctga	0.020													4	2	---	---	---	---	
DHRS12	79758	broad.mit.edu	37	13	52367064	52367065	+	Intron	DEL	TT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52367064_52367065delTT	uc001vfq.2	-						DHRS12_uc001vfr.1_Intron|DHRS12_uc001vfs.1_Intron			A0PJE2	DHR12_HUMAN	RecName: Full=Dehydrogenase/reductase SDR family member 12;          EC=1.1.-.-;								binding|oxidoreductase activity				0		Breast(56;0.00173)|Prostate(109;0.00899)|Lung NSC(96;0.0199)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.81e-08)		GCTGCTGATCTTTTTTTTTTTT	0.356													4	2	---	---	---	---	
TPTE2P3	220115	broad.mit.edu	37	13	53108776	53108777	+	Intron	DEL	AA	-	-	rs76725612		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53108776_53108777delAA	uc001vgw.2	+							NR_002793				Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase pseudogene, mRNA (cDNA clone IMAGE:5298506), with apparent retained intron.												0						ggagtgtctgaaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	58041789	58041790	+	IGR	DEL	AC	-	-	rs67377298		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58041789_58041790delAC								PRR20B (297437 upstream) : PCDH17 (163999 downstream)																							ctgTGTAAGTacacacacacac	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	59201266	59201266	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59201266delC								PCDH17 (898201 upstream) : None (None downstream)																							atacaaaaagcccaaagattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	65515772	65515773	+	IGR	DEL	TC	-	-	rs35431332		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65515772_65515773delTC								None (None upstream) : None (None downstream)																							ggaaaccatatctctactaaaa	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	73725334	73725335	+	IGR	INS	-	AC	AC	rs146908588	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73725334_73725335insAC								KLF5 (73659 upstream) : KLF12 (534815 downstream)																							GTCCTCCAAGTacacacacaca	0.307													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	87569953	87569954	+	IGR	DEL	CA	-	-	rs112083893		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87569953_87569954delCA								None (None upstream) : SLITRK5 (754916 downstream)																							cgtgcgcgcgcacacacacaca	0.000													4	2	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92496985	92496986	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92496985_92496986insT	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ttttgtttttgtttttttttag	0.104													4	2	---	---	---	---	
DCT	1638	broad.mit.edu	37	13	95132285	95132285	+	5'Flank	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95132285delA	uc001vlv.3	-						DCT_uc010afh.2_5'Flank	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1						epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		ACATGTGTGCAAAAAAGACCA	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	96014869	96014870	+	IGR	INS	-	A	A	rs111357758		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96014869_96014870insA								ABCC4 (61182 upstream) : CLDN10 (70983 downstream)																							gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99621717	99621718	+	Intron	INS	-	AA	AA	rs141589900	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99621717_99621718insAA	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCGGGAGAAAGAAAAAAAAAAG	0.441													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	100129661	100129662	+	IGR	DEL	GT	-	-	rs61972518		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100129661_100129662delGT								UBAC2 (90910 upstream) : TM9SF2 (24066 downstream)																							gtatgtgtgcgtgtgtgtgtat	0.000													3	4	---	---	---	---	
PCCA	5095	broad.mit.edu	37	13	100831984	100831999	+	Intron	DEL	TGTGTGTGTGTGTGTT	-	-	rs66657247	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100831984_100831999delTGTGTGTGTGTGTGTT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron	NM_000282	NP_000273	P05165	PCCA_HUMAN	propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	TTTTCCtgtctgtgtgtgtgtgtgtttgtgtgtgtg	0.051													4	2	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111162964	111162965	+	Intron	DEL	TG	-	-	rs35675138		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111162964_111162965delTG	uc001vqx.2	+							NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AAGCATGCACtgtgtgtgtgtg	0.292													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112015607	112015607	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112015607delC								C13orf16 (19014 upstream) : SOX1 (706306 downstream)																							GAGCCTCTGTCCCCCACGTCA	0.403													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112757694	112757695	+	IGR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112757694_112757695delAC								SOX1 (31674 upstream) : C13orf28 (272974 downstream)																							CTGCAAGAGGACACACACACAC	0.599													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112882951	112882952	+	IGR	INS	-	T	T	rs113016666		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112882951_112882952insT								SOX1 (156931 upstream) : C13orf28 (147717 downstream)																							tttttgttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	113133111	113133112	+	IGR	INS	-	A	A	rs150933474	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113133111_113133112insA								C13orf28 (44110 upstream) : TUBGCP3 (6216 downstream)																							AATGCTCAGttaaaaaaaaaag	0.193													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19787163	19787163	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19787163delC								POTEG (202221 upstream) : P704P (196791 downstream)																							GACAAAGACACCAGGCCCTGA	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19818287	19818287	+	IGR	DEL	C	-	-	rs111887361		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19818287delC								POTEG (233345 upstream) : P704P (165667 downstream)																							gcatgagacacgcaccaccac	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21622710	21622711	+	IGR	DEL	GA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21622710_21622711delGA								ZNF219 (49847 upstream) : OR5AU1 (386 downstream)																							ctcgggggtggagagagagaga	0.020													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	26370395	26370396	+	IGR	INS	-	CTCT	CTCT	rs148530520	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26370395_26370396insCTCT								STXBP6 (851224 upstream) : NOVA1 (544694 downstream)																							cccctccccagctatctacaca	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	39304293	39304294	+	Intron	DEL	CA	-	-	rs10570892		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39304293_39304294delCA	uc001wun.2	-						uc001wuo.2_Intron|uc010amw.1_Intron					Homo sapiens cDNA FLJ43028 fis, clone BRTHA3000297.																		CGCCCTGCTCcacacacacaca	0.366													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	39412403	39412404	+	Intron	INS	-	T	T	rs113819899		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39412403_39412404insT	uc001wun.2	-						uc001wuo.2_Intron					Homo sapiens cDNA FLJ43028 fis, clone BRTHA3000297.																		AGCAAGAATCATTTTTTTTTTT	0.386													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	44672636	44672636	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44672636delG								None (None upstream) : FSCB (300719 downstream)																							catagagtgtggaataataga	0.000													4	2	---	---	---	---	
FRMD6	122786	broad.mit.edu	37	14	52188364	52188367	+	Intron	DEL	GGAA	-	-	rs35529093		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52188364_52188367delGGAA	uc001wzd.2	+						FRMD6_uc001wzb.2_Intron|FRMD6_uc001wzc.2_Intron|FRMD6_uc001wze.2_Intron|FRMD6_uc001wzf.2_Intron|FRMD6_uc001wzg.2_Intron	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6							cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					agggagggagggaaggaaggaagg	0.064													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	55561182	55561183	+	IGR	INS	-	TTGT	TTGT	rs148866614	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55561182_55561183insTTGT								MAPK1IP1L (24270 upstream) : LGALS3 (34689 downstream)																							TGCCCATTTCCttgtttgtttg	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	55586820	55586820	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55586820delC								MAPK1IP1L (49908 upstream) : LGALS3 (9052 downstream)																							CTCACCGCAGCCTTCACTGTG	0.522													4	5	---	---	---	---	
KIAA0831	22863	broad.mit.edu	37	14	55860267	55860267	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55860267delT	uc001xbx.1	-						FBXO34_uc001xbv.2_Intron|KIAA0831_uc001xbw.1_5'Flank	NM_014924	NP_055739	Q6ZNE5	BAKOR_HUMAN	Barkor						autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0						TCTTTTCAGAttttttttttt	0.164													4	2	---	---	---	---	
DAAM1	23002	broad.mit.edu	37	14	59748243	59748245	+	Intron	DEL	GGA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59748243_59748245delGGA	uc001xdz.1	+						DAAM1_uc001xea.1_Intron|DAAM1_uc001xeb.1_Intron	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of						actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TGCTGCTGTTggaggaggaggag	0.197													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62278071	62278071	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62278071delC								SNAPC1 (14926 upstream) : SYT16 (175732 downstream)																							cactatgttgcccaggcttgt	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62372494	62372494	+	IGR	DEL	G	-	-	rs67392436		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62372494delG								SNAPC1 (109349 upstream) : SYT16 (81309 downstream)																							ttttttttttggggataaatc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	64834257	64834258	+	IGR	INS	-	A	A	rs144287464	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64834257_64834258insA								ESR2 (28989 upstream) : MTHFD1 (20501 downstream)																							gatcccatctcaaaaaaaggaa	0.000													4	2	---	---	---	---	
GALNTL1	57452	broad.mit.edu	37	14	69786803	69786804	+	Intron	INS	-	CG	CG	rs141337737	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69786803_69786804insCG	uc010aqu.1	+						GALNTL1_uc001xla.1_Intron|GALNTL1_uc001xlb.1_Intron	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		CCAGGACTCACCCCCCCAATAT	0.332													3	3	---	---	---	---	
SLC8A3	6547	broad.mit.edu	37	14	70654317	70654336	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTG	-	-	rs138734126		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70654317_70654336delTGTGTGTGTGTGTGTGTGTG	uc001xly.2	-						SLC8A3_uc001xlw.2_Intron|SLC8A3_uc001xlx.2_Intron|SLC8A3_uc001xlz.2_Intron|SLC8A3_uc010ara.2_Intron	NM_183002	NP_892114	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(2)|breast(2)	7				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GGGCTTTGACtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.409													4	3	---	---	---	---	
RBM25	58517	broad.mit.edu	37	14	73581862	73581865	+	Intron	DEL	GTGT	-	-	rs148098788		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73581862_73581865delGTGT	uc001xno.2	+						RBM25_uc010ttu.1_Intron|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25						apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		GAACTGATACgtgtgtgtgtgtgt	0.191													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76017964	76017965	+	IGR	INS	-	TT	TT	rs138805922	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76017964_76017965insTT								BATF (4637 upstream) : FLVCR2 (26975 downstream)																							ATTTAATACTCGTTTCTGCCAG	0.307													4	3	---	---	---	---	
STON2	85439	broad.mit.edu	37	14	81871648	81871648	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81871648delT	uc001xvk.1	-						STON2_uc010atc.1_Intron	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2						endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		ttttataatgttattttacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86567756	86567757	+	IGR	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86567756_86567757insG								FLRT2 (473487 upstream) : None (None downstream)																							ggagaacccctgctctcttcaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	90239138	90239141	+	IGR	DEL	TTCC	-	-	rs111947567		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90239138_90239141delTTCC								FOXN3 (153644 upstream) : C14orf143 (24330 downstream)																							ttccttccttttccttccttcctt	0.000													4	2	---	---	---	---	
KCNK13	56659	broad.mit.edu	37	14	90587406	90587409	+	Intron	DEL	TGGA	-	-	rs33945753		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90587406_90587409delTGGA	uc001xye.1	+							NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13							integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				GAGGATGATTTGGAGTCCATTGTC	0.461													3	3	---	---	---	---	
PSMC1	5700	broad.mit.edu	37	14	90720930	90720930	+	5'Flank	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90720930delT	uc001xyf.2	+						PSMC1_uc001xyg.2_5'Flank	NM_002802	NP_002793	P62191	PRS4_HUMAN	proteasome 26S ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		attttccttcttttcgccccg	0.075													4	2	---	---	---	---	
CLMN	79789	broad.mit.edu	37	14	95713450	95713451	+	Intron	INS	-	GCTCT	GCTCT	rs150846362	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95713450_95713451insGCTCT	uc001yef.2	-							NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)		TGTGGGACCCAGCAGTGTGCCA	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99320484	99320485	+	IGR	INS	-	A	A	rs140587346	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99320484_99320485insA								C14orf177 (136387 upstream) : BCL11B (315142 downstream)																							ATCCACTAGGCAAAAAAAAAAC	0.530													4	2	---	---	---	---	
DEGS2	123099	broad.mit.edu	37	14	100619218	100619219	+	Intron	INS	-	ATGG	ATGG	rs138869050	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100619218_100619219insATGG	uc001ygx.2	-							NM_206918	NP_996801	Q6QHC5	DEGS2_HUMAN	degenerative spermatocyte homolog 2, lipid						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	sphingosine hydroxylase activity				0		Melanoma(154;0.212)				cccctctTCGAATggatggatg	0.040													6	3	---	---	---	---	
WDR25	79446	broad.mit.edu	37	14	100947441	100947448	+	Intron	DEL	AAAAAAAA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100947441_100947448delAAAAAAAA	uc010avx.2	+						WDR25_uc001yhm.2_Intron|WDR25_uc001yhn.2_Intron|WDR25_uc010avy.2_Intron|WDR25_uc001yho.2_Intron	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25												0		Melanoma(154;0.212)				AAAAAAGTGCaaaaaaaaaaaaaaaaaa	0.389													4	2	---	---	---	---	
TRAF3	7187	broad.mit.edu	37	14	103339036	103339037	+	Intron	INS	-	T	T	rs148875421	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103339036_103339037insT	uc001ymc.1	+						TRAF3_uc001yme.1_Intron|TRAF3_uc001ymd.1_Intron|TRAF3_uc010txy.1_Intron	NM_145725	NP_663777	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3 isoform 1						apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		tcttctttttcttttttttttg	0.178													6	5	---	---	---	---	
KLC1	3831	broad.mit.edu	37	14	104140260	104140260	+	Intron	DEL	A	-	-	rs113413878		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104140260delA	uc001yno.2	+						KLC1_uc010tyd.1_Intron|KLC1_uc010tye.1_Intron|KLC1_uc001ynm.1_Intron|KLC1_uc001ynn.1_Intron|KLC1_uc010tyf.1_Intron|KLC1_uc001ynp.1_5'Flank|KLC1_uc001ynr.1_5'Flank|KLC1_uc010awu.1_5'Flank|KLC1_uc001ynq.1_5'Flank|KLC1_uc001yns.2_5'Flank	NM_182923	NP_891553	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 2						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				actctgtctcaaaaaaaaaaa	0.070													4	3	---	---	---	---	
TDRD9	122402	broad.mit.edu	37	14	104515456	104515457	+	Intron	DEL	TA	-	-	rs35907795		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104515456_104515457delTA	uc001yom.3	+						TDRD9_uc001yon.3_Intron	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9						cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				tgtatgtatgtatgtgtgtgtg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104650814	104650828	+	IGR	DEL	ACAGTGGCAGCAATG	-	-	rs33965997		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104650814_104650828delACAGTGGCAGCAATG								KIF26A (3580 upstream) : C14orf180 (395228 downstream)																							TGGGATGGGAACAGTGGCAGCAATGACAGTGGGAG	0.614													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	105968189	105968191	+	IGR	DEL	CTT	-	-	rs72028451		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105968189_105968191delCTT								C14orf80 (2605 upstream) : TMEM121 (24762 downstream)																							TTCTGCACTACTTCAGGGCTCCT	0.567													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20453330	20453334	+	IGR	DEL	GGAGG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20453330_20453334delGGAGG								None (None upstream) : GOLGA6L6 (283760 downstream)																							gaacgggacaggaggggaggggagg	0.020													4	2	---	---	---	---	
SNRPN	6638	broad.mit.edu	37	15	25223030	25223030	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25223030delC	uc001ywp.1	+	11	1416	c.526delC	c.(526-528)CCCfs	p.P176fs	SNRPN_uc001ywq.1_Frame_Shift_Del_p.P176fs|SNRPN_uc001ywr.1_Frame_Shift_Del_p.P176fs|SNRPN_uc001yws.1_Frame_Shift_Del_p.P176fs|SNRPN_uc001ywt.1_Frame_Shift_Del_p.P176fs|SNRPN_uc001ywv.1_Frame_Shift_Del_p.P179fs|SNRPN_uc001yww.1_Frame_Shift_Del_p.P176fs|SNRPN_uc001ywx.1_Frame_Shift_Del_p.P176fs|SNRPN_uc001ywz.1_RNA|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	176	|Repeat-rich region.				RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		GGGCACTCCGCCCCCACCCGT	0.567									Prader-Willi_syndrome				5	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30241673	30241674	+	IGR	INS	-	CTT	CTT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30241673_30241674insCTT								TJP1 (126967 upstream) : FAM7A3 (154261 downstream)																							tccaccaccaccacctccacaa	0.000													4	2	---	---	---	---	
FMN1	342184	broad.mit.edu	37	15	33153863	33153864	+	Intron	DEL	AG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33153863_33153864delAG	uc001zhf.3	-							NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1						actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CAGAACAGCAAGAGAGTCATGG	0.307													4	2	---	---	---	---	
SLC12A6	9990	broad.mit.edu	37	15	34538857	34538857	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34538857delT	uc001zhw.2	-						SLC12A6_uc001zhv.2_Intron|SLC12A6_uc001zhx.2_Intron|SLC12A6_uc001zhy.2_Intron|SLC12A6_uc001zhz.2_Intron|SLC12A6_uc001zia.2_Intron|SLC12A6_uc001zib.2_Intron|SLC12A6_uc001zic.2_Intron|SLC12A6_uc010bau.2_Intron|SLC12A6_uc001zid.2_Intron|SLC12A6_uc001zht.2_Intron|SLC12A6_uc001zhu.2_Intron	NM_133647	NP_598408	Q9UHW9	S12A6_HUMAN	solute carrier family 12, member 6 isoform a						angiogenesis|cellular hypotonic salinity response|potassium ion transport|sodium ion transport	basolateral plasma membrane|integral to membrane	potassium:chloride symporter activity			central_nervous_system(5)|ovary(1)|skin(1)	7		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	gcaggttttgttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	35947328	35947328	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35947328delT	uc001zjc.2	+											Homo sapiens, Similar to LOC161538, clone IMAGE:5199550, mRNA.																		GGCTGTCTTATTTTCCAATGA	0.318													4	2	---	---	---	---	
TGM7	116179	broad.mit.edu	37	15	43591191	43591191	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43591191delA	uc001zrf.1	-							NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7						peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	AATAGCAGCCAAAAAAAAAAG	0.279													4	2	---	---	---	---	
GNB5	10681	broad.mit.edu	37	15	52483383	52483385	+	Intron	DEL	AAC	-	-	rs148164194		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52483383_52483385delAAC	uc002abt.1	-						uc002abv.2_Intron	NM_016194	NP_057278	O14775	GBB5_HUMAN	guanine nucleotide-binding protein, beta-5							heterotrimeric G-protein complex	GTPase activity|signal transducer activity			lung(1)	1				all cancers(107;0.0163)		TCTACGGATTAACAACAACAAAA	0.296													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56057322	56057322	+	IGR	DEL	A	-	-	rs141660391		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56057322delA								PRTG (22145 upstream) : NEDD4 (61809 downstream)																							gagactgtctaaaaaaaaaag	0.149													1	7	---	---	---	---	
TCF12	6938	broad.mit.edu	37	15	57443109	57443111	+	Intron	DEL	CTT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57443109_57443111delCTT	uc002aec.2	+						TCF12_uc010ugm.1_Intron|TCF12_uc010ugn.1_Intron|TCF12_uc002aea.2_Intron|TCF12_uc010bfs.2_Intron|TCF12_uc002aeb.2_Intron|TCF12_uc002aed.2_Intron	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		tccttccttccttccttccttcc	0.034			T	TEC	extraskeletal myxoid chondrosarcoma								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	64177300	64177301	+	IGR	INS	-	G	G	rs147919504	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64177300_64177301insG								MIR422A (14082 upstream) : DAPK2 (21935 downstream)																							CCACCAGGACCGGGGGGTTGGC	0.599													1	5	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64834153	64834153	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64834153delC	uc002ann.2	+							NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TCTCTTCCTTCCCTTTCTCTT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70916408	70916408	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70916408delT								TLE3 (526152 upstream) : UACA (30487 downstream)																							ttttcttttctttttttgcga	0.000													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	71729461	71729461	+	Intron	DEL	A	-	-	rs35724794		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71729461delA	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						gtggaaggtgaagtgggagca	0.000													2	6	---	---	---	---	
LOXL1	4016	broad.mit.edu	37	15	74228369	74228370	+	Intron	DEL	AG	-	-	rs63213862		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74228369_74228370delAG	uc002awc.1	+							NM_005576	NP_005567	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1 preproprotein						protein deamination	extracellular space	copper ion binding				0						CCATGGAGTCAGGGGGTAAAAA	0.302													4	3	---	---	---	---	
PPCDC	60490	broad.mit.edu	37	15	75332543	75332543	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75332543delC	uc002azo.2	+							NM_021823	NP_068595	Q96CD2	COAC_HUMAN	phosphopantothenoylcysteine decarboxylase						coenzyme A biosynthetic process|pantothenate metabolic process	cytosol	phosphopantothenoylcysteine decarboxylase activity				0						cccaccttggcctccagagta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75367782	75367782	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75367782delA								PPCDC (24716 upstream) : C15orf39 (123451 downstream)																							gactctgtctaaaaaaaaaga	0.000													4	2	---	---	---	---	
PTPN9	5780	broad.mit.edu	37	15	75764285	75764285	+	Intron	DEL	A	-	-	rs78327695		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75764285delA	uc002bal.2	-							NM_002833	NP_002824	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding			lung(1)|skin(1)	2						ctcttgtctcaaaaaaaaaaG	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78008623	78008623	+	IGR	DEL	T	-	-	rs143048795		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78008623delT								LINGO1 (20148 upstream) : LOC645752 (197936 downstream)																							cttcttcttcttttttttttt	0.134													4	2	---	---	---	---	
DNAJA4	55466	broad.mit.edu	37	15	78562047	78562048	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78562047_78562048insT	uc002bdj.1	+						DNAJA4_uc002bdi.2_Intron|DNAJA4_uc002bdk.2_Intron|DNAJA4_uc002bdl.2_5'Flank	NM_001130182	NP_001123654	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4						protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			skin(1)	1						ctttgtagccattttttttttt	0.000													2	4	---	---	---	---	
RASGRF1	5923	broad.mit.edu	37	15	79283821	79283822	+	Intron	INS	-	GT	GT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79283821_79283822insGT	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron|RASGRF1_uc010unh.1_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						ATTCCAGAAAAGTGTGTGTGTG	0.470													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80316177	80316177	+	IGR	DEL	T	-	-	rs71701593		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80316177delT								BCL2A1 (52534 upstream) : ZFAND6 (35844 downstream)																							TGttttcttcttttttttttt	0.090													4	3	---	---	---	---	
FAH	2184	broad.mit.edu	37	15	80451570	80451570	+	Intron	DEL	A	-	-	rs112905605		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80451570delA	uc002bfj.2	+						FAH_uc002bfk.1_Intron|FAH_uc002bfm.1_Intron|FAH_uc002bfn.1_Intron|FAH_uc010unl.1_Intron|FAH_uc002bfl.1_Intron	NM_000137	NP_000128	P16930	FAAA_HUMAN	fumarylacetoacetase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	fumarylacetoacetase activity|metal ion binding				0						acagaatgggaaaaaaaaaaa	0.005									Tyrosinemia_type_1				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	83168626	83168626	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83168626delC	uc002bhl.2	+						uc002bhm.2_Intron|LOC80154_uc002bij.3_Intron|LOC80154_uc010bmj.2_Intron|LOC80154_uc010bml.2_Intron|LOC80154_uc010bmi.1_Intron|LOC80154_uc010bmk.1_Intron|LOC80154_uc002bii.3_Intron|LOC80154_uc010bmn.2_Intron|LOC80154_uc010bmm.2_Intron|LOC80154_uc010bmo.1_Intron					SubName: Full=Putative uncharacterized protein ENSP00000348917;																		tttgtgctcaccacttctatt	0.000													4	2	---	---	---	---	
FSD2	123722	broad.mit.edu	37	15	83438318	83438318	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83438318delA	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing											central_nervous_system(1)	1						gactcatctcaaaaaaaaaaa	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90520220	90520221	+	IGR	DEL	AA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90520220_90520221delAA								AP3S2 (63998 upstream) : ZNF710 (24531 downstream)																							ctcaaaaattaaaaaaaaaaaa	0.064													3	3	---	---	---	---	
NGRN	51335	broad.mit.edu	37	15	90809270	90809270	+	Intron	DEL	T	-	-	rs34851303		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90809270delT	uc002bpf.1	+						TTLL13_uc002bpe.1_Intron|NGRN_uc002bpg.1_5'UTR	NM_001033088	NP_001028260	Q9NPE2	NGRN_HUMAN	neugrin						neuron differentiation	extracellular region|nucleus				large_intestine(2)|ovary(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TCAGCTCCCCTGGGACCACTG	0.562													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91190262	91190264	+	IGR	DEL	TCC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91190262_91190264delTCC								CRTC3 (1686 upstream) : BLM (70315 downstream)																							CCCTCTACAAtcctcctcctcct	0.296													6	5	---	---	---	---	
FAM174B	400451	broad.mit.edu	37	15	93179858	93179859	+	Intron	INS	-	GGCT	GGCT	rs147368360	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93179858_93179859insGGCT	uc010boe.2	-						FAM174B_uc002bsl.3_Intron	NM_207446	NP_997329	Q3ZCQ3	F174B_HUMAN	hypothetical protein LOC400451							integral to membrane					0						CCGCGGAGATAGGCTGCATGGG	0.545													2	4	---	---	---	---	
CHD2	1106	broad.mit.edu	37	15	93477655	93477656	+	Intron	DEL	GG	-	-	rs35336221		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93477655_93477656delGG	uc002bsp.2	+						CHD2_uc002bsm.1_Intron|CHD2_uc002bsn.2_Intron|CHD2_uc002bso.1_Intron|CHD2_uc010urb.1_Intron	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			ACAGTATCTAGGGGGGACTCTG	0.356													1	6	---	---	---	---	
RGMA	56963	broad.mit.edu	37	15	93618801	93618801	+	Intron	DEL	T	-	-	rs79364327		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93618801delT	uc002bss.1	-						RGMA_uc002bsq.1_5'Flank|RGMA_uc010boi.1_5'Flank|RGMA_uc002bsr.1_5'Flank|RGMA_uc010urc.1_5'Flank	NM_020211	NP_064596	Q96B86	RGMA_HUMAN	RGM domain family, member A precursor						axon guidance	anchored to membrane|endoplasmic reticulum|plasma membrane					0	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			AGCCTGAGAATTTTTTTTTTT	0.269													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93726832	93726834	+	IGR	DEL	TTA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93726832_93726834delTTA								RGMA (94399 upstream) : None (None downstream)																							TGGAGCTACTTTAATCAGACCCA	0.271													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98440975	98440978	+	IGR	DEL	CACA	-	-	rs112551243		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98440975_98440978delCACA								LOC91948 (23316 upstream) : ARRDC4 (21806 downstream)																							cacacacactcacacacacacaca	0.034													2	4	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99480550	99480550	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99480550delC	uc002bul.2	+						IGF1R_uc010bon.2_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	CTCCCTTCCTCCCCAGTTTCA	0.259													4	2	---	---	---	---	
LRRK1	79705	broad.mit.edu	37	15	101598011	101598011	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101598011delC	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron|LRRK1_uc002bws.2_Intron	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CCAAAGGTGACCCAGATACCT	0.473													6	3	---	---	---	---	
NPRL3	8131	broad.mit.edu	37	16	173803	173803	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:173803delG	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc010uuc.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1						CTGAGAAACAGGATCACACAC	0.562													4	2	---	---	---	---	
TMEM8A	58986	broad.mit.edu	37	16	426005	426006	+	Intron	DEL	CT	-	-	rs141906733		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:426005_426006delCT	uc002cgu.3	-						TMEM8A_uc002cgv.3_Intron	NM_021259	NP_067082	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8 (five membrane-spanning						cell adhesion	integral to plasma membrane				central_nervous_system(2)|pancreas(1)	3						ACATGGGCCCCTGTCTTGGCCC	0.703													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	880161	880176	+	IGR	DEL	GCTGGGCTGCTGGGCT	-	-	rs11275697		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:880161_880176delGCTGGGCTGCTGGGCT								PRR25 (16301 upstream) : LMF1 (23459 downstream)																							GTGAGTGGACgctgggctgctgggctgctgggctgc	0.481													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1856082	1856085	+	IGR	DEL	TTTC	-	-	rs139425711		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1856082_1856085delTTTC								IGFALS (11173 upstream) : HAGH (3021 downstream)																							ttcatttctttttctttctttttt	0.000													4	5	---	---	---	---	
PRSS27	83886	broad.mit.edu	37	16	2766055	2766055	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2766055delC	uc002crf.2	-						PRSS27_uc002cre.2_5'Flank|PRSS27_uc002crg.2_Intron|PRSS27_uc010bst.1_Intron	NM_031948	NP_114154	Q9BQR3	PRS27_HUMAN	marapsin precursor						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						GGCAGACCCTCCCCAGCTGCC	0.647													4	2	---	---	---	---	
CCDC64B	146439	broad.mit.edu	37	16	3083796	3083797	+	Intron	INS	-	A	A	rs149473712	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3083796_3083797insA	uc002ctf.3	-						CCDC64B_uc002cte.3_5'Flank|CCDC64B_uc010bta.1_5'Flank	NM_001103175	NP_001096645	A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B												0						tccaaaaaaagaaaaaaaaaat	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3209664	3209664	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3209664delG								ZNF213 (16860 upstream) : OR1F1 (44583 downstream)																							ctggagtgctggagtgcagtg	0.010													4	2	---	---	---	---	
NAT15	79903	broad.mit.edu	37	16	3515372	3515379	+	Intron	DEL	TTCTGTCC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3515372_3515379delTTCTGTCC	uc002cvh.3	+						NAT15_uc010uxb.1_Intron|NAT15_uc010btk.1_Intron|NAT15_uc010btl.2_Intron|NAT15_uc010btm.2_Intron|NAT15_uc010uxc.1_Intron|NAT15_uc010uxd.1_Intron|NAT15_uc010uxe.1_Intron	NM_001083601	NP_001077070	Q9H7X0	NAT15_HUMAN	N-acetyltransferase 15								N-acetyltransferase activity				0						CGGTTTAGCGTTCTGTCCTTCTCTTGGG	0.476													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8509244	8509245	+	IGR	INS	-	AC	AC	rs145043114	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8509244_8509245insAC								A2BP1 (745904 upstream) : TMEM114 (110258 downstream)																							AGTGcacgcaaacacacacaca	0.366													4	2	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10744467	10744468	+	Intron	INS	-	G	G	rs142212421	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10744467_10744468insG	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						TCTggccaggtgggtggctcac	0.213													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	11318701	11318701	+	IGR	DEL	A	-	-	rs75188452		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11318701delA								CLEC16A (42657 upstream) : C16orf75 (24805 downstream)																							agaagtgaacaaaaaaaaaga	0.085													4	3	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12561512	12561512	+	Intron	DEL	C	-	-	rs75996327		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12561512delC	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						ttcattcattccattcactca	0.144													4	2	---	---	---	---	
SHISA9	729993	broad.mit.edu	37	16	13272183	13272184	+	Intron	INS	-	T	T	rs11442158		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13272183_13272184insT	uc010uyy.1	+							NM_001145204	NP_001138676	B4DS77	SHSA9_HUMAN	shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0						CTCTCTCTGGGTTTTTTTTTTT	0.406													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	14144022	14144023	+	IGR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14144022_14144023delAC								ERCC4 (97817 upstream) : MKL2 (21173 downstream)																							agacagacagacacacacacac	0.000													4	4	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17376817	17376818	+	Intron	INS	-	CC	CC	rs138423148	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17376817_17376818insCC	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						gcaataagtcaccccccccaag	0.059													4	2	---	---	---	---	
COQ7	10229	broad.mit.edu	37	16	19084630	19084631	+	Intron	INS	-	AAAAAAACA	AAAAAAACA	rs145418670	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19084630_19084631insAAAAAAACA	uc002dfr.2	+						COQ7_uc002dfs.2_Intron	NM_016138	NP_057222	Q99807	COQ7_HUMAN	COQ7 protein						ubiquinone biosynthetic process	mitochondrial inner membrane|nucleus	oxidoreductase activity|transition metal ion binding			skin(1)	1						gactccgtctcaaaaaaacaaa	0.000													3	3	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	20951914	20951914	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20951914delT	uc010vbe.1	-						DNAH3_uc010vbd.1_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		catgcctgccttttttttttt	0.000													6	3	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	20996186	20996186	+	Intron	DEL	A	-	-	rs142384699		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20996186delA	uc010vbe.1	-						DNAH3_uc010vbd.1_Intron	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		gactgtctttaaaaaaaaaaT	0.254													3	7	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27832613	27832613	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27832613delT	uc002doz.2	-						GSG1L_uc010bya.1_Intron|GSG1L_uc010bxz.1_Intron|GSG1L_uc002doy.2_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						atttcttgtattttttttttt	0.000													3	3	---	---	---	---	
GSG1L	146395	broad.mit.edu	37	16	27990888	27990888	+	Intron	DEL	A	-	-	rs77066595		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27990888delA	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233	Q6UXU4	GSG1L_HUMAN	GSG1-like isoform 1							integral to membrane				ovary(1)	1						agaatccatcaaaaaaaaaaa	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29007422	29007423	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29007422_29007423insT	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		atgtcctattcttttttttttt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	30930063	30930066	+	IGR	DEL	TCCT	-	-	rs112136811		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30930063_30930066delTCCT								CTF1 (15183 upstream) : NCRNA00095 (574 downstream)																							tccttcctcctccttccttcttct	0.010													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33421473	33421474	+	IGR	DEL	CT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33421473_33421474delCT								SLC6A10P (525010 upstream) : MIR1826 (544034 downstream)																							cagagtctcactctttcaccca	0.188													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33579992	33579993	+	IGR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33579992_33579993delAC								SLC6A10P (683529 upstream) : MIR1826 (385515 downstream)																							TAGCTTTATAACAGTTTTCTTT	0.302													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33917813	33917813	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33917813delA								None (None upstream) : MIR1826 (47695 downstream)																							tagaatctgcaaatggatatt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33921970	33921970	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33921970delC								None (None upstream) : MIR1826 (43538 downstream)																							accaaatatgcctggttctgt	0.000													4	3	---	---	---	---	
LONP2	83752	broad.mit.edu	37	16	48384297	48384298	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48384297_48384298insA	uc002efi.1	+						LONP2_uc002efj.1_Intron	NM_031490	NP_113678	Q86WA8	LONP2_HUMAN	peroxisomal LON protease-like						misfolded or incompletely synthesized protein catabolic process|protein targeting to peroxisome|signal peptide processing	nucleoid|peroxisomal matrix	ATP binding|ATP-dependent peptidase activity|enzyme binding|sequence-specific DNA binding|serine-type endopeptidase activity				0						aagactgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48650436	48650436	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48650436delC								N4BP1 (6316 upstream) : CBLN1 (661775 downstream)																							tgctctgttgcccaggctgga	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	48991022	48991022	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48991022delC								N4BP1 (346902 upstream) : CBLN1 (321189 downstream)																							ggcctgCAGACCAGGAGCTCA	0.239													4	2	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49804114	49804115	+	Intron	INS	-	GAAT	GAAT	rs148397608	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49804114_49804115insGAAT	uc002efs.2	-							NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				aaagaatgaacgaatgaatgaa	0.223													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54619377	54619378	+	IGR	DEL	CT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54619377_54619378delCT								IRX3 (298999 upstream) : IRX5 (345733 downstream)																							tctgtccccactctctctctct	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55383819	55383820	+	IGR	INS	-	A	A	rs113154481		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55383819_55383820insA								IRX6 (19148 upstream) : MMP2 (129261 downstream)																							GCTCACTagagaaaaaaaaaaa	0.416													3	4	---	---	---	---	
GNAO1	2775	broad.mit.edu	37	16	56266029	56266029	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56266029delA	uc002eit.3	+						GNAO1_uc002eiu.3_Intron	NM_138736	NP_620073	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				TGTCTGCTTTAAAAAAAAAAA	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	56728835	56728836	+	IGR	INS	-	T	T	rs148829214	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56728835_56728836insT								MT1X (10728 upstream) : NUP93 (35181 downstream)																							tacggactatcttttttttttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	56978624	56978624	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56978624delC								HERPUD1 (831 upstream) : CETP (17211 downstream)																							aggtgatctgcccgcctcggc	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	59292444	59292445	+	IGR	INS	-	GTCT	GTCT	rs139688187	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59292444_59292445insGTCT								GOT2 (524198 upstream) : None (None downstream)																							tccttccttccttctctttctt	0.000													8	5	---	---	---	---	
NUTF2	10204	broad.mit.edu	37	16	67889791	67889791	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67889791delG	uc002eup.2	+						NUTF2_uc010vkf.1_Intron	NM_005796	NP_005787	P61970	NTF2_HUMAN	nuclear transport factor 2						protein transport	cytosol|nuclear pore	protein binding|transporter activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		TTTTTTTGGCGGGGGGGGGGG	0.532													2	4	---	---	---	---	
PLA2G15	23659	broad.mit.edu	37	16	68285761	68285762	+	Intron	DEL	AA	-	-	rs3068687		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68285761_68285762delAA	uc002evr.2	+						PLA2G15_uc010vld.1_Intron|PLA2G15_uc010vle.1_Intron|PLA2G15_uc010vlf.1_Intron	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase A2)						fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1						agactgtctcaaaaaaaaaaaa	0.233													4	2	---	---	---	---	
CLEC18A	348174	broad.mit.edu	37	16	69988604	69988605	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69988604_69988605insT	uc010vlo.1	+						CLEC18C_uc002exy.2_Intron|CLEC18A_uc002exz.2_Intron|CLEC18A_uc002eya.2_Intron|CLEC18A_uc010vlp.1_Intron	NM_001136214	NP_001129686	A5D8T8	CL18A_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTTAGttttacttttttttttt	0.223													4	3	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70175439	70175441	+	Intron	DEL	GAA	-	-	rs72232114		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70175439_70175441delGAA	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CAGGCACAATGAAGAATCGAATG	0.414													4	2	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70177799	70177799	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70177799delT	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron|PDPR_uc002eyh.2_5'Flank|PDPR_uc010vls.1_5'Flank	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		gtcttttttcttttttttttt	0.174													8	4	---	---	---	---	
VAC14	55697	broad.mit.edu	37	16	70779743	70779743	+	Intron	DEL	G	-	-	rs67543825		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70779743delG	uc002ezm.2	-						VAC14_uc010cfw.2_Intron|VAC14_uc002ezn.2_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog						interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)|skin(1)	2		Ovarian(137;0.0699)				CTTCAGCCCTGGACCAGGGAA	0.582													3	3	---	---	---	---	
ZFHX3	463	broad.mit.edu	37	16	72998970	72998971	+	Intron	INS	-	T	T	rs146702714	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72998970_72998971insT	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				tatagatggggtttcaccatgt	0.000													4	4	---	---	---	---	
LOC283922	283922	broad.mit.edu	37	16	74397106	74397107	+	Intron	INS	-	TTT	TTT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74397106_74397107insTTT	uc002fcr.2	-						LOC283922_uc010vms.1_Intron					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						ttcctcagcaattttttttttt	0.198													5	3	---	---	---	---	
CFDP1	10428	broad.mit.edu	37	16	75464371	75464371	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75464371delT	uc002fdy.2	-						CFDP1_uc002fdz.2_Intron|CFDP1_uc002fea.1_Intron	NM_006324	NP_006315	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						multicellular organismal development					upper_aerodigestive_tract(1)	1						acctggccACttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75557021	75557022	+	IGR	INS	-	T	T	rs113228901		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75557021_75557022insT								CHST6 (28095 upstream) : CHST5 (5408 downstream)																							ATAtttgcttcttttttttttt	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	75750017	75750017	+	IGR	DEL	A	-	-	rs111346751		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75750017delA								TERF2IP (58689 upstream) : CNTNAP4 (561159 downstream)																							TCTCTGAGGGAAAAAAAaaaa	0.184													4	3	---	---	---	---	
WWOX	51741	broad.mit.edu	37	16	78522808	78522810	+	Intron	DEL	TTC	-	-	rs72008808		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78522808_78522810delTTC	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457	Q9NZC7	WWOX_HUMAN	WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TATTATTTTGTTCTTTCTGCCAT	0.379													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80989228	80989230	+	IGR	DEL	GCT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80989228_80989230delGCT								CDYL2 (151053 upstream) : C16orf61 (20471 downstream)																							accccactacgctgctgctgctg	0.000													5	3	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81505020	81505021	+	Intron	INS	-	AT	AT	rs140387392	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81505020_81505021insAT	uc002fgp.2	+							NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						tgcatacacacatacatgtaca	0.000													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81522580	81522581	+	Intron	INS	-	T	T	rs150325663	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81522580_81522581insT	uc002fgp.2	+							NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						tctttcattcattttttttttc	0.193													3	3	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81571329	81571330	+	Intron	INS	-	AAAAC	AAAAC	rs148933344	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81571329_81571330insAAAAC	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						gaaaagaaaagaaaTGCCCCAA	0.257													4	4	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81666636	81666636	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81666636delA	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						CATCCAGCGCAGGCTTTGATG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81796174	81796174	+	IGR	DEL	A	-	-	rs112193321		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81796174delA								CMIP (50809 upstream) : PLCG2 (16756 downstream)																							actccgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
CDH13	1012	broad.mit.edu	37	16	83023549	83023549	+	Intron	DEL	T	-	-	rs150159461		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83023549delT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		ATCAGTCCCATTTTTTTTTTT	0.428													4	3	---	---	---	---	
KIAA1609	57707	broad.mit.edu	37	16	84519877	84519877	+	Intron	DEL	G	-	-	rs141362605		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84519877delG	uc002fib.2	-						KIAA1609_uc010vod.1_Intron|KIAA1609_uc002fic.2_Intron	NM_020947	NP_065998	Q6P9B6	K1609_HUMAN	hypothetical protein LOC57707								protein binding			ovary(2)	2						GCGTGGCGGTGGGGGCAGGGG	0.517													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85440673	85440674	+	IGR	DEL	GC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85440673_85440674delGC								FAM92B (294559 upstream) : KIAA0182 (204355 downstream)																							TACACTCAGGGCCCCCCCGGAT	0.574													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85501803	85501803	+	IGR	DEL	T	-	-	rs67948507		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85501803delT								FAM92B (355689 upstream) : KIAA0182 (143226 downstream)																							GGGAAAGCCCTTAGAGGAACA	0.338													6	5	---	---	---	---	
IRF8	3394	broad.mit.edu	37	16	85935957	85935957	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85935957delT	uc002fjh.2	+						IRF8_uc002fji.2_5'Flank	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8						interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				tagtgttttgttagctgcatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86383154	86383155	+	IGR	INS	-	A	A	rs150722703	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86383154_86383155insA								LOC732275 (3869 upstream) : FOXF1 (160978 downstream)																							ctggacccactacctgtgatgc	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87078230	87078233	+	IGR	DEL	CTGA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87078230_87078233delCTGA								FOXL1 (462927 upstream) : FBXO31 (284711 downstream)																							CCAGAGATGCctgactaagtggca	0.093													2	4	---	---	---	---	
CDH15	1013	broad.mit.edu	37	16	89249591	89249591	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89249591delA	uc002fmt.2	+						CDH15_uc010cij.1_Intron	NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		actctatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	115994	115995	+	Intron	INS	-	GT	GT	rs143271530	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:115994_115995insGT	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		AGGCCCCAGTGgtgtgtgtgtg	0.436													3	3	---	---	---	---	
RPH3AL	9501	broad.mit.edu	37	17	182085	182086	+	Intron	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:182085_182086delGT	uc002fre.1	-						RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron|uc010cjm.1_RNA|uc002frg.2_Intron	NM_006987	NP_008918	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		GTGTGTGCGCGTGTGTGTGTAC	0.594													4	2	---	---	---	---	
NXN	64359	broad.mit.edu	37	17	830821	830821	+	Intron	DEL	A	-	-	rs71371593		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:830821delA	uc002fsa.2	-							NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		accttgtctcaaaaaaaaaaa	0.229													3	3	---	---	---	---	
NXN	64359	broad.mit.edu	37	17	852856	852856	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:852856delC	uc002fsa.2	-							NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		ctcctcctctccccgcggcct	0.000													7	5	---	---	---	---	
ABR	29	broad.mit.edu	37	17	1016225	1016226	+	Intron	INS	-	C	C	rs146272171	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1016225_1016226insC	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010cjq.1_Intron	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GCATTTGTTAACGCCTGACCCA	0.322													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	1176849	1176849	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1176849delA								ABR (86233 upstream) : TUSC5 (6108 downstream)																							CTCAGCCTGGAAATAGCAAGG	0.244													4	2	---	---	---	---	
PAFAH1B1	5048	broad.mit.edu	37	17	2559079	2559079	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2559079delA	uc002fuw.3	+						PAFAH1B1_uc010ckb.1_Intron	NM_000430	NP_000421	P43034	LIS1_HUMAN	platelet-activating factor acetylhydrolase,						acrosome assembly|actin cytoskeleton organization|adult locomotory behavior|brain morphogenesis|corpus callosum morphogenesis|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|hippocampus development|layer formation in cerebral cortex|learning or memory|lipid catabolic process|microtubule organizing center organization|mitotic prometaphase|neuroblast proliferation|neuromuscular process controlling balance|neuron migration|platelet activating factor metabolic process|regulation of Rho GTPase activity|retrograde axon cargo transport|synaptic transmission|vesicle transport along microtubule	astral microtubule|cell cortex|centrosome|cytosol|kinetochore|motile primary cilium|nuclear membrane|perinuclear region of cytoplasm	dynactin binding|heparin binding|microtubule binding|phospholipase binding|phosphoprotein binding|protein homodimerization activity			skin(1)	1						gaccgatgtgaAAAAAAAAAA	0.169													4	2	---	---	---	---	
ITGAE	3682	broad.mit.edu	37	17	3685635	3685636	+	Intron	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3685635_3685636delGT	uc002fwo.3	-							NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TAAATCTCTAgtgtgtgtgtgt	0.094													4	2	---	---	---	---	
UBE2G1	7326	broad.mit.edu	37	17	4209449	4209449	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4209449delG	uc002fxs.2	-							NM_003342	NP_003333	P62253	UB2G1_HUMAN	ubiquitin-conjugating enzyme E2G 1						protein K48-linked ubiquitination|protein K63-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						AGTATTCGGTGGGGACTCAAG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	4301044	4301044	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4301044delT								UBE2G1 (31075 upstream) : SPNS3 (36175 downstream)																							tttttctttcttttttttttt	0.000													4	2	---	---	---	---	
PLD2	5338	broad.mit.edu	37	17	4714407	4714426	+	Intron	DEL	CATTGATCTCTCTGATTTCG	-	-	rs113274766		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4714407_4714426delCATTGATCTCTCTGATTTCG	uc002fzc.2	+						PLD2_uc010vsj.1_Intron|PLD2_uc002fzd.2_Intron	NM_002663	NP_002654	O14939	PLD2_HUMAN	phospholipase D2						cell communication|cytoskeleton organization|small GTPase mediated signal transduction		NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5					Choline(DB00122)	TCTTTAACCACATTGATCTCTCTGATTTCGCGCCGACCTT	0.473													2	6	---	---	---	---	
RABEP1	9135	broad.mit.edu	37	17	5209922	5209923	+	Intron	INS	-	A	A	rs76214309		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5209922_5209923insA	uc002gbm.3	+						RABEP1_uc010clc.1_Intron|RABEP1_uc010cld.1_Intron|RABEP1_uc010vsw.1_Intron|RABEP1_uc002gbl.3_Intron|RABEP1_uc002gbj.2_Intron|RABEP1_uc002gbk.2_Intron	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1						apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						gactctgtctgaaaaaaaaaaa	0.183													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6275430	6275431	+	IGR	INS	-	AGAAG	AGAAG	rs59226853		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6275430_6275431insAGAAG								WSCD1 (247685 upstream) : AIPL1 (51629 downstream)																							aaaagaagaaagaagaagaaga	0.000													4	4	---	---	---	---	
GABARAP	11337	broad.mit.edu	37	17	7145230	7145233	+	Intron	DEL	AATC	-	-	rs75210172		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7145230_7145233delAATC	uc002gfb.2	-						PHF23_uc002gfa.2_5'Flank|PHF23_uc010vtt.1_5'Flank|PHF23_uc010cma.2_5'Flank	NM_007278	NP_009209	O95166	GBRAP_HUMAN	GABA(A) receptor-associated protein						protein targeting|synaptic transmission	autophagic vacuole membrane|Golgi membrane|microtubule|plasma membrane	beta-tubulin binding|GABA receptor binding				0						CAACTATCTTAATCAGACGGAGGT	0.480													3	6	---	---	---	---	
DULLARD	23399	broad.mit.edu	37	17	7147350	7147351	+	3'UTR	INS	-	C	C	rs147084197	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7147350_7147351insC	uc002gfd.2	-	8					GABARAP_uc002gfb.2_5'Flank|DULLARD_uc002gfe.2_3'UTR|DULLARD_uc002gff.2_3'UTR|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247	O95476	CNEP1_HUMAN	dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0						CCATCCAGACTCCAAGTGGAGT	0.614													1	9	---	---	---	---	
MPDU1	9526	broad.mit.edu	37	17	7488855	7488856	+	Intron	DEL	CA	-	-	rs140696498		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7488855_7488856delCA	uc002ghw.2	+						MPDU1_uc010vub.1_Intron|MPDU1_uc002ghx.2_Intron|MPDU1_uc010vuc.1_Intron	NM_004870	NP_004861	O75352	MPU1_HUMAN	mannose-P-dolichol utilization defect 1						dolichol-linked oligosaccharide biosynthetic process|protein folding	endoplasmic reticulum membrane|integral to membrane|mitochondrion	protein binding			central_nervous_system(1)	1						actctgtctccaaaaaaaaaaa	0.257													4	3	---	---	---	---	
DHRS7C	201140	broad.mit.edu	37	17	9683469	9683469	+	Intron	DEL	A	-	-	rs111824797		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9683469delA	uc010vvb.1	-						DHRS7C_uc010cof.2_Intron	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C							extracellular region	binding|oxidoreductase activity				0						GAAATGACTGAAAAAAAAAAA	0.413													4	2	---	---	---	---	
GAS7	8522	broad.mit.edu	37	17	10029861	10029862	+	Intron	INS	-	CA	CA	rs140315308	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10029861_10029862insCA	uc002gmg.1	-							NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						cacacaaagagcgcacacacgc	0.000			T	MLL	AML*								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	10178512	10178513	+	IGR	DEL	AG	-	-	rs10546071		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10178512_10178513delAG								GAS7 (76644 upstream) : MYH13 (25670 downstream)																							AAAGAGCGACAGGGGGTTGGAG	0.480													2	8	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11651611	11651611	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11651611delT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		gccactgcactccagtctggg	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	13908870	13908871	+	IGR	DEL	CT	-	-	rs138001089		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13908870_13908871delCT								HS3ST3A1 (403626 upstream) : CDRT15P (18944 downstream)																							GGATATGGGACTCTCTTTATTC	0.455													1	9	---	---	---	---	
ADORA2B	136	broad.mit.edu	37	17	15858315	15858316	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15858315_15858316insT	uc002gpd.1	+							NM_000676	NP_000667	P29275	AA2BR_HUMAN	adenosine A2b receptor						activation of MAPK activity|cellular defense response|excretion|JNK cascade	integral to plasma membrane				ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0855)	Defibrotide(DB04932)|Enprofylline(DB00824)|Pegademase bovine(DB00061)|Theophylline(DB00277)	gtaactcttacttttttttttc	0.000													4	2	---	---	---	---	
NCOR1	9611	broad.mit.edu	37	17	16066763	16066768	+	Intron	DEL	AACTAC	-	-	rs77358577		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16066763_16066768delAACTAC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		tgcaaatgaaaactacaactagatac	0.000													4	4	---	---	---	---	
TRIM16L	147166	broad.mit.edu	37	17	18617014	18617014	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18617014delA	uc002gug.1	+						uc002guf.2_Intron|TRIM16L_uc010vyf.1_Intron|TRIM16L_uc002guh.1_Intron|TRIM16L_uc010cqg.1_Intron	NM_001037330	NP_001032407	Q309B1	TR16L_HUMAN	tripartite motif-containing 16-like							cytoplasm					0						gagacaggagaaaacggcgag	0.169													4	2	---	---	---	---	
AKAP10	11216	broad.mit.edu	37	17	19872060	19872060	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19872060delT	uc002gwo.2	-						AKAP10_uc002gwp.1_Intron|AKAP10_uc010cqw.1_Intron|AKAP10_uc010vze.1_Intron	NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor						blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					ccatgtgatcttggacaagtt	0.095													4	2	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20774710	20774711	+	Intron	INS	-	T	T	rs141798496	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20774710_20774711insT	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						TACAGTTGGACTGGAACAGCTT	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21221283	21221291	+	IGR	DEL	CCACCCCTG	-	-	rs11278363		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21221283_21221291delCCACCCCTG								MAP2K3 (2734 upstream) : KCNJ12 (58408 downstream)																							CCCCGGGCGCCCACCCCTGCCTCCCCTGT	0.679													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21231336	21231337	+	IGR	INS	-	T	T	rs59433745		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21231336_21231337insT								MAP2K3 (12787 upstream) : KCNJ12 (48362 downstream)																							atctcttattgttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21238658	21238658	+	IGR	DEL	T	-	-	rs113708521		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21238658delT								MAP2K3 (20109 upstream) : KCNJ12 (41041 downstream)																							taaccgtcagttctctctcct	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21244088	21244089	+	IGR	INS	-	A	A	rs139026617		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21244088_21244089insA								MAP2K3 (25539 upstream) : KCNJ12 (35610 downstream)																							ACAGACAAAAGGGTTggccggg	0.094													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21250019	21250028	+	IGR	DEL	CCTTAGGCCC	-	-	rs67030450		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21250019_21250028delCCTTAGGCCC								MAP2K3 (31470 upstream) : KCNJ12 (29671 downstream)																							tgggatttaaccttaggccccctcccccca	0.324													9	5	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21309595	21309596	+	Intron	INS	-	C	C	rs144963854		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21309595_21309596insC	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	agcatgcagggcttgcacagtG	0.084										Prostate(3;0.18)			3	4	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21316859	21316860	+	Intron	INS	-	G	G	rs142216456		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21316859_21316860insG	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	AGCTCCTCCGTCGGGGCTAATG	0.653										Prostate(3;0.18)			11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21514769	21514769	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21514769delC								C17orf51 (37038 upstream) : FAM27L (310601 downstream)																							ccagtttcttcccaccctctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25279763	25279764	+	IGR	DEL	AG	-	-	rs145186341		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25279763_25279764delAG								None (None upstream) : WSB1 (341342 downstream)																							gaaaagaaaaagaaaagaaaga	0.035													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	26069101	26069102	+	IGR	DEL	AA	-	-	rs33934217		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26069101_26069102delAA								LGALS9 (92516 upstream) : NOS2 (14691 downstream)																							gctccaggggaaagaatctgtt	0.000													2	4	---	---	---	---	
PIPOX	51268	broad.mit.edu	37	17	27376413	27376413	+	Intron	DEL	A	-	-	rs11291050		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27376413delA	uc002hdr.1	+							NM_016518	NP_057602	Q9P0Z9	SOX_HUMAN	pipecolic acid oxidase						tetrahydrofolate metabolic process	peroxisome	L-pipecolate oxidase activity|sarcosine oxidase activity				0	Lung NSC(42;0.015)		Epithelial(11;9.87e-06)|BRCA - Breast invasive adenocarcinoma(11;3.92e-05)|all cancers(11;5.59e-05)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)		Glycine(DB00145)	GTCTAAGCAGAAAAAAAGAAG	0.438													4	5	---	---	---	---	
MYO18A	399687	broad.mit.edu	37	17	27467820	27467821	+	Intron	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27467820_27467821delAC	uc002hdt.1	-						MYO18A_uc002hds.2_5'Flank|MYO18A_uc010csa.1_Intron|MYO18A_uc002hdu.1_Intron|MYO18A_uc010wbd.1_5'Flank	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a						anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GTacacgtatacacacacacac	0.436													7	4	---	---	---	---	
NUFIP2	57532	broad.mit.edu	37	17	27622002	27622002	+	5'Flank	DEL	T	-	-	rs35025358		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27622002delT	uc002hdy.3	-						NUFIP2_uc002hdx.3_5'Flank	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein							nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			AGTGGGTTTGTTTTTTTTTTT	0.328													4	2	---	---	---	---	
LRRC37B	114659	broad.mit.edu	37	17	30354547	30354548	+	Intron	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30354547_30354548delTG	uc002hgu.2	+						LRRC37B_uc010wbx.1_Intron|LRRC37B_uc010csu.2_Intron	NM_052888	NP_443120	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B precursor							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				tgtgtgtgcttgtgtgtgtgtg	0.208													4	2	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31340646	31340646	+	3'UTR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31340646delA	uc002hhu.2	-	10					ACCN1_uc002hht.2_3'UTR	NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	CGCGTGGAGGAGTGTCATGTA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34228762	34228762	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34228762delA	uc010ctx.1	-											Homo sapiens cDNA FLJ43944 fis, clone TESTI4014392.																		acgccgtctcaaaaaaaaaaa	0.209													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34825862	34825865	+	IGR	DEL	ACAG	-	-	rs148707495		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34825862_34825865delACAG								TBC1D3G (17759 upstream) : ZNHIT3 (16608 downstream)																							ctgttaggatacagacaatgaccg	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35269782	35269783	+	IGR	DEL	CA	-	-	rs62072260		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35269782_35269783delCA								MRM1 (304376 upstream) : LHX1 (24716 downstream)																							CGCGCGCGCGcacacacacaca	0.460											OREG0004186	type=REGULATORY REGION|EvidenceSubtype=Dual luciferase reporter gene assay; In-vivo GFP Expression Assay	5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39130721	39130724	+	IGR	DEL	TCTT	-	-	rs12941907	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39130721_39130724delTCTT								KRT39 (7577 upstream) : KRT40 (3244 downstream)																							tttctttctctctttctttctttc	0.000													2	5	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39808265	39808266	+	Intron	INS	-	AC	AC	rs145869591	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39808265_39808266insAC	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		acaccctaccaacacacacaca	0.000													3	3	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39873741	39873741	+	Intron	DEL	A	-	-	rs113590562		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39873741delA	uc010wfs.1	-							NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		tctttcaaagaaaaaaaaaaa	0.000													5	3	---	---	---	---	
ACLY	47	broad.mit.edu	37	17	40033610	40033611	+	Intron	INS	-	A	A	rs35726439		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40033610_40033611insA	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				tggccagcctggtctcgaactt	0.005													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41441940	41441941	+	IGR	INS	-	T	T	rs11312824		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41441940_41441941insT								TMEM106A (70351 upstream) : LOC100130581 (5272 downstream)																							tttttcttttcttttttttttt	0.000													4	2	---	---	---	---	
PLCD3	113026	broad.mit.edu	37	17	43205184	43205185	+	Intron	INS	-	GT	GT	rs144234608	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43205184_43205185insGT	uc002iib.2	-							NM_133373	NP_588614	Q8N3E9	PLCD3_HUMAN	phospholipase C delta 3						intracellular signal transduction|lipid catabolic process	cleavage furrow|cytoplasm|membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			breast(2)|lung(1)	3					Phosphatidylserine(DB00144)	tgtgcgtgtgagtgtgtgtgtg	0.376													3	4	---	---	---	---	
PNPO	55163	broad.mit.edu	37	17	46021567	46021568	+	Intron	DEL	GT	-	-	rs3047638		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46021567_46021568delGT	uc002imo.2	+						PNPO_uc010wkz.1_Intron|PNPO_uc010wla.1_Intron|PNPO_uc010wlb.1_Intron	NM_018129	NP_060599	Q9NVS9	PNPO_HUMAN	pyridoxine 5'-phosphate oxidase						pyridoxine biosynthetic process	cytosol	FMN binding|pyridoxamine-phosphate oxidase activity				0					Pyridoxal Phosphate(DB00114)	actgcctttcgtgtgtgtgtgt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46564204	46564205	+	IGR	INS	-	T	T	rs76217305		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46564204_46564205insT								SKAP1 (56610 upstream) : HOXB1 (42602 downstream)																							AAACTCAAGTCTTTTTTTTTCC	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54122722	54122722	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54122722delC								PCTP (267975 upstream) : ANKFN1 (108114 downstream)																							TTTAGGGCTGCCCCAAATATG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54151043	54151043	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54151043delT								PCTP (296296 upstream) : ANKFN1 (79793 downstream)																							ctgtcttcccttcagtccctg	0.000													4	2	---	---	---	---	
TEX14	56155	broad.mit.edu	37	17	56757443	56757443	+	Intron	DEL	T	-	-	rs5821242		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56757443delT	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron|TEX14_uc010wnz.1_Intron	NM_198393	NP_938207	Q8IWB6	TEX14_HUMAN	testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)					Gtcttttttctttttttttcc	0.164													4	2	---	---	---	---	
MAP3K3	4215	broad.mit.edu	37	17	61737954	61737954	+	Intron	DEL	C	-	-	rs149386379		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61737954delC	uc002jbg.2	+						MAP3K3_uc002jbe.2_Intron|MAP3K3_uc002jbf.2_Intron|MAP3K3_uc002jbh.2_Intron|MAP3K3_uc010wpo.1_Intron|MAP3K3_uc010wpp.1_Intron	NM_002401	NP_002392	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3						MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6						ttcttcttttctttttttttt	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	64273933	64273934	+	IGR	INS	-	T	T	rs72298650		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64273933_64273934insT								APOH (48377 upstream) : PRKCA (24992 downstream)																							agagtgagaccttTTTTTTTTT	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68532150	68532151	+	IGR	INS	-	T	T	rs5821786		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68532150_68532151insT								KCNJ2 (355969 upstream) : None (None downstream)																							TATGttttgtcttttttttttt	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70582967	70582967	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70582967delA	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		ACCAATGCCTAAAAAAGCATC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71676249	71676250	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71676249_71676250delGT								SDK2 (36022 upstream) : C17orf54 (69159 downstream)																							cttgtgtgtggtgtgtgtgtgt	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71935447	71935448	+	IGR	INS	-	AC	AC	rs113615491		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71935447_71935448insAC								C17orf54 (110771 upstream) : RPL38 (264347 downstream)																							CTCTGTCCCCTacacacacaca	0.287													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72381934	72381935	+	IGR	DEL	AA	-	-	rs149470307		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72381934_72381935delAA								GPR142 (13173 upstream) : GPRC5C (45732 downstream)																							agaaagagagaaagagagaaag	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72642126	72642126	+	IGR	DEL	A	-	-	rs34327039		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72642126delA								CD300E (22325 upstream) : RAB37 (25130 downstream)																							acaccatctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
GRIN2C	2905	broad.mit.edu	37	17	72842695	72842698	+	Intron	DEL	TTGA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72842695_72842698delTTGA	uc002jlt.1	-						GRIN2C_uc010wrh.1_Intron|GRIN2C_uc002jlu.1_Intron	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C						glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	AGGCTGAACTTTGATTGGCACCAC	0.564													6	3	---	---	---	---	
SLC16A5	9121	broad.mit.edu	37	17	73088918	73088919	+	Intron	DEL	GT	-	-	rs151240825		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73088918_73088919delGT	uc002jmr.2	+						SLC16A5_uc002jms.1_Intron|SLC16A5_uc002jmt.2_Intron|SLC16A5_uc002jmu.2_Intron|SLC16A5_uc010wrt.1_5'Flank	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5						organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	gtgccactgcgtgtgtgtgtgt	0.134													6	6	---	---	---	---	
SLC16A5	9121	broad.mit.edu	37	17	73098833	73098833	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73098833delT	uc002jmr.2	+						SLC16A5_uc002jms.1_Intron|SLC16A5_uc002jmt.2_Intron|SLC16A5_uc002jmu.2_Intron|SLC16A5_uc010wrt.1_Intron	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5						organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	ttcttttttcttttttttttt	0.249													4	2	---	---	---	---	
FBF1	85302	broad.mit.edu	37	17	73934945	73934946	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73934945_73934946insA	uc002jqc.2	-						FBF1_uc010wsp.1_5'Flank|FBF1_uc002jqd.1_Intron	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1												0						gactccatctcaaaaaaaaaaa	0.158													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74955429	74955430	+	IGR	INS	-	CCTTT	CCTTT	rs148849252	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74955429_74955430insCCTTT								MGAT5B (8959 upstream) : C17orf86 (129295 downstream)																							ttctcttcttccctttcctttc	0.109													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75913657	75913659	+	IGR	DEL	GGG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75913657_75913659delGGG								FLJ45079 (33488 upstream) : TNRC6C (86659 downstream)																							ggaaggagaaggggggggaggag	0.015													6	4	---	---	---	---	
PGS1	9489	broad.mit.edu	37	17	76391133	76391133	+	Intron	DEL	T	-	-	rs35729867		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76391133delT	uc002jvm.2	+						PGS1_uc010wtt.1_Intron	NM_024419	NP_077733	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						phospholipid biosynthetic process	endoplasmic reticulum|mitochondrion	ATP binding|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity				0			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TTCCCTGCCATCTGGGCTGAA	0.617													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77019787	77019788	+	Intron	DEL	CA	-	-	rs59199190		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77019787_77019788delCA	uc002jwo.2	-						C1QTNF1_uc002jwp.2_5'Flank|C1QTNF1_uc002jwq.2_5'Flank|C1QTNF1_uc002jwr.3_5'Flank					Homo sapiens, clone IMAGE:5225774, mRNA.																		cgcgcgcgcgcacacacacaca	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78100062	78100063	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78100062_78100063insT								GAA (6384 upstream) : EIF4A3 (8956 downstream)																							ggtctgtttccttttagccatt	0.000													3	3	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79418983	79418984	+	Intron	INS	-	C	C	rs147840370	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79418983_79418984insC	uc002kaf.2	+						BAHCC1_uc002kae.2_Intron|hsa-mir-3186|MI0014229_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			AGGCCCCTGTGCCCCCCCCACC	0.723													4	2	---	---	---	---	
ASPSCR1	79058	broad.mit.edu	37	17	79942871	79942871	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79942871delC	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron|ASPSCR1_uc002kdb.1_Intron	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			tgcgtgcacacccccccacac	0.000			T	TFE3	alveolar soft part sarcoma								3	3	---	---	---	---	
CCDC57	284001	broad.mit.edu	37	17	80102462	80102462	+	Intron	DEL	A	-	-	rs71883605		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80102462delA	uc002kdx.1	-						CCDC57_uc002kdy.2_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CCACTGTGGTAAACAGGGAac	0.279													5	3	---	---	---	---	
SLC16A3	9123	broad.mit.edu	37	17	80202015	80202016	+	Intron	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80202015_80202016delCA	uc002kee.2	+						CSNK1D_uc002kef.2_Intron|CSNK1D_uc002keg.1_RNA	NM_004207	NP_004198	O15427	MOT4_HUMAN	solute carrier family 16, member 3						blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	actin cytoskeleton|integral to plasma membrane|membrane fraction|nuclear membrane	secondary active monocarboxylate transmembrane transporter activity|symporter activity			upper_aerodigestive_tract(1)|lung(1)	2	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Pyruvic acid(DB00119)	CACACACGGGCACACACACACA	0.525											OREG0024822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	80252965	80252966	+	5'Flank	INS	-	GT	GT	rs34679256		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80252965_80252966insGT	uc002kek.1	-											Homo sapiens cDNA clone IMAGE:4824158.																		gtaatgccagCgtgtgtgtgtg	0.030													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	3236646	3236646	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3236646delC								MYOM1 (16540 upstream) : MYL12A (10882 downstream)																							ggtttacatgcccaacagaca	0.000													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3508981	3508982	+	Intron	DEL	TT	-	-	rs66808659		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3508981_3508982delTT	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				CAGTTGTTGCTTTTTTTTTTTT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10590513	10590515	+	IGR	DEL	TTT	-	-	rs112110725		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10590513_10590515delTTT								NAPG (37751 upstream) : FAM38B (80345 downstream)																							catacctggcttttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11522544	11522544	+	IGR	DEL	T	-	-	rs80218447		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11522544delT								FAM38B (820565 upstream) : GNAL (166592 downstream)																							TCTTTAGGTGTTTTTTTTTTC	0.338													4	4	---	---	---	---	
MC5R	4161	broad.mit.edu	37	18	13823261	13823268	+	5'Flank	DEL	GCAACCAC	-	-	rs118161276	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13823261_13823268delGCAACCAC	uc010xaf.1	+							NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						aaccaaccaagcaaccacccacccaacg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14268158	14268159	+	IGR	INS	-	G	G	rs111674515		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14268158_14268159insG								ZNF519 (135729 upstream) : LOC284233 (69263 downstream)																							GTGGAGAGAATGGGGAGATTAT	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14323111	14323112	+	IGR	INS	-	AG	AG	rs145471953		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14323111_14323112insAG								ZNF519 (190682 upstream) : LOC284233 (14310 downstream)																							ttcagaggctcaggtagaacat	0.000													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34895016	34895016	+	Intron	DEL	T	-	-	rs5824048		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34895016delT	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						TGTCGTGTGCTTTTCAGTTCT	0.567													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	40318824	40318825	+	IGR	INS	-	G	G	rs148784938	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40318824_40318825insG								PIK3C3 (657380 upstream) : RIT2 (4368 downstream)																							ccagcacgcaaaactccaaatg	0.000													4	7	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42453070	42453071	+	Intron	DEL	AT	-	-	rs2308289		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42453070_42453071delAT	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		ACAAGAACACATAGGAAAACAT	0.401									Schinzel-Giedion_syndrome				4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46305100	46305101	+	Intron	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46305100_46305101delAC	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron|KIAA0427_uc002lde.3_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						ATGGAGTACTACACTTCATTGA	0.594											OREG0024974	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47634375	47634375	+	Intron	DEL	T	-	-	rs35171705		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47634375delT	uc002leb.2	-							NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		gcctcccaggttcaagcaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49144674	49144675	+	IGR	INS	-	GAGA	GAGA	rs149066758	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49144674_49144675insGAGA								MEX3C (420984 upstream) : DCC (721896 downstream)																							gtggtgatgatgagaggggctg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	55191919	55191920	+	IGR	DEL	GT	-	-	rs147694363	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55191919_55191920delGT								ONECUT2 (33390 upstream) : FECH (20154 downstream)																							gaggagaggagtggaggaggag	0.000													4	3	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	55792591	55792594	+	Intron	DEL	GTGT	-	-	rs147387948		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55792591_55792594delGTGT	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lha.1_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						CACCAGGAGGgtgtgtgtgtgtgt	0.147													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	58721704	58721705	+	IGR	DEL	GT	-	-	rs141112244		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58721704_58721705delGT								MC4R (681703 upstream) : CDH20 (279283 downstream)																							TGTTTTAAGAgtgtgtgtgtgt	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64311672	64311672	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64311672delT								CDH19 (40456 upstream) : DSEL (862147 downstream)																							ctctcttggattttttttttg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	74409032	74409033	+	IGR	DEL	TG	-	-	rs111334965		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74409032_74409033delTG								LOC284276 (137249 upstream) : ZNF236 (127083 downstream)																							ACTGGGGTTTtgtgtgtgtgtg	0.317													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75886068	75886071	+	IGR	DEL	TGTT	-	-	rs55709857		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75886068_75886071delTGTT								GALR1 (903974 upstream) : SALL3 (854204 downstream)																							TGTCCCTGAGTGTTTGCACATATG	0.078													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77557501	77557504	+	IGR	DEL	GTGA	-	-	rs145245115		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77557501_77557504delGTGA								CTDP1 (42994 upstream) : KCNG2 (66164 downstream)																							atgcatgtacgtgagtatgaatga	0.020													5	4	---	---	---	---	
PQLC1	80148	broad.mit.edu	37	18	77679894	77679894	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77679894delA	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		gaggagagacaggaaccgagt	0.045													4	3	---	---	---	---	
PARD6G	84552	broad.mit.edu	37	18	77926456	77926457	+	Intron	INS	-	TG	TG	rs3051500		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77926456_77926457insTG	uc002lny.2	-						LOC100130522_uc002lnx.2_Intron|LOC100130522_uc010xfn.1_Intron|LOC100130522_uc010xfo.1_Intron	NM_032510	NP_115899	Q9BYG4	PAR6G_HUMAN	PAR-6 gamma protein						cell cycle|cell division|tight junction assembly	cytosol|tight junction	protein binding				0		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		CAAATTAtgtttgtgtgtgtgt	0.188													3	3	---	---	---	---	
THEG	51298	broad.mit.edu	37	19	364516	364516	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:364516delA	uc002lol.2	-						THEG_uc002lom.2_Intron	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1						cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ccccatctctaaaaaaaaaaa	0.264													4	2	---	---	---	---	
HCN2	610	broad.mit.edu	37	19	602101	602105	+	Intron	DEL	CCTCT	-	-	rs112732996		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:602101_602105delCCTCT	uc002lpe.2	+							NM_001194	NP_001185	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic						cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACTTCCTcccctctcctcctgcgt	0.341													4	2	---	---	---	---	
HMHA1	23526	broad.mit.edu	37	19	1081462	1081463	+	Intron	INS	-	G	G	rs140438432	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1081462_1081463insG	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron|HMHA1_uc002lrc.1_Intron|HMHA1_uc002lrd.1_5'Flank|HMHA1_uc010dsd.1_5'Flank	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCTGTGAGCGCCCCGGGGAG	0.728													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	1192378	1192379	+	IGR	INS	-	TG	TG	rs138277481		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1192378_1192379insTG								SBNO2 (18096 upstream) : STK11 (13419 downstream)																							tgtttttgtttttttttttctt	0.094													4	3	---	---	---	---	
STK11	6794	broad.mit.edu	37	19	1226933	1226933	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1226933delG	uc002lrl.1	+							NM_000455	NP_000446	Q15831	STK11_HUMAN	serine/threonine protein kinase 11						anoikis|cell cycle arrest|energy reserve metabolic process|insulin receptor signaling pathway|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(174)|cervix(35)|skin(15)|large_intestine(12)|pancreas(6)|gastrointestinal_tract_(site_indeterminate)(5)|stomach(4)|ovary(4)|breast(2)|upper_aerodigestive_tract(1)|testis(1)|liver(1)|biliary_tract(1)|small_intestine(1)|urinary_tract(1)|oesophagus(1)|prostate(1)|kidney(1)	266		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCTCAGAGTGGGTGCATTCC	0.692		14	D|Mis|N|F|S		NSCLC|pancreatic	jejunal harmartoma|ovarian|testicular|pancreatic			Peutz-Jeghers_syndrome	TSP Lung(3;<1E-08)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	1671894	1671895	+	IGR	INS	-	TGCCTTTT	TGCCTTTT	rs142088846	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1671894_1671895insTGCCTTTT								TCF3 (19568 upstream) : ONECUT3 (81767 downstream)																							TTCACCATTGGTGCCTTTTCCT	0.649											OREG0025122	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
SPPL2B	56928	broad.mit.edu	37	19	2336834	2336835	+	Intron	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2336834_2336835delGT	uc002lvs.2	+						SPPL2B_uc010dsw.1_Intron|SPPL2B_uc010dsy.1_Intron|SPPL2B_uc010dsz.1_Intron|SPPL2B_uc002lvr.2_Intron|SPPL2B_uc010dta.1_5'Flank|SPPL2B_uc002lvu.2_5'Flank	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ggctatgtgcgtgtgtgtgtgt	0.084													4	3	---	---	---	---	
ATCAY	85300	broad.mit.edu	37	19	3898175	3898175	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3898175delT	uc002lyy.3	+						ATCAY_uc010xhz.1_Intron	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin						transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		taaacatctcttttttttttc	0.000													4	2	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4209113	4209114	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4209113_4209114insT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		Gtttttttgtgttttttttccc	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5987573	5987573	+	IGR	DEL	C	-	-	rs56064819		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5987573delC								RANBP3 (9253 upstream) : RFX2 (5603 downstream)																							ATCAAAACAACTCCAGGAAAA	0.517											OREG0025190	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6209706	6209709	+	IGR	DEL	CCAT	-	-	rs10530972		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6209706_6209709delCCAT								ACSBG2 (16594 upstream) : MLLT1 (684 downstream)																							Gtccatccaaccatccatccatcc	0.221													5	3	---	---	---	---	
ACER1	125981	broad.mit.edu	37	19	6326685	6326685	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6326685delC	uc002mel.2	-							NM_133492	NP_597999	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1							endoplasmic reticulum membrane|integral to membrane	ceramidase activity				0						CTCAAGCTAACCATGGGGCTG	0.542													4	2	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153065	7153066	+	Intron	DEL	CA	-	-	rs113402674		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153065_7153066delCA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacacccccccacacacacaca	0.054													3	12	---	---	---	---	
PNPLA6	10908	broad.mit.edu	37	19	7608700	7608701	+	Intron	DEL	TT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7608700_7608701delTT	uc010xjq.1	+						PNPLA6_uc002mgq.1_Intron|PNPLA6_uc010xjp.1_Intron|PNPLA6_uc002mgr.1_Intron|PNPLA6_uc002mgs.2_Intron	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b						cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						cttttttttctttttttttttt	0.193													4	2	---	---	---	---	
FCER2	2208	broad.mit.edu	37	19	7764364	7764368	+	Intron	DEL	TTTTT	-	-	rs74174902		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7764364_7764368delTTTTT	uc002mhn.2	-						FCER2_uc010xjs.1_Intron|FCER2_uc010xjt.1_Intron|FCER2_uc002mhm.2_Intron|FCER2_uc010dvo.2_Intron	NM_002002	NP_001993	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor						positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0						GCTGAAGCCGttttttttttttttt	0.444													6	4	---	---	---	---	
UBL5	59286	broad.mit.edu	37	19	9940172	9940173	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9940172_9940173insT	uc002mmi.1	+						FBXL12_uc002mmh.2_5'Flank|UBL5_uc002mmj.1_Intron	NM_001048241	NP_001041706	Q9BZL1	UBL5_HUMAN	ubiquitin-like 5							cytoplasm					0						GGAACAGAAACttttttttttt	0.030													5	3	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10077733	10077734	+	Intron	INS	-	CG	CG	rs150786566	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10077733_10077734insCG	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			ggcgccagtatagacagagaca	0.267													5	3	---	---	---	---	
PDE4A	5141	broad.mit.edu	37	19	10556521	10556521	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10556521delT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	CACCCCCACCttttttttttt	0.159													5	3	---	---	---	---	
ILF3	3609	broad.mit.edu	37	19	10770895	10770896	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10770895_10770896insT	uc002mpn.2	+						ILF3_uc002mpm.2_Intron|ILF3_uc002mpl.2_Intron|ILF3_uc002mpk.2_Intron|ILF3_uc010xli.1_Intron|ILF3_uc002mpo.2_Intron	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a						M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			TAATGTTTttcttttttttttc	0.173													4	2	---	---	---	---	
JUNB	3726	broad.mit.edu	37	19	12899989	12899990	+	5'Flank	DEL	GA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12899989_12899990delGA	uc002mvc.2	+						JUNB_uc002mvb.2_5'Flank	NM_002229	NP_002220	P17275	JUNB_HUMAN	jun B proto-oncogene							chromatin|nucleus	protein dimerization activity|transcription coactivator activity|transcription corepressor activity			lung(2)|central_nervous_system(1)	3						CTGGGAAGCTgagagagagaga	0.376													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13408646	13408646	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13408646delT	uc010dze.2	-						CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	aCATACAGCAttttttttttt	0.020													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13729547	13729548	+	IGR	DEL	AG	-	-	rs112163024		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13729547_13729548delAG								CACNA1A (112273 upstream) : CCDC130 (113026 downstream)																							agacagagacagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14392131	14392132	+	IGR	DEL	TC	-	-	rs149353385		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14392131_14392132delTC								LPHN1 (75134 upstream) : CD97 (100081 downstream)																							ttccttcctttctctttctttc	0.000													4	7	---	---	---	---	
CD97	976	broad.mit.edu	37	19	14495432	14495442	+	Intron	DEL	CCGTTCCCCTG	-	-	rs67810293		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14495432_14495442delCCGTTCCCCTG	uc002myl.2	+						CD97_uc002mym.2_Intron|CD97_uc002myn.2_Intron	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor						cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						CCAACGCCCTCCGTTCCCCTGCCCTTCCCCT	0.455													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14619895	14619895	+	IGR	DEL	T	-	-	rs36039204		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14619895delT								GIPC1 (12951 upstream) : DNAJB1 (5687 downstream)																							tattctttccttttttttttt	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14620707	14620708	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14620707_14620708insT								GIPC1 (13763 upstream) : DNAJB1 (4874 downstream)																							CGtttcttctgttttttttttt	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15666487	15666487	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15666487delT								CYP4F22 (3360 upstream) : CYP4F8 (59542 downstream)																							aaaacaaaaCTTTTTTTTttg	0.005													2	4	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16628260	16628261	+	Intron	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16628260_16628261delAC	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						GGGGTGATGGACACACACACAC	0.579													7	4	---	---	---	---	
CPAMD8	27151	broad.mit.edu	37	19	17051275	17051275	+	Intron	DEL	G	-	-	rs11364574		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17051275delG	uc002nfb.2	-							NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain							extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						tctctaagatgggggttaaag	0.139													2	4	---	---	---	---	
B3GNT3	10331	broad.mit.edu	37	19	17907227	17907228	+	Intron	INS	-	AA	AA	rs151028154	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17907227_17907228insAA	uc002nhk.1	+						B3GNT3_uc002nhl.1_Intron|B3GNT3_uc010ebd.1_Intron|B3GNT3_uc010ebe.1_Intron	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal						protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						GGACACTTCTCAAGAGGAAACT	0.351													2	4	---	---	---	---	
ARRDC2	27106	broad.mit.edu	37	19	18111475	18111476	+	5'Flank	INS	-	GGAA	GGAA	rs141584055	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18111475_18111476insGGAA	uc002nhu.2	+							NM_001025604	NP_001020775	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 2											pancreas(1)	1						agaggaaggagggaaggaagga	0.223													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	19859182	19859191	+	5'Flank	DEL	TGGCCAGGCC	-	-	rs116345387	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19859182_19859191delTGGCCAGGCC	uc002nnn.1	-						uc002nno.1_5'Flank|uc002nnq.1_5'Flank					DQ595898																		TGGCCAGGGATGGCCAGGCCTGGCCTGTAG	0.605													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24062478	24062484	+	IGR	DEL	AAAAAGA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24062478_24062484delAAAAAGA								RPSAP58 (51561 upstream) : ZNF254 (153763 downstream)																							gagaaaggagaaaaagaaAAAAGAAAA	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27739119	27739119	+	IGR	DEL	C	-	-	rs75788788		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27739119delC								None (None upstream) : LOC148189 (542283 downstream)																							ctctgtttgtcaagtctgcat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28336717	28336718	+	IGR	INS	-	A	A	rs145412796	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28336717_28336718insA								LOC148189 (51869 upstream) : None (None downstream)																							ctacagagggcaaaaaaaagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30352224	30352224	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30352224delG								CCNE1 (37006 upstream) : C19orf2 (62327 downstream)																							ttttgtttttgtttttttttt	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31393406	31393407	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31393406_31393407delGT								ZNF536 (344441 upstream) : DKFZp566F0947 (247376 downstream)																							GGTGGATAGAGTGTGTGTGTGT	0.317													5	3	---	---	---	---	
SLC7A9	11136	broad.mit.edu	37	19	33346131	33346132	+	Intron	INS	-	TA	TA			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33346131_33346132insTA	uc002ntv.3	-						SLC7A9_uc002ntt.3_Intron|SLC7A9_uc002ntu.3_Intron|SLC7A9_uc002ntw.3_Intron	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	atgatctcccttatgtattatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34530573	34530574	+	IGR	INS	-	T	T	rs66758244		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34530573_34530574insT								KCTD15 (223908 upstream) : LSM14A (132778 downstream)																							CCTTGCTTGAAttttttttttt	0.307													4	5	---	---	---	---	
MLL4	9757	broad.mit.edu	37	19	36212906	36212906	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36212906delT	uc010eei.2	+							NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4						chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTAtcttccttttttttttt	0.274													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37548334	37548337	+	IGR	DEL	TGTC	-	-	rs142377558		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37548334_37548337delTGTC								ZNF568 (59500 upstream) : ZNF420 (21045 downstream)																							cactgctgtatgtCTGTGTGTGTG	0.123													7	5	---	---	---	---	
CATSPERG	57828	broad.mit.edu	37	19	38848155	38848156	+	Intron	INS	-	AAAA	AAAA	rs145684392		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38848155_38848156insAAAA	uc002oih.3	+						CATSPERG_uc002oig.3_Intron|CATSPERG_uc002oif.3_Intron|CATSPERG_uc010efw.2_Intron	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						gacccggtctcaaaaaaaaaaa	0.015													2	4	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40763494	40763497	+	Intron	DEL	ACAC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40763494_40763497delACAC	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			atgcacacaaacacacacacacac	0.216			A		ovarian|pancreatic 								4	3	---	---	---	---	
PSG9	5678	broad.mit.edu	37	19	43773896	43773899	+	5'Flank	DEL	ACAC	-	-	rs72297875		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43773896_43773899delACAC	uc002owd.3	-						PSG9_uc002owe.3_5'Flank|PSG9_uc010xwm.1_5'Flank|PSG9_uc002owf.3_5'Flank|PSG9_uc002owg.2_5'Flank|PSG9_uc002owh.2_5'Flank	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				CTTTGTGcagacacacacacacac	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45222185	45222186	+	IGR	DEL	AA	-	-	rs113598502		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45222185_45222186delAA								CEACAM16 (8201 upstream) : BCL3 (29792 downstream)																							ggagagagagaaaaaaaaaaaa	0.198													10	6	---	---	---	---	
RELB	5971	broad.mit.edu	37	19	45503839	45503840	+	5'Flank	INS	-	T	T	rs35012703		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45503839_45503840insT	uc002paj.1	+							NM_006509	NP_006500	Q01201	RELB_HUMAN	reticuloendotheliosis viral oncogene homolog B							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		atccaataaacttttttttttt	0.183													3	3	---	---	---	---	
ZNF296	162979	broad.mit.edu	37	19	45576027	45576028	+	Intron	INS	-	AGGCTTTGTGTTTGA	AGGCTTTGTGTTTGA	rs138758931	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45576027_45576028insAGGCTTTGTGTTTGA	uc002pao.2	-							NM_145288	NP_660331	Q8WUU4	ZN296_HUMAN	zinc finger protein 296						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTAAGTACCTGAAAACAttttt	0.277													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47804021	47804025	+	IGR	DEL	TTTTC	-	-	rs35129203		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47804021_47804025delTTTTC								PRR24 (25042 upstream) : C5AR1 (9079 downstream)																							TGTCTTGTCTttttcttttcttttc	0.068													3	4	---	---	---	---	
GLTSCR2	29997	broad.mit.edu	37	19	48265463	48265464	+	Intron	INS	-	ACAAA	ACAAA	rs142882605	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48265463_48265464insACAAA	uc010elk.1	+									Q9NZM5	GSCR2_HUMAN	Homo sapiens HSPC271 mRNA, partial cds.							nucleolus				central_nervous_system(1)	1		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		tcaaaaacaagacaaaacaaaa	0.109													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48317641	48317641	+	IGR	DEL	C	-	-	rs34243674		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48317641delC								TPRX1 (10780 upstream) : CRX (7458 downstream)																							GTTTATTATgcgctgtggctc	0.025													5	4	---	---	---	---	
KDELR1	10945	broad.mit.edu	37	19	48893549	48893549	+	Intron	DEL	C	-	-	rs36034010		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48893549delC	uc002pjb.1	-						KDELR1_uc002pja.1_Intron	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum						intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		agagtccaggcccccggcccc	0.000													7	5	---	---	---	---	
FAM83E	54854	broad.mit.edu	37	19	49114380	49114381	+	Intron	INS	-	CA	CA	rs148463984	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49114380_49114381insCA	uc002pjn.2	-							NM_017708	NP_060178	Q2M2I3	FA83E_HUMAN	hypothetical protein LOC54854											ovary(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		taatcataaatCATGTTTGCTT	0.050													4	2	---	---	---	---	
DHDH	27294	broad.mit.edu	37	19	49446643	49446643	+	Intron	DEL	A	-	-	rs144533245		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49446643delA	uc002ple.1	+							NM_014475	NP_055290	Q9UQ10	DHDH_HUMAN	dimeric dihydrodiol dehydrogenase						carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		TTGTTGCTAGAAAAAAAAAAA	0.279													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49837377	49837378	+	Intron	INS	-	T	T	rs142104686	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49837377_49837378insT	uc002pnb.1	-						CD37_uc002pnc.2_5'Flank|CD37_uc010yam.1_5'Flank|CD37_uc010yan.1_5'Flank|CD37_uc002pnf.3_5'Flank|CD37_uc002pnd.2_5'Flank|CD37_uc002pne.2_5'Flank					SubName: Full=cDNA FLJ40032 fis, clone STOMA2009256;																		CAGCACCTGGGTGCTCCCTGGT	0.564													1	5	---	---	---	---	
CD37	951	broad.mit.edu	37	19	49840723	49840723	+	Intron	DEL	A	-	-	rs111968087		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49840723delA	uc002pnd.2	+						uc002pnb.1_Intron|CD37_uc002pnc.2_Intron|CD37_uc010yam.1_Intron|CD37_uc010yan.1_Intron|CD37_uc002pnf.3_Intron|CD37_uc002pne.2_Intron	NM_001774	NP_001765	P11049	CD37_HUMAN	CD37 antigen isoform A							integral to membrane					0		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		atctatatttaaaaaaaaaat	0.000													2	5	---	---	---	---	
SLC17A7	57030	broad.mit.edu	37	19	49947383	49947384	+	5'Flank	INS	-	CTT	CTT	rs138140864	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49947383_49947384insCTT	uc002pnp.2	-						uc002pnr.1_RNA	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7						glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		ttccttcattccttctttctct	0.119													5	3	---	---	---	---	
LRRC4B	94030	broad.mit.edu	37	19	51069835	51069836	+	Intron	INS	-	T	T	rs141646660	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51069835_51069836insT	uc002pss.2	-							NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor							cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		aggcgaaggggtggaggggtgg	0.297													6	4	---	---	---	---	
KLK7	5650	broad.mit.edu	37	19	51484625	51484625	+	Intron	DEL	A	-	-	rs149100794		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51484625delA	uc002puo.2	-						KLK7_uc002pup.2_Intron|KLK7_uc010yco.1_Intron|KLK7_uc010eok.2_Intron	NM_139277	NP_644806	P49862	KLK7_HUMAN	stratum corneum chymotryptic enzyme						epidermis development|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		acccagagagagggggacaga	0.000													9	4	---	---	---	---	
KLK11	11012	broad.mit.edu	37	19	51525823	51525824	+	Frame_Shift_Ins	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51525823_51525824insG	uc002pvd.1	-	6	938_939	c.826_827insC	c.(826-828)CAGfs	p.Q276fs	KLK10_uc002puy.2_5'Flank|KLK10_uc002puz.2_5'Flank|KLK10_uc002pva.2_5'Flank|KLK11_uc002pvb.1_Frame_Shift_Ins_p.Q269fs|KLK11_uc002pve.1_Frame_Shift_Ins_p.Q133fs|KLK11_uc002pvf.1_Frame_Shift_Ins_p.Q244fs|KLK11_uc002pvc.3_Frame_Shift_Ins_p.Q244fs	NM_144947	NP_659196	Q9UBX7	KLK11_HUMAN	kallikrein 11 isoform 2 precursor	276	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|GBM - Glioblastoma multiforme(134;0.00878)		CATCGTCTCCTGGATCCAGTCC	0.500													114	54	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	52102233	52102234	+	IGR	DEL	GA	-	-	rs142978762		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52102233_52102234delGA								ZNF175 (9243 upstream) : SIGLEC5 (12548 downstream)																							TCATCTTAGtgagagatgaagc	0.262													7	12	---	---	---	---	
FPR2	2358	broad.mit.edu	37	19	52265045	52265045	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52265045delT	uc002pxr.2	+						FPR2_uc002pxs.3_Intron|FPR2_uc010epf.2_5'Flank	NM_001005738	NP_001005738	P25090	FPR2_HUMAN	formyl peptide receptor-like 1						cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4						aaactctaactcaaagataaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55023716	55023717	+	IGR	DEL	CT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55023716_55023717delCT								LAIR2 (1821 upstream) : KIR3DX1 (20192 downstream)																							ATTCTCCCTGCTCTCTCTGTGT	0.441													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55515159	55515159	+	IGR	DEL	A	-	-	rs36004374		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55515159delA								NLRP2 (2656 upstream) : GP6 (9918 downstream)																							GAAGGTTGGTAAAAAGAGAGG	0.204													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56051292	56051293	+	IGR	DEL	GT	-	-	rs147055621		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56051292_56051293delGT								SBK2 (3631 upstream) : ZNF579 (37599 downstream)																							gtgcgagtgcgtgtgtgtccat	0.139													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57247762	57247762	+	Intron	DEL	C	-	-	rs138710502		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57247762delC	uc010ygp.1	+											Homo sapiens cDNA clone IMAGE:4793694.																		cccctcttggcctggtgtgcc	0.010													3	3	---	---	---	---	
ZNF544	27300	broad.mit.edu	37	19	58747869	58747869	+	Intron	DEL	A	-	-	rs35110851		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58747869delA	uc010euo.2	+						ZNF544_uc010eun.1_Intron|ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Intron|ZNF544_uc010yhy.1_Intron|ZNF544_uc002qrt.3_Intron|ZNF544_uc002qru.3_Intron|ZNF544_uc002qrv.2_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		actgtgtctcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2625968	2625970	+	IGR	DEL	GAG	-	-	rs72005009		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2625968_2625970delGAG								TMC2 (3538 upstream) : NOP56 (7284 downstream)																							tgagtaggctgaggaggaggagg	0.000													2	4	---	---	---	---	
C20orf27	54976	broad.mit.edu	37	20	3741983	3741984	+	Intron	INS	-	T	T	rs11480104		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3741983_3741984insT	uc002wji.1	-						C20orf27_uc002wjf.1_Intron|C20orf27_uc002wjh.1_Intron	NM_001039140	NP_001034229	Q9GZN8	CT027_HUMAN	hypothetical protein LOC54976												0						TATGGtttttgttttttttttt	0.114													3	3	---	---	---	---	
PANK2	80025	broad.mit.edu	37	20	3880118	3880119	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3880118_3880119insT	uc002wkc.2	+						PANK2_uc002wkb.2_Intron|PANK2_uc010gbd.1_Intron|PANK2_uc002wkd.2_Intron|PANK2_uc002wke.2_Intron|PANK2_uc002wkf.2_Intron	NM_153638	NP_705902	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2 isoform 1 preproprotein						cell death|coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial intermembrane space|nucleus	ATP binding|pantothenate kinase activity|protein binding				0						acatccggcTGTTTTTTTTTTT	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4572622	4572623	+	IGR	INS	-	A	A	rs145589248	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4572622_4572623insA								ADRA1D (342963 upstream) : PRNP (94174 downstream)																							AAAGGGGTGCTAGGAATTCCAG	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16597523	16597523	+	IGR	DEL	A	-	-	rs66642197		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16597523delA								KIF16B (43445 upstream) : SNRPB2 (113106 downstream)																							aaagagaaggaaagaggtttg	0.000													4	2	---	---	---	---	
BFSP1	631	broad.mit.edu	37	20	17548507	17548507	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17548507delA	uc010zro.1	-						DSTN_uc002wpq.2_5'Flank|DSTN_uc002wpr.2_5'Flank	NM_001161705	NP_001155177	Q12934	BFSP1_HUMAN	filensin isoform 2							cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1						actcagtctcaaaaaaaaaaa	0.189													4	2	---	---	---	---	
OVOL2	58495	broad.mit.edu	37	20	18018564	18018565	+	Intron	INS	-	A	A	rs72533979	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18018564_18018565insA	uc002wqi.1	-							NM_021220	NP_067043	Q9BRP0	OVOL2_HUMAN	zinc finger protein 339						negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1						atccttgtgtcgcgtctgcttc	0.030													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24223529	24223530	+	IGR	DEL	CA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24223529_24223530delCA								GGTLC1 (254113 upstream) : TMEM90B (226305 downstream)																							TCCCCTCATGcacacacacaca	0.218													4	2	---	---	---	---	
TMEM90B	79953	broad.mit.edu	37	20	24642132	24642133	+	Intron	INS	-	AAA	AAA	rs147180862	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24642132_24642133insAAA	uc002wtw.1	+							NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						aagaagggagggagggaagagg	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26117513	26117514	+	IGR	INS	-	GGTGGT	GGTGGT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26117513_26117514insGGTGGT								C20orf191 (22836 upstream) : MIR663 (71308 downstream)																							gactttgaaaagggggaagttt	0.000													6	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29628390	29628390	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628390delT	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ACTGTATCTCTTTAAAATGTT	0.303													9	6	---	---	---	---	
DEFB123	245936	broad.mit.edu	37	20	30025864	30025865	+	5'Flank	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30025864_30025865insT	uc002wvy.2	+							NM_153324	NP_697019	Q8N688	DB123_HUMAN	defensin, beta 123 precursor						defense response to bacterium	extracellular region					0	Lung NSC(7;0.000139)|all_lung(7;0.000197)|all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			tactttttttcttttttttttt	0.000													4	3	---	---	---	---	
DNMT3B	1789	broad.mit.edu	37	20	31366171	31366171	+	Intron	DEL	A	-	-	rs33960116		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31366171delA	uc002wyc.2	+						DNMT3B_uc010ztx.1_Intron|DNMT3B_uc010zty.1_Intron|DNMT3B_uc002wyd.2_Intron|DNMT3B_uc002wye.2_Intron|DNMT3B_uc010gee.2_Intron|DNMT3B_uc010gef.2_Intron|DNMT3B_uc010ztz.1_Intron|DNMT3B_uc010zua.1_Intron|DNMT3B_uc002wyf.2_5'Flank	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						actctgtctcaaaaaaaaaaa	0.214													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36828030	36828031	+	IGR	DEL	AA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36828030_36828031delAA								TGM2 (34330 upstream) : KIAA1755 (10876 downstream)																							actttgtctcaaaaaaaaaaaa	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37677899	37677899	+	IGR	DEL	A	-	-	rs73622057		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37677899delA								DHX35 (9536 upstream) : LOC339568 (164525 downstream)																							gctacctgataaccaggatgc	0.100													2	7	---	---	---	---	
L3MBTL	26013	broad.mit.edu	37	20	42178371	42178372	+	3'UTR	DEL	TG	-	-	rs72174034		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42178371_42178372delTG	uc002xkn.1	+	15					SGK2_uc002xkq.1_Intron	NM_032107	NP_115479	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform II						chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			tgtgtgtgcatgtgtgtgtgtg	0.416													2	4	---	---	---	---	
JPH2	57158	broad.mit.edu	37	20	42745917	42745918	+	Intron	INS	-	A	A	rs140058795	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42745917_42745918insA	uc002xli.1	-							NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			gactccgtctcaaaaaaaacaa	0.223													8	5	---	---	---	---	
RIMS4	140730	broad.mit.edu	37	20	43435722	43435725	+	Intron	DEL	ACAC	-	-	rs5841571		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43435722_43435725delACAC	uc002xms.2	-						RIMS4_uc010ggu.2_Intron	NM_182970	NP_892015	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)				GGGCAACAAAACACACACACAAAA	0.377													2	4	---	---	---	---	
CDH22	64405	broad.mit.edu	37	20	44854928	44854928	+	Intron	DEL	C	-	-	rs71793463		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44854928delC	uc002xrm.2	-						CDH22_uc010ghk.1_Intron	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				tcttcttcttcttcttttttt	0.000													9	4	---	---	---	---	
ZMYND8	23613	broad.mit.edu	37	20	45842585	45842585	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45842585delT	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xsr.1_Intron	NM_012408	NP_036540	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			CCCTGCACTATTTTATTCTCT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46499401	46499401	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46499401delT								SULF2 (84041 upstream) : LOC284749 (489253 downstream)																							AAGCAGACACTTTTTTTTTTT	0.343													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47033712	47033712	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47033712delT								LOC284749 (34331 upstream) : PREX1 (207081 downstream)																							ATTCCATGCATTTTTTTTTCT	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47078507	47078508	+	IGR	INS	-	GGATG	GGATG			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47078507_47078508insGGATG								LOC284749 (79126 upstream) : PREX1 (162285 downstream)																							tgggatgggatggatgggatgg	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48193875	48193875	+	IGR	DEL	A	-	-	rs111802608		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48193875delA								PTGIS (9168 upstream) : B4GALT5 (55610 downstream)																							aagtagaaagaaaaaaaaata	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48875029	48875030	+	IGR	INS	-	TA	TA	rs11474325		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48875029_48875030insTA								CEBPB (65817 upstream) : PTPN1 (251861 downstream)																							gtgtgtgtctgtgtgtgtgtgt	0.450													4	2	---	---	---	---	
NFATC2	4773	broad.mit.edu	37	20	50153437	50153438	+	Intron	INS	-	AC	AC	rs147837422	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50153437_50153438insAC	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					GCAAGCACCAAacacacacaca	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55198250	55198250	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55198250delC								C20orf107 (86676 upstream) : TFAP2C (6108 downstream)																							CACCTCCCCTCCCCCAACCCC	0.443													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56174944	56174945	+	IGR	DEL	TT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56174944_56174945delTT								PCK1 (33437 upstream) : ZBP1 (3959 downstream)																							TTTTGTTTTGTTTTTTTTTTTT	0.381													4	2	---	---	---	---	
PMEPA1	56937	broad.mit.edu	37	20	56257714	56257715	+	Intron	INS	-	AA	AA	rs142650246	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56257714_56257715insAA	uc002xyq.2	-						PMEPA1_uc002xyr.2_Intron|PMEPA1_uc002xys.2_Intron|PMEPA1_uc002xyt.2_Intron	NM_020182	NP_064567	Q969W9	PMEPA_HUMAN	transmembrane prostate androgen-induced protein						androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1						GTTTTTGATTTAAAAAAAATCC	0.545													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58925215	58925216	+	Intron	INS	-	AC	AC	rs138825466	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58925215_58925216insAC	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		GTATACATGTAACACGTTATTA	0.297													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59950943	59950945	+	Intron	DEL	TGG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59950943_59950945delTGG	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			gtggtggtgatggtgtggtttgt	0.020													6	3	---	---	---	---	
TAF4	6874	broad.mit.edu	37	20	60557484	60557484	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60557484delA	uc002ybs.2	-							NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			AGGAGACACCAAAACCCACAC	0.552													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	60662724	60662725	+	IGR	INS	-	GCACAC	GCACAC	rs138111603	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60662724_60662725insGCACAC								TAF4 (21858 upstream) : LSM14B (34792 downstream)																							tacgctcacctgcacacgcaca	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61171542	61171543	+	IGR	DEL	GA	-	-	rs113234886		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61171542_61171543delGA								C20orf166 (3572 upstream) : SLCO4A1 (102254 downstream)																							aggagagagggagagagagaga	0.020													3	3	---	---	---	---	
NKAIN4	128414	broad.mit.edu	37	20	61874138	61874139	+	Intron	INS	-	G	G	rs147746767	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61874138_61874139insG	uc002yek.2	-							NM_152864	NP_690603	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4							integral to membrane|plasma membrane					0	all_cancers(38;2.72e-09)					CCTGGGGGGACGGGGGGGGTGG	0.673													8	4	---	---	---	---	
RTEL1	51750	broad.mit.edu	37	20	62288728	62288729	+	5'Flank	DEL	AC	-	-	rs3834652		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62288728_62288729delAC	uc002yfu.1	+						RTEL1_uc011abc.1_5'Flank|RTEL1_uc002yft.1_5'Flank|RTEL1_uc011abd.1_5'Flank|RTEL1_uc002yfv.2_5'Flank|RTEL1_uc011abe.1_5'Flank|RTEL1_uc002yfw.2_5'Flank	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			ttgggtggagacacagagccga	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9576271	9576271	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9576271delC								None (None upstream) : None (None downstream)																							ggccCCAGGACACACAGCTTT	0.259													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9879509	9879512	+	IGR	DEL	TTGT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9879509_9879512delTTGT								None (None upstream) : None (None downstream)																							cgcggcgcggttgttttttttttt	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10498158	10498158	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10498158delG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		CCATTTTGCTGGGGCAAAGTG	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10597942	10597942	+	5'Flank	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10597942delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		cgcagaaagattccccagggc	0.000													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10701885	10701885	+	IGR	DEL	C	-	-	rs71254025		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10701885delC								None (None upstream) : TPTE (204858 downstream)																							ttgaacctttcttttcattga	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10714560	10714560	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10714560delT								None (None upstream) : TPTE (192183 downstream)																							atacatttcctttttaaccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10891635	10891635	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10891635delA								None (None upstream) : TPTE (15108 downstream)																							gctggagtgcagtggcacaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10894837	10894838	+	IGR	INS	-	TTC	TTC	rs149040382	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10894837_10894838insTTC								None (None upstream) : TPTE (11905 downstream)																							tcctctttcttttttttctttt	0.020													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11022862	11022862	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11022862delC	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		actgcaagctctgtctcccag	0.015													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11065757	11065758	+	Intron	INS	-	TA	TA			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11065757_11065758insTA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaatatctagtatcctggatat	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11125315	11125315	+	IGR	DEL	A	-	-	rs151067982		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11125315delA								BAGE (26378 upstream) : None (None downstream)																							aaaggatcagaaaaaaataac	0.000													6	3	---	---	---	---	
C21orf99	149992	broad.mit.edu	37	21	14439852	14439853	+	Intron	INS	-	T	T	rs111888945		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14439852_14439853insT	uc002yja.3	+							NR_026916				Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						tcttgatctcctgacctcgtga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14889042	14889043	+	IGR	INS	-	T	T	rs149548459		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14889042_14889043insT								C21orf99 (398473 upstream) : POTED (93455 downstream)																							gtggggaaatattttttttcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15223830	15223830	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15223830delA								C21orf15 (3145 upstream) : C21orf81 (92266 downstream)																							cctcactgacaaagtcccaac	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15427195	15427195	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15427195delG	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																		gggcatggcaggaagtgccag	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	25487030	25487031	+	IGR	INS	-	ATGAACAG	ATGAACAG	rs146601317	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25487030_25487031insATGAACAG								None (None upstream) : None (None downstream)																							acaaagcaaaaatgagatcatc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	33416325	33416326	+	IGR	DEL	GT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33416325_33416326delGT								HUNK (39949 upstream) : NCRNA00159 (36303 downstream)																							gtacacatgagtgtgtgtgcac	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	35676775	35676775	+	IGR	DEL	A	-	-	rs112729135		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35676775delA								C21orf82 (114555 upstream) : KCNE2 (59548 downstream)																							acaggttcataaaaaaaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40415127	40415128	+	IGR	DEL	AC	-	-	rs113616325		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40415127_40415128delAC								ETS2 (218251 upstream) : PSMG1 (132262 downstream)																							acaagcacgtacacacacacac	0.079													3	3	---	---	---	---	
B3GALT5	10317	broad.mit.edu	37	21	40939916	40939916	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40939916delA	uc002yyb.1	+							NM_033173	NP_149363	Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta						protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)				cttccaccttaaaaaaaaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42919488	42919488	+	IGR	DEL	T	-	-	rs71885442		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42919488delT								TMPRSS2 (16445 upstream) : NCRNA00111 (179974 downstream)																							agtaactggcttttttttttt	0.045													4	2	---	---	---	---	
PRDM15	63977	broad.mit.edu	37	21	43227442	43227442	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43227442delC	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						accactacctccaccaccatc	0.154													4	2	---	---	---	---	
ABCG1	9619	broad.mit.edu	37	21	43671653	43671654	+	Intron	INS	-	GAG	GAG	rs77858173		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43671653_43671654insGAG	uc002zaq.2	+						ABCG1_uc002zan.2_Intron|ABCG1_uc002zam.2_Intron|ABCG1_uc002zao.2_Intron|ABCG1_uc002zap.2_Intron|ABCG1_uc002zar.2_Intron|ABCG1_uc011aev.1_Intron	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1						amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	AAGGTTGGGATGATAGGGTGGT	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46760567	46760570	+	IGR	DEL	ATCC	-	-	rs12627741		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46760567_46760570delATCC								LOC642852 (43299 upstream) : COL18A1 (64527 downstream)																							ccatccatctatccatccatccat	0.010													4	2	---	---	---	---	
PCBP3	54039	broad.mit.edu	37	21	47313498	47313498	+	Intron	DEL	C	-	-	rs57075620		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47313498delC	uc002zhq.1	+						PCBP3_uc010gqb.2_Intron|PCBP3_uc002zhp.1_Intron|PCBP3_uc010gqc.1_Intron|PCBP3_uc002zhs.1_Intron|PCBP3_uc002zhr.1_Intron|PCBP3_uc002zht.1_5'Flank	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		AGTGGGGAGGCAGGTGAGGGC	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47510679	47510681	+	IGR	DEL	GTG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47510679_47510681delGTG								COL6A1 (85716 upstream) : COL6A2 (7352 downstream)																							gggtgatggtgtggtggtggtga	0.000													5	3	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47520602	47520603	+	Intron	INS	-	A	A	rs144550726	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47520602_47520603insA	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		tcacgtggcttaatgtcctcca	0.000													0	6	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47530690	47530691	+	Intron	INS	-	G	G	rs138728139	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47530690_47530691insG	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GCGGAGCCAGCAGCACAGTGAG	0.644													3	3	---	---	---	---	
LSS	4047	broad.mit.edu	37	21	47638246	47638247	+	Intron	INS	-	AAGACACTGGTTA	AAGACACTGGTTA	rs144034674	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47638246_47638247insAAGACACTGGTTA	uc002zij.2	-						LSS_uc011afv.1_Intron|LSS_uc002zil.2_Intron|LSS_uc002zik.2_Intron	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1						cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					TAAAATGTTACAAGACACCACA	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16407346	16407346	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16407346delC								POTEH (119409 upstream) : OR11H1 (41480 downstream)																							ttgctcttgtcccccccaggc	0.080													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17044089	17044089	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17044089delG								OR11H1 (594285 upstream) : CCT8L2 (27559 downstream)																							aagccagccagccagccaagc	0.000													5	6	---	---	---	---	
BID	637	broad.mit.edu	37	22	18235437	18235438	+	Intron	INS	-	TT	TT	rs150636512		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18235437_18235438insTT	uc002znd.1	-						BID_uc002znc.1_Intron|BID_uc002zne.1_Intron|BID_uc010gra.1_Intron|BID_uc002znf.1_Intron|BID_uc010grb.1_Intron|BID_uc010grc.1_Intron	NM_001196	NP_001187	P55957	BID_HUMAN	BH3 interacting domain death agonist isoform 2						activation of pro-apoptotic gene products|establishment of protein localization in membrane|induction of apoptosis by intracellular signals|induction of apoptosis via death domain receptors|neuron apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|release of cytochrome c from mitochondria	cytosol|membrane fraction|mitochondrial outer membrane	death receptor binding				0		all_epithelial(15;0.198)		Lung(27;0.0419)		CCAATGGGACAttttttttttt	0.238													3	3	---	---	---	---	
DGCR5	26220	broad.mit.edu	37	22	18997856	18997856	+	Intron	DEL	T	-	-	rs71653301		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18997856delT	uc002zon.1	+						uc002zoo.2_Intron					Homo sapiens mRNA for KIAA1647 protein, partial cds.												0						ggctgaatgattttttttttt	0.000													3	3	---	---	---	---	
LOC400891	400891	broad.mit.edu	37	22	21401383	21401383	+	Intron	DEL	A	-	-	rs111961814		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21401383delA	uc011ahz.1	+						P2RX6P_uc002zuf.1_5'Flank|LOC400891_uc002zug.2_Intron|LOC400891_uc002zuh.2_Intron					Homo sapiens cDNA FLJ46805 fis, clone TRACH3033535.												0						gtctgtctcgaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	22000621	22000621	+	IGR	DEL	C	-	-	rs138337151		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22000621delC								SDF2L1 (2034 upstream) : MIR301B (6649 downstream)																							CCCTGGGCATCCCCCTGTCCA	0.463													9	4	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	23260278	23260278	+	Intron	DEL	C	-	-	rs61196692		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23260278delC	uc011aim.1	+						uc011aix.1_5'Flank					Parts of antibodies, mostly variable regions.												0						GGTTGGGGGGCGGGGTGGCCT	0.612													5	3	---	---	---	---	
RAB36	9609	broad.mit.edu	37	22	23499442	23499442	+	Intron	DEL	T	-	-	rs113088083		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23499442delT	uc002zwv.1	+						RAB36_uc010gtw.1_Intron	NM_004914	NP_004905	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		GACTAACAGGttttttttttt	0.254													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23842658	23842659	+	IGR	INS	-	GT	GT	rs149310011	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23842658_23842659insGT								ZDHHC8P1 (97859 upstream) : IGLL1 (72656 downstream)																							AGCCCTGGGTGGGGAGAGGGAA	0.347													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	24099880	24099881	+	IGR	DEL	AG	-	-	rs113186766		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24099880_24099881delAG								VPREB3 (3250 upstream) : C22orf15 (5327 downstream)																							ttcttgagacagagtcttgctc	0.000													4	4	---	---	---	---	
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	aaaaaaaaaaaaTCTTTCCTCC	0.277													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	25181862	25181863	+	IGR	INS	-	T	T	rs72559625	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25181862_25181863insT								PIWIL3 (11179 upstream) : SGSM1 (20273 downstream)																							AGCCAGTGTTAGTTCCCCTCAT	0.465													3	3	---	---	---	---	
CRYBB2	1415	broad.mit.edu	37	22	25627289	25627293	+	Intron	DEL	CAGTA	-	-	rs144589013		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25627289_25627293delCAGTA	uc003abp.1	+							NM_000496	NP_000487	P43320	CRBB2_HUMAN	crystallin, beta B2						response to stimulus|visual perception		structural constituent of eye lens				0						GCTCTGACCCcagtacagtacagta	0.293													2	4	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26696123	26696123	+	Intron	DEL	T	-	-	rs35878349		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26696123delT	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						cctttgcccatttttttttaa	0.000													2	4	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26709538	26709539	+	Intron	DEL	AC	-	-	rs68081834		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26709538_26709539delAC	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						TTTAATCATTacacacacacac	0.401													11	5	---	---	---	---	
TPST2	8459	broad.mit.edu	37	22	26935570	26935570	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26935570delA	uc003acv.2	-						TPST2_uc003acw.2_Intron|TPST2_uc003acx.2_Intron	NM_003595	NP_003586	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2						peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1						ctctactaggaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	27045876	27045876	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27045876delA								CRYBA4 (19241 upstream) : MIAT (7608 downstream)																							actccgtctcaaaaaaaaaag	0.000													4	2	---	---	---	---	
KREMEN1	83999	broad.mit.edu	37	22	29516013	29516014	+	Intron	DEL	AG	-	-	rs58137014		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29516013_29516014delAG	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						tgaaggaaacagagggaggaag	0.000													4	3	---	---	---	---	
EMID1	129080	broad.mit.edu	37	22	29626326	29626326	+	Intron	DEL	A	-	-	rs67366588		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29626326delA	uc003aen.2	+						EMID1_uc003aem.2_Intron|EMID1_uc003aeo.2_Intron|EMID1_uc003aep.2_Intron	NM_133455	NP_597712	Q96A84	EMID1_HUMAN	EMI domain containing 1							collagen					0						tccatcttggaaaaaaaaaaa	0.015													4	2	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31218698	31218698	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31218698delT	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Splice_Site_p.D27_splice	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						TTAAGAAGGGTTAGTGCTTGC	0.662													4	2	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31226873	31226873	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31226873delA	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						ATTGAGATCCAAAAAAAAAAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	31431692	31431693	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31431692_31431693insA								TUG1 (56315 upstream) : SMTN (45612 downstream)																							ggctccatctcaaaaaaaaaaa	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32306043	32306043	+	IGR	DEL	A	-	-	rs75398081		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32306043delA								DEPDC5 (3043 upstream) : C22orf24 (23465 downstream)																							accttatctcaaaaaaaaaaG	0.204													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32308807	32308807	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32308807delT								DEPDC5 (5807 upstream) : C22orf24 (20701 downstream)																							CTCTGTGCTCttttttttttt	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32683447	32683448	+	IGR	INS	-	TAAAAG	TAAAAG	rs148361258	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32683447_32683448insTAAAAG								SLC5A4 (32129 upstream) : RFPL3 (67424 downstream)																							ttctctccgtttaaaagtgttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32781138	32781138	+	IGR	DEL	T	-	-	rs10556832		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32781138delT								RFPL3S (14075 upstream) : C22orf28 (2424 downstream)																							gcccagctaattttttttttt	0.000													6	3	---	---	---	---	
TIMP3	7078	broad.mit.edu	37	22	33257378	33257379	+	3'UTR	INS	-	AGA	AGA	rs141714786	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33257378_33257379insAGA	uc003anb.2	+	5					SYN3_uc003amx.2_Intron|SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_000362	NP_000353	P35625	TIMP3_HUMAN	tissue inhibitor of metalloproteinase 3						negative regulation of membrane protein ectodomain proteolysis|visual perception		metal ion binding|metalloendopeptidase inhibitor activity|protein binding			lung(1)	1						GCAGTGTGAGCAGAAGCTGATG	0.500													5	5	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34223649	34223649	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34223649delG	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				CATCACATCAGGGCTGTTCTT	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34333698	34333699	+	IGR	DEL	TG	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34333698_34333699delTG								LARGE (15114 upstream) : None (None downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34405710	34405710	+	IGR	DEL	T	-	-	rs67940210		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34405710delT								LARGE (87126 upstream) : None (None downstream)																							ttatatgcacttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35864174	35864175	+	IGR	INS	-	T	T	rs68091092		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35864174_35864175insT								MCM5 (43680 upstream) : RASD2 (73177 downstream)																							AGCGAACTCCATTTTTTTTTTT	0.550													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36029788	36029789	+	Intron	DEL	GT	-	-	rs143831981		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36029788_36029789delGT	uc010gwt.1	-											Homo sapiens hypothetical gene supported by BC001801, mRNA (cDNA clone MGC:3170 IMAGE:3355513), complete cds.																		gcgtgtgtgcgtgtgtgttagt	0.000													3	3	---	---	---	---	
ELFN2	114794	broad.mit.edu	37	22	37808317	37808317	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37808317delA	uc003asq.3	-							NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62							cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)					actccgtctcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39584923	39584923	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39584923delA								CBX7 (36385 upstream) : PDGFB (34764 downstream)																							aaaaaaagttaaaaaaaaaAA	0.209													4	2	---	---	---	---	
MKL1	57591	broad.mit.edu	37	22	40951733	40951733	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40951733delT	uc003ayw.1	-						MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron|MKL1_uc003ayy.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						ctccacctcctgcattcacgc	0.010			T	RBM15	acute megakaryocytic leukemia								4	2	---	---	---	---	
XPNPEP3	63929	broad.mit.edu	37	22	41344279	41344280	+	Intron	DEL	TG	-	-	rs148060687	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41344279_41344280delTG	uc011aoy.1	+							NM_022098		Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0						tacctgaGACTGtttttttttt	0.015													4	3	---	---	---	---	
TEF	7008	broad.mit.edu	37	22	41770718	41770718	+	Intron	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41770718delA	uc003azx.2	+							NM_001145398	NP_001138870	Q10587	TEF_HUMAN	thyrotrophic embryonic factor isoform 2						rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						aaactgtctcaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	41952021	41952021	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41952021delT								POLR3H (11542 upstream) : CSDC2 (4993 downstream)																							cttccctgccttttttttttt	0.219													5	3	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42227807	42227807	+	Intron	DEL	T	-	-	rs146695720		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42227807delT	uc011ape.1	+						LOC339674_uc003bba.1_Intron|SREBF2_uc003bbi.2_5'Flank	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						ggatttctgattttttttttt	0.010													2	4	---	---	---	---	
TCF20	6942	broad.mit.edu	37	22	42586465	42586466	+	Intron	INS	-	AC	AC	rs146423039	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42586465_42586466insAC	uc003bcj.1	-						TCF20_uc003bck.1_Intron|TCF20_uc003bnt.2_Intron	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						gaccttgACTGacacacacaca	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	43188356	43188356	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43188356delG								A4GALT (71070 upstream) : ARFGAP3 (4176 downstream)																							AGGGAACAAAGGGGGCAGCGT	0.622													14	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	43560310	43560319	+	IGR	DEL	ACACACACAC	-	-	rs10522794		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43560310_43560319delACACACACAC								TSPO (1063 upstream) : TTLL12 (2310 downstream)																							TGcacgcacaacacacacacacacacacac	0.224													5	3	---	---	---	---	
MPPED1	758	broad.mit.edu	37	22	43895504	43895506	+	Intron	DEL	TGA	-	-	rs148284187	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43895504_43895506delTGA	uc011apv.1	+						MPPED1_uc011apw.1_Intron|MPPED1_uc011apx.1_Intron|MPPED1_uc011apy.1_Intron|MPPED1_uc011apz.1_Intron	NM_001044370	NP_001037835	O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1								hydrolase activity				0		all_neural(38;0.0244)|Ovarian(80;0.0694)				atggtggtggtgatgatggtgga	0.000													2	9	---	---	---	---	
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45208244	45208245	+	Intron	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45208244_45208245insT	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						tttgctttctgttttttttttt	0.277													6	3	---	---	---	---	
PHF21B	112885	broad.mit.edu	37	22	45279924	45279925	+	Intron	INS	-	CAT	CAT	rs142141866	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45279924_45279925insCAT	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		gtgatcagcaccaccaccacca	0.005													6	5	---	---	---	---	
PHF21B	112885	broad.mit.edu	37	22	45345729	45345730	+	Intron	INS	-	T	T	rs138706875	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45345729_45345730insT	uc003bfn.2	-						PHF21B_uc003bfm.2_Intron|PHF21B_uc011aqk.1_Intron|PHF21B_uc011aql.1_Intron|PHF21B_uc011aqm.1_Intron	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1								zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		agttcaggtgattttttcggca	0.000													4	2	---	---	---	---	
C22orf9	23313	broad.mit.edu	37	22	45606131	45606132	+	Intron	DEL	GA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45606131_45606132delGA	uc003bfx.1	-						C22orf9_uc003bfv.1_Intron|C22orf9_uc003bfw.1_Intron|C22orf9_uc010gzx.2_Intron	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b								protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		AGCAGAAGCTGAGAGGCCACAG	0.599													3	5	---	---	---	---	
C22orf9	23313	broad.mit.edu	37	22	45636356	45636356	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45636356delG	uc003bfx.1	-							NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b								protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		CAGGGACGGTGGGGGGGGGGC	0.682													3	4	---	---	---	---	
TBC1D22A	25771	broad.mit.edu	37	22	47194936	47194937	+	Intron	INS	-	T	T	rs144774350	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47194936_47194937insT	uc003bib.2	+						TBC1D22A_uc010haf.2_Intron|TBC1D22A_uc003bic.2_Intron|TBC1D22A_uc003bie.2_Intron|TBC1D22A_uc003bid.2_Intron|TBC1D22A_uc010hag.2_Intron|TBC1D22A_uc003bif.2_Intron	NM_014346	NP_055161	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A							intracellular	protein homodimerization activity|Rab GTPase activator activity			ovary(1)	1		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		CCTTATGTTTGTTTTTTTTTGA	0.500											OREG0026659	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48260397	48260398	+	IGR	INS	-	A	A	rs111880307		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48260397_48260398insA								TBC1D22A (690675 upstream) : FAM19A5 (624890 downstream)																							ctctgtctcagaaaaaaaaaaa	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	48766703	48766704	+	IGR	INS	-	AT	AT	rs143328407	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48766703_48766704insAT								None (None upstream) : FAM19A5 (118584 downstream)																							GCCAGTCTTAGATTTCCTGGAA	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49155394	49155395	+	IGR	INS	-	AC	AC	rs148382589	by1000genomes	TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49155394_49155395insAC								FAM19A5 (7652 upstream) : C22orf34 (652781 downstream)																							accacacacatacacacacaca	0.000													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49344890	49344890	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49344890delT								FAM19A5 (197148 upstream) : C22orf34 (463286 downstream)																							ccagcctcacttccctctcca	0.065													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49347512	49347513	+	IGR	INS	-	G	G			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49347512_49347513insG								FAM19A5 (199770 upstream) : C22orf34 (460663 downstream)																							aaaaaaaaaaaaagaaaggaag	0.000													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50776601	50776603	+	IGR	DEL	GGT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50776601_50776603delGGT								FAM116B (11112 upstream) : SAPS2 (5157 downstream)																							cgatgtgtgaggtgtgtgtgtgc	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50933289	50933290	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50933289_50933290insA								MIOX (4539 upstream) : LMF2 (8086 downstream)																							gactctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1786258	1786258	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1786258delT								ASMT (24285 upstream) : DHRSX (351299 downstream)																							tggacagatcttttggggatc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1854387	1854388	+	IGR	INS	-	CT	CT			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1854387_1854388insCT								ASMT (92414 upstream) : DHRSX (283169 downstream)																							tctccctcctctttctccctcc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6451611	6451614	+	IGR	DEL	CCCT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451611_6451614delCCCT								NLGN4X (304905 upstream) : VCX3A (46 downstream)																							acctcttcccccctccctccctcc	0.181													5	3	---	---	---	---	
FRMPD4	9758	broad.mit.edu	37	X	12164483	12164484	+	Intron	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12164483_12164484insA	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						gactctgtctcaaaaaaaaaaa	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	30814999	30815003	+	IGR	DEL	TGCCT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30814999_30815003delTGCCT								GK (66275 upstream) : TAB3 (30557 downstream)																							ctttgctttgtgccttgccttgcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	30819599	30819605	+	IGR	DEL	TTTCCCT	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30819599_30819605delTTTCCCT								GK (70875 upstream) : TAB3 (25955 downstream)																							ccttgccttgtttccctccttgctttg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	34399945	34399945	+	IGR	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34399945delG								FAM47A (249517 upstream) : TMEM47 (245238 downstream)																							tttgttttttgcctttacctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	39610583	39610586	+	IGR	DEL	ACAC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39610583_39610586delACAC								MID1IP1 (944802 upstream) : BCOR (299915 downstream)																							acgcacacatacacacacacacac	0.382													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	47154932	47154932	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47154932delT								USP11 (47206 upstream) : ZNF157 (75067 downstream)																							CACAGCAGCATTTTTTTTGAT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48145858	48145858	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48145858delA								SSX1 (18979 upstream) : SSX3 (60005 downstream)																							gtctccatataaaaaaaaaaa	0.000													4	2	---	---	---	---	
HDAC6	10013	broad.mit.edu	37	X	48679625	48679625	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48679625delT	uc011mmi.1	+						HDAC6_uc004dks.1_Intron|HDAC6_uc010nig.1_Intron|HDAC6_uc004dkt.1_Intron|HDAC6_uc011mmk.1_Intron|HDAC6_uc004dkv.1_Intron|HDAC6_uc004dkw.1_Intron|HDAC6_uc004dkx.1_Intron	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	tttctttttcttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53557408	53557408	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53557408delT								HSD17B10 (96085 upstream) : HUWE1 (1664 downstream)																							GTTCCAATACttttttttttt	0.114													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61727148	61727149	+	IGR	INS	-	A	A	rs113272963		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61727148_61727149insA								None (None upstream) : SPIN4 (839959 downstream)																							gcagataccacaaaagactgtt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	64414976	64414976	+	IGR	DEL	T	-	-	rs113764687		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64414976delT								ZC4H2 (160383 upstream) : ZC3H12B (293730 downstream)																							tcattgggtcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	68004998	68004998	+	IGR	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68004998delA								STARD8 (59321 upstream) : EFNB1 (43842 downstream)																							AGGACTATTTAAAAAAAAAAA	0.348													4	2	---	---	---	---	
FOXO4	4303	broad.mit.edu	37	X	70314214	70314214	+	5'Flank	DEL	A	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70314214delA	uc004dys.1	+						FOXO4_uc010nkz.2_5'Flank|FOXO4_uc004dyt.1_5'Flank	NM_005938	NP_005929	P98177	FOXO4_HUMAN	forkhead box O4						cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			central_nervous_system(2)|prostate(1)	3	Renal(35;0.156)					ggaaagaaagaaagaaggaag	0.085													4	2	---	---	---	---	
ZDHHC15	158866	broad.mit.edu	37	X	74743332	74743333	+	5'UTR	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74743332_74743333delAC	uc004ecg.2	-	1					ZDHHC15_uc004ech.2_5'UTR|ZDHHC15_uc011mqo.1_RNA|ZDHHC15_uc004eci.2_5'UTR	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1							integral to membrane	zinc ion binding			ovary(2)	2						CCCCACAGTTacacacacacac	0.218													5	3	---	---	---	---	
CENPI	2491	broad.mit.edu	37	X	100356526	100356526	+	Intron	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100356526delT	uc004egx.2	+						CENPI_uc011mrg.1_Intron|CENPI_uc004egy.2_Intron	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						cctttTTTTCTTTTTTTTTTT	0.095													4	2	---	---	---	---	
IL1RAPL2	26280	broad.mit.edu	37	X	104478546	104478547	+	Frame_Shift_Ins	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104478546_104478547insA	uc004elz.1	+	4	1157_1158	c.401_402insA	c.(400-402)GCAfs	p.A134fs		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	134	Extracellular (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						TTGACTGTTGCAGAGAATGAAT	0.396													47	87	---	---	---	---	
IL1RAPL2	26280	broad.mit.edu	37	X	104856806	104856806	+	Intron	DEL	G	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104856806delG	uc004elz.1	+							NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						ctttgctagaggggaatcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	106260834	106260835	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106260834_106260835insA								MORC4 (17392 upstream) : RBM41 (46815 downstream)																							ctccacctcataaaaaaaaaaa	0.168													4	2	---	---	---	---	
TSC22D3	1831	broad.mit.edu	37	X	106958419	106958419	+	Intron	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106958419delC	uc004eng.2	-						TSC22D3_uc004enf.2_Intron|TSC22D3_uc004enh.2_Intron|TSC22D3_uc004eni.2_Intron|TSC22D3_uc004enj.2_Intron	NM_004089	NP_004080	Q99576	T22D3_HUMAN	TSC22 domain family, member 3 isoform 2								sequence-specific DNA binding transcription factor activity				0						CAAATCTTAACCAAGAGAATA	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	118645129	118645129	+	IGR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118645129delC								SLC25A5 (39837 upstream) : CXorf56 (28372 downstream)																							GGGTTCAACTCCCGACTATTT	0.483													4	2	---	---	---	---	
SEPT6	23157	broad.mit.edu	37	X	118764855	118764856	+	Intron	INS	-	A	A	rs112337408		TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118764855_118764856insA	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						ctctgtctcggaaaaaaaaaaa	0.134													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	129468191	129468192	+	IGR	INS	-	A	A			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129468191_129468192insA								ZNF280C (65318 upstream) : SLC25A14 (5718 downstream)																							aatgaaaaattaaaaaaaaaaC	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	130042865	130042865	+	IGR	DEL	T	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130042865delT								ENOX2 (5657 upstream) : ARHGAP36 (149351 downstream)																							TGTTGCAGGGTTTTAGGCCAA	0.448													4	2	---	---	---	---	
ARHGAP36	158763	broad.mit.edu	37	X	130194388	130194389	+	Intron	DEL	AC	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130194388_130194389delAC	uc004evz.2	+						ARHGAP36_uc004ewa.2_Intron	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						aaagccacgaacacacacacac	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	148092285	148092286	+	IGR	DEL	GA	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148092285_148092286delGA								AFF2 (10093 upstream) : IDS (468011 downstream)																							acagggaagggagagagagaga	0.277													3	3	---	---	---	---	
F8	2157	broad.mit.edu	37	X	154065707	154065707	+	3'UTR	DEL	C	-	-			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154065707delC	uc004fmt.2	-	26					F8_uc004fms.2_3'UTR	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor						acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	ACCCTCCTGGCCCCCCACCAA	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59008746	59008747	+	IGR	INS	-	T	T			TCGA-18-3408-01A-01D-0983-08	TCGA-18-3408-11A-01D-0983-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59008746_59008747insT								None (None upstream) : None (None downstream)																							tgccaacagactttaaagcata	0.000													5	4	---	---	---	---	
