Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
C1orf94	84970	broad.mit.edu	37	1	34663136	34663136	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34663136C>G	uc001bxs.3	+	2	460	c.61C>G	c.(61-63)CTG>GTG	p.L21V	C1orf94_uc001bxt.2_Missense_Mutation_p.L211V	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN	hypothetical protein LOC84970 isoform b	21							protein binding				0		Myeloproliferative disorder(586;0.0393)				CACAGACATTCTGTGTGCCGC	0.557													28	109	---	---	---	---	PASS
ZMYM1	79830	broad.mit.edu	37	1	35579681	35579681	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35579681G>T	uc001bym.2	+	11	2398	c.2250G>T	c.(2248-2250)TTG>TTT	p.L750F	ZMYM1_uc001byn.2_Missense_Mutation_p.L750F|ZMYM1_uc010ohu.1_Missense_Mutation_p.L731F|ZMYM1_uc001byo.2_Missense_Mutation_p.L390F|ZMYM1_uc009vut.2_Missense_Mutation_p.L675F	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	750						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CACACTTTTTGGATTTATCAA	0.303													18	80	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39788297	39788297	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39788297G>A	uc010ois.1	+	33	4267	c.4062G>A	c.(4060-4062)CTG>CTA	p.L1354L	MACF1_uc001cda.1_Silent_p.L1262L|MACF1_uc001cdc.1_Silent_p.L441L|MACF1_uc009vvq.1_Silent_p.L411L|MACF1_uc001cdb.1_Silent_p.L441L	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1354					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATTGCAACTGATGACATACA	0.428													24	162	---	---	---	---	PASS
INADL	10207	broad.mit.edu	37	1	62228771	62228771	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62228771A>G	uc001dab.2	+	3	223	c.109A>G	c.(109-111)ATG>GTG	p.M37V	INADL_uc009waf.1_Missense_Mutation_p.M37V|INADL_uc001daa.2_Missense_Mutation_p.M37V	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	37	L27.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						GAAGTTATCTATGTTTTATGA	0.438													37	84	---	---	---	---	PASS
ASB17	127247	broad.mit.edu	37	1	76387993	76387993	+	Silent	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76387993G>T	uc001dhe.1	-	2	593	c.453C>A	c.(451-453)CTC>CTA	p.L151L	ASB17_uc001dhf.1_Intron	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	151	ANK.				intracellular signal transduction					ovary(1)	1						CTACATAAAAGAGAGGTGTGA	0.328													33	57	---	---	---	---	PASS
GBP5	115362	broad.mit.edu	37	1	89729413	89729413	+	Intron	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89729413G>A	uc001dnc.2	-						GBP5_uc001dnd.2_Intron|GBP5_uc001dne.1_Intron	NM_052942	NP_443174	Q96PP8	GBP5_HUMAN	guanylate-binding protein 5							plasma membrane	GTP binding|GTPase activity			ovary(1)	1				all cancers(265;0.00784)|Epithelial(280;0.0286)		GTAGAACTAGGGATACCTGTA	0.423													59	140	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117564311	117564311	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117564311A>T	uc010oxb.1	+	7	2192	c.2134A>T	c.(2134-2136)ATT>TTT	p.I712F	CD101_uc009whd.2_Missense_Mutation_p.I712F|CD101_uc010oxc.1_Missense_Mutation_p.I712F|CD101_uc010oxd.1_Missense_Mutation_p.I650F	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	712	Ig-like C2-type 6.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GTTAGCCATTATTTGGTATTT	0.428													40	78	---	---	---	---	PASS
GJA5	2702	broad.mit.edu	37	1	147230638	147230638	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147230638G>A	uc001eps.1	-	2	850	c.709C>T	c.(709-711)CGA>TGA	p.R237*	GJA5_uc001ept.1_Nonsense_Mutation_p.R237*	NM_181703	NP_859054	P36382	CXA5_HUMAN	connexin 40	237	Cytoplasmic (Potential).				angiogenesis|cell-cell junction assembly|muscle contraction	integral to membrane				ovary(1)	1	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			TTGACAAATCGCTGTCTGATC	0.547													17	112	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155255034	155255034	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155255034C>T	uc001fjz.1	+	5	1176	c.1168C>T	c.(1168-1170)CAC>TAC	p.H390Y	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_Missense_Mutation_p.H85Y	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	390	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTACTATGAGCACCGCTACCA	0.627													38	63	---	---	---	---	PASS
DPT	1805	broad.mit.edu	37	1	168698420	168698420	+	5'UTR	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168698420G>A	uc001gfp.2	-	1						NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor						cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					CATGCTGCCTGGGATTTTGGC	0.507													22	25	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175292529	175292529	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175292529G>A	uc001gkp.1	-	21	4122	c.4041C>T	c.(4039-4041)CTC>CTT	p.L1347L	TNR_uc009wwu.1_Silent_p.L1347L	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1347					axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TCCCTGCCATGAGACGGTGGT	0.473													26	262	---	---	---	---	PASS
RGL1	23179	broad.mit.edu	37	1	183857628	183857628	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183857628T>G	uc001gqo.2	+	8	1129	c.972T>G	c.(970-972)AAT>AAG	p.N324K	RGL1_uc010pof.1_Missense_Mutation_p.N129K|RGL1_uc001gqm.2_Missense_Mutation_p.N359K|RGL1_uc010pog.1_Missense_Mutation_p.N322K|RGL1_uc010poh.1_Missense_Mutation_p.N322K|RGL1_uc010poi.1_Missense_Mutation_p.N324K	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	324	Ras-GEF.				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						TCCTGAAGAATTTTTCCTCCT	0.418													45	531	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214170587	214170587	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214170587C>T	uc001hkh.2	+	2	981	c.709C>T	c.(709-711)CGA>TGA	p.R237*	PROX1_uc001hkg.1_Nonsense_Mutation_p.R237*	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	237					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGAGGAGCGCCGACAGCTGAA	0.498													38	66	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216498814	216498814	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216498814C>T	uc001hku.1	-	6	1363	c.976G>A	c.(976-978)GAC>AAC	p.D326N	USH2A_uc001hkv.2_Missense_Mutation_p.D326N	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	326	Laminin N-terminal.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCAGCTGTGTCTCCTGCATCA	0.488										HNSCC(13;0.011)			71	154	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220273998	220273998	+	Intron	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220273998A>T	uc001hmc.2	+							NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	AAAGGTAAATAATCTGTATTT	0.333													56	86	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236898981	236898981	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236898981C>T	uc001hyf.2	+	8	948	c.744C>T	c.(742-744)TAC>TAT	p.Y248Y	ACTN2_uc001hyg.2_Silent_p.Y3Y|ACTN2_uc009xgi.1_Intron|ACTN2_uc010pxu.1_Intron	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	248	CH 2.|Actin-binding.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TCATGACGTACGTCTCTTGCT	0.522													55	74	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777602	237777602	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777602A>T	uc001hyl.1	+	37	5294	c.5174A>T	c.(5173-5175)TAC>TTC	p.Y1725F		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1725	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACAACGAGTACATTGTCCCC	0.542													28	59	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777665	237777665	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777665A>G	uc001hyl.1	+	37	5357	c.5237A>G	c.(5236-5238)CAC>CGC	p.H1746R		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1746	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACAAAAAACACGGCCTTCCA	0.512													8	101	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237870500	237870500	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237870500G>C	uc001hyl.1	+	68	9952	c.9832G>C	c.(9832-9834)GGG>CGG	p.G3278R	RYR2_uc010pxz.1_Missense_Mutation_p.G233R	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3278					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACACTTCTAGGGAACATATT	0.478													4	52	---	---	---	---	PASS
ZNF692	55657	broad.mit.edu	37	1	249152384	249152384	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249152384T>C	uc001ifc.1	-	2	292	c.125A>G	c.(124-126)AAG>AGG	p.K42R	ZNF692_uc001iez.1_5'Flank|ZNF692_uc001ifa.1_5'Flank|ZNF692_uc001ifb.1_5'UTR|ZNF692_uc001ifd.1_Missense_Mutation_p.K42R|ZNF692_uc001ife.1_RNA|ZNF692_uc001iff.1_Missense_Mutation_p.K42R|ZNF692_uc010pzr.1_Missense_Mutation_p.K47R	NM_017865	NP_060335	Q9BU19	ZN692_HUMAN	zinc finger protein 692 isoform 2	42					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CAGCCGCTCCTTGAGGAGGCA	0.701													26	20	---	---	---	---	PASS
TMEM18	129787	broad.mit.edu	37	2	669577	669577	+	3'UTR	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:669577C>A	uc002qwl.2	-	5					TMEM18_uc002qwk.2_RNA	NM_152834	NP_690047	Q96B42	TMM18_HUMAN	transmembrane protein 18						cell migration	integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		CAGCTGCTGCCCCTCAGTCtt	0.453													22	83	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15449304	15449304	+	Silent	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15449304G>T	uc002rcc.1	-	39	4676	c.4650C>A	c.(4648-4650)GCC>GCA	p.A1550A	NBAS_uc010exl.1_Silent_p.A622A|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1550										ovary(2)|liver(1)|skin(1)	4						CTTGTGGTAAGGCAAGAAGGT	0.358													12	84	---	---	---	---	PASS
GEN1	348654	broad.mit.edu	37	2	17963069	17963069	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17963069G>T	uc002rct.2	+	14	2663	c.2590G>T	c.(2590-2592)GAA>TAA	p.E864*	SMC6_uc010exo.2_Intron|GEN1_uc010yjs.1_Nonsense_Mutation_p.E864*|GEN1_uc002rcu.2_Nonsense_Mutation_p.E864*	NM_182625	NP_872431	Q17RS7	GEN_HUMAN	Gen homolog 1, endonuclease	864					DNA repair	nucleus	DNA binding|endonuclease activity|metal ion binding			breast(5)|kidney(1)|central_nervous_system(1)|skin(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGAAAATGAAGAAAGCTGTTT	0.363								Homologous_recombination					13	132	---	---	---	---	PASS
HADHB	3032	broad.mit.edu	37	2	26501540	26501540	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26501540G>A	uc002rgz.2	+	8	752	c.501G>A	c.(499-501)TTG>TTA	p.L167L	HADHB_uc010ykv.1_Silent_p.L145L|HADHB_uc010ykw.1_Silent_p.L152L|HADHB_uc002rha.2_Intron|HADHB_uc010ykx.1_Silent_p.L93L	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta	167					fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGTTGAGTTGATGTCCGATG	0.438													19	142	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32832622	32832622	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32832622C>T	uc010ezu.2	+	72	14305	c.14171C>T	c.(14170-14172)TCT>TTT	p.S4724F		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	4724					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					ACACAGAGTTCTCGAGAATAT	0.423													43	303	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39249797	39249797	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39249797T>C	uc002rrk.3	-	10	1813	c.1772A>G	c.(1771-1773)AAC>AGC	p.N591S	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_Missense_Mutation_p.N205S|SOS1_uc002rrl.2_Missense_Mutation_p.N323S	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	591					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				GGGCTGCATGTTCTCTTCAAA	0.403									Noonan_syndrome				32	266	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54893114	54893114	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54893114A>C	uc002rxu.2	+	34	6971	c.6722A>C	c.(6721-6723)AAG>ACG	p.K2241T	SPTBN1_uc010you.1_Missense_Mutation_p.K231T	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	2241	PH.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			AAAGATGCAAAGACTGCTGCT	0.433													65	418	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89266047	89266047	+	RNA	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89266047A>T	uc010ytr.1	-	95		c.7519T>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GAGGATGGAGACTGGGTCATC	0.463													52	359	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100210203	100210203	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100210203C>G	uc002tag.2	-	14	2156	c.1920G>C	c.(1918-1920)GAG>GAC	p.E640D	AFF3_uc002taf.2_Missense_Mutation_p.E665D|AFF3_uc010fiq.1_Missense_Mutation_p.E640D|AFF3_uc010yvr.1_Missense_Mutation_p.E793D|AFF3_uc002tah.1_Missense_Mutation_p.E665D	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	640					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						AGGAGCGCAGCTCCTTGCGGT	0.657													19	111	---	---	---	---	PASS
WDR33	55339	broad.mit.edu	37	2	128466368	128466368	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128466368C>T	uc002tpg.1	-	21	3847	c.3664G>A	c.(3664-3666)GGC>AGC	p.G1222S		NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN	WD repeat domain 33 isoform 1	1222					postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		ATGTCCATGCCTTGGAGAGAA	0.602													21	118	---	---	---	---	PASS
MGAT5	4249	broad.mit.edu	37	2	135012094	135012094	+	Silent	SNP	T	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135012094T>G	uc002ttv.1	+	1	265	c.120T>G	c.(118-120)CCT>CCG	p.P40P		NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V	40	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		GAACTCAGCCTGAAAGCAGCT	0.517													8	57	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136570015	136570015	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136570015G>A	uc002tuu.1	-	7	2230	c.2219C>T	c.(2218-2220)TCC>TTC	p.S740F		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	740	Extracellular (Potential).|4 X approximate repeats.|2.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GTATTCCAGGGATACAAACTG	0.498													34	169	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152512352	152512352	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152512352C>T	uc010fnx.2	-	50	6872	c.6681G>A	c.(6679-6681)CAG>CAA	p.Q2227Q		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	2227	Nebulin 59.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TATGTGCATTCTGCTTGGCAA	0.493													34	205	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152527701	152527701	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152527701C>T	uc010fnx.2	-	38	4533	c.4342G>A	c.(4342-4344)GGA>AGA	p.G1448R		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1448	Nebulin 37.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGGATCCATCCGATGCCCTTC	0.438													13	89	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155098713	155098713	+	Intron	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155098713C>A	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						GAAAGAGGTACAAACTGgttt	0.299													16	82	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160303431	160303431	+	Silent	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160303431T>C	uc002uao.2	-	6	910	c.558A>G	c.(556-558)ACA>ACG	p.T186T	BAZ2B_uc002uap.2_Silent_p.T184T|BAZ2B_uc002uas.1_Silent_p.T123T|BAZ2B_uc002uau.1_Silent_p.T184T|BAZ2B_uc002uaq.1_Silent_p.T114T|BAZ2B_uc002uat.3_Silent_p.T123T|BAZ2B_uc010fop.1_Silent_p.T184T	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	186	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						ATAGTACAGATGTGTTGATAC	0.303													42	154	---	---	---	---	PASS
TTC21B	79809	broad.mit.edu	37	2	166788360	166788360	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166788360T>A	uc002udk.2	-	8	935	c.802A>T	c.(802-804)ACC>TCC	p.T268S	TTC21B_uc002udl.2_Missense_Mutation_p.T268S|uc002udm.1_5'Flank	NM_024753	NP_079029	Q7Z4L5	TT21B_HUMAN	tetratricopeptide repeat domain 21B	268						cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5						TCCAGCTTGGTGGAAGCCTAA	0.368													14	75	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179473085	179473085	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179473085G>C	uc010zfg.1	-	224	45045	c.44821C>G	c.(44821-44823)CGT>GGT	p.R14941G	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R8636G|TTN_uc010zfi.1_Missense_Mutation_p.R8569G|TTN_uc010zfj.1_Missense_Mutation_p.R8444G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15868							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAACTTCACGTTTTTCAAGC	0.408													7	34	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179529272	179529272	+	Intron	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179529272G>A	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron|TTN_uc010zfk.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACTTTGAAGATATTAATAA	0.398													29	162	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179604796	179604796	+	Silent	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179604796T>A	uc010zfh.1	-	46	12875	c.12651A>T	c.(12649-12651)CCA>CCT	p.P4217P	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.P4150P|TTN_uc010zfj.1_Silent_p.P4025P|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGCTCTTCTGGAATACCAG	0.463													21	135	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185803761	185803761	+	3'UTR	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803761C>T	uc002uph.2	+	4						NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TAGTCATCACCATAATGGGAA	0.428													52	365	---	---	---	---	PASS
HSPD1	3329	broad.mit.edu	37	2	198358950	198358950	+	Silent	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198358950A>G	uc002uui.2	-	6	768	c.631T>C	c.(631-633)TTA>CTA	p.L211L	HSPD1_uc002uuj.2_Silent_p.L209L|HSPD1_uc010zgx.1_Silent_p.L202L|HSPD1_uc010fsm.2_Silent_p.L22L|HSPD1_uc002uuk.2_Silent_p.L211L	NM_002156	NP_002147	P10809	CH60_HUMAN	chaperonin	211					'de novo' protein folding|activation of caspase activity|B cell cytokine production|B cell proliferation|chaperone-mediated protein complex assembly|interspecies interaction between organisms|isotype switching to IgG isotypes|MyD88-dependent toll-like receptor signaling pathway|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of interferon-alpha production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of macrophage activation|positive regulation of T cell activation|positive regulation of T cell mediated immune response to tumor cell|protein maturation|protein refolding|protein stabilization|response to unfolded protein|T cell activation	cell surface|coated pit|coated vesicle|cytosol|early endosome|extracellular space|lipopolysaccharide receptor complex|mitochondrial inner membrane|mitochondrial matrix|stored secretory granule	ATP binding|ATPase activity|cell surface binding|chaperone binding|DNA replication origin binding|lipopolysaccharide binding|p53 binding|single-stranded DNA binding				0			Epithelial(96;0.225)			ATAATTTCTAATTCATCATTC	0.279													13	87	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211460215	211460215	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211460215C>T	uc002vee.3	+	13	1400	c.1268C>T	c.(1267-1269)TCC>TTC	p.S423F	CPS1_uc010fur.2_Missense_Mutation_p.S429F|CPS1_uc010fus.2_5'UTR	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	423					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TTATAGGTTTCCAAAGTCCTT	0.393													49	254	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882388	228882388	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882388G>A	uc002vpq.2	-	7	3229	c.3182C>T	c.(3181-3183)GCG>GTG	p.A1061V	SPHKAP_uc002vpp.2_Missense_Mutation_p.A1061V|SPHKAP_uc010zlx.1_Missense_Mutation_p.A1061V	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1061						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ATAGCCCTGCGCCTGCCACAT	0.557													21	123	---	---	---	---	PASS
SP140	11262	broad.mit.edu	37	2	231102917	231102917	+	Intron	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231102917A>T	uc002vql.2	+						SP140_uc010zma.1_Intron|SP140_uc002vqj.2_Intron|SP140_uc002vqk.2_Intron|SP140_uc002vqn.2_Intron|SP140_uc002vqm.2_Intron|SP140_uc010fxl.2_Intron	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1						defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TCTCCATTTAATATTTTTAAG	0.348													28	107	---	---	---	---	PASS
C2orf85	285093	broad.mit.edu	37	2	242814310	242814310	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242814310C>T	uc010fzu.1	+	2	626	c.603C>T	c.(601-603)GTC>GTT	p.V201V		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	201						integral to membrane				ovary(1)	1						GTGGCGTTGTCATCGCCATCC	0.677													11	57	---	---	---	---	PASS
C2orf85	285093	broad.mit.edu	37	2	242814556	242814556	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242814556C>A	uc010fzu.1	+	2	872	c.849C>A	c.(847-849)TTC>TTA	p.F283L		NM_173821	NP_776182	Q14D33	CB085_HUMAN	hypothetical protein LOC285093	283						integral to membrane				ovary(1)	1						TCCAGACCTTCGAGCTCAAGG	0.677													27	139	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36896951	36896951	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36896951A>C	uc003cgj.2	-	3	2782	c.2480T>G	c.(2479-2481)CTG>CGG	p.L827R		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	1377					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						GAGCTTCGACAGCCTCCGGGA	0.502													101	231	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36898598	36898598	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36898598G>A	uc003cgj.2	-	3	1135	c.833C>T	c.(832-834)ACC>ATC	p.T278I		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	828					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						CAGGCCCTGGGTCCACTCGCC	0.512													36	177	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41280628	41280628	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41280628C>G	uc010hia.1	+	16	2297	c.2141C>G	c.(2140-2142)CCT>CGT	p.P714R	CTNNB1_uc003ckp.2_Missense_Mutation_p.P714R|CTNNB1_uc003ckq.2_Missense_Mutation_p.P714R|CTNNB1_uc003ckr.2_Missense_Mutation_p.P714R|CTNNB1_uc011azf.1_Missense_Mutation_p.P707R|CTNNB1_uc011azg.1_Missense_Mutation_p.P642R	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	714					adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	CTTCTAGATCCTAGCTATCGT	0.502		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				52	148	---	---	---	---	PASS
HIGD1A	25994	broad.mit.edu	37	3	42827622	42827622	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42827622C>T	uc003cma.3	-	3	276	c.130G>A	c.(130-132)GGA>AGA	p.G44R	HIGD1A_uc010hid.2_Missense_Mutation_p.G58R|HIGD1A_uc003cmb.3_Missense_Mutation_p.G44R	NM_001099669	NP_001093139	Q9Y241	HIG1A_HUMAN	HIG1 domain family, member 1A isoform b	44	Helical; (Potential).|HIG1.				response to stress	integral to membrane|protein complex	protein binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.217)		TTATATAATCCATATGCAACA	0.413													14	123	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48612109	48612109	+	Splice_Site	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48612109C>T	uc003ctz.2	-	77	6394	c.6393_splice	c.e77+1	p.R2131_splice		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor						cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGAGGCCTCACCCTGTCTCCT	0.632													59	121	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74413659	74413659	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74413659T>C	uc003dpm.1	-	9	1252	c.1172A>G	c.(1171-1173)AAA>AGA	p.K391R		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	391	Ig-like C2-type 4.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AAGGCCATGTTTGTTTTCTGC	0.373													24	199	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74418477	74418477	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74418477G>A	uc003dpm.1	-	7	889	c.809C>T	c.(808-810)TCC>TTC	p.S270F		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	270	Ig-like C2-type 3.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AATTTTGCTGGAAAATGGCAG	0.408													12	169	---	---	---	---	PASS
POU1F1	5449	broad.mit.edu	37	3	87310415	87310415	+	Intron	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87310415A>C	uc003dqq.1	-						POU1F1_uc010hoj.1_Intron	NM_000306	NP_000297	P28069	PIT1_HUMAN	pituitary specific transcription factor 1						negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)|skin(1)	2	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		TTTTAATATAAAGAATACCTT	0.294													5	24	---	---	---	---	PASS
PHLDB2	90102	broad.mit.edu	37	3	111686651	111686651	+	Silent	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111686651A>C	uc010hqa.2	+	15	3706	c.3295A>C	c.(3295-3297)AGG>CGG	p.R1099R	PHLDB2_uc003dyc.2_Silent_p.R1083R|PHLDB2_uc003dyd.2_Silent_p.R1056R|PHLDB2_uc003dyg.2_Silent_p.R1099R|PHLDB2_uc003dyh.2_Silent_p.R1056R|PHLDB2_uc003dyi.2_Silent_p.R590R|PHLDB2_uc003dyj.2_Silent_p.R154R	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	1099						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						AGTAAAAATAAGGGAGAGACA	0.478											OREG0015707	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	72	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140407246	140407246	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140407246C>A	uc003eto.1	+	3	1913	c.1722C>A	c.(1720-1722)TAC>TAA	p.Y574*		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	574						intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TCTACACCTACTGGAGTGCTG	0.582													28	178	---	---	---	---	PASS
SLC25A36	55186	broad.mit.edu	37	3	140692756	140692756	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140692756A>C	uc003etr.2	+	6	886	c.651A>C	c.(649-651)GAA>GAC	p.E217D	SLC25A36_uc003ets.2_Missense_Mutation_p.E217D|SLC25A36_uc003etq.2_Missense_Mutation_p.E60D|SLC25A36_uc011bmz.1_Missense_Mutation_p.E191D	NM_001104647	NP_001098117	Q96CQ1	S2536_HUMAN	solute carrier family 25, member 36 isoform a	217					response to estradiol stimulus|transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						AAAATGATGAAGAGTCTGTGA	0.358													26	106	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128534	147128534	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128534C>A	uc003ewe.2	+	1	1354	c.635C>A	c.(634-636)GCC>GAC	p.A212D		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	212					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GGCGCCGGCGCCTTCTTCCGC	0.627													96	67	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907944	164907944	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907944C>T	uc003fej.3	-	2	1119	c.675G>A	c.(673-675)ATG>ATA	p.M225I	SLITRK3_uc003fek.2_Missense_Mutation_p.M225I	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	225	Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						GCTGGAGCTCCATCAGGCTTC	0.443										HNSCC(40;0.11)			21	404	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179472565	179472565	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179472565G>T	uc003fkh.2	+	15	1925	c.1844G>T	c.(1843-1845)CGA>CTA	p.R615L	USP13_uc003fkf.2_Nonsense_Mutation_p.E543*	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	615					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			AACCATCTCCGAGCCAGGGGG	0.453													41	874	---	---	---	---	PASS
KLHL24	54800	broad.mit.edu	37	3	183368735	183368735	+	Silent	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183368735T>C	uc003flv.2	+	3	886	c.591T>C	c.(589-591)GAT>GAC	p.D197D	KLHL24_uc003flw.2_Silent_p.D197D|KLHL24_uc003flx.2_Silent_p.D197D	NM_017644	NP_060114	Q6TFL4	KLH24_HUMAN	DRE1 protein	197	BACK.					axon|cytoplasm|perikaryon				ovary(1)	1	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			CTTTTGAGGATGTATCCCAGC	0.358													35	737	---	---	---	---	PASS
SENP2	59343	broad.mit.edu	37	3	185316310	185316310	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185316310C>T	uc003fpn.2	+	3	439	c.268C>T	c.(268-270)CGG>TGG	p.R90W	SENP2_uc011brv.1_Missense_Mutation_p.R80W|SENP2_uc011brw.1_Translation_Start_Site	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2	90					mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			TAATGGAACACGGAATGTGGC	0.418													26	481	---	---	---	---	PASS
C3orf65	646600	broad.mit.edu	37	3	185434530	185434530	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185434530C>T	uc003fpr.2	+	2	539	c.363C>T	c.(361-363)GTC>GTT	p.V121V	IGF2BP2_uc010hyi.2_Intron|IGF2BP2_uc010hyj.2_Intron|IGF2BP2_uc010hyk.2_Intron|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpo.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron|C3orf65_uc003fps.3_Intron	NR_027317				RecName: Full=Putative uncharacterized protein C3orf65;												0	all_cancers(143;1.5e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			GCTGGCTGGTCATCAGAATGG	0.537													25	472	---	---	---	---	PASS
TPRG1	285386	broad.mit.edu	37	3	188933167	188933167	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188933167G>A	uc003frv.1	+	8	1524	c.297G>A	c.(295-297)TTG>TTA	p.L99L	TPRG1_uc003frw.1_Silent_p.L99L	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	99											0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		TCTGGCTCTTGACAAAGTGAG	0.493													121	145	---	---	---	---	PASS
C3orf59	151963	broad.mit.edu	37	3	192516720	192516720	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192516720G>C	uc011bsp.1	-	2	1252	c.931C>G	c.(931-933)CAG>GAG	p.Q311E		NM_178496	NP_848591	Q8IYB1	M21D2_HUMAN	hypothetical protein LOC151963	311											0	all_cancers(143;1.56e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.8e-18)|LUSC - Lung squamous cell carcinoma(58;8.04e-06)|Lung(62;8.62e-06)	GBM - Glioblastoma multiforme(46;3.86e-05)		TTGCAGGCCTGATAGGCCTGC	0.557													19	172	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193183889	193183889	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193183889G>A	uc003ftd.2	-	11	1305	c.1197C>T	c.(1195-1197)ATC>ATT	p.I399I	ATP13A4_uc003fte.1_Silent_p.I399I|ATP13A4_uc011bsr.1_Intron|ATP13A4_uc010hzi.2_RNA|ATP13A4_uc003ftf.3_Silent_p.I105I	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	399	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GGAGGAACCTGATGGCATCCC	0.453													104	606	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195480067	195480067	+	Silent	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195480067G>T	uc011bto.1	-	21	15439	c.14979C>A	c.(14977-14979)TCC>TCA	p.S4993S	MUC4_uc010hzq.2_Translation_Start_Site|MUC4_uc003fuz.2_Silent_p.S719S|MUC4_uc003fva.2_Silent_p.S601S|MUC4_uc003fvb.2_Silent_p.S637S|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Silent_p.S637S|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Silent_p.S601S|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Silent_p.S685S|MUC4_uc011bti.1_Silent_p.S685S|MUC4_uc011btj.1_Silent_p.S862S|MUC4_uc011btk.1_Silent_p.S601S|MUC4_uc011btl.1_Silent_p.S630S|MUC4_uc011btm.1_Silent_p.S810S|MUC4_uc011btn.1_Silent_p.S601S|MUC4_uc003fvo.2_Silent_p.S885S|MUC4_uc003fvp.2_Silent_p.S834S	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1878	EGF-like 1.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TCACAGGGCAGGACTGGTTCT	0.617													24	395	---	---	---	---	PASS
PIGG	54872	broad.mit.edu	37	4	517609	517609	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:517609G>A	uc003gak.3	+	9	2112	c.1976G>A	c.(1975-1977)TGG>TAG	p.W659*	PIGG_uc003gaj.3_Nonsense_Mutation_p.W651*|PIGG_uc011bux.1_RNA|PIGG_uc010ibf.2_Nonsense_Mutation_p.W526*|PIGG_uc003gal.3_Nonsense_Mutation_p.W570*	NM_001127178	NP_001120650	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	659					C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	CP2 mannose-ethanolamine phosphotransferase activity			central_nervous_system(2)|ovary(1)|skin(1)	4						GCCAGTCCGTGGCTAATACTG	0.642													7	15	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36075362	36075362	+	Silent	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36075362C>G	uc003gsq.1	-	32	5030	c.4692G>C	c.(4690-4692)CTG>CTC	p.L1564L	ARAP2_uc003gso.2_RNA	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1564					regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						GTATAGGAATCAGAGGCAAAC	0.363													34	162	---	---	---	---	PASS
PLRG1	5356	broad.mit.edu	37	4	155461791	155461791	+	Silent	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155461791C>A	uc003iny.2	-	10	957	c.894G>T	c.(892-894)CCG>CCT	p.P298P	PLRG1_uc003inz.2_Silent_p.P289P|PLRG1_uc011cil.1_Silent_p.P137P	NM_002669	NP_002660	O43660	PLRG1_HUMAN	pleiotropic regulator 1 (PRL1 homolog,	298	WD 3.					catalytic step 2 spliceosome|nuclear speck	protein binding|signal transducer activity|transcription corepressor activity				0	all_hematologic(180;0.215)	Renal(120;0.0854)				CATCGATTGTCGGGTGCAAAT	0.378													35	118	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186380653	186380653	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186380653A>G	uc003ixu.3	-	6	1164	c.1088T>C	c.(1087-1089)ATC>ACC	p.I363T	CCDC110_uc003ixv.3_Missense_Mutation_p.I326T|CCDC110_uc011ckt.1_Missense_Mutation_p.I363T	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	363						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTTGCCAGTGATGGGAATTTC	0.318													7	258	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10411627	10411627	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10411627G>T	uc003jet.1	+	19	2057	c.1874G>T	c.(1873-1875)CGA>CTA	p.R625L	MARCH6_uc011cmu.1_Missense_Mutation_p.R577L|MARCH6_uc003jeu.1_Missense_Mutation_p.R323L|MARCH6_uc011cmv.1_Missense_Mutation_p.R520L	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	625	Cytoplasmic (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CCTTACCGCCGACCTTTAAAT	0.458													38	156	---	---	---	---	PASS
FBXL7	23194	broad.mit.edu	37	5	15937245	15937245	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15937245C>T	uc003jfn.1	+	4	1907	c.1426C>T	c.(1426-1428)CGC>TGC	p.R476C		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	476					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						CTTTGTCAAACGCCACTGCAA	0.577													18	39	---	---	---	---	PASS
SLC45A2	51151	broad.mit.edu	37	5	33984399	33984399	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33984399G>C	uc003jid.2	-	1	382	c.290C>G	c.(289-291)TCC>TGC	p.S97C	SLC45A2_uc003jie.2_Missense_Mutation_p.S97C|SLC45A2_uc003jif.3_Missense_Mutation_p.S97C|SLC45A2_uc011coe.1_Missense_Mutation_p.S97C	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	97	Cytoplasmic (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						GCCCCACCTGGACCGGCAGTG	0.627													13	81	---	---	---	---	PASS
GHR	2690	broad.mit.edu	37	5	42566037	42566037	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42566037G>A	uc003jmt.2	+	2	104	c.61G>A	c.(61-63)GGA>AGA	p.G21R	GHR_uc011cpq.1_5'UTR	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	21	Extracellular (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TGCTTTTTCTGGAAGTGAGGG	0.433													46	367	---	---	---	---	PASS
C5orf28	64417	broad.mit.edu	37	5	43446438	43446438	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43446438G>A	uc003jny.2	-	3	677	c.534C>T	c.(532-534)TTC>TTT	p.F178F	C5orf28_uc003jnv.3_Silent_p.F178F|C5orf28_uc003jnx.2_Silent_p.F178F	NM_022483	NP_071928	Q0VDI3	CE028_HUMAN	hypothetical protein LOC64417	178	Helical; (Potential).					integral to membrane					0	Lung NSC(6;2.07e-05)					CATAAAGCCAGAATGGCAAAG	0.378													68	168	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63257016	63257016	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63257016G>A	uc011cqt.1	-	1	531	c.531C>T	c.(529-531)ACC>ACT	p.T177T		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	177	Helical; Name=4; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	GGTCTTCCGGGGTGCGCCAGC	0.597													54	287	---	---	---	---	PASS
ADAMTS6	11174	broad.mit.edu	37	5	64484044	64484044	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64484044C>T	uc003jtp.2	-	22	3523	c.2709G>A	c.(2707-2709)TGG>TGA	p.W903*	ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1	903	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CCCCAATGAACCACCTGCAGC	0.493													41	253	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79033202	79033202	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79033202C>T	uc003kgc.2	+	2	8686	c.8614C>T	c.(8614-8616)CAC>TAC	p.H2872Y		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2872						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTCAAAGCACCACTTGGAGGC	0.403													11	218	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101834355	101834355	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101834355C>T	uc003knn.2	-	1	366	c.194G>A	c.(193-195)CGA>CAA	p.R65Q	SLCO6A1_uc003kno.2_Missense_Mutation_p.R65Q|SLCO6A1_uc003knp.2_Missense_Mutation_p.R65Q|SLCO6A1_uc003knq.2_Missense_Mutation_p.R65Q	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	65	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TTTCCTTTTTCGGAAACCGCC	0.542													71	409	---	---	---	---	PASS
FNIP1	96459	broad.mit.edu	37	5	131034692	131034692	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131034692T>C	uc003kvs.1	-	11	1262	c.1120A>G	c.(1120-1122)ATG>GTG	p.M374V	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.M346V|FNIP1_uc010jdm.1_Missense_Mutation_p.M329V|FNIP1_uc003kvu.2_Missense_Mutation_p.M374V	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	374					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)|skin(1)	2		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		CTCATTTTCATAGCCTTGAAA	0.358													45	123	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140594235	140594235	+	Silent	SNP	G	T	T	rs112800248		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140594235G>T	uc003lja.1	+	1	727	c.540G>T	c.(538-540)CGG>CGT	p.R180R		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	180	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTATTTTCGGGTCCTCACCC	0.498													34	129	---	---	---	---	PASS
PCDHGB2	56103	broad.mit.edu	37	5	140740288	140740288	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140740288C>G	uc003ljs.1	+	1	586	c.586C>G	c.(586-588)CTA>GTA	p.L196V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc011dar.1_Missense_Mutation_p.L196V	NM_018923	NP_061746	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2 isoform 1	196	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGTTGATTCTAAAACACTC	0.463													11	133	---	---	---	---	PASS
PCDHGB5	56101	broad.mit.edu	37	5	140778505	140778505	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140778505G>T	uc003lkf.1	+	1	811	c.811G>T	c.(811-813)GAG>TAG	p.E271*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Nonsense_Mutation_p.E271*	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	271	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCAAGACGAGGGCATCAA	0.473													34	188	---	---	---	---	PASS
DIAPH1	1729	broad.mit.edu	37	5	140951005	140951005	+	Intron	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140951005T>A	uc003llb.3	-						DIAPH1_uc003llc.3_Intron|DIAPH1_uc010jgc.1_Intron	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGGAAGCTTCAGGAGCAA	0.358													28	99	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149216209	149216209	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149216209G>A	uc003lrc.2	+	8	2233	c.2191G>A	c.(2191-2193)GAG>AAG	p.E731K	PPARGC1B_uc003lrb.1_Missense_Mutation_p.E731K|PPARGC1B_uc003lrd.2_Missense_Mutation_p.E692K|PPARGC1B_uc003lrf.2_Missense_Mutation_p.E710K|PPARGC1B_uc003lre.1_Missense_Mutation_p.E710K	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	731					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCCTTGGGCTGAGGCACAGGC	0.652													23	102	---	---	---	---	PASS
FOXI1	2299	broad.mit.edu	37	5	169535196	169535196	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169535196G>T	uc003mai.3	+	2	763	c.718G>T	c.(718-720)GTG>TTG	p.V240L	FOXI1_uc003maj.3_Intron	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	240					epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGTCTCCCGGTGGACAGCCC	0.577									Pendred_syndrome				22	153	---	---	---	---	PASS
GPRIN1	114787	broad.mit.edu	37	5	176026691	176026691	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176026691G>C	uc003meo.1	-	2	320	c.145C>G	c.(145-147)CAG>GAG	p.Q49E		NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth	49						growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCTTTTGCTGGGAGGGGCAG	0.662													55	189	---	---	---	---	PASS
DDX41	51428	broad.mit.edu	37	5	176939832	176939832	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176939832C>A	uc003mho.2	-	13	1369	c.1348G>T	c.(1348-1350)GAG>TAG	p.E450*	DOK3_uc003mhi.3_5'Flank|DOK3_uc003mhj.3_5'Flank|DOK3_uc003mhk.2_5'Flank|DOK3_uc003mhl.2_5'Flank|DDX41_uc003mhm.2_Nonsense_Mutation_p.E230*|DDX41_uc003mhn.2_Nonsense_Mutation_p.E319*|DDX41_uc003mhp.2_Nonsense_Mutation_p.E319*|DDX41_uc003mhq.1_Nonsense_Mutation_p.E230*	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt	450	Helicase C-terminal.				apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			AGCAGGTACTCGTGGATGGCG	0.602													85	233	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178413425	178413425	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178413425G>T	uc003mjr.2	-	8	2009	c.1830C>A	c.(1828-1830)TAC>TAA	p.Y610*	GRM6_uc003mjq.2_5'Flank|GRM6_uc010jla.1_Nonsense_Mutation_p.Y193*|GRM6_uc003mjs.1_Nonsense_Mutation_p.Y230*	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	610	Cytoplasmic (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		GCGTGTTGTTGTACCGCACGA	0.672													9	35	---	---	---	---	PASS
F13A1	2162	broad.mit.edu	37	6	6167791	6167791	+	Missense_Mutation	SNP	G	C	C	rs148207995	byFrequency	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6167791G>C	uc003mwv.2	-	13	1931	c.1808C>G	c.(1807-1809)GCG>GGG	p.A603G	F13A1_uc011dib.1_Missense_Mutation_p.A540G	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	603					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	GTGCAGGGACGCTTGTTCCAG	0.522													22	96	---	---	---	---	PASS
GTF2H4	2968	broad.mit.edu	37	6	30876830	30876830	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30876830C>A	uc003nsa.1	+	2	224	c.17C>A	c.(16-18)TCA>TAA	p.S6*	GTF2H4_uc010jsf.2_Nonsense_Mutation_p.S6*|GTF2H4_uc011dmv.1_Intron|GTF2H4_uc003nsb.1_5'UTR|GTF2H4_uc011dmw.1_Nonsense_Mutation_p.S12*	NM_001517	NP_001508	Q92759	TF2H4_HUMAN	general transcription factor IIH, polypeptide 4,	6					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3						AGCACCCCTTCAAGGGGACTG	0.542								NER					19	123	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36927041	36927041	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36927041G>C	uc003ona.2	+	2	620	c.292G>C	c.(292-294)GAC>CAC	p.D98H	PI16_uc003omz.1_Missense_Mutation_p.D98H|PI16_uc003onb.2_Missense_Mutation_p.D98H|PI16_uc011dts.1_5'Flank	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	98	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						CGAGGGCATGGACGTGCCGCT	0.677													6	23	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38863930	38863930	+	Missense_Mutation	SNP	C	T	T	rs143707632	byFrequency	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38863930C>T	uc003ooe.1	+	58	8818	c.8218C>T	c.(8218-8220)CGT>TGT	p.R2740C		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8									p.R2740H(1)		skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GGATTTTCTTCGTGAGATGCC	0.388													44	218	---	---	---	---	PASS
LRFN2	57497	broad.mit.edu	37	6	40399554	40399554	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40399554G>A	uc003oph.1	-	2	1764	c.1299C>T	c.(1297-1299)ACC>ACT	p.T433T		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	433	Fibronectin type-III.|Extracellular (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGGCCGAGGTGGTGGTCACTT	0.607													27	140	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46656835	46656835	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46656835G>T	uc003oyj.2	+	1	970	c.970G>T	c.(970-972)GGA>TGA	p.G324*	TDRD6_uc010jze.2_Nonsense_Mutation_p.G318*	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	324	Tudor 2.				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			TGGCCTGGATGGACATTGGTA	0.582													31	72	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49578736	49578736	+	Splice_Site	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49578736C>T	uc003ozk.3	-	7	1129	c.1067_splice	c.e7+1	p.T356_splice	RHAG_uc010jzl.2_Splice_Site_p.T356_splice|RHAG_uc010jzm.2_Intron	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein						carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					CTTTTACTCACGTGTTGGAGG	0.502													42	148	---	---	---	---	PASS
GFRAL	389400	broad.mit.edu	37	6	55216362	55216362	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55216362C>A	uc003pcm.1	+	5	768	c.682C>A	c.(682-684)CAA>AAA	p.Q228K		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	228	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TCGCAGCTGCCAAAATGATGA	0.418													17	100	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	55929373	55929373	+	Intron	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55929373T>C	uc003pcs.2	-						COL21A1_uc010jzz.2_Intron|COL21A1_uc011dxg.1_Intron|COL21A1_uc011dxh.1_Intron|COL21A1_uc003pcr.2_Intron	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AACCAAAAAATACCTGTTGCC	0.348													5	21	---	---	---	---	PASS
DDX43	55510	broad.mit.edu	37	6	74119083	74119083	+	Intron	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74119083C>A	uc003pgw.2	+							NM_018665	NP_061135	Q9NXZ2	DDX43_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 43							intracellular	ATP binding|ATP-dependent RNA helicase activity|RNA binding			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4						TACGTATATGCTTAATTACTG	0.383													73	139	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84333061	84333061	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84333061G>T	uc011dze.1	-	9	1083	c.766C>A	c.(766-768)CAA>AAA	p.Q256K	SNAP91_uc003pkb.2_Missense_Mutation_p.Q221K|SNAP91_uc003pkc.2_Missense_Mutation_p.Q256K|SNAP91_uc003pkd.2_Intron|SNAP91_uc003pka.2_Missense_Mutation_p.Q256K|SNAP91_uc011dzf.1_Missense_Mutation_p.Q137K	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	256					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		ATACCAACTTGCTGTGGATTT	0.308													6	21	---	---	---	---	PASS
ARMC2	84071	broad.mit.edu	37	6	109274546	109274546	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109274546C>A	uc003pss.3	+	13	2081	c.1907C>A	c.(1906-1908)ACC>AAC	p.T636N	ARMC2_uc011eao.1_Missense_Mutation_p.T471N	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	636	ARM 9.						binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		CTGCTCCTGACCACGCTGGGT	0.617													10	15	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110538960	110538960	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110538960C>T	uc003pua.2	+	10	1068	c.1044C>T	c.(1042-1044)CTC>CTT	p.L348L		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	348	WD 2.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		CACAGTTCCTCAGTGCAGCCT	0.403													27	107	---	---	---	---	PASS
SLC16A10	117247	broad.mit.edu	37	6	111498481	111498481	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111498481G>A	uc003pus.2	+	3	730	c.555G>A	c.(553-555)CAG>CAA	p.Q185Q	SLC16A10_uc003pur.3_Silent_p.Q185Q|SLC16A10_uc003put.2_5'UTR	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10	185	Helical; (Potential).				aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		TTGCATACCAGCCTTCATTGG	0.463													25	125	---	---	---	---	PASS
SLC16A10	117247	broad.mit.edu	37	6	111498482	111498482	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111498482C>A	uc003pus.2	+	3	731	c.556C>A	c.(556-558)CCT>ACT	p.P186T	SLC16A10_uc003pur.3_Missense_Mutation_p.P186T|SLC16A10_uc003put.2_5'UTR	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10	186	Helical; (Potential).				aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		TGCATACCAGCCTTCATTGGT	0.463													25	129	---	---	---	---	PASS
TXLNB	167838	broad.mit.edu	37	6	139563943	139563943	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139563943C>T	uc011eds.1	-	10	1940	c.1775G>A	c.(1774-1776)GGT>GAT	p.G592D		NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta	592						cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		AACAGGGAGACCCTCGCATTG	0.612													61	113	---	---	---	---	PASS
UTRN	7402	broad.mit.edu	37	6	144780310	144780310	+	Silent	SNP	C	A	A	rs145026541		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144780310C>A	uc003qkt.2	+	20	2619	c.2527C>A	c.(2527-2529)CGG>AGG	p.R843R	UTRN_uc010khq.1_Silent_p.R843R	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	843	Interaction with SYNM.|Spectrin 6.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCTTCCTTAGCGGGAATTGAC	0.458													17	68	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152529337	152529337	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152529337C>G	uc010kiw.2	-	125	23196	c.22594G>C	c.(22594-22596)GAA>CAA	p.E7532Q	SYNE1_uc010kiv.2_Missense_Mutation_p.E2056Q|SYNE1_uc003qos.3_Missense_Mutation_p.E2056Q|SYNE1_uc003qot.3_Missense_Mutation_p.E7461Q|SYNE1_uc003qou.3_Missense_Mutation_p.E7532Q|SYNE1_uc003qor.3_Missense_Mutation_p.E432Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7532	Cytoplasmic (Potential).|Spectrin 25.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGTTGAATTCATCCCTAGTG	0.463										HNSCC(10;0.0054)			11	111	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155579203	155579203	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155579203C>T	uc003qqj.3	-	7	872	c.808G>A	c.(808-810)GAA>AAA	p.E270K	TFB1M_uc003qqk.2_Intron|uc003qqi.1_5'Flank	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	270					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		CGCTGCGCTTCAGGGAATAAC	0.448													43	207	---	---	---	---	PASS
ITGB8	3696	broad.mit.edu	37	7	20441445	20441445	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20441445T>G	uc003suu.2	+	10	2088	c.1383T>G	c.(1381-1383)ATT>ATG	p.I461M	ITGB8_uc011jyh.1_Missense_Mutation_p.I326M	NM_002214	NP_002205	P26012	ITB8_HUMAN	integrin, beta 8 precursor	461	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|placenta blood vessel development	integrin complex	protein binding|receptor activity			skin(3)	3						CCGCTAAAATTCATATACACA	0.353													17	203	---	---	---	---	PASS
STX1A	6804	broad.mit.edu	37	7	73122914	73122914	+	Intron	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73122914C>T	uc003tyx.2	-						STX1A_uc003tyy.2_Intron|STX1A_uc010lbj.1_Intron|hsa-mir-4284|MI0015893_5'Flank	NM_004603	NP_004594	Q16623	STX1A_HUMAN	syntaxin 1A isoform 1						energy reserve metabolic process|glutamate secretion|intracellular protein transport|regulation of insulin secretion	cell junction|extracellular region|integral to membrane|neuron projection|synaptic vesicle membrane|synaptosome	SNAP receptor activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GCCCCACACACTCACTCTCAT	0.632													4	43	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94047155	94047155	+	Intron	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94047155C>A	uc003ung.1	+						COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TACGTGTTGACCCCTATTACA	0.502										HNSCC(75;0.22)			8	22	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103180703	103180703	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103180703G>A	uc003vca.2	-	44	7031	c.6871C>T	c.(6871-6873)CTT>TTT	p.L2291F	RELN_uc010liz.2_Missense_Mutation_p.L2291F	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2291					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CACCAGCGAAGGCGAGTAGAA	0.498													57	156	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103243798	103243798	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103243798G>C	uc003vca.2	-	24	3446	c.3286C>G	c.(3286-3288)CAA>GAA	p.Q1096E	RELN_uc010liz.2_Missense_Mutation_p.Q1096E	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1096					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CCACACCCTTGTTCTGGTTTT	0.448													34	229	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103301968	103301968	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103301968A>C	uc003vca.2	-	12	1456	c.1296T>G	c.(1294-1296)GAT>GAG	p.D432E	RELN_uc010liz.2_Missense_Mutation_p.D432E	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	432					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTCCCAAGACATCCCATCTAA	0.363													27	97	---	---	---	---	PASS
ANKRD7	56311	broad.mit.edu	37	7	117874896	117874896	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117874896G>T	uc003vji.2	+	3	609	c.436G>T	c.(436-438)GAA>TAA	p.E146*		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	146	ANK 3.				male gonad development						0						AAAACTGCTTGAATACGAAGC	0.328													37	128	---	---	---	---	PASS
TPK1	27010	broad.mit.edu	37	7	144380018	144380018	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144380018C>G	uc003weq.2	-	4	272	c.169G>C	c.(169-171)GAA>CAA	p.E57Q	TPK1_uc003weo.2_Silent_p.P11P|TPK1_uc003wep.2_RNA|TPK1_uc003wer.2_Missense_Mutation_p.E57Q|TPK1_uc003wes.2_RNA	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a	57					thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	CTCTCTCCTTCGGTGATATCA	0.393													66	443	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149476125	149476125	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149476125A>G	uc010lpk.2	+	8	1003	c.1003A>G	c.(1003-1005)ATG>GTG	p.M335V	SSPO_uc010lpl.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	335	VWFD 1.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGATGACTTCATGGAGCCAGG	0.627													26	51	---	---	---	---	PASS
PAXIP1	22976	broad.mit.edu	37	7	154768046	154768046	+	Intron	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154768046G>T	uc003wlp.2	-						PAXIP1_uc003wlq.1_Intron|PAXIP1_uc011kvs.1_Intron|PAXIP1_uc003wlr.1_Intron	NM_007349	NP_031375	Q6ZW49	PAXI1_HUMAN	PAX interacting protein 1						DNA damage response, signal transduction by p53 class mediator|DNA recombination|DNA repair|histone H3-K4 methylation|positive regulation of histone acetylation|positive regulation of histone H3-K36 methylation|positive regulation of histone H3-K4 methylation|positive regulation of isotype switching|positive regulation of protein ubiquitination|positive regulation of transcription initiation from RNA polymerase II promoter|response to ionizing radiation|transcription, DNA-dependent	histone methyltransferase complex|nuclear matrix				lung(2)|ovary(1)|breast(1)|pancreas(1)	5	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TTTCTCCTACGAGGAAAGCAG	0.363													29	190	---	---	---	---	PASS
C8orf40	114926	broad.mit.edu	37	8	42407759	42407759	+	3'UTR	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42407759G>A	uc011lcv.1	+	4					C8orf40_uc003xph.2_3'UTR|C8orf40_uc003xpg.2_3'UTR|C8orf40_uc010lxo.2_3'UTR	NM_001135676	NP_001129148	Q96E16	CH040_HUMAN	hypothetical protein LOC114926							cytoplasm|integral to membrane|nucleolus					0	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TGAAACCTCAGAAAAAGAGCA	0.343													36	105	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52323844	52323844	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52323844C>T	uc003xqu.3	-	16	2129	c.2028G>A	c.(2026-2028)GTG>GTA	p.V676V	PXDNL_uc003xqt.3_5'Flank	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	676					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCCCCTGCTTCACACGTTCCC	0.512													16	15	---	---	---	---	PASS
NIPAL2	79815	broad.mit.edu	37	8	99248447	99248447	+	Intron	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99248447A>C	uc003yil.1	-						NIPAL2_uc011lgw.1_Intron|NIPAL2_uc003yim.1_Intron	NM_024759	NP_079035	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2							integral to membrane					0						CACTACCTATAAAGAAAATGG	0.338													5	122	---	---	---	---	PASS
ABRA	137735	broad.mit.edu	37	8	107773334	107773334	+	Silent	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107773334C>G	uc003ymm.3	-	2	1131	c.1077G>C	c.(1075-1077)CTG>CTC	p.L359L		NM_139166	NP_631905	Q8N0Z2	ABRA_HUMAN	actin-binding Rho activating protein	359	Interaction with actin (By similarity).				positive regulation of Rho protein signal transduction|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent|transmembrane transport	actin cytoskeleton|plasma membrane|sarcomere	actin binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			CAAAGTCTACCAGTCCATGTT	0.438													10	379	---	---	---	---	PASS
SNTB1	6641	broad.mit.edu	37	8	121823898	121823898	+	Silent	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823898G>T	uc010mdg.2	-	1	412	c.186C>A	c.(184-186)ACC>ACA	p.T62T	SNTB1_uc003ype.2_Silent_p.T62T	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	62	PH 1.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CATTGGTGGCGGTCCCGATGC	0.433													9	40	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164667	139164667	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164667G>C	uc003yuy.2	-	13	2222	c.2051C>G	c.(2050-2052)TCT>TGT	p.S684C	FAM135B_uc003yux.2_Missense_Mutation_p.S585C|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.S246C|FAM135B_uc003yvb.2_Missense_Mutation_p.S246C	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	684										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCCTGAATCAGATATGATGGA	0.527										HNSCC(54;0.14)			25	158	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630669	140630669	+	Silent	SNP	G	A	A	rs140285421		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630669G>A	uc003yvf.1	-	2	1021	c.957C>T	c.(955-957)AGC>AGT	p.S319S	KCNK9_uc003yvg.1_Silent_p.S319S|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	319	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			CAAGCTTGGCGCTGAAGGAGT	0.577													42	89	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143957739	143957739	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143957739G>A	uc003yxi.2	-	5	879	c.872C>T	c.(871-873)GCG>GTG	p.A291V	CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'UTR|CYP11B1_uc003yxj.2_Missense_Mutation_p.A291V|CYP11B1_uc010mey.2_Missense_Mutation_p.A362V	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	291					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	CAGGAGCTCCGCCACGATGCT	0.592									Familial_Hyperaldosteronism_type_I				36	38	---	---	---	---	PASS
PPP1R16A	84988	broad.mit.edu	37	8	145727009	145727009	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145727009G>A	uc003zdd.2	+	11	2223	c.1310G>A	c.(1309-1311)AGC>AAC	p.S437N	uc003zde.1_5'Flank|PPP1R16A_uc003zdf.2_Missense_Mutation_p.S437N|GPT_uc011lli.1_5'Flank|GPT_uc011llj.1_5'Flank|GPT_uc003zdh.3_5'Flank	NM_032902	NP_116291	Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	437						plasma membrane	protein binding				0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TACCAGCTGAGCCCCCTGGAC	0.652													9	19	---	---	---	---	PASS
DDX58	23586	broad.mit.edu	37	9	32526089	32526089	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32526089G>T	uc003zra.2	-	1	234	c.76C>A	c.(76-78)CTG>ATG	p.L26M	DDX58_uc010mjj.2_RNA|DDX58_uc010mjk.1_Missense_Mutation_p.L26M|DDX58_uc011lnr.1_Translation_Start_Site	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	26	CARD 1.				detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ATGTAGCTCAGGATGTAGGTA	0.572													18	100	---	---	---	---	PASS
SMC5	23137	broad.mit.edu	37	9	72929652	72929652	+	Intron	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72929652A>G	uc004ahr.2	+							NM_015110	NP_055925	Q8IY18	SMC5_HUMAN	SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3						TTTTCCCTATATTCAGGTTCG	0.308													19	67	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84606183	84606183	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84606183G>T	uc004amn.2	+	4	845	c.798G>T	c.(796-798)TTG>TTT	p.L266F		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	266						integral to membrane					0						AAGCCAGTTTGTCTCTGAACA	0.512													65	537	---	---	---	---	PASS
FBP2	8789	broad.mit.edu	37	9	97333768	97333768	+	Silent	SNP	G	C	C	rs144416702		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97333768G>C	uc004auv.2	-	4	610	c.543C>G	c.(541-543)GGC>GGG	p.G181G	uc004auu.2_Intron	NM_003837	NP_003828	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	181					fructose metabolic process|gluconeogenesis	cytosol	fructose 1,6-bisphosphate 1-phosphatase activity|fructose-2,6-bisphosphate 2-phosphatase activity|metal ion binding				0		Acute lymphoblastic leukemia(62;0.136)				AGAGGTCCACGCCTTGCCCTG	0.562													24	126	---	---	---	---	PASS
FAM22G	441457	broad.mit.edu	37	9	99699495	99699495	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99699495G>T	uc004awq.1	+	5	1847	c.1132G>T	c.(1132-1134)GAA>TAA	p.E378*	HIATL2_uc004awr.1_Intron	NM_001045477	NP_001038942	Q5VZR2	FA22G_HUMAN	hypothetical protein LOC441457	378										skin(1)	1		Acute lymphoblastic leukemia(62;0.0527)				GATCCCCCCTGAAGTGGTGCA	0.652													31	127	---	---	---	---	PASS
FAM22G	441457	broad.mit.edu	37	9	99699561	99699561	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99699561G>A	uc004awq.1	+	5	1913	c.1198G>A	c.(1198-1200)GAG>AAG	p.E400K	HIATL2_uc004awr.1_Intron	NM_001045477	NP_001038942	Q5VZR2	FA22G_HUMAN	hypothetical protein LOC441457	400										skin(1)	1		Acute lymphoblastic leukemia(62;0.0527)				GGACACAGGGGAGCCTGAGGG	0.607													25	90	---	---	---	---	PASS
KIAA1529	57653	broad.mit.edu	37	9	100124529	100124529	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100124529G>C	uc011lut.1	+	40	5030	c.4257G>C	c.(4255-4257)CAG>CAC	p.Q1419H	KIAA1529_uc004axe.1_Missense_Mutation_p.Q1251H|KIAA1529_uc004axg.1_Missense_Mutation_p.Q1280H|KIAA1529_uc004axh.1_RNA|KIAA1529_uc011luw.1_Missense_Mutation_p.Q436H	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				ATCCGTCCCAGACAGGTAGAG	0.597													41	235	---	---	---	---	PASS
NR4A3	8013	broad.mit.edu	37	9	102595930	102595930	+	Intron	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102595930C>G	uc004baf.1	+						NR4A3_uc004bae.2_3'UTR|NR4A3_uc004bag.1_Intron|NR4A3_uc004bai.2_Intron	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				TATTGAATCTCTAAATGCCTT	0.393			T	EWSR1	extraskeletal myxoid chondrosarcoma								9	64	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104390665	104390665	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104390665C>A	uc004bbp.1	-	4	2972	c.2371G>T	c.(2371-2373)GGA>TGA	p.G791*	GRIN3A_uc004bbq.1_Nonsense_Mutation_p.G791*	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	791	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	AAGCGGAATCCTTGGGAAGGA	0.343													8	112	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109746651	109746651	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109746651C>A	uc004bcz.2	+	10	7306	c.7017C>A	c.(7015-7017)CAC>CAA	p.H2339Q	ZNF462_uc010mto.2_Missense_Mutation_p.H2248Q|ZNF462_uc004bda.2_Missense_Mutation_p.H2247Q|ZNF462_uc011lvz.1_Missense_Mutation_p.H296Q|uc004bdc.1_Intron	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	2339	C2H2-type 26.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						AGACCAAGCACACGGAGGAAC	0.537													19	178	---	---	---	---	PASS
STRBP	55342	broad.mit.edu	37	9	125921449	125921449	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125921449C>T	uc004bns.2	-	9	1191	c.761G>A	c.(760-762)TGT>TAT	p.C254Y	STRBP_uc004bnt.2_Missense_Mutation_p.C72Y|STRBP_uc004bnu.2_Missense_Mutation_p.C240Y|STRBP_uc004bnv.2_Missense_Mutation_p.C254Y	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	254	DZF.				multicellular organismal development	cytoplasm|nucleus	DNA binding			breast(1)|skin(1)	2						AGGTCTATTACAAGTACCTAT	0.398													33	129	---	---	---	---	PASS
NAIF1	203245	broad.mit.edu	37	9	130829300	130829300	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130829300C>G	uc004bta.2	-	1	300	c.81G>C	c.(79-81)AAG>AAC	p.K27N	NAIF1_uc004bsz.2_RNA|SLC25A25_uc004btb.2_5'Flank	NM_197956	NP_931045	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	27	Required for nuclear localization and apoptosis-inducing activity.				apoptosis|induction of apoptosis	nucleus					0						GCAGGTGCTTCTTCAGCTCCA	0.622													72	308	---	---	---	---	PASS
SPTAN1	6709	broad.mit.edu	37	9	131381253	131381253	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131381253G>C	uc004bvl.3	+	43	5802	c.5689G>C	c.(5689-5691)GAT>CAT	p.D1897H	SPTAN1_uc004bvm.3_Missense_Mutation_p.D1902H|SPTAN1_uc004bvn.3_Missense_Mutation_p.D1877H	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	1897	Spectrin 20.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						GGCCAGCGAAGATTATGGCGA	0.507													4	93	---	---	---	---	PASS
CCBL1	883	broad.mit.edu	37	9	131598152	131598152	+	Intron	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598152A>T	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	GCCCACCTGCAGCAGGGGCGC	0.617													9	71	---	---	---	---	PASS
NUP188	23511	broad.mit.edu	37	9	131733096	131733096	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131733096G>T	uc004bws.1	+	11	994	c.972G>T	c.(970-972)TTG>TTT	p.L324F		NM_015354	NP_056169	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	324					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7						CAGTGCTTTTGGCCTGGGCTC	0.488													33	159	---	---	---	---	PASS
TOR1B	27348	broad.mit.edu	37	9	132571783	132571783	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132571783T>C	uc004byk.1	+	5	992	c.932T>C	c.(931-933)ATG>ACG	p.M311T		NM_014506	NP_055321	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B) precursor	311					chaperone mediated protein folding requiring cofactor|response to unfolded protein	endoplasmic reticulum lumen	ATP binding|nucleoside-triphosphatase activity|unfolded protein binding				0		Ovarian(14;0.0586)				GCAGAGGAAATGACGTTTTTC	0.512													32	155	---	---	---	---	PASS
IDI1	3422	broad.mit.edu	37	10	1089329	1089329	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1089329T>A	uc001iga.2	-	3	436	c.318A>T	c.(316-318)TTA>TTT	p.L106F	C10orf110_uc010qaf.1_Intron|C10orf110_uc001ifx.3_Intron|C10orf110_uc001ifw.3_Intron|C10orf110_uc001ify.3_Intron|IDI1_uc001ifz.2_Missense_Mutation_p.L50F|IDI1_uc001igb.2_RNA|IDI1_uc001igc.2_Missense_Mutation_p.L50F	NM_004508	NP_004499	Q13907	IDI1_HUMAN	isopentenyl-diphosphate delta isomerase	49	Nudix hydrolase.				carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.221)	Epithelial(11;0.0972)		CTCGATGCAATAATCCTGAAA	0.353													11	114	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8115958	8115958	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8115958C>G	uc001ika.2	+	6	1861	c.1304C>G	c.(1303-1305)CCC>CGC	p.P435R	GATA3_uc001ijz.2_Missense_Mutation_p.P436R	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	435					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						CCACACCACCCCTCCAGCATG	0.627			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						10	76	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15729992	15729992	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15729992A>T	uc001ioc.1	-	3	389	c.389T>A	c.(388-390)TTC>TAC	p.F130Y	ITGA8_uc010qcb.1_Missense_Mutation_p.F130Y	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	130	Extracellular (Potential).|FG-GAP 2.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						ATTGGATTTGAACTCGATAGG	0.408													58	265	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16990574	16990574	+	Silent	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16990574A>T	uc001ioo.2	-	35	5164	c.5112T>A	c.(5110-5112)CCT>CCA	p.P1704P		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1704	CUB 11.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGATGTGATAGGATGGGGCA	0.507													11	57	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24874554	24874554	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24874554T>C	uc001isb.2	-	26	5151	c.4664A>G	c.(4663-4665)CAG>CGG	p.Q1555R	ARHGAP21_uc010qdb.1_RNA	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1554					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						CAGGGAGGCCTGGGAAGACGT	0.522													28	221	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26359049	26359049	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26359049C>T	uc001isn.2	+	13	1540	c.1180C>T	c.(1180-1182)CTA>TTA	p.L394L	MYO3A_uc009xko.1_Silent_p.L394L|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Silent_p.L394L	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	394	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity	p.L394I(1)		ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GCATTCCAAACTATATATTGG	0.303													13	104	---	---	---	---	PASS
GDF2	2658	broad.mit.edu	37	10	48414241	48414241	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48414241G>T	uc001jfa.1	-	2	790	c.627C>A	c.(625-627)AGC>AGA	p.S209R		NM_016204	NP_057288	Q9UK05	GDF2_HUMAN	growth differentiation factor 2 precursor	209					activin receptor signaling pathway|BMP signaling pathway|cartilage development|cellular iron ion homeostasis|growth|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of DNA replication|negative regulation of endothelial cell proliferation|ossification|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			ovary(2)|skin(1)	3						GCTTCACGGCGCTGGACACTT	0.572													29	155	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55626539	55626539	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55626539C>A	uc001jju.1	-	27	3975	c.3580G>T	c.(3580-3582)GGA>TGA	p.G1194*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.G1199*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.G1194*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.G1206*|PCDH15_uc010qht.1_Nonsense_Mutation_p.G1201*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.G1194*|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Nonsense_Mutation_p.G1194*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.G1157*|PCDH15_uc010qhx.1_Nonsense_Mutation_p.G1123*|PCDH15_uc010qhy.1_Nonsense_Mutation_p.G1199*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.G1194*|PCDH15_uc010qia.1_Nonsense_Mutation_p.G1172*|PCDH15_uc010qib.1_Nonsense_Mutation_p.G1172*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1194	Cadherin 11.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				ACTACAAATCCTTCTTTTCCC	0.378										HNSCC(58;0.16)			26	208	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67680377	67680377	+	Intron	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67680377T>C	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ACTGTCCAACTGTAGGGAAAA	0.313													20	133	---	---	---	---	PASS
USP54	159195	broad.mit.edu	37	10	75294514	75294514	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75294514T>C	uc001juo.2	-	10	1176	c.1159A>G	c.(1159-1161)ATC>GTC	p.I387V	USP54_uc001jum.2_RNA|USP54_uc001jun.2_Intron|USP54_uc001jup.2_Missense_Mutation_p.I387V|USP54_uc010qkl.1_Missense_Mutation_p.I387V	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	387					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					TCACTTGAGATGGAGGGCTCC	0.473													12	81	---	---	---	---	PASS
C10orf46	143384	broad.mit.edu	37	10	120488808	120488808	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120488808T>A	uc001lds.1	-	3	1080	c.596A>T	c.(595-597)CAG>CTG	p.Q199L	C10orf46_uc010qst.1_RNA	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46	199					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		GTTCTTTACCTGCAGCTCCTT	0.363													17	172	---	---	---	---	PASS
FANK1	92565	broad.mit.edu	37	10	127677168	127677168	+	Silent	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127677168G>C	uc001ljh.3	+	3	344	c.240G>C	c.(238-240)CTG>CTC	p.L80L	FANK1_uc010quk.1_Silent_p.L74L|FANK1_uc009yan.2_Silent_p.L80L|FANK1_uc001lji.2_Silent_p.L74L	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains	80	Fibronectin type-III.					cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CAAGGACGCTGTACAGATTTC	0.512													57	277	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5344690	5344690	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5344690G>T	uc001mao.1	-	1	893	c.838C>A	c.(838-840)CTC>ATC	p.L280I	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGAAAGAGGAAGTAGATG	0.363													63	123	---	---	---	---	PASS
HPX	3263	broad.mit.edu	37	11	6453216	6453216	+	Silent	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6453216C>A	uc001mdg.2	-	8	928	c.867G>T	c.(865-867)CGG>CGT	p.R289R	HPX_uc001mdf.2_Silent_p.R35R|HPX_uc009yfc.2_RNA	NM_000613	NP_000604	P02790	HEMO_HUMAN	hemopexin precursor	289	Hemopexin-like 4.				cellular iron ion homeostasis|interspecies interaction between organisms	extracellular space	heme transporter activity|metal ion binding|protein binding				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GCCAGCCATCCCGGCTGGTGT	0.577													25	228	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32663553	32663553	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32663553C>G	uc001mtv.2	-	13	1059	c.1015G>C	c.(1015-1017)GAG>CAG	p.E339Q	CCDC73_uc001mtw.1_Missense_Mutation_p.E329Q	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	339	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTTTCATGCTCATTTTGAAGA	0.244													25	54	---	---	---	---	PASS
SLC35C1	55343	broad.mit.edu	37	11	45832316	45832316	+	Intron	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45832316C>T	uc001nbp.2	+						SLC35C1_uc001nbo.2_Intron|SLC35C1_uc010rgm.1_Intron	NM_018389	NP_060859	Q96A29	FUCT1_HUMAN	GDP-fucose transporter 1 isoform a							Golgi membrane|integral to membrane	GDP-fucose transmembrane transporter activity				0				GBM - Glioblastoma multiforme(35;0.227)		ctcctcctctcccCACTGCAG	0.418													8	81	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46388861	46388861	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46388861G>C	uc001ncn.1	+	3	874	c.749G>C	c.(748-750)GGC>GCC	p.G250A	DGKZ_uc001nch.1_Missense_Mutation_p.G78A|DGKZ_uc010rgq.1_Missense_Mutation_p.G27A|DGKZ_uc001ncj.1_Missense_Mutation_p.G27A|DGKZ_uc010rgr.1_Missense_Mutation_p.G27A|DGKZ_uc001nck.1_5'UTR|DGKZ_uc001ncl.2_Missense_Mutation_p.G61A|DGKZ_uc001ncm.2_Missense_Mutation_p.G61A|DGKZ_uc009yky.1_Missense_Mutation_p.G61A|DGKZ_uc010rgs.1_Missense_Mutation_p.G61A|DGKZ_uc001nci.1_Missense_Mutation_p.G27A	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	250					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		ACCAAGTCGGGCCTCCAGCAC	0.662													8	63	---	---	---	---	PASS
FNBP4	23360	broad.mit.edu	37	11	47744580	47744580	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47744580G>A	uc009ylv.2	-	15	2906	c.2753C>T	c.(2752-2754)CCA>CTA	p.P918L	FNBP4_uc001ngi.2_Missense_Mutation_p.P232L|FNBP4_uc001ngj.2_Missense_Mutation_p.P825L	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	918	Pro-rich.									ovary(1)	1						TTTGGGAGCtggtggtggtgg	0.299													4	8	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579674	55579674	+	Missense_Mutation	SNP	C	A	A	rs145975508		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579674C>A	uc001nhw.1	+	1	732	c.732C>A	c.(730-732)CAC>CAA	p.H244Q		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				GTGCTTCCCACCTCACAGCTA	0.517													18	181	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579675	55579675	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579675C>A	uc001nhw.1	+	1	733	c.733C>A	c.(733-735)CTC>ATC	p.L245I		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				TGCTTCCCACCTCACAGCTAT	0.517													18	181	---	---	---	---	PASS
PRG3	10394	broad.mit.edu	37	11	57144317	57144317	+	3'UTR	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57144317G>A	uc001njv.1	-	6						NM_006093	NP_006084	Q9Y2Y8	PRG3_HUMAN	proteoglycan 3 precursor						basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0						TCTCCGTGCCGCTGGCTTAGA	0.567													39	282	---	---	---	---	PASS
GIF	2694	broad.mit.edu	37	11	59610591	59610591	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59610591G>T	uc001noi.2	-	3	328	c.280C>A	c.(280-282)CTC>ATC	p.L94I	GIF_uc010rkz.1_Missense_Mutation_p.L94I	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	94					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						ATGATGGTGAGGCCGAGCTGC	0.532													9	101	---	---	---	---	PASS
GIF	2694	broad.mit.edu	37	11	59610592	59610592	+	Silent	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59610592G>C	uc001noi.2	-	3	327	c.279C>G	c.(277-279)GGC>GGG	p.G93G	GIF_uc010rkz.1_Silent_p.G93G	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	93					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						TGATGGTGAGGCCGAGCTGCC	0.527													9	101	---	---	---	---	PASS
STIP1	10963	broad.mit.edu	37	11	63967716	63967716	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63967716A>G	uc001nyk.1	+	10	1343	c.1196A>G	c.(1195-1197)AAT>AGT	p.N399S	STIP1_uc010rnb.1_Missense_Mutation_p.N375S	NM_006819	NP_006810	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1	399	TPR 8.				axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3						TTATACAGCAATCGAGCTGCC	0.512													142	328	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66191621	66191621	+	Silent	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66191621T>C	uc001ohx.1	+	7	1436	c.1260T>C	c.(1258-1260)CTT>CTC	p.L420L	NPAS4_uc010rpc.1_Silent_p.L210L	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	420					transcription, DNA-dependent		DNA binding|signal transducer activity				0						GCAAGGATCTTGTGTGCACTC	0.562													50	313	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70332960	70332960	+	Silent	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70332960C>A	uc001oqc.2	-	21	3516	c.3438G>T	c.(3436-3438)CCG>CCT	p.P1146P	SHANK2_uc010rqn.1_Silent_p.P558P|SHANK2_uc001opz.2_Silent_p.P551P|uc009ysn.1_Intron|SHANK2_uc001opy.2_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	767					intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GCGTGGCACTCGGCATGGGGG	0.687													18	108	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78380299	78380299	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78380299C>A	uc001ozl.3	-	32	7554	c.7091G>T	c.(7090-7092)GGG>GTG	p.G2364V	ODZ4_uc001ozk.3_Missense_Mutation_p.G589V|ODZ4_uc009yvb.1_Missense_Mutation_p.G948V	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2364	Extracellular (Potential).|YD 23.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						AAGAGGGGTCCCGATGTTGTC	0.483													64	140	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83170850	83170850	+	3'UTR	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83170850C>T	uc001paj.2	-	23					DLG2_uc001pai.2_3'UTR|DLG2_uc010rsy.1_3'UTR|DLG2_uc010rsz.1_3'UTR|DLG2_uc010rta.1_3'UTR|DLG2_uc001pak.2_3'UTR|DLG2_uc010rsw.1_3'UTR|DLG2_uc010rsx.1_3'UTR	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GTCAGAGGCGCAGTAGCTAAT	0.343													12	104	---	---	---	---	PASS
KBTBD3	143879	broad.mit.edu	37	11	105929622	105929622	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105929622C>A	uc001pja.2	-	3	843	c.203G>T	c.(202-204)TGT>TTT	p.C68F	KBTBD3_uc001pjb.2_Missense_Mutation_p.C68F|KBTBD3_uc009yxm.2_Intron	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3	64	BTB.									ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		TGCTAACACACAACGATGACA	0.308													5	130	---	---	---	---	PASS
C11orf52	91894	broad.mit.edu	37	11	111789712	111789712	+	Missense_Mutation	SNP	T	A	A	rs140110474		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111789712T>A	uc001pmh.2	+	2	499	c.16T>A	c.(16-18)TGC>AGC	p.C6S	HSPB2_uc009yyj.2_RNA|C11orf52_uc001pmi.2_Missense_Mutation_p.C6S	NM_080659	NP_542390	Q96A22	CK052_HUMAN	hypothetical protein LOC91894	6										ovary(1)	1		all_cancers(61;8.8e-15)|all_epithelial(67;6.27e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.63e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.7e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)		AAACCGGGTCTGCTGCGGAGG	0.557													14	80	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	121037356	121037356	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121037356G>T	uc010rzo.1	+	17	5453	c.5453G>T	c.(5452-5454)TGC>TTC	p.C1818F		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1818	ZP.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ATATCTAAGTGCAAGCTCTTC	0.483													14	210	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135322	124135322	+	IGR	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135322G>T								OR8G2 (39012 upstream) : OR8D1 (44415 downstream)																							GTATGTTTAGGGTTCAATTCT	0.358													91	369	---	---	---	---	PASS
OR8D1	283159	broad.mit.edu	37	11	124179936	124179936	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124179936A>T	uc010sag.1	-	1	727	c.727T>A	c.(727-729)TCT>ACT	p.S243T		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		ATGAGATGAGAGCTGCATGTT	0.522													8	101	---	---	---	---	PASS
ESAM	90952	broad.mit.edu	37	11	124624230	124624230	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124624230C>A	uc001qav.3	-	6	910	c.737G>T	c.(736-738)GGA>GTA	p.G246V	VSIG2_uc001qas.2_5'Flank|VSIG2_uc001qat.2_5'Flank|ESAM_uc010sao.1_Missense_Mutation_p.G67V|ESAM_uc001qau.3_Missense_Mutation_p.G173V|ESAM_uc001qaw.3_RNA|ESAM_uc001qax.3_RNA|ESAM_uc009zbi.2_Missense_Mutation_p.G246V	NM_138961	NP_620411	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule precursor	246	Extracellular (Potential).				blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction					0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		CACTGCAGCTCCAGGCCCTGG	0.637													15	51	---	---	---	---	PASS
ROBO3	64221	broad.mit.edu	37	11	124748308	124748308	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124748308G>T	uc001qbc.2	+	22	3488	c.3296G>T	c.(3295-3297)GGG>GTG	p.G1099V	ROBO3_uc001qbd.2_Missense_Mutation_p.G24V|ROBO3_uc010sar.1_Missense_Mutation_p.G148V|ROBO3_uc001qbe.2_Missense_Mutation_p.G24V|ROBO3_uc001qbf.1_Intron	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	1099	Cytoplasmic (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TGCCTAGAAGGGCCGGAGGAG	0.632													12	82	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128844013	128844013	+	Intron	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128844013C>T	uc009zcp.2	-						ARHGAP32_uc009zcq.1_Missense_Mutation_p.V973I|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Intron	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1						cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						GGAAAACAAACGGTACCTGTC	0.448													16	175	---	---	---	---	PASS
PARP11	57097	broad.mit.edu	37	12	3931253	3931253	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3931253G>A	uc001qmk.1	-	4	449	c.394C>T	c.(394-396)CAG>TAG	p.Q132*	PARP11_uc001qml.2_Nonsense_Mutation_p.Q139*|PARP11_uc009zef.2_RNA|PARP11_uc001qmm.2_Nonsense_Mutation_p.Q58*|PARP11_uc001qmn.2_Nonsense_Mutation_p.Q58*	NM_020367	NP_065100	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	132	PARP catalytic.						NAD+ ADP-ribosyltransferase activity			ovary(1)|central_nervous_system(1)	2			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			GCTCTTACCTGATATGGTACT	0.378													34	176	---	---	---	---	PASS
ACSM4	341392	broad.mit.edu	37	12	7480901	7480901	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7480901C>T	uc001qsx.1	+	13	1675	c.1675C>T	c.(1675-1677)CTC>TTC	p.L559F		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	559					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						TGTTCAAGAACTCCCAAAGAC	0.403													5	15	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40728758	40728758	+	Intron	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40728758G>A	uc001rmg.3	+						LRRK2_uc009zjw.2_Intron|LRRK2_uc001rmi.2_Intron	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2						activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CATGATTTTGGACTTTTGCAG	0.458													32	155	---	---	---	---	PASS
KRT72	140807	broad.mit.edu	37	12	52979845	52979845	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52979845C>G	uc001sar.2	-	9	1543	c.1457G>C	c.(1456-1458)GGC>GCC	p.G486A	KRT72_uc001saq.2_Missense_Mutation_p.G486A|KRT72_uc010sns.1_Missense_Mutation_p.G444A|KRT72_uc010snt.1_Missense_Mutation_p.G298A	NM_001146225	NP_001139697	Q14CN4	K2C72_HUMAN	keratin 72 isoform 1	486	Tail.					keratin filament	structural molecule activity			ovary(5)|pancreas(1)	6				BRCA - Breast invasive adenocarcinoma(357;0.195)		GCCACAGCTGCCTTTGGTCTT	0.567													61	284	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70964993	70964993	+	Silent	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70964993A>G	uc001swb.3	-	11	2559	c.2529T>C	c.(2527-2529)AAT>AAC	p.N843N	PTPRB_uc010sto.1_Silent_p.N843N|PTPRB_uc010stp.1_Silent_p.N753N|PTPRB_uc001swc.3_Silent_p.N1061N|PTPRB_uc001swa.3_Silent_p.N973N|PTPRB_uc001swd.3_Silent_p.N1060N|PTPRB_uc009zrr.1_Silent_p.N940N	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	843	Fibronectin type-III 10.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CGACATCCCCATTAGCTCCTG	0.438													29	63	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94975677	94975677	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94975677T>A	uc001tdj.2	-	2	834	c.716A>T	c.(715-717)TAC>TTC	p.Y239F	TMCC3_uc001tdi.2_Missense_Mutation_p.Y208F	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	239						integral to membrane				ovary(1)|skin(1)	2						GCTGCCCCCGTAGGCCCTGGC	0.537													47	167	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99638142	99638142	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99638142T>G	uc001tge.1	-	14	2814	c.2397A>C	c.(2395-2397)AAA>AAC	p.K799N	ANKS1B_uc001tgf.1_Missense_Mutation_p.K379N|ANKS1B_uc001tgk.2_Missense_Mutation_p.K96N	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	799						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CATTCATCTCTTTAAGTTCGT	0.313													14	69	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100930750	100930750	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100930750G>C	uc001tht.1	+	6	914	c.886G>C	c.(886-888)GAA>CAA	p.E296Q	NR1H4_uc001thp.1_Missense_Mutation_p.E282Q|NR1H4_uc001thq.1_Missense_Mutation_p.E286Q|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Missense_Mutation_p.E286Q|NR1H4_uc010svk.1_Missense_Mutation_p.E235Q|NR1H4_uc001ths.1_Missense_Mutation_p.E292Q	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	296	Ligand-binding.				bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CAGTGCAGAAGAAAATTTTCT	0.244													26	302	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104380873	104380873	+	3'UTR	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104380873G>A	uc001tkg.2	+	10					TDG_uc009zuk.2_3'UTR|TDG_uc010swi.1_3'UTR|TDG_uc010swj.1_3'UTR	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase						depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		GCTTAAGAATGGTGCTTCTCA	0.388								BER_DNA_glycosylases					7	133	---	---	---	---	PASS
NUAK1	9891	broad.mit.edu	37	12	106480624	106480624	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106480624T>C	uc001tlj.1	-	3	1781	c.401A>G	c.(400-402)TAT>TGT	p.Y134C		NM_014840	NP_055655	O60285	NUAK1_HUMAN	AMPK-related protein kinase 5	134	Protein kinase.						ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2						TTTGCTGGCATATTCCATGAT	0.498													30	173	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106820975	106820975	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106820975C>T	uc001tlp.2	+	13	1324	c.1102C>T	c.(1102-1104)CTT>TTT	p.L368F	POLR3B_uc001tlq.2_Missense_Mutation_p.L310F	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	368					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						TTTTTTTTAGCTTTTATCTCT	0.274													5	17	---	---	---	---	PASS
CCDC60	160777	broad.mit.edu	37	12	119866545	119866545	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119866545A>T	uc001txe.2	+	2	613	c.148A>T	c.(148-150)AAA>TAA	p.K50*	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	50										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AATAAACCTCAAAAAGGACCT	0.453													6	28	---	---	---	---	PASS
TRPC4	7223	broad.mit.edu	37	13	38357251	38357251	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38357251G>T	uc001uws.2	-	2	455	c.220C>A	c.(220-222)CTC>ATC	p.L74I	TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.L74I|TRPC4_uc010tey.1_Missense_Mutation_p.L74I|TRPC4_uc010abw.2_Missense_Mutation_p.L74I|TRPC4_uc010abx.2_Missense_Mutation_p.L74I|TRPC4_uc010aby.2_Missense_Mutation_p.L74I	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	74	ANK 2.|Cytoplasmic (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		gcaatgaggagagcagttctt	0.209													46	159	---	---	---	---	PASS
MTRF1	9617	broad.mit.edu	37	13	41834927	41834927	+	Silent	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41834927C>A	uc001uxx.2	-	4	587	c.117G>T	c.(115-117)CTG>CTT	p.L39L	MTRF1_uc001uxy.2_Silent_p.L39L|MTRF1_uc001uxz.2_5'UTR|MTRF1_uc010tff.1_Silent_p.L52L|MTRF1_uc001uyc.1_Silent_p.L39L	NM_004294	NP_004285	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	39					regulation of translational termination	mitochondrion	translation release factor activity, codon specific				0		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		TAAAAACTTGCAGCCTTGTAT	0.393													39	199	---	---	---	---	PASS
UTP14C	9724	broad.mit.edu	37	13	52604681	52604681	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52604681G>C	uc001vgb.2	+	2	2276	c.1741G>C	c.(1741-1743)GAG>CAG	p.E581Q	UTP14C_uc001vgc.2_RNA	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	581					cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AATAATAGAGGAGCTGGAAGA	0.458													27	109	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58208193	58208193	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208193G>A	uc001vhq.1	+	1	2405	c.1513G>A	c.(1513-1515)GGC>AGC	p.G505S	PCDH17_uc010aec.1_Missense_Mutation_p.G505S	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	505	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GGGCCAGAACGGCACCGTATC	0.597													13	78	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	75915719	75915719	+	Silent	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75915719G>C	uc001vjl.1	-	6	1760	c.1413C>G	c.(1411-1413)CTC>CTG	p.L471L	TBC1D4_uc010aer.2_Silent_p.L471L|TBC1D4_uc010aes.2_Silent_p.L471L	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	471						cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		TTGGTGGGTAGAGACCTAAGG	0.453													14	102	---	---	---	---	PASS
SOX1	6656	broad.mit.edu	37	13	112722245	112722245	+	Silent	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112722245C>A	uc001vsb.1	+	1	333	c.273C>A	c.(271-273)GTC>GTA	p.V91V		NM_005986	NP_005977	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	91	HMG box.				chromatin organization	nucleus	core promoter sequence-specific DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		AGTGGAAGGTCATGTCCGAGG	0.662													7	34	---	---	---	---	PASS
ATP4B	496	broad.mit.edu	37	13	114307223	114307223	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114307223C>A	uc001vtz.2	-	4	562	c.520G>T	c.(520-522)GAA>TAA	p.E174*	ATP4B_uc010agy.1_Nonsense_Mutation_p.E174*	NM_000705	NP_000696	P51164	ATP4B_HUMAN	hydrogen/potassium-exchanging ATPase 4B	174	Extracellular (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	hydrogen:potassium-exchanging ATPase activity|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)		Rabeprazole(DB01129)	GGCTTTCCTTCTTCAAAGCCG	0.522													13	71	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21968795	21968795	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21968795G>A	uc001wbc.2	-	6	1238	c.1146C>T	c.(1144-1146)GAC>GAT	p.D382D	METTL3_uc001wbb.2_Silent_p.D227D	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	382				D -> V (in Ref. 1; AAB71850).	gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		AGATACTGACGTCCAGGTAGC	0.493													27	160	---	---	---	---	PASS
MIR624	693209	broad.mit.edu	37	14	31483884	31483884	+	RNA	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31483884C>T	hsa-mir-624|MI0003638	-			c.65C>T			STRN3_uc001wqu.2_Intron|STRN3_uc001wqv.2_Intron|STRN3_uc010tpj.1_Intron																	0						AAGGTAATACCAATACCTTGT	0.323													2	1	---	---	---	---	PASS
C14orf43	91748	broad.mit.edu	37	14	74189513	74189513	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74189513T>A	uc001xot.2	-	10	3395	c.2612A>T	c.(2611-2613)TAC>TTC	p.Y871F	C14orf43_uc001xos.2_Missense_Mutation_p.Y136F|C14orf43_uc001xou.2_Missense_Mutation_p.Y871F|C14orf43_uc010tud.1_Missense_Mutation_p.Y871F|C14orf43_uc010arw.2_RNA	NM_194278	NP_919254	Q6PJG2	CN043_HUMAN	hypothetical protein LOC91748	871	SANT.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00358)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)|OV - Ovarian serous cystadenocarcinoma(108;0.115)		GTAGGTGTAGTAGAACTCCAC	0.522													160	330	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81251423	81251423	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81251423T>C	uc001xux.2	-	14	2198	c.2027A>G	c.(2026-2028)GAT>GGT	p.D676G	C14orf145_uc010asz.1_RNA	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	676	Potential.					centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGTTTCTTCATCCCTGGATTT	0.453													11	356	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28502333	28502333	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28502333C>T	uc001zbj.2	-	17	2497	c.2391G>A	c.(2389-2391)ATG>ATA	p.M797I	HERC2_uc001zbl.1_Missense_Mutation_p.M492I	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	797					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCTCAAAAGTCATTGAGCAGA	0.547													13	121	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346239	29346239	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346239T>C	uc001zck.2	+	3	359	c.152T>C	c.(151-153)CTG>CCG	p.L51P	APBA2_uc010azj.2_Missense_Mutation_p.L51P|APBA2_uc010uat.1_Missense_Mutation_p.L51P|APBA2_uc001zcl.2_Missense_Mutation_p.L51P|APBA2_uc010uas.1_Missense_Mutation_p.L51P	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	51					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CTGGCTGCCCTGCGGCCAGAG	0.657													41	106	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35222550	35222550	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35222550T>C	uc001ziv.2	-	12	1104	c.923A>G	c.(922-924)TAT>TGT	p.Y308C		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	308						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AAAACCAGTATAGAATTTAAG	0.303													123	337	---	---	---	---	PASS
C15orf41	84529	broad.mit.edu	37	15	37100543	37100543	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37100543C>T	uc001zje.3	+	11	985	c.735C>T	c.(733-735)GTC>GTT	p.V245V	C15orf41_uc001zjd.2_Silent_p.V245V|C15orf41_uc010bbb.1_Silent_p.V147V|C15orf41_uc001zjf.2_Silent_p.V147V|C15orf41_uc010uci.1_Silent_p.V147V|CSNK1A1P_uc001zjg.3_Intron	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1	245							protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		CAGGCTTAGTCATCTATTGGT	0.458													14	187	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43038444	43038444	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43038444T>C	uc001zqo.2	-	15	3723	c.3284A>G	c.(3283-3285)TAT>TGT	p.Y1095C	TTBK2_uc010bcy.2_Missense_Mutation_p.Y1026C|uc001zqn.2_5'Flank	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	1095					cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TAGGACTTTATATCTGCGTAG	0.393													13	69	---	---	---	---	PASS
C15orf63	25764	broad.mit.edu	37	15	44085281	44085281	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44085281G>T	uc001ztb.2	+	2	517	c.34G>T	c.(34-36)GCT>TCT	p.A12S	ELL3_uc001zsx.1_Intron|SERF2_uc010bdq.2_Missense_Mutation_p.R39M|SERF2_uc010uee.1_Missense_Mutation_p.G12W|SERF2_uc001zsz.3_Missense_Mutation_p.R39M	NM_016400	NP_057484	Q9NX55	HYPK_HUMAN	chromosome 15 open reading frame 63	Error:Variant_position_missing_in_Q9NX55_after_alignment											0						CGCAAGCAGAGGTAGCCCCAG	0.577													6	37	---	---	---	---	PASS
FGF7	2252	broad.mit.edu	37	15	49716483	49716483	+	5'UTR	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49716483C>A	uc001zxn.2	+	2					C15orf33_uc001zxl.2_Intron|C15orf33_uc001zxm.2_Intron	NM_002009	NP_002000	P21781	FGF7_HUMAN	fibroblast growth factor 7 precursor						actin cytoskeleton reorganization|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|mesenchymal cell proliferation|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization at cell surface|secretion by lung epithelial cell involved in lung growth		chemoattractant activity|growth factor activity				0		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)	Palifermin(DB00039)	ACACCCGGAGCACTACACTAT	0.368													51	236	---	---	---	---	PASS
ONECUT1	3175	broad.mit.edu	37	15	53080992	53080992	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53080992C>A	uc002aci.1	-	1	1218	c.1090G>T	c.(1090-1092)GCG>TCG	p.A364S		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	364	CUT.				endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		AAGCGGAGCGCGGACATGCGC	0.637													24	72	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77046217	77046217	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77046217G>A	uc002bby.2	-	14	1857	c.1798C>T	c.(1798-1800)CAT>TAT	p.H600Y	SCAPER_uc002bbx.2_Missense_Mutation_p.H354Y|SCAPER_uc002bbz.1_Missense_Mutation_p.H471Y|SCAPER_uc002bca.1_Missense_Mutation_p.H465Y|SCAPER_uc002bcb.1_Missense_Mutation_p.H606Y	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	599	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						AACTCAGCATGAAGTAATTTT	0.378													69	385	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79755579	79755579	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79755579G>A	uc002bew.1	+	3	2544	c.2469G>A	c.(2467-2469)GTG>GTA	p.V823V	KIAA1024_uc010unk.1_Silent_p.V823V	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	823						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						TGGCCGAGGTGAAGCGGGGCC	0.612													64	159	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84611786	84611786	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84611786T>A	uc002bjz.3	+	19	2666	c.2442T>A	c.(2440-2442)TGT>TGA	p.C814*	ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.C814*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.C814*	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	814	TSP type-1 6.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			ACAAGTCCTGTGCCAGGACAG	0.512													13	185	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1394216	1394216	+	Intron	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1394216G>T	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				TCAGCGTGCTGCCCCCACCCA	0.672													19	119	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1545504	1545504	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1545504G>T	uc002cly.2	+	3	784	c.493G>T	c.(493-495)GAT>TAT	p.D165Y	TELO2_uc010uvg.1_Missense_Mutation_p.D165Y	NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	165						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				GGCCCTGCCCGATCACCTGGG	0.682													4	43	---	---	---	---	PASS
C16orf73	254528	broad.mit.edu	37	16	1884318	1884318	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1884318G>A	uc002cne.2	-	13	1386	c.1268C>T	c.(1267-1269)TCG>TTG	p.S423L	FAHD1_uc002cnd.2_Intron|FAHD1_uc010brz.2_Intron|C16orf73_uc010uvq.1_Missense_Mutation_p.S452L|C16orf73_uc010uvr.1_Missense_Mutation_p.S245L	NM_152764	NP_689977	Q8N635	CP073_HUMAN	hypothetical protein LOC254528 isoform 2	423					meiosis	cytoplasm					0						AAGCTTGCACGAGAGTACACT	0.383													19	134	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	8992280	8992280	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8992280G>A	uc002czl.2	-	25	2854	c.2655C>T	c.(2653-2655)ATC>ATT	p.I885I	USP7_uc010uyk.1_Silent_p.I786I|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Silent_p.I786I|USP7_uc002czk.2_Silent_p.I869I	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	885					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						CAAAGTCTGTGATTTTCATCT	0.313													47	232	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15100389	15100389	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15100389A>G	uc002dda.3	+	6	752	c.528A>G	c.(526-528)ATA>ATG	p.I176M	PDXDC1_uc010uzl.1_Missense_Mutation_p.I161M|PDXDC1_uc010uzm.1_Missense_Mutation_p.I85M|PDXDC1_uc010bvc.1_Missense_Mutation_p.I117M|PDXDC1_uc002dcz.2_Missense_Mutation_p.I176M|PDXDC1_uc002ddb.3_Missense_Mutation_p.I149M|PDXDC1_uc010uzn.1_Missense_Mutation_p.I148M|PDXDC1_uc002ddc.2_Missense_Mutation_p.I176M	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	176					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AGCCTGTCATATATCTTAGTG	0.393													29	263	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20551990	20551990	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20551990T>A	uc002dhj.3	-	14	1825	c.1615A>T	c.(1615-1617)AAG>TAG	p.K539*	ACSM2B_uc002dhk.3_Nonsense_Mutation_p.K539*	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	539					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						CTTGGGTACTTGTATGGGGCT	0.478													39	193	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22328500	22328500	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22328500G>C	uc002dkk.2	+	12	994	c.838G>C	c.(838-840)GAT>CAT	p.D280H	POLR3E_uc002dkj.1_Missense_Mutation_p.D280H|POLR3E_uc002dkm.2_Missense_Mutation_p.D244H|POLR3E_uc010vbr.1_Missense_Mutation_p.D280H|POLR3E_uc002dkl.2_Missense_Mutation_p.D280H|POLR3E_uc010vbs.1_Missense_Mutation_p.D244H|POLR3E_uc010vbt.1_Missense_Mutation_p.D224H	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	280					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		GCCCCTGGCCGATCAGATCAA	0.642													28	162	---	---	---	---	PASS
TUFM	7284	broad.mit.edu	37	16	28855622	28855622	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28855622C>G	uc002drh.2	-	7	990	c.851G>C	c.(850-852)CGT>CCT	p.R284P	uc010vct.1_Intron|SH2B1_uc002dri.2_5'Flank	NM_003321	NP_003312	P49411	EFTU_HUMAN	Tu translation elongation factor, mitochondrial	281						mitochondrial nucleoid	GTP binding|GTPase activity|protein binding|translation elongation factor activity			ovary(1)	1						TAAAATGCCACGCTCTAGTGT	0.562													35	252	---	---	---	---	PASS
ARMC5	79798	broad.mit.edu	37	16	31471257	31471257	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31471257G>T	uc002ecc.2	+	1	941	c.412G>T	c.(412-414)GAT>TAT	p.D138Y	ARMC5_uc010vfn.1_Missense_Mutation_p.D233Y|ARMC5_uc010vfo.1_Missense_Mutation_p.D170Y|ARMC5_uc002eca.3_Missense_Mutation_p.D138Y|ARMC5_uc010vfp.1_Missense_Mutation_p.D138Y|ARMC5_uc002ecb.2_Missense_Mutation_p.D138Y	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	138							binding			pancreas(1)	1						CATCCTAGCCGATTGCTGTAC	0.547													20	137	---	---	---	---	PASS
ACD	65057	broad.mit.edu	37	16	67694322	67694322	+	Silent	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67694322T>A	uc002etq.3	-	1	397	c.60A>T	c.(58-60)GCA>GCT	p.A20A	ACD_uc002etp.3_Silent_p.A20A|ACD_uc002etr.3_Silent_p.A20A|ACD_uc010vjt.1_Silent_p.A10A|PARD6A_uc002ets.2_5'Flank|PARD6A_uc002ett.2_5'Flank|PARD6A_uc002etu.2_5'Flank	NM_001082486	NP_001075955	Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog isoform 1	20					intracellular protein transport|negative regulation of telomere maintenance via telomerase|positive regulation of single-stranded telomeric DNA binding|positive regulation of telomerase activity|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|telomere assembly	nuclear telomere cap complex|nucleoplasm	DNA binding|DNA polymerase binding			pancreas(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		ACCCCGCTGGTGCACGGGATG	0.687													6	29	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75276604	75276604	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75276604G>T	uc002fdv.2	-	2	520	c.397C>A	c.(397-399)CCC>ACC	p.P133T	BCAR1_uc010cgu.2_Missense_Mutation_p.P104T|BCAR1_uc010vna.1_Missense_Mutation_p.P131T|BCAR1_uc010vnb.1_Missense_Mutation_p.P179T|BCAR1_uc002fdw.2_Missense_Mutation_p.P133T|BCAR1_uc010vnc.1_Intron|BCAR1_uc010vnd.1_Missense_Mutation_p.P151T|BCAR1_uc002fdx.2_Missense_Mutation_p.P151T	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	133	Substrate for kinases (By similarity).				actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGAGGGCTGGGACCCGGGACT	0.637													14	324	---	---	---	---	PASS
MBTPS1	8720	broad.mit.edu	37	16	84094378	84094378	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84094378C>T	uc002fhi.2	-	20	3115	c.2613G>A	c.(2611-2613)TCG>TCA	p.S871S	MBTPS1_uc002fhh.2_Silent_p.S375S	NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	871	Lumenal (Potential).				cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						TCACCCCATACGATGTGTACT	0.483													5	23	---	---	---	---	PASS
ZCCHC14	23174	broad.mit.edu	37	16	87445175	87445175	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87445175G>C	uc002fjz.1	-	12	2768	c.2741C>G	c.(2740-2742)ACT>AGT	p.T914S	ZCCHC14_uc002fka.1_RNA|ZCCHC14_uc002fkb.2_Missense_Mutation_p.T690S	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	914	CCHC-type.				cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GCGGTGACCAGTGGCCCCGCA	0.627													61	291	---	---	---	---	PASS
CBFA2T3	863	broad.mit.edu	37	16	88951483	88951483	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88951483C>T	uc002fmm.1	-	7	1274	c.1088G>A	c.(1087-1089)CGG>CAG	p.R363Q	CBFA2T3_uc002fml.1_Missense_Mutation_p.R277Q|CBFA2T3_uc010cif.1_Missense_Mutation_p.R302Q|CBFA2T3_uc002fmn.1_Missense_Mutation_p.R338Q	NM_005187	NP_005178	O75081	MTG16_HUMAN	myeloid translocation gene on chromosome 16	363	Mediates localization to the nucleus (By similarity).|Mediates interaction with PDE7A (in isoform 2).				cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)		TCGTAGCTCCCGGGGGTCTGG	0.687			T	RUNX1	AML								10	42	---	---	---	---	PASS
CAMTA2	23125	broad.mit.edu	37	17	4883174	4883174	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4883174C>A	uc002gah.1	-	9	1551	c.1443G>T	c.(1441-1443)AGG>AGT	p.R481S	CAMTA2_uc010cku.1_Missense_Mutation_p.R504S|CAMTA2_uc002gag.1_Missense_Mutation_p.R480S|CAMTA2_uc002gai.1_Missense_Mutation_p.R483S|CAMTA2_uc010ckv.1_Missense_Mutation_p.R128S|CAMTA2_uc010vsu.1_Missense_Mutation_p.R294S	NM_015099	NP_055914	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	481					cardiac muscle hypertrophy in response to stress|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	calmodulin binding|chromatin binding|histone deacetylase binding|transcription factor binding			ovary(1)	1						CTCTTCCTACCCTGCTTGACG	0.453													86	168	---	---	---	---	PASS
MYH10	4628	broad.mit.edu	37	17	8526239	8526239	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8526239T>C	uc002gll.2	-	2	422	c.326A>G	c.(325-327)TAC>TGC	p.Y109C	MYH10_uc002glm.2_Missense_Mutation_p.Y109C|MYH10_uc010cnx.2_Missense_Mutation_p.Y109C	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle	109	Myosin head-like.				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						TCCTGAATAGTAGCGATCCTT	0.348													49	100	---	---	---	---	PASS
MYO1D	4642	broad.mit.edu	37	17	30821850	30821850	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30821850G>A	uc002hho.1	-	22	2960	c.2948C>T	c.(2947-2949)ACG>ATG	p.T983M		NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	983						myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GTTGAGCCGCGTCTCCACGGA	0.637													7	64	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34190546	34190546	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34190546C>T	uc002hke.1	-	7	734	c.585G>A	c.(583-585)GAG>GAA	p.E195E	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Silent_p.E155E|C17orf66_uc010wcm.1_Silent_p.E161E	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	195							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		ACTTCACTTTCTCTGGACCAG	0.383													33	195	---	---	---	---	PASS
C17orf104	284071	broad.mit.edu	37	17	42744135	42744135	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42744135G>C	uc010czv.2	+	5	856	c.856G>C	c.(856-858)GAT>CAT	p.D286H	C17orf104_uc002igy.1_Missense_Mutation_p.D120H|C17orf104_uc002igz.3_Missense_Mutation_p.D120H|C17orf104_uc010wja.1_RNA|C17orf104_uc002iha.2_Missense_Mutation_p.D120H	NM_001145080	NP_001138552	A2RUB1	CQ104_HUMAN	hypothetical protein LOC284071	286										central_nervous_system(1)	1						ATCAGGAGTTGATATCTACCA	0.348													6	61	---	---	---	---	PASS
FMNL1	752	broad.mit.edu	37	17	43319802	43319802	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43319802C>T	uc002iin.2	+	16	2180	c.1980C>T	c.(1978-1980)TTC>TTT	p.F660F	FMNL1_uc002iiq.2_Silent_p.F238F|FMNL1_uc010dag.2_RNA	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	660	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						GCACTGTCTTCACAGAGCTCA	0.587													52	115	---	---	---	---	PASS
LUC7L3	51747	broad.mit.edu	37	17	48797172	48797172	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48797172G>T	uc002isr.2	+	1	196	c.79G>T	c.(79-81)GTG>TTG	p.V27L	LUC7L3_uc002isp.1_5'UTR|LUC7L3_uc010wmw.1_5'UTR|LUC7L3_uc002isq.2_Missense_Mutation_p.V27L|LUC7L3_uc002iss.2_Missense_Mutation_p.V27L	NM_006107	NP_006098	O95232	LC7L3_HUMAN	LUC7-like 3	27					apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0						GCGCAGCAACGTGCGGTGGGA	0.697													4	26	---	---	---	---	PASS
MRC2	9902	broad.mit.edu	37	17	60754815	60754815	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60754815G>T	uc002jad.2	+	12	2422	c.2020G>T	c.(2020-2022)GCC>TCC	p.A674S	MRC2_uc010ddq.1_RNA	NM_006039	NP_006030	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	674	Extracellular (Potential).				endocytosis	integral to membrane	receptor activity|sugar binding			ovary(1)|central_nervous_system(1)|skin(1)	3						CCAGGGCTGGGCCTCGGACAC	0.657													5	34	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66921013	66921013	+	Intron	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66921013A>G	uc002jhp.2	-						ABCA8_uc002jhq.2_Intron|ABCA8_uc010wqq.1_Intron|ABCA8_uc010wqr.1_Intron|ABCA8_uc002jhr.2_Intron	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8							integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					ATATTCATCTACATGGCCAGA	0.438													41	129	---	---	---	---	PASS
UNK	85451	broad.mit.edu	37	17	73780870	73780870	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73780870C>G	uc002jpm.2	+	2	137	c.137C>G	c.(136-138)TCG>TGG	p.S46W	UNK_uc002jpn.2_RNA|UNK_uc002jpo.2_RNA	NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	Error:Variant_position_missing_in_Q9C0B0_after_alignment							nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTCACGTTCTCGTGGCGCGGC	0.612													7	60	---	---	---	---	PASS
LGALS3BP	3959	broad.mit.edu	37	17	76967746	76967746	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76967746G>A	uc002jwh.2	-	6	1849	c.1670C>T	c.(1669-1671)TCC>TTC	p.S557F	LGALS3BP_uc002jwi.2_Missense_Mutation_p.S363F|LGALS3BP_uc010dhr.2_Missense_Mutation_p.S363F	NM_005567	NP_005558	Q08380	LG3BP_HUMAN	galectin 3 binding protein	557					cell adhesion|cellular defense response	extracellular space|membrane|proteinaceous extracellular matrix	protein binding|scavenger receptor activity			central_nervous_system(3)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GGGGAAGGAGGAGGTGCTCTT	0.632											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	141	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2934442	2934442	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2934442T>C	uc002klo.2	-	8	1414	c.1175A>G	c.(1174-1176)CAC>CGC	p.H392R		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	392					fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GCTTCTTTTGTGAACACCTGT	0.373													16	135	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14179555	14179555	+	Silent	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14179555G>T	uc010xag.1	+	1	460	c.162G>T	c.(160-162)GCG>GCT	p.A54A						RecName: Full=Putative ankyrin repeat domain-containing protein 20A5;																		GCTGTCTGGCGCGCAGGAGCG	0.662													12	31	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18546931	18546931	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18546931G>C	uc002kte.2	-	27	4240	c.3299C>G	c.(3298-3300)TCT>TGT	p.S1100C		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	1100	Potential.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					AACACTTGTAGAATCCGAGAG	0.398													31	185	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	34901833	34901833	+	Silent	SNP	C	A	A	rs41352348	byFrequency	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34901833C>A	uc002lae.2	-	3	777	c.381G>T	c.(379-381)CCG>CCT	p.P127P	CELF4_uc010dnd.1_Silent_p.P127P|CELF4_uc002lag.2_Silent_p.P127P|CELF4_uc002laf.2_Silent_p.P123P|CELF4_uc002lai.2_Silent_p.P123P	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	127	RRM 1.|Sufficient for RNA-binding and MSE- dependent splicing activity.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						TCACCTGGATCGGCCGGTTCA	0.592											OREG0024927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	55	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55021655	55021655	+	Silent	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55021655C>T	uc002lgn.2	+	2	559	c.202C>T	c.(202-204)CTA>TTA	p.L68L		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	68	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GCTGAAGTTTCTAGACCCGTC	0.502													48	276	---	---	---	---	PASS
PHLPP1	23239	broad.mit.edu	37	18	60570353	60570353	+	Silent	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60570353A>G	uc002lis.2	+	8	1243	c.1065A>G	c.(1063-1065)TTA>TTG	p.L355L		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	867					apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						TGGTCACATTAGACATCTGTG	0.393													31	236	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67833309	67833309	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67833309C>A	uc002lkp.2	-	14	1986	c.1918G>T	c.(1918-1920)GAA>TAA	p.E640*	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_5'UTR	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	640							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTCGTGATTTCCAGACAGCAG	0.393													14	53	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10260160	10260160	+	Missense_Mutation	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10260160T>A	uc002mng.2	-	25	2687	c.2507A>T	c.(2506-2508)TAC>TTC	p.Y836F	DNMT1_uc010xlc.1_Missense_Mutation_p.Y852F|DNMT1_uc002mnh.2_Missense_Mutation_p.Y731F|DNMT1_uc010xld.1_Missense_Mutation_p.Y836F	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	836	BAH 1.				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	GGGGGCTTTGTAGATGACTTT	0.557													208	392	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602314	10602314	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602314C>T	uc002moq.1	-	3	1420	c.1264G>A	c.(1264-1266)GAT>AAT	p.D422N	KEAP1_uc002mop.1_Missense_Mutation_p.D140N|KEAP1_uc002mor.1_Missense_Mutation_p.D422N	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	422	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			ATGTGGCCATCGATGACCCCC	0.667													5	26	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271945	22271945	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271945G>T	uc010ecx.2	+	4	1562	c.1393G>T	c.(1393-1395)GGC>TGC	p.G465C	ZNF257_uc010ecy.2_Missense_Mutation_p.G433C	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	465	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGAAGAGTGTGGCAAAGCCTT	0.403													32	102	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31767694	31767694	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31767694C>A	uc002nsy.3	-	2	3070	c.3005G>T	c.(3004-3006)CGG>CTG	p.R1002L		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	1002					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GTCCCGTAGCCGGAAGCCTAA	0.502													20	86	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34791501	34791501	+	Silent	SNP	G	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34791501G>C	uc002nvd.3	+	2	982	c.123G>C	c.(121-123)CTG>CTC	p.L41L	KIAA0355_uc010edk.1_Silent_p.L31L	NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	41										ovary(1)	1	Esophageal squamous(110;0.162)					GCCGAGCACTGAGTGCTCCCC	0.637													14	69	---	---	---	---	PASS
TMEM145	284339	broad.mit.edu	37	19	42828932	42828932	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42828932G>T	uc002otk.1	+	15	1497	c.1445G>T	c.(1444-1446)CGT>CTT	p.R482L	MEGF8_uc002otl.3_5'Flank	NM_173633	NP_775904	Q8NBT3	TM145_HUMAN	transmembrane protein 145	482						integral to membrane					0		Prostate(69;0.00682)				CCGCTGTTCCGTGACCTCCGG	0.726													6	17	---	---	---	---	PASS
TSKS	60385	broad.mit.edu	37	19	50243100	50243100	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50243100C>T	uc002ppm.2	-	11	1723	c.1712G>A	c.(1711-1713)GGA>GAA	p.G571E		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	571							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CCCCATTGTTCCCGTGGACCC	0.562													62	142	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55396678	55396678	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55396678A>T	uc002qhr.1	+	3	299	c.102A>T	c.(100-102)AAA>AAT	p.K34N	FCAR_uc002qhq.2_Missense_Mutation_p.K34N|FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Missense_Mutation_p.K7N|FCAR_uc010esi.1_Missense_Mutation_p.K7N|FCAR_uc002qhu.1_Missense_Mutation_p.K34N|FCAR_uc002qhv.1_Missense_Mutation_p.K34N|FCAR_uc002qhw.1_Missense_Mutation_p.K22N|FCAR_uc002qhx.1_Missense_Mutation_p.K22N|FCAR_uc002qhy.1_Missense_Mutation_p.K22N|FCAR_uc002qhz.1_Missense_Mutation_p.K22N|FCAR_uc002qia.1_Intron	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	34	Extracellular (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		TATCTGCCAAATCGAGTCCTG	0.502													4	88	---	---	---	---	PASS
ZNF444	55311	broad.mit.edu	37	19	56669923	56669923	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56669923G>T	uc002qmm.2	+	4	725	c.358G>T	c.(358-360)GGC>TGC	p.G120C	ZNF444_uc002qmn.1_Missense_Mutation_p.G120C	NM_018337	NP_060807	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444	120					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		TGTGACGCAGGGCCCTGGGGC	0.627													24	58	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701294	56701294	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701294C>A	uc010ygh.1	-	4	1390	c.1390G>T	c.(1390-1392)GAG>TAG	p.E464*		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	464					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TAGGGCTTCTCTCCGGAGTGG	0.537													18	66	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701908	56701908	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701908T>C	uc010ygh.1	-	4	776	c.776A>G	c.(775-777)AAA>AGA	p.K259R		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	259					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						AGAGGCTCTTTTCTGGGGTTC	0.488													36	179	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57669852	57669852	+	Intron	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57669852C>A	uc002qoa.1	-							NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		CTAGGGAAGGCATGGAAAGAT	0.488													33	74	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58601243	58601243	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58601243A>G	uc002qri.2	-	2	701	c.392T>C	c.(391-393)CTG>CCG	p.L131P	ZSCAN18_uc002qrj.3_Missense_Mutation_p.L131P|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_Missense_Mutation_p.L131P|ZSCAN18_uc010yht.1_Missense_Mutation_p.L187P|ZSCAN18_uc002qrk.1_Missense_Mutation_p.L131P|ZSCAN18_uc002qrl.2_Missense_Mutation_p.L131P	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	131	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TGGCTCTTCCAGGACATCAGC	0.632													38	137	---	---	---	---	PASS
C20orf196	149840	broad.mit.edu	37	20	5753675	5753675	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5753675C>G	uc002wmf.2	+	2	251	c.164C>G	c.(163-165)TCT>TGT	p.S55C		NM_152504	NP_689717	Q8IYI0	CT196_HUMAN	hypothetical protein LOC149840	55											0						CCTTATTCTTCTGATGTGGAT	0.413													36	235	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33575444	33575444	+	Missense_Mutation	SNP	A	C	C			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33575444A>C	uc002xbi.1	+	15	1450	c.1358A>C	c.(1357-1359)AAC>ACC	p.N453T	MIR499_hsa-mir-499|MI0003183_5'Flank	NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	411	Myosin head-like.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CGTGTAGGGAACGAGTACGTG	0.652													44	253	---	---	---	---	PASS
EIF6	3692	broad.mit.edu	37	20	33872226	33872226	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33872226G>A	uc002xbv.1	-	1	281	c.65C>T	c.(64-66)ACC>ATC	p.T22I	EIF6_uc002xbx.1_Missense_Mutation_p.T22I|EIF6_uc002xbz.1_Missense_Mutation_p.T22I|EIF6_uc002xby.1_RNA	NM_181468	NP_852133	P56537	IF6_HUMAN	eukaryotic translation initiation factor 6	22					mature ribosome assembly	cytoplasm|nucleolus	protein binding|ribosome binding|translation initiation factor activity			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CAGACAGTAGGTGTTGGTGAG	0.642													62	178	---	---	---	---	PASS
LIPI	149998	broad.mit.edu	37	21	15481335	15481335	+	Silent	SNP	T	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15481335T>G	uc002yjm.2	-	10	1435	c.1425A>C	c.(1423-1425)ACA>ACC	p.T475T	uc002yjk.2_Intron|uc002yjl.2_Intron	NM_198996	NP_945347	Q6XZB0	LIPI_HUMAN	lipase, member I	454					lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		TTGGTGTACATGTGTTTGGAT	0.333													34	220	---	---	---	---	PASS
BACH1	571	broad.mit.edu	37	21	30698598	30698598	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30698598G>T	uc002ynj.2	+	3	568	c.453G>T	c.(451-453)CAG>CAT	p.Q151H	BACH1_uc002ynk.2_Missense_Mutation_p.Q151H|BACH1_uc002ynl.2_RNA	NM_001186	NP_001177	O14867	BACH1_HUMAN	BTB and CNC homology 1 transcription factor	151						nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|liver(1)	2						CACACTGTCAGAAAACAGACC	0.383													18	175	---	---	---	---	PASS
AGPAT3	56894	broad.mit.edu	37	21	45387860	45387860	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45387860C>T	uc002zdv.2	+	4	434	c.212C>T	c.(211-213)ACG>ATG	p.T71M	AGPAT3_uc002zdw.2_Missense_Mutation_p.T71M|AGPAT3_uc002zdx.2_Missense_Mutation_p.T158M|AGPAT3_uc002zdy.2_Missense_Mutation_p.T9M	NM_020132	NP_064517	Q9NRZ7	PLCC_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 3	71	Cytoplasmic (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		TGGTCCTGCACGGAGTGTACA	0.607													14	77	---	---	---	---	PASS
SEPT5	5413	broad.mit.edu	37	22	19707183	19707183	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19707183C>T	uc002zpv.1	+	3	238	c.113C>T	c.(112-114)TCG>TTG	p.S38L	SEPT5_uc002zpw.1_RNA|SEPT5_uc002zpx.1_RNA|SEPT5_uc002zpy.1_5'Flank	NM_002688	NP_002679	Q99719	SEPT5_HUMAN	septin 5	38					cell cycle|cytokinesis|regulation of exocytosis|synaptic vesicle targeting	plasma membrane|septin complex|synaptic vesicle	GTP binding|GTPase activity|protein binding|structural molecule activity			lung(1)	1	Colorectal(54;0.0993)					CACCGCAAGTCGGTGAAGAAA	0.592													18	165	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22550615	22550615	+	RNA	SNP	T	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22550615T>A	uc011aim.1	+	11		c.1109T>A								Parts of antibodies, mostly variable regions.												0						CCTCACCATCTCTGGACTGAA	0.527													22	115	---	---	---	---	PASS
MGAT3	4248	broad.mit.edu	37	22	39883958	39883958	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39883958G>A	uc003axv.3	+	2	845	c.606G>A	c.(604-606)AGG>AGA	p.R202R	MGAT3_uc010gxy.2_Silent_p.R202R	NM_002409	NP_002400	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein	202	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity				0	Melanoma(58;0.04)					TGGTGCCCAGGGAGGTGCCGC	0.677													4	30	---	---	---	---	PASS
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45182498	45182498	+	Intron	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45182498G>T	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						TAGGGCCCCAGCTGGGCAGTC	0.637													9	34	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50724256	50724256	+	Silent	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50724256G>A	uc003bkv.3	-	11	2167	c.2061C>T	c.(2059-2061)TTC>TTT	p.F687F		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	687	Extracellular (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCTTGCCCTGGAAGTTCACAT	0.657													18	187	---	---	---	---	PASS
PHEX	5251	broad.mit.edu	37	X	22065257	22065257	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22065257C>G	uc004dah.2	+	3	480	c.277C>G	c.(277-279)CCA>GCA	p.P93A	PHEX_uc011mjr.1_Missense_Mutation_p.P93A|PHEX_uc011mjs.1_Translation_Start_Site	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	93	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						AAGCAATAATCCAATTCCCGA	0.413													47	108	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23019068	23019068	+	Silent	SNP	G	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23019068G>T	uc004daj.2	+	1	982	c.894G>T	c.(892-894)GGG>GGT	p.G298G		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	298	Helicase ATP-binding.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						ATGGGCCTGGGATGCTAGTCC	0.418													50	73	---	---	---	---	PASS
KDM6A	7403	broad.mit.edu	37	X	44938381	44938381	+	Intron	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44938381A>T	uc004dge.3	+						KDM6A_uc010nhk.2_Intron|KDM6A_uc011mkz.1_Intron|KDM6A_uc011mla.1_Intron|KDM6A_uc011mlb.1_Intron|KDM6A_uc011mlc.1_Intron|KDM6A_uc011mld.1_Intron	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide						histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						ACATTTATGTATTCATGAAGA	0.328			D|N|F|S		renal|oesophageal SCC|MM								39	35	---	---	---	---	PASS
FOXR2	139628	broad.mit.edu	37	X	55650442	55650442	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55650442G>A	uc004duo.2	+	1	610	c.298G>A	c.(298-300)GGA>AGA	p.G100R		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	100					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						AAAGCCCAGTGGAAAAGAGGA	0.542													29	36	---	---	---	---	PASS
ZC3H12B	340554	broad.mit.edu	37	X	64722205	64722205	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64722205C>A	uc010nko.2	+	5	1603	c.1594C>A	c.(1594-1596)CAT>AAT	p.H532N		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	532							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CATGGGGGACCATGGCTACTA	0.478													42	48	---	---	---	---	PASS
ZFY	7544	broad.mit.edu	37	Y	2829519	2829519	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2829519A>T	uc004fqj.2	+	3	787	c.466A>T	c.(466-468)AGT>TGT	p.S156C	ZFY_uc010nwd.1_Missense_Mutation_p.S156C|ZFY_uc011nan.1_Intron|ZFY_uc010nwe.2_Missense_Mutation_p.S130C	NM_003411	NP_003402	P08048	ZFY_HUMAN	zinc finger protein, Y-linked isoform 1	156					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGTGCATGATAGTGTAGTGGA	0.418													56	124	---	---	---	---	PASS
PGD	5226	broad.mit.edu	37	1	10479232	10479232	+	Intron	DEL	T	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10479232delT	uc001arc.2	+						PGD_uc001ard.2_Intron|PGD_uc010oak.1_Intron|PGD_uc010oal.1_Intron	NM_002631	NP_002622	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase						pentose-phosphate shunt, oxidative branch	cytosol	NADP binding|phosphogluconate dehydrogenase (decarboxylating) activity|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)		acctggctaattttttttttt	0.000													3	3	---	---	---	---	
EIF3I	8668	broad.mit.edu	37	1	32690259	32690260	+	Intron	INS	-	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32690259_32690260insT	uc001bur.3	+						C1orf91_uc001buo.3_5'Flank|C1orf91_uc001bup.3_5'Flank|C1orf91_uc009vub.1_5'Flank|C1orf91_uc010oha.1_5'Flank|C1orf91_uc001buq.3_5'Flank|EIF3I_uc009vuc.2_Intron|EIF3I_uc001bus.2_Intron	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				ATTAAGTTTTCTTttttttttt	0.183													4	2	---	---	---	---	
FAM73A	374986	broad.mit.edu	37	1	78277224	78277224	+	Intron	DEL	C	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78277224delC	uc001dhx.2	+						FAM73A_uc010ork.1_Intron|FAM73A_uc010orl.1_Intron|FAM73A_uc001dhy.1_Intron	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986							integral to membrane				ovary(1)	1				Colorectal(170;0.226)		CTTCTTGAGACTGTGTGGACT	0.363													176	78	---	---	---	---	
KIAA1324	57535	broad.mit.edu	37	1	109726212	109726213	+	Intron	INS	-	TTCTTCCTTCCTTCCTTCCCTCCCTCCC	TTCTTCCTTCCTTCCTTCCCTCCCTCCC			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109726212_109726213insTTCTTCCTTCCTTCCTTCCCTCCCTCCC	uc001dwq.2	+						KIAA1324_uc009wex.1_Intron|KIAA1324_uc009wey.2_Intron|KIAA1324_uc010ovg.1_Intron	NM_020775	NP_065826	Q6UXG2	K1324_HUMAN	hypothetical protein LOC57535 precursor						macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		ccttccttccttccttccttcc	0.089													4	3	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180805492	180805493	+	Intron	INS	-	A	A	rs112629887		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180805492_180805493insA	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						gactcagtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224170871	224170872	+	IGR	DEL	AA	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224170871_224170872delAA								TP53BP2 (137197 upstream) : FBXO28 (130919 downstream)																							actccatctcaaaaaaaaaaaa	0.168													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229824632	229824633	+	IGR	INS	-	CAAAA	CAAAA			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229824632_229824633insCAAAA								URB2 (28686 upstream) : GALNT2 (368903 downstream)																							agactccatctcaaaacaaaac	0.158													4	3	---	---	---	---	
VWA3B	200403	broad.mit.edu	37	2	98917002	98917004	+	Intron	DEL	TCC	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98917002_98917004delTCC	uc002syo.2	+						VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron|VWA3B_uc002syp.1_Intron|VWA3B_uc002syq.1_Intron|VWA3B_uc002syr.1_Intron|VWA3B_uc002sys.2_Intron	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6						cgcgtcctcatcctcctcctcct	0.463													4	2	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218668979	218668980	+	3'UTR	INS	-	TCTC	TCTC	rs148936266	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218668979_218668980insTCTC	uc002vgt.2	-	33					TNS1_uc002vgr.2_3'UTR|TNS1_uc002vgs.2_3'UTR|TNS1_uc002vgq.2_3'UTR	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TCCTCCAtctttctctctctct	0.431													7	6	---	---	---	---	
ITGA9	3680	broad.mit.edu	37	3	37790259	37790259	+	Intron	DEL	G	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37790259delG	uc003chd.2	+							NM_002207	NP_002198	Q13797	ITA9_HUMAN	integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		aaaaaaaaaagaaGGAAGCCA	0.264													9	4	---	---	---	---	
LMOD3	56203	broad.mit.edu	37	3	69169385	69169389	+	Intron	DEL	TAAAA	-	-	rs111478601		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69169385_69169389delTAAAA	uc003dns.2	-						LMOD3_uc003dnt.2_Intron	NM_198271	NP_938012	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)							cytoplasm|cytoskeleton	tropomyosin binding			ovary(1)	1		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		TCCCATAAATTAAAATGAGTATTAA	0.234													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125400039	125400039	+	IGR	DEL	G	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125400039delG								OSBPL11 (85658 upstream) : MIR548I1 (109208 downstream)																							ATGGATCTGAGCAAGCATGAC	0.572													4	2	---	---	---	---	
TMEM207	131920	broad.mit.edu	37	3	190147698	190147698	+	Intron	DEL	G	-	-	rs5855335		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147698delG	uc003fsj.2	-							NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor							integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		AGTCACCACAGGGGGGAAAAA	0.363													16	7	---	---	---	---	
C1QTNF7	114905	broad.mit.edu	37	4	15351874	15351877	+	Intron	DEL	GGAA	-	-	rs72415331		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15351874_15351877delGGAA	uc003gno.2	+							NM_001135170	NP_001128642	Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7							collagen					0						agggagggagggaaggagagaggg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	116964504	116964509	+	IGR	DEL	TTTTTT	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116964504_116964509delTTTTTT								NDST4 (929472 upstream) : MIR1973 (256372 downstream)																							cttttctgtctttttttttttttttt	0.175													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4887035	4887036	+	IGR	INS	-	AC	AC	rs72522295		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4887035_4887036insAC								None (None upstream) : LOC340094 (147436 downstream)																							GTGGCCCCATAacacacacaca	0.396													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20095643	20095644	+	IGR	INS	-	A	A			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20095643_20095644insA								CDH18 (107336 upstream) : None (None downstream)																							aggaaggaaggaaagaaggaag	0.015													11	6	---	---	---	---	
PARP8	79668	broad.mit.edu	37	5	50090386	50090387	+	Intron	DEL	AT	-	-	rs33958370		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50090386_50090387delAT	uc003jon.3	+						PARP8_uc011cpz.1_Intron|PARP8_uc003joo.2_Intron|PARP8_uc003jop.2_Intron	NM_024615	NP_078891	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular	NAD+ ADP-ribosyltransferase activity			lung(3)|large_intestine(1)|ovary(1)	5		Lung NSC(810;0.0305)|Breast(144;0.222)				CTAAAATTACATTCTTTGCTTT	0.272													5	4	---	---	---	---	
DOCK2	1794	broad.mit.edu	37	5	169452852	169452853	+	Intron	INS	-	TTCC	TTCC	rs142164505	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169452852_169452853insTTCC	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tccttccttctttccttccttc	0.074													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29770021	29770021	+	IGR	DEL	A	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29770021delA								HCG4 (9171 upstream) : HLA-G (24735 downstream)																							TAGGGGTGGGAAGAGTGATCC	0.532													4	3	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29841217	29841217	+	Intron	DEL	T	-	-	rs111432584		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29841217delT	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						gaagttttgattagtatgtgc	0.000													3	5	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70859585	70859585	+	Intron	DEL	T	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70859585delT	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						TAAAATCTCATTTGTACTCAG	0.388													97	43	---	---	---	---	
RIMS1	22999	broad.mit.edu	37	6	72947379	72947379	+	Intron	DEL	A	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72947379delA	uc003pga.2	+						RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgb.3_Intron|RIMS1_uc010kas.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				atcccatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155566095	155566096	+	Intron	INS	-	T	T	rs151112442	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155566095_155566096insT	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron|TIAM2_uc010kjj.2_Intron|TIAM2_uc003qqf.2_Intron|TIAM2_uc011efl.1_Intron|TIAM2_uc003qqg.2_Intron|TIAM2_uc003qqh.2_Intron	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGCTGTATATATTTTTTTTTCC	0.450													5	8	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6863145	6863146	+	Intron	DEL	TC	-	-	rs35402612		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6863145_6863146delTC	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron|C7orf28B_uc003sqy.1_3'UTR	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		GTGTTTGCGttctttttttttt	0.193													8	4	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14773671	14773672	+	Intron	INS	-	GT	GT	rs71004332		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14773671_14773672insGT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron|DGKB_uc011jxv.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	tgtgtgtgtgtggtgtgtgaaa	0.040													4	2	---	---	---	---	
C7orf46	340277	broad.mit.edu	37	7	23741876	23741877	+	3'UTR	INS	-	T	T			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23741876_23741877insT	uc003swo.3	+	7					C7orf46_uc003swq.3_3'UTR|C7orf46_uc003swr.3_3'UTR|C7orf46_uc003swp.3_RNA|C7orf46_uc010kup.2_RNA	NM_199136	NP_954587	A4D161	CG046_HUMAN	hypothetical protein LOC340277 isoform 1												0						AAATTATTTACTTTTTTTTTTT	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128210234	128210235	+	IGR	INS	-	TT	TT			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128210234_128210235insTT								METTL2B (67257 upstream) : FLJ45340 (71060 downstream)																							agttttagttcttTTTTTTTTT	0.193													3	3	---	---	---	---	
MTPAP	55149	broad.mit.edu	37	10	30638287	30638287	+	5'Flank	DEL	G	-	-	rs112277654		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30638287delG	uc001iva.3	-						MTPAP_uc001ivb.3_Intron|MTPAP_uc001ivc.2_5'Flank	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						TCGGGGGGGAGGGGGGGGGCA	0.507													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42398206	42398206	+	IGR	DEL	C	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42398206delC								None (None upstream) : LOC441666 (429109 downstream)																							aacgggatttcttcatataat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112210759	112210760	+	IGR	DEL	AA	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112210759_112210760delAA								SMNDC1 (146052 upstream) : DUSP5 (46865 downstream)																							GATGCAGaagaaaaaaaaaaaa	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113583212	113583212	+	IGR	DEL	T	-	-	rs35166182		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113583212delT								TMPRSS5 (6144 upstream) : ZW10 (20699 downstream)																							caacccctgcttttttttgct	0.000													4	3	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50537187	50537188	+	Intron	INS	-	TTG	TTG	rs10690664		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50537187_50537188insTTG	uc001rwd.3	-						LASS5_uc001rwc.2_5'UTR|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron|LASS5_uc010smq.1_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						TATACATATCCTTTTGTCTCTT	0.267													4	2	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315343	124315343	+	Intron	DEL	T	-	-	rs7976816		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315343delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		aaaaaaaaaattagctgagcg	0.100													5	4	---	---	---	---	
PAN3	255967	broad.mit.edu	37	13	28834855	28834855	+	Intron	DEL	T	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28834855delT	uc001urz.2	+						PAN3_uc010tdo.1_Intron|PAN3_uc001ury.2_Intron|PAN3_uc001urx.2_Intron	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		GAAACCTGTCTTTTAAAAAAA	0.249													4	2	---	---	---	---	
KL	9365	broad.mit.edu	37	13	33637746	33637746	+	Intron	DEL	A	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33637746delA	uc001uus.2	+							NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor						aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		catctctactaaaaaaaaaaa	0.000													3	3	---	---	---	---	
SLC15A1	6564	broad.mit.edu	37	13	99363920	99363924	+	Intron	DEL	GTTTT	-	-	rs6145194		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99363920_99363924delGTTTT	uc001vno.2	-							NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	ATTGCttttggttttgttttgtttt	0.283													2	5	---	---	---	---	
HECTD1	25831	broad.mit.edu	37	14	31647112	31647112	+	Intron	DEL	T	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31647112delT	uc001wrc.1	-							NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		tttttagaaattttttttttt	0.318													6	3	---	---	---	---	
ZNF280D	54816	broad.mit.edu	37	15	57049884	57049884	+	Intron	DEL	A	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57049884delA	uc002adw.1	-							NM_001002843	NP_001002843	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		aaaagaaaagaaaagaaggaa	0.080													5	3	---	---	---	---	
IDH2	3418	broad.mit.edu	37	15	90631012	90631012	+	Intron	DEL	T	-	-	rs74743859		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90631012delT	uc002box.2	-						IDH2_uc010uqb.1_Intron|IDH2_uc010uqc.1_Intron|IDH2_uc010bnu.2_Intron	NM_002168	NP_002159	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+),						2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding			haematopoietic_and_lymphoid_tissue(621)|central_nervous_system(80)|bone(7)|skin(3)	711	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			AAACACCGCCTTTTTTTTTTT	0.403			M		GBM								4	2	---	---	---	---	
ADCY7	113	broad.mit.edu	37	16	50335986	50335986	+	Intron	DEL	C	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50335986delC	uc002egd.1	+						ADCY7_uc002egb.1_Intron|ADCY7_uc002egc.1_Intron	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	CTGATCCTCGCCCTGTACCCC	0.652													4	2	---	---	---	---	
CDH3	1001	broad.mit.edu	37	16	68684841	68684841	+	Intron	DEL	A	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68684841delA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding			ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TGAACAGGTTAAAAAAAAAAA	0.483													6	5	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70169971	70169972	+	Intron	INS	-	A	A	rs35739737		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70169971_70169972insA	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		gactccatctcaaaaaaaaaaa	0.153													3	3	---	---	---	---	
IGF2BP1	10642	broad.mit.edu	37	17	47076718	47076719	+	Intron	INS	-	A	A	rs141190373	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47076718_47076719insA	uc002iom.2	+						IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding						CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						TTACAGCTTGTAAAAAAAAAAT	0.441													5	4	---	---	---	---	
TAC4	255061	broad.mit.edu	37	17	47925055	47925058	+	Intron	DEL	ACAC	-	-	rs113382605		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47925055_47925058delACAC	uc002ipo.1	-						TAC4_uc002ipp.1_Intron|TAC4_uc002ipq.1_Intron|TAC4_uc002ipr.1_Intron|TAC4_uc002ips.1_Intron|TAC4_uc002ipt.2_Intron|TAC4_uc002ipu.2_Intron	NM_170685	NP_733786	Q86UU9	TKN4_HUMAN	tachykinin 4 isoform alpha						regulation of blood pressure	extracellular region				breast(1)	1						acacacacagacacacacacacac	0.191													6	8	---	---	---	---	
BPTF	2186	broad.mit.edu	37	17	65905565	65905565	+	Intron	DEL	T	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65905565delT	uc002jgf.2	+						BPTF_uc002jge.2_Intron	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GACCTTTGTCTTTTTTTTTTT	0.299													8	4	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938473	41938474	+	Intron	INS	-	GTGT	GTGT	rs149102482	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938473_41938474insGTGT	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						ACAgtgtgtgcgtgtgtgtgtg	0.416													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54396035	54396036	+	Intron	DEL	CG	-	-	rs41275812	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54396035_54396036delCG	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		cacacacacacgcacacacacg	0.213													4	2	---	---	---	---	
NLRP2	55655	broad.mit.edu	37	19	55511961	55511961	+	Intron	DEL	A	-	-	rs34129339		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55511961delA	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		actgtcttttaaaaaaaaaaa	0.194													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	23092546	23092551	+	IGR	DEL	TTGAGT	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23092546_23092551delTTGAGT								NCAM2 (181332 upstream) : None (None downstream)																							CAAATAAGAGTTGAGTTTGTCTTttc	0.146													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20976584	20976584	+	Intron	DEL	A	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20976584delA	uc002zsv.2	-											Homo sapiens, clone IMAGE:5171202, mRNA.																		gactttgcctaaaaaaaaaaa	0.229													4	3	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774840	2774841	+	Intron	INS	-	ATCT	ATCT	rs142965389		TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774840_2774841insATCT	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				atctatctatcatctatctatc	0.173													4	2	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652829	53652852	+	Intron	DEL	GCCGGGGCCGGGGCCGGGGCCGGT	-	-	rs78801842	by1000genomes	TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652829_53652852delGCCGGGGCCGGGGCCGGGGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggggccggggccggggccggtgccgggactg	0.219													3	42	---	---	---	---	
ZCCHC12	170261	broad.mit.edu	37	X	117960025	117960025	+	Frame_Shift_Del	DEL	C	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117960025delC	uc004equ.2	+	4	1291	c.818delC	c.(817-819)TCCfs	p.S273fs		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	273					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1						CTCGACGACTCCGATGAGGAT	0.582													78	82	---	---	---	---	
TSPY3	728137	broad.mit.edu	37	Y	9366667	9366672	+	In_Frame_Del	DEL	GAAGAT	-	-			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9366667_9366672delGAAGAT	uc004fse.2	+	2	553_558	c.526_531delGAAGAT	c.(526-531)GAAGATdel	p.ED178del	TSPY3_uc004fsf.2_In_Frame_Del_p.ED178del	NM_001077697	NP_001071165	Q01534	TSPY1_HUMAN	testis specific protein, Y-linked 3	178_179					cell differentiation|cell proliferation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus	identical protein binding				0						GATCACTGACGAAGATGAAGACATGC	0.515													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9368339	9368340	+	IGR	INS	-	TC	TC			TCGA-21-1077-01A-01D-1521-08	TCGA-21-1077-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9368339_9368340insTC								TSPY1 (20950 upstream) : RBMY3AP (79990 downstream)																							ttgtgtgtgtgtgtgtgtgtat	0.277													6	5	---	---	---	---	
