Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MUTYH	4595	broad.mit.edu	37	1	45797465	45797465	+	Missense_Mutation	SNP	T	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:45797465T>A	uc001cnm.2	-	12	1261	c.1045A>T	c.(1045-1047)ACC>TCC	p.T349S	MUTYH_uc009vxn.2_Missense_Mutation_p.T174S|MUTYH_uc001cnf.2_Missense_Mutation_p.T324S|MUTYH_uc009vxo.2_Missense_Mutation_p.T324S|MUTYH_uc001cng.2_Missense_Mutation_p.T335S|MUTYH_uc001cnj.2_Missense_Mutation_p.T232S|MUTYH_uc001cni.2_Missense_Mutation_p.T324S|MUTYH_uc001cnh.2_Missense_Mutation_p.T325S|MUTYH_uc001cno.2_Missense_Mutation_p.T232S|MUTYH_uc001cnk.2_Missense_Mutation_p.T209S|MUTYH_uc010oll.1_Intron|MUTYH_uc001cnl.2_Missense_Mutation_p.T338S|MUTYH_uc009vxp.2_Missense_Mutation_p.T352S|MUTYH_uc001cnn.2_Missense_Mutation_p.T339S	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1	349					depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					ACTCCCAGGGTCTGGTCCCAG	0.652					162	Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				0.425532	55.886613	56.114842	20	27	KEEP	---	---	---	---	8	13	18	10	-1	capture	Missense_Mutation	SNP	45797465	45797465	MUTYH	1	T	A	A	A	1	0	0	0	0	1	0	0	0	754	58	4	4	9903	182
CTSK	1513	broad.mit.edu	37	1	150771721	150771721	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150771721G>A	uc001evp.1	-	7	937	c.813C>T	c.(811-813)AGC>AGT	p.S271S	CTSK_uc001evq.1_Silent_p.S182S	NM_000396	NP_000387	P43235	CATK_HUMAN	cathepsin K preproprotein	271					proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCAGATTATCGCTATTGCAGC	0.433																0.028409	-34.686906	8.428997	5	171	KEEP	---	---	---	---	3	2	91	105	-1	capture	Silent	SNP	150771721	150771721	CTSK	1	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	3998	182
FCRL1	115350	broad.mit.edu	37	1	157772382	157772382	+	Missense_Mutation	SNP	A	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157772382A>C	uc001frg.2	-	4	505	c.392T>G	c.(391-393)GTC>GGC	p.V131G	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.V131G|FCRL1_uc001fri.2_Missense_Mutation_p.V131G|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	131	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCAGATGAGGACCAGCCTGTC	0.542	GBM(54;482 1003 11223 30131 35730)															0.16	1.018101	7.017204	8	42	KEEP	---	---	---	---	10	18	21	29	-1	capture	Missense_Mutation	SNP	157772382	157772382	FCRL1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	5740	182
HMCN1	83872	broad.mit.edu	37	1	186097315	186097315	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186097315C>A	uc001grq.1	+	83	13025	c.12796C>A	c.(12796-12798)CCT>ACT	p.P4266T	HMCN1_uc001grs.1_5'UTR	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4266	Ig-like C2-type 42.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TACTGAACTTCCTGGAGACGT	0.418																0.027322	-37.393642	7.749342	5	178	KEEP	---	---	---	---	3	2	87	102	0.4	capture	Missense_Mutation	SNP	186097315	186097315	HMCN1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	7145	182
CACNA1S	779	broad.mit.edu	37	1	201021762	201021762	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201021762G>A	uc001gvv.2	-	32	4103	c.3876C>T	c.(3874-3876)ATC>ATT	p.I1292I		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1292	Extracellular (Potential).|IV.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CCACCAAGGCGATCTTCCCAA	0.557																0.061947	-9.274188	13.364316	7	106	KEEP	---	---	---	---	1	6	51	66	-1	capture	Silent	SNP	201021762	201021762	CACNA1S	1	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	2523	182
C1orf69	200205	broad.mit.edu	37	1	228362831	228362831	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228362831G>A	uc001hsl.3	+	3	777	c.688G>A	c.(688-690)GAG>AAG	p.E230K	C1orf69_uc010pvw.1_Missense_Mutation_p.E37K	NM_001010867	NP_001010867	Q5T440	CAF17_HUMAN	hypothetical protein LOC200205 precursor	230					glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity				0		Prostate(94;0.0405)				AGGCGTTCCTGAGGGGGTCCG	0.627																0.875	175.423026	184.208257	56	8	KEEP	---	---	---	---	30	34	4	6	-1	capture	Missense_Mutation	SNP	228362831	228362831	C1orf69	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	2039	182
PCDH15	65217	broad.mit.edu	37	10	55591167	55591167	+	Silent	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:55591167T>C	uc001jju.1	-	30	4505	c.4110A>G	c.(4108-4110)CTA>CTG	p.L1370L	PCDH15_uc010qhq.1_Silent_p.L1375L|PCDH15_uc010qhr.1_Silent_p.L1370L|PCDH15_uc010qhs.1_Silent_p.L1382L|PCDH15_uc010qht.1_Silent_p.L1377L|PCDH15_uc010qhu.1_Silent_p.L1370L|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.L1370L|PCDH15_uc010qhw.1_Silent_p.L1333L|PCDH15_uc010qhx.1_Silent_p.L1299L|PCDH15_uc010qhy.1_Silent_p.L1375L|PCDH15_uc010qhz.1_Silent_p.L1370L|PCDH15_uc010qia.1_Silent_p.L1348L|PCDH15_uc010qib.1_Silent_p.L1348L	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1370	Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CTGTGTATCCTAGACTTTCTC	0.483					1612								HNSCC(58;0.16)			0.157895	52.101878	66.931412	21	112	KEEP	---	---	---	---	7	16	56	59	-1	capture	Silent	SNP	55591167	55591167	PCDH15	10	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	11414	182
PLA2G16	11145	broad.mit.edu	37	11	63381479	63381479	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63381479G>A	uc001nxh.2	-	1	431	c.8C>T	c.(7-9)GCG>GTG	p.A3V	PLA2G16_uc001nxi.2_Missense_Mutation_p.R32C|PLA2G16_uc009you.1_Missense_Mutation_p.A3V	NM_007069	NP_009000	P53816	PAG16_HUMAN	HRAS-like suppressor 3	3					lipid catabolic process	integral to membrane|perinuclear region of cytoplasm	hydrolase activity|protein binding			ovary(1)	1						TACAATGGGCGCACGCATCTT	0.478																0.052632	-7.963135	8.108279	4	72	KEEP	---	---	---	---	0	4	46	48	-1	capture	Missense_Mutation	SNP	63381479	63381479	PLA2G16	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11896	182
ANO6	196527	broad.mit.edu	37	12	45823037	45823037	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:45823037G>A	uc001roo.2	+	20	3011	c.2676G>A	c.(2674-2676)GTG>GTA	p.V892V	ANO6_uc010sld.1_Intron|ANO6_uc010sle.1_Intron|ANO6_uc010slf.1_Silent_p.V913V|ANO6_uc010slg.1_Silent_p.V874V	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	892	Cytoplasmic (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						ATATGGGGGTGATAGCTGAGC	0.373																0.092105	3.365359	16.098612	7	69	KEEP	---	---	---	---	5	3	38	43	-1	capture	Silent	SNP	45823037	45823037	ANO6	12	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	695	182
STAT6	6778	broad.mit.edu	37	12	57490672	57490672	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57490672C>T	uc009zpe.2	-	21	2566	c.2315G>A	c.(2314-2316)TGC>TAC	p.C772Y	STAT6_uc009zpf.2_Missense_Mutation_p.C772Y|STAT6_uc001sna.2_Missense_Mutation_p.C772Y|STAT6_uc010srb.1_Missense_Mutation_p.C662Y|STAT6_uc010src.1_Missense_Mutation_p.C662Y|STAT6_uc010srd.1_Missense_Mutation_p.C662Y|STAT6_uc009zpg.2_Missense_Mutation_p.C821Y	NM_003153	NP_003144	P42226	STAT6_HUMAN	signal transducer and activator of transcription	772					regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4						CTGGCTCAGGCAGCTGTCTTC	0.642					241											0.101695	3.002838	12.345122	6	53	KEEP	---	---	---	---	2	4	26	40	-1	capture	Missense_Mutation	SNP	57490672	57490672	STAT6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	15160	182
OSBPL8	114882	broad.mit.edu	37	12	76791554	76791554	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:76791554T>C	uc001sye.1	-	8	1072	c.592A>G	c.(592-594)ATC>GTC	p.I198V	OSBPL8_uc001syf.1_Missense_Mutation_p.I156V|OSBPL8_uc001syg.1_Missense_Mutation_p.I156V|OSBPL8_uc001syh.1_Missense_Mutation_p.I173V	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN	oxysterol-binding protein-like protein 8 isoform	198	PH.				lipid transport		lipid binding			ovary(1)	1						CGTTCAATGATTTCACAGGCA	0.408																0.065574	-2.39927	21.496127	8	114	KEEP	---	---	---	---	4	4	54	66	-1	capture	Missense_Mutation	SNP	76791554	76791554	OSBPL8	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11187	182
EP400	57634	broad.mit.edu	37	12	132551418	132551418	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132551418G>A	uc001ujn.2	+	48	8688	c.8653G>A	c.(8653-8655)GTC>ATC	p.V2885I	EP400_uc001ujl.2_Missense_Mutation_p.V2884I|EP400_uc001ujm.2_Missense_Mutation_p.V2804I|EP400_uc001ujp.2_Missense_Mutation_p.V95I	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2921					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity	p.P2885P(1)		central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGTGGTGTCCGTCCCGGCAGC	0.682																0.063492	-5.652826	6.852213	4	59	KEEP	---	---	---	---	2	2	40	27	-1	capture	Missense_Mutation	SNP	132551418	132551418	EP400	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5104	182
LMO7	4008	broad.mit.edu	37	13	76287343	76287343	+	Missense_Mutation	SNP	C	A	A	rs75385907		TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:76287343C>A	uc010thv.1	+	3	1511	c.251C>A	c.(250-252)ACA>AAA	p.T84K	LMO7_uc001vjt.1_Missense_Mutation_p.T32K	NM_005358	NP_005349	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 1	84	CH.					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AATTTTGAAACAAAAGATTTT	0.318																0.071429	-1.211338	6.740961	3	39	KEEP	---	---	---	---	2	1	22	22	0.333333333333	capture	Missense_Mutation	SNP	76287343	76287343	LMO7	13	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	8775	182
OR11G2	390439	broad.mit.edu	37	14	20666093	20666093	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20666093A>G	uc010tlb.1	+	1	599	c.599A>G	c.(598-600)AAC>AGC	p.N200S		NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G,	200	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CCTATCGTCAACATCTCCCAA	0.448																0.120482	18.491976	30.212305	10	73	KEEP	---	---	---	---	3	7	39	37	-1	capture	Missense_Mutation	SNP	20666093	20666093	OR11G2	14	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	10829	182
AKAP5	9495	broad.mit.edu	37	14	64936331	64936331	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64936331T>C	uc001xhd.3	+	2	1597	c.1219T>C	c.(1219-1221)TCA>CCA	p.S407P	ZBTB25_uc001xhc.2_Intron	NM_004857	NP_004848	P24588	AKAP5_HUMAN	A-kinase anchor protein 5	407				S -> Y (in Ref. 3).	energy reserve metabolic process|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting|regulation of insulin secretion|signal transduction|synaptic transmission	cytosol	adenylate cyclase binding|calmodulin binding				0				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)		TATTCAGTTGTCAATAGAACA	0.348																0.117978	35.546854	61.074262	21	157	KEEP	---	---	---	---	8	14	72	102	-1	capture	Missense_Mutation	SNP	64936331	64936331	AKAP5	14	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	454	182
HEATR4	399671	broad.mit.edu	37	14	73989140	73989140	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73989140C>A	uc010tub.1	-	3	1039	c.717G>T	c.(715-717)CAG>CAT	p.Q239H	HEATR4_uc010tua.1_Missense_Mutation_p.Q192H	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		AGTCGTACTGCTGGCGCAGGA	0.582																0.096386	4.03327	17.593428	8	75	KEEP	---	---	---	---	7	3	37	43	0.3	capture	Missense_Mutation	SNP	73989140	73989140	HEATR4	14	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	6957	182
LTBP2	4053	broad.mit.edu	37	14	74974771	74974771	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74974771G>A	uc001xqa.2	-	25	4067	c.3680C>T	c.(3679-3681)CCG>CTG	p.P1227L		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1227	EGF-like 13; calcium-binding (Potential).|Cys-rich.				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TCCCACACACGGGTCTGTGGT	0.582																0.7	142.37113	144.516713	42	18	KEEP	---	---	---	---	26	19	7	13	-1	capture	Missense_Mutation	SNP	74974771	74974771	LTBP2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8989	182
RYR3	6263	broad.mit.edu	37	15	33999198	33999198	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33999198A>G	uc001zhi.2	+	43	6632	c.6562A>G	c.(6562-6564)AAC>GAC	p.N2188D	RYR3_uc010bar.2_Missense_Mutation_p.N2188D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2188	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGTCGGCTGGAACCCCATTGA	0.517																0.139535	0.91836	6.570302	6	37	KEEP	---	---	---	---	7	6	17	24	-1	capture	Missense_Mutation	SNP	33999198	33999198	RYR3	15	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	13662	182
ATP8B4	79895	broad.mit.edu	37	15	50190419	50190419	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50190419A>T	uc001zxu.2	-	22	2461	c.2319T>A	c.(2317-2319)AAT>AAA	p.N773K	ATP8B4_uc010ber.2_Missense_Mutation_p.N646K|ATP8B4_uc010ufd.1_Missense_Mutation_p.N583K|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxv.1_Missense_Mutation_p.N71K	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	773	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CTAGGAGATCATTCTTGACAT	0.398																0.430769	93.19446	93.465216	28	37	KEEP	---	---	---	---	13	20	14	26	-1	capture	Missense_Mutation	SNP	50190419	50190419	ATP8B4	15	A	T	T	T	1	0	0	0	0	1	0	0	0	102	8	4	4	1188	182
C15orf60	283677	broad.mit.edu	37	15	73832877	73832877	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:73832877G>A	uc002avq.2	+	3	329	c.301G>A	c.(301-303)GTG>ATG	p.V101M	C15orf60_uc010bjb.2_Intron	NM_001042367	NP_001035826	Q7Z4M0	CO060_HUMAN	hypothetical protein LOC283677	101										pancreas(1)	1						TGTAAGACGCGTGGATTGTCT	0.383																0.024229	-100.641943	14.215681	11	443	KEEP	---	---	---	---	2	10	276	252	-1	capture	Missense_Mutation	SNP	73832877	73832877	C15orf60	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1794	182
KIAA1199	57214	broad.mit.edu	37	15	81213426	81213426	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:81213426C>T	uc002bfw.1	+	15	2317	c.2057C>T	c.(2056-2058)GCC>GTC	p.A686V	KIAA1199_uc010unn.1_Missense_Mutation_p.A686V	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	686										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						ATCAACTGTGCCGCTGCAGGA	0.547																0.053333	-7.267482	8.530411	4	71	KEEP	---	---	---	---	1	3	39	48	-1	capture	Missense_Mutation	SNP	81213426	81213426	KIAA1199	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8135	182
RHBDL1	9028	broad.mit.edu	37	16	727863	727863	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:727863G>A	uc002cis.1	+	7	1155	c.1128G>A	c.(1126-1128)GCG>GCA	p.A376A	RHBDL1_uc002cir.1_Silent_p.A311A|RHBDL1_uc010uun.1_3'UTR|STUB1_uc002cit.2_5'Flank|STUB1_uc002ciu.2_5'Flank|STUB1_uc010bqz.2_5'Flank|STUB1_uc002civ.2_5'Flank	NM_003961	NP_003952	O75783	RHBL1_HUMAN	rhomboid protease 1	376	Helical; (Potential).				proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.0218)				GCTTCATGGCGCACCTGGCAG	0.736																0.15	4.811771	7.161008	3	17	KEEP	---	---	---	---	2	3	14	8	-1	capture	Silent	SNP	727863	727863	RHBDL1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13213	182
KIAA0430	9665	broad.mit.edu	37	16	15690712	15690712	+	Silent	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15690712C>T	uc002ddr.2	-	27	5260	c.5067G>A	c.(5065-5067)TCG>TCA	p.S1689S	KIAA0430_uc002ddq.2_Silent_p.S1523S|KIAA0430_uc010uzv.1_Silent_p.S1685S|KIAA0430_uc010uzw.1_Silent_p.S1688S	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	1688	Poly-Ser.					peroxisome	nucleotide binding|RNA binding				0						AGATGCAGGACGAGCTGGAGT	0.507																0.052083	-9.901784	10.4616	5	91	KEEP	---	---	---	---	4	1	42	50	-1	capture	Silent	SNP	15690712	15690712	KIAA0430	16	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	8099	182
ITGAX	3687	broad.mit.edu	37	16	31388543	31388543	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31388543C>A	uc002ebu.1	+	23	2813	c.2746C>A	c.(2746-2748)CTG>ATG	p.L916M	ITGAX_uc002ebt.2_Missense_Mutation_p.L916M	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	916	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CACCTTCCAGCTGGAGCTCCC	0.537																0.025532	-48.472671	10.151787	6	229	KEEP	---	---	---	---	3	3	133	146	0.5	capture	Missense_Mutation	SNP	31388543	31388543	ITGAX	16	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	7812	182
TP53	7157	broad.mit.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577580T>C	uc002gim.2	-	7	895	c.701A>G	c.(700-702)TAC>TGC	p.Y234C	TP53_uc002gig.1_Missense_Mutation_p.Y234C|TP53_uc002gih.2_Missense_Mutation_p.Y234C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y102C|TP53_uc010cng.1_Missense_Mutation_p.Y102C|TP53_uc002gii.1_Missense_Mutation_p.Y102C|TP53_uc010cnh.1_Missense_Mutation_p.Y234C|TP53_uc010cni.1_Missense_Mutation_p.Y234C|TP53_uc002gij.2_Missense_Mutation_p.Y234C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Y141C|TP53_uc002gio.2_Missense_Mutation_p.Y102C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	234	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> F (in a sporadic cancer; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y234C(70)|p.Y234H(13)|p.Y234N(11)|p.0?(7)|p.Y234S(6)|p.Y234*(4)|p.Y234D(3)|p.Y234del(3)|p.Y234fs*2(1)|p.V225fs*23(1)|p.Y234fs*6(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.Y234R(1)|p.Y234Y(1)|p.H233_C242del10(1)|p.D228fs*12(1)|p.Y234F(1)|p.I232_Y236delIHYNY(1)|p.Y141S(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234_N235insX(1)|p.I232fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATGTAGTTGTAGTGGATGGT	0.572	Pancreas(47;798 1329 9957 10801)		111	p.I232fs(HDMYZ-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.843137	176.062713	181.796044	43	8	KEEP	---	---	---	---	15	35	5	5	-1	capture	Missense_Mutation	SNP	7577580	7577580	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	16264	182
KRT31	3881	broad.mit.edu	37	17	39551111	39551111	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39551111G>A	uc002hwn.2	-	6	1139	c.1086C>T	c.(1084-1086)AGC>AGT	p.S362S	KRT31_uc010cxn.2_Silent_p.S362S	NM_002277	NP_002268	Q15323	K1H1_HUMAN	keratin 31	362	Coil 2.|Rod.				epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton				0		Breast(137;0.000496)				TGCAGTCCTCGCTCTCCAGCA	0.532																0.069959	-11.722895	34.746586	17	226	KEEP	---	---	---	---	7	10	107	141	-1	capture	Silent	SNP	39551111	39551111	KRT31	17	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	8387	182
MMD	23531	broad.mit.edu	37	17	53471726	53471726	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:53471726C>T	uc002iui.2	-	7	971	c.686G>A	c.(685-687)CGA>CAA	p.R229Q		NM_012329	NP_036461	Q15546	PAQRB_HUMAN	monocyte to macrophage	229	Lumenal (Potential).				cytolysis	integral to plasma membrane|late endosome membrane|lysosomal membrane|membrane fraction	receptor activity				0						CGTAGGACTTCGGTAAAGGTA	0.463																0.042453	-29.393197	18.234273	9	203	KEEP	---	---	---	---	2	7	131	96	-1	capture	Missense_Mutation	SNP	53471726	53471726	MMD	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9555	182
KCNH6	81033	broad.mit.edu	37	17	61611547	61611547	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61611547A>G	uc002jay.2	+	5	1056	c.976A>G	c.(976-978)ACC>GCC	p.T326A	KCNH6_uc002jax.1_Missense_Mutation_p.T326A|KCNH6_uc010wpl.1_Missense_Mutation_p.T203A|KCNH6_uc010wpm.1_Missense_Mutation_p.T326A|KCNH6_uc002jaz.1_Missense_Mutation_p.T326A	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	326	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	CTATGTCAACACCAATGATGA	0.567																0.030151	-34.803484	13.379804	6	193	KEEP	---	---	---	---	3	5	108	108	-1	capture	Missense_Mutation	SNP	61611547	61611547	KCNH6	17	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	7958	182
DNMT1	1786	broad.mit.edu	37	19	10288042	10288042	+	Silent	SNP	A	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10288042A>G	uc002mng.2	-	5	627	c.447T>C	c.(445-447)CCT>CCC	p.P149P	DNMT1_uc010xlc.1_Silent_p.A165A|DNMT1_uc002mnh.2_Silent_p.A44A|DNMT1_uc010xld.1_Silent_p.P149P|DNMT1_uc010dxb.1_RNA	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	149	Interaction with DNMT3B.|Interaction with the PRC2/EED-EZH2 complex (By similarity).				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	GTGAAGGTTCAGCTGTTTAAA	0.398					705											0.032609	-14.558761	7.391659	3	89	KEEP	---	---	---	---	1	2	49	48	-1	capture	Silent	SNP	10288042	10288042	DNMT1	19	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	4631	182
PLEKHG2	64857	broad.mit.edu	37	19	39915859	39915859	+	Silent	SNP	T	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39915859T>G	uc010xuz.1	+	19	4411	c.4086T>G	c.(4084-4086)GCT>GCG	p.A1362A	PLEKHG2_uc010xuy.1_Intron|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Silent_p.A1140A	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	1362					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ACCACCCTGCTCTCTTGGCCT	0.652																0.097087	6.177724	22.928276	10	93	KEEP	---	---	---	---	7	4	48	52	-1	capture	Silent	SNP	39915859	39915859	PLEKHG2	19	T	G	G	G	1	0	0	0	0	0	0	0	1	691	54	4	4	11972	182
NLRP13	126204	broad.mit.edu	37	19	56423467	56423467	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56423467G>A	uc010ygg.1	-	5	1741	c.1716C>T	c.(1714-1716)CAC>CAT	p.H572H		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	572							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		CAAGCAAGACGTGTTGCAGTA	0.423																0.057915	-22.386677	30.696577	15	244	KEEP	---	---	---	---	9	7	137	128	-1	capture	Silent	SNP	56423467	56423467	NLRP13	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10382	182
TMEM18	129787	broad.mit.edu	37	2	669581	669581	+	Silent	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:669581C>T	uc002qwl.2	-	5	516	c.422G>A	c.(421-423)TGA>TAA	p.*141*	TMEM18_uc002qwk.2_RNA	NM_152834	NP_690047	Q96B42	TMM18_HUMAN	transmembrane protein 18	141					cell migration	integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		TGCTGCCCCTCAGTCttcttt	0.448																0.590643	302.770076	303.991539	101	70	KEEP	---	---	---	---	49	53	36	38	-1	capture	Silent	SNP	669581	669581	TMEM18	2	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	15981	182
GREB1	9687	broad.mit.edu	37	2	11750922	11750922	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11750922G>A	uc002rbk.1	+	18	3075	c.2775G>A	c.(2773-2775)TCG>TCA	p.S925S	GREB1_uc002rbo.1_Silent_p.S559S|GREB1_uc002rbp.1_5'Flank	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	925						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ACTACACGTCGGTGGAGACGC	0.657	Ovarian(39;850 945 2785 23371 33093)															0.522013	268.096731	268.169451	83	76	KEEP	---	---	---	---	46	53	41	44	-1	capture	Silent	SNP	11750922	11750922	GREB1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6693	182
APOB	338	broad.mit.edu	37	2	21225763	21225763	+	Silent	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21225763T>C	uc002red.2	-	29	12659	c.12531A>G	c.(12529-12531)CGA>CGG	p.R4177R		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	4177					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTTGAGTAACTCGTACCAAGC	0.463																0.36478	197.91334	200.468145	58	101	KEEP	---	---	---	---	36	26	54	52	-1	capture	Silent	SNP	21225763	21225763	APOB	2	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	778	182
FAM128A	653784	broad.mit.edu	37	2	132241729	132241729	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132241729C>T	uc002tsw.3	-	3	497	c.382G>A	c.(382-384)GAG>AAG	p.E128K	FAM128A_uc002tsv.3_RNA	NM_001085365	NP_001078834	Q6P582	MZT2A_HUMAN	hypothetical protein LOC653784	128						centrosome|gamma-tubulin ring complex|spindle					0				BRCA - Breast invasive adenocarcinoma(221;0.13)		CTGGATCCCTCGTGGTTGCTG	0.642																0.02551	-40.153192	8.69228	5	191	KEEP	---	---	---	---	1	4	111	115	-1	capture	Missense_Mutation	SNP	132241729	132241729	FAM128A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5388	182
FMNL2	114793	broad.mit.edu	37	2	153399316	153399316	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:153399316C>T	uc002tye.2	+	3	632	c.265C>T	c.(265-267)CCA>TCA	p.P89S		NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2	89	GBD/FH3.				actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						CTATCTGGATCCAGCTGTAAC	0.433																0.337748	145.165527	148.687425	51	100	KEEP	---	---	---	---	30	27	62	59	-1	capture	Missense_Mutation	SNP	153399316	153399316	FMNL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	5896	182
ACVR1C	130399	broad.mit.edu	37	2	158485147	158485147	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158485147C>T	uc002tzk.3	-	1	253	c.10G>A	c.(10-12)GCG>ACG	p.A4T	ACVR1C_uc002tzl.3_Missense_Mutation_p.A4T|ACVR1C_uc010fof.2_Missense_Mutation_p.A4T	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	4					apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						GAGCAGAGCGCCCGGGTCATC	0.751					127											0.428571	7.632089	7.661084	3	4	KEEP	---	---	---	---	4	1	1	4	-1	capture	Missense_Mutation	SNP	158485147	158485147	ACVR1C	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	222	182
CPS1	1373	broad.mit.edu	37	2	211476895	211476895	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:211476895T>C	uc002vee.3	+	20	2578	c.2446T>C	c.(2446-2448)TGC>CGC	p.C816R	CPS1_uc010fur.2_Missense_Mutation_p.C822R|CPS1_uc010fus.2_Missense_Mutation_p.C365R	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	816					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		TTTACGGATGTGCCACCCATC	0.413																0.037267	-52.366001	22.297027	12	310	KEEP	---	---	---	---	8	5	183	187	-1	capture	Missense_Mutation	SNP	211476895	211476895	CPS1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3788	182
CYP27A1	1593	broad.mit.edu	37	2	219677652	219677652	+	Missense_Mutation	SNP	A	C	C	rs72551319		TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219677652A>C	uc002viz.3	+	5	1284	c.850A>C	c.(850-852)AAG>CAG	p.K284Q		NM_000784	NP_000775	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A,	284					bile acid biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	cholestanetriol 26-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Cholecalciferol(DB00169)	CACAGGGAAGAAGCTGATTGA	0.517																0.039683	-15.932401	12.853263	5	121	KEEP	---	---	---	---	4	2	72	64	-1	capture	Missense_Mutation	SNP	219677652	219677652	CYP27A1	2	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	4118	182
C2orf54	79919	broad.mit.edu	37	2	241831024	241831024	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241831024G>A	uc002wae.3	-	2	830	c.671C>T	c.(670-672)CCT>CTT	p.P224L	C2orf54_uc002wac.2_Missense_Mutation_p.P56L|C2orf54_uc002wad.2_Missense_Mutation_p.P75L	NM_001085437	NP_001078906	Q08AI8	CB054_HUMAN	hypothetical protein LOC79919 isoform 1	224											0		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		GCTGCCCTCAGGGAATCCGGG	0.647																0.040404	-27.868977	17.174317	8	190	KEEP	---	---	---	---	5	4	93	123	-1	capture	Missense_Mutation	SNP	241831024	241831024	C2orf54	2	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	2155	182
COL18A1	80781	broad.mit.edu	37	21	46875768	46875768	+	Silent	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46875768C>T	uc011afs.1	+	1	345	c.324C>T	c.(322-324)GCC>GCT	p.A108A	COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Silent_p.A108A	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	108					cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		AGAACATTGCCGGTGTCGGAG	0.642				p.A108A(HLF-Tumor)	1836											0.037594	-21.825884	8.945035	5	128	KEEP	---	---	---	---	3	2	69	75	-1	capture	Silent	SNP	46875768	46875768	COL18A1	21	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3640	182
EFCAB6	64800	broad.mit.edu	37	22	44083357	44083357	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:44083357C>T	uc003bdy.1	-	11	1351	c.1136G>A	c.(1135-1137)AGA>AAA	p.R379K	EFCAB6_uc003bdz.1_Missense_Mutation_p.R227K|EFCAB6_uc010gzi.1_Missense_Mutation_p.R227K|EFCAB6_uc010gzk.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Missense_Mutation_p.R376K	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	379					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				ATACCTATTTCTTTTTGTCAG	0.308																0.145833	0.919865	6.902424	7	41	KEEP	---	---	---	---	2	6	18	26	-1	capture	Missense_Mutation	SNP	44083357	44083357	EFCAB6	22	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4894	182
CX3CR1	1524	broad.mit.edu	37	3	39307958	39307958	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:39307958C>T	uc003cjl.2	-	2	135	c.43G>A	c.(43-45)GAT>AAT	p.D15N		NM_001337	NP_001328	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	15	Extracellular (Potential).				cell adhesion|cellular defense response|chemotaxis|interspecies interaction between organisms|response to wounding	integral to plasma membrane	chemokine receptor activity			lung(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		GCCAAATCATCGTACTCAAAG	0.448																0.308642	68.74385	71.387768	25	56	KEEP	---	---	---	---	12	14	40	25	-1	capture	Missense_Mutation	SNP	39307958	39307958	CX3CR1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4035	182
BAP1	8314	broad.mit.edu	37	3	52442518	52442518	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52442518A>G	uc003ddx.2	-	4	342	c.227T>C	c.(226-228)ATT>ACT	p.I76T	PHF7_uc003ddy.2_5'Flank|PHF7_uc003ddz.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	76					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GTTATTCACAATATCATCATC	0.478	GBM(101;493 1458 7992 21037 25532)				294	N|Mis|F|S|O		uveal melanoma|breast|NSCLC								0.171429	14.128803	17.699937	6	29	KEEP	---	---	---	---	4	4	15	15	-1	capture	Missense_Mutation	SNP	52442518	52442518	BAP1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	1300	182
ATXN7	6314	broad.mit.edu	37	3	63898472	63898472	+	Silent	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:63898472C>T	uc003dlw.3	+	3	751	c.198C>T	c.(196-198)GGC>GGT	p.G66G	ATXN7_uc003dlv.2_Silent_p.G66G|ATXN7_uc010hnv.2_Silent_p.G66G|ATXN7_uc010hnu.1_RNA	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	66					cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		gcgggcccggcgccgccTCCA	0.308																0.5	37.542949	37.542949	14	14	KEEP	---	---	---	---	12	11	6	13	-1	capture	Silent	SNP	63898472	63898472	ATXN7	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1206	182
SR140	23350	broad.mit.edu	37	3	142731118	142731118	+	Missense_Mutation	SNP	A	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:142731118A>G	uc003evh.1	+	3	244	c.145A>G	c.(145-147)AGC>GGC	p.S49G	SR140_uc003evi.1_5'UTR|SR140_uc011bnj.1_Missense_Mutation_p.S49G|SR140_uc003evj.1_RNA|SR140_uc003evk.1_Missense_Mutation_p.S49G	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein	49					RNA processing	nucleus	nucleotide binding|RNA binding				0						ACGACCTAAGAGCCCAAGAAA	0.388	Colon(87;897 1320 15089 19747 35974)															0.471429	123.576201	123.625442	33	37	KEEP	---	---	---	---	12	25	21	22	-1	capture	Missense_Mutation	SNP	142731118	142731118	SR140	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	15023	182
ZBBX	79740	broad.mit.edu	37	3	167034878	167034878	+	Missense_Mutation	SNP	A	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:167034878A>T	uc003fep.2	-	14	1432	c.1109T>A	c.(1108-1110)GTA>GAA	p.V370E	ZBBX_uc011bpc.1_Missense_Mutation_p.V370E|ZBBX_uc003feq.2_Missense_Mutation_p.V341E	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	370						intracellular	zinc ion binding			ovary(2)	2						TGTGTGTTGTACTTTGGTCTC	0.328																0.087838	4.966863	30.389014	13	135	KEEP	---	---	---	---	8	6	82	67	-1	capture	Missense_Mutation	SNP	167034878	167034878	ZBBX	3	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	17397	182
KIAA0232	9778	broad.mit.edu	37	4	6865692	6865692	+	Nonsense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:6865692C>T	uc003gjr.3	+	7	4046	c.3583C>T	c.(3583-3585)CAG>TAG	p.Q1195*	KIAA0232_uc003gjq.3_Nonsense_Mutation_p.Q1195*	NM_014743	NP_055558	Q92628	K0232_HUMAN	hypothetical protein LOC9778	1195							ATP binding			ovary(2)	2						ACTGGATTCCCAGGAGGAATC	0.408																0.483146	133.016709	133.038907	43	46	KEEP	---	---	---	---	19	26	21	27	-1	capture	Nonsense_Mutation	SNP	6865692	6865692	KIAA0232	4	C	T	T	T	1	0	0	0	0	0	1	0	0	273	21	5	2	8085	182
NAAA	27163	broad.mit.edu	37	4	76842123	76842123	+	Missense_Mutation	SNP	G	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:76842123G>C	uc003hjb.2	-	6	884	c.820C>G	c.(820-822)CTA>GTA	p.L274V	NAAA_uc003hja.2_Missense_Mutation_p.L274V|NAAA_uc003hjc.3_Missense_Mutation_p.L274V|NAAA_uc003hjd.3_RNA|NAAA_uc011cbq.1_Missense_Mutation_p.L173V	NM_014435	NP_055250	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase isoform 1	274					lipid metabolic process	lysosome	hydrolase activity			skin(1)	1						AAAGGATCTAGAGGCCAAATG	0.433																0.393701	175.824284	177.080425	50	77	KEEP	---	---	---	---	29	25	41	50	-1	capture	Missense_Mutation	SNP	76842123	76842123	NAAA	4	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	10037	182
PET112L	5188	broad.mit.edu	37	4	152592379	152592379	+	Nonsense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:152592379G>A	uc003iml.2	-	13	1633	c.1621C>T	c.(1621-1623)CGA>TGA	p.R541*	PET112L_uc003imk.2_RNA	NM_004564	NP_004555	O75879	GATB_HUMAN	PET112-like precursor	541						mitochondrion	ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor|translation factor activity, nucleic acid binding				0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)			L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GGATCTGCTCGGCTTTGAGTC	0.453																0.022556	-56.687666	10.921046	6	260	KEEP	---	---	---	---	1	5	152	132	-1	capture	Nonsense_Mutation	SNP	152592379	152592379	PET112L	4	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	11637	182
ETFDH	2110	broad.mit.edu	37	4	159603468	159603468	+	Silent	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159603468T>C	uc003iqb.2	+	3	629	c.297T>C	c.(295-297)CGT>CGC	p.R99R	ETFDH_uc011cjg.1_Silent_p.R52R|ETFDH_uc010iqr.2_Intron|ETFDH_uc011cjh.1_Silent_p.R38R|ETFDH_uc010iqs.2_Silent_p.R38R	NM_004453	NP_004444	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	99					fatty acid beta-oxidation using acyl-CoA dehydrogenase|respiratory electron transport chain|response to oxidative stress|transport	integral to mitochondrial inner membrane|mitochondrial matrix	4 iron, 4 sulfur cluster binding|electron carrier activity|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity, oxidizing metal ions with flavin as acceptor|ubiquinone binding			large_intestine(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		AGGACATCCGTGTGTGTCTAG	0.502																0.065395	-20.892368	51.078576	24	343	KEEP	---	---	---	---	15	10	189	178	-1	capture	Silent	SNP	159603468	159603468	ETFDH	4	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	5226	182
C6orf10	10665	broad.mit.edu	37	6	32260945	32260945	+	Missense_Mutation	SNP	T	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32260945T>A	uc011dpy.1	-	12	1678	c.1505A>T	c.(1504-1506)GAA>GTA	p.E502V	C6orf10_uc011dpx.1_Intron	NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	502	Lys-rich.					integral to membrane				skin(1)	1						tctctccttttctttatcatt	0.174																0.479452	298.82811	298.910004	105	114	KEEP	---	---	---	---	68	37	71	45	-1	capture	Missense_Mutation	SNP	32260945	32260945	C6orf10	6	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	2294	182
HLA-DMB	3109	broad.mit.edu	37	6	32903319	32903319	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32903319G>A	uc003ocl.1	-	4	966	c.733C>T	c.(733-735)CAC>TAC	p.H245Y	HLA-DMB_uc003ocj.1_3'UTR|HLA-DMB_uc003ock.1_RNA|HLA-DMB_uc010jud.1_Missense_Mutation_p.H114Y|HLA-DMB_uc010jue.1_Intron|HLA-DMB_uc010juf.1_Intron	NM_002118	NP_002109	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM	245	Cytoplasmic (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TCACTAGAGTGGCCAGCTCTC	0.537																0.351515	164.698283	167.907961	58	107	KEEP	---	---	---	---	40	37	71	60	-1	capture	Missense_Mutation	SNP	32903319	32903319	HLA-DMB	6	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	7124	182
GRM4	2914	broad.mit.edu	37	6	34004117	34004117	+	Silent	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34004117C>T	uc003oir.3	-	8	1940	c.1770G>A	c.(1768-1770)CTG>CTA	p.L590L	GRM4_uc011dsn.1_Silent_p.L543L|GRM4_uc010jvh.2_Silent_p.L590L|GRM4_uc010jvi.2_Silent_p.L282L|GRM4_uc003oio.2_Silent_p.L282L|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Silent_p.L450L|GRM4_uc003oiq.2_Silent_p.L457L|GRM4_uc011dsm.1_Silent_p.L421L	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	590	Helical; Name=1; (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GGAAGAGGGGCAGCACGGCCC	0.647																0.264368	46.290874	50.67147	23	64	KEEP	---	---	---	---	13	14	38	36	-1	capture	Silent	SNP	34004117	34004117	GRM4	6	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	6732	182
MCM3	4172	broad.mit.edu	37	6	52149470	52149470	+	Missense_Mutation	SNP	C	G	G			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52149470C>G	uc003pan.1	-	1	113	c.3G>C	c.(1-3)ATG>ATC	p.M1I	MCM3_uc011dwu.1_5'UTR	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	1					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)					CGGTACCCGCCATGCCCGCTG	0.642																0.466667	23.423852	23.438359	7	8	KEEP	---	---	---	---	2	5	12	8	-1	capture	Missense_Mutation	SNP	52149470	52149470	MCM3	6	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	9300	182
IKZF1	10320	broad.mit.edu	37	7	50450397	50450397	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50450397C>T	uc003tow.3	+	6	749	c.581C>T	c.(580-582)ACG>ATG	p.T194M	IKZF1_uc003tox.3_Missense_Mutation_p.T194M|IKZF1_uc003toy.3_Missense_Mutation_p.T194M|IKZF1_uc011kck.1_Missense_Mutation_p.T107M|IKZF1_uc003toz.3_Missense_Mutation_p.T164M|IKZF1_uc010kyx.2_Intron	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	194	C2H2-type 3.|Required for both high-affinity DNA binding and pericentromeric heterochromatin localization (By similarity).				cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(74)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CACCTGAGGACGCACTCCGGT	0.657					226	D		ALL								0.147059	7.853056	11.921994	5	29	KEEP	---	---	---	---	3	3	24	13	-1	capture	Missense_Mutation	SNP	50450397	50450397	IKZF1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7537	182
TAF6	6878	broad.mit.edu	37	7	99711354	99711354	+	Silent	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99711354G>A	uc003uti.2	-	4	363	c.282C>T	c.(280-282)TTC>TTT	p.F94F	TAF6_uc003utg.2_Silent_p.F35F|TAF6_uc003uth.2_Silent_p.F151F|TAF6_uc003utk.2_Silent_p.F94F|TAF6_uc011kji.1_Silent_p.F131F|TAF6_uc003utj.2_Silent_p.F84F|TAF6_uc003utl.2_Silent_p.F94F|TAF6_uc003utm.2_Silent_p.F94F|TAF6_uc003utn.1_RNA	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	94					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGCGAAGCGGAAAGGAATGA	0.602																0.059701	-6.149771	7.443311	4	63	KEEP	---	---	---	---	3	2	33	40	-1	capture	Silent	SNP	99711354	99711354	TAF6	7	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	15418	182
PIK3CG	5294	broad.mit.edu	37	7	106509904	106509904	+	Missense_Mutation	SNP	G	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106509904G>A	uc003vdv.3	+	2	1983	c.1898G>A	c.(1897-1899)TGC>TAC	p.C633Y	PIK3CG_uc003vdu.2_Missense_Mutation_p.C633Y|PIK3CG_uc003vdw.2_Missense_Mutation_p.C633Y	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	633					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CTCCTGGACTGCAACTTCTCA	0.333					292											0.032468	-28.953226	7.827257	5	149	KEEP	---	---	---	---	3	2	72	88	-1	capture	Missense_Mutation	SNP	106509904	106509904	PIK3CG	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	11819	182
ADAMDEC1	27299	broad.mit.edu	37	8	24251623	24251623	+	Missense_Mutation	SNP	C	A	A			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24251623C>A	uc003xdz.2	+	4	546	c.326C>A	c.(325-327)CCC>CAC	p.P109H	ADAMDEC1_uc010lub.2_Missense_Mutation_p.P30H|ADAMDEC1_uc011lab.1_Missense_Mutation_p.P30H	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	109					integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		TTGTACTCACCCAGAGGAGAG	0.463	Ovarian(147;687 1849 3699 25981 31337)															0.065217	-5.428408	12.636575	6	86	KEEP	---	---	---	---	5	2	39	62	0.285714285714	capture	Missense_Mutation	SNP	24251623	24251623	ADAMDEC1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	254	182
SNTB1	6641	broad.mit.edu	37	8	121644863	121644863	+	Missense_Mutation	SNP	T	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121644863T>C	uc010mdg.2	-	3	1043	c.817A>G	c.(817-819)AAG>GAG	p.K273E	SNTB1_uc003ype.2_Missense_Mutation_p.K273E	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin	273	PH 1.				muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			ACCGTGTGCTTAGCATCTGGA	0.527																0.47191	155.259304	155.318918	42	47	KEEP	---	---	---	---	24	29	28	32	-1	capture	Missense_Mutation	SNP	121644863	121644863	SNTB1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	14764	182
SH2D3C	10044	broad.mit.edu	37	9	130507361	130507361	+	Missense_Mutation	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130507361C>T	uc004bsc.2	-	7	1424	c.1282G>A	c.(1282-1284)GCC>ACC	p.A428T	SH2D3C_uc010mxo.2_Missense_Mutation_p.A268T|SH2D3C_uc004bry.2_Missense_Mutation_p.A270T|SH2D3C_uc004brz.3_Missense_Mutation_p.A74T|SH2D3C_uc011mak.1_Missense_Mutation_p.A74T|SH2D3C_uc004bsa.2_Missense_Mutation_p.A271T|SH2D3C_uc004bsb.2_Missense_Mutation_p.A360T	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	428					JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						GCTGCAGGGGCGGCATGGACA	0.627																0.431373	64.747146	64.955285	22	29	KEEP	---	---	---	---	10	12	14	16	-1	capture	Missense_Mutation	SNP	130507361	130507361	SH2D3C	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14127	182
GFI1B	8328	broad.mit.edu	37	9	135863634	135863634	+	Missense_Mutation	SNP	G	A	A	rs145562579		TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135863634G>A	uc004ccg.2	+	4	440	c.289G>A	c.(289-291)GAC>AAC	p.D97N	GFI1B_uc010mzy.2_Missense_Mutation_p.D97N	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription	97	Interaction with ARIH2.				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		TCCACTGTCCGACTCACCCCC	0.587																0.069444	-5.751025	21.809411	10	134	KEEP	---	---	---	---	6	5	72	76	-1	capture	Missense_Mutation	SNP	135863634	135863634	GFI1B	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6280	182
SFRS17A	8227	broad.mit.edu	37	X	1719770	1719770	+	Silent	SNP	C	T	T			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1719770C>T	uc004cqa.2	+	5	1567	c.1371C>T	c.(1369-1371)GGC>GGT	p.G457G	SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_Intron	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	457					B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACGAGCTGGGCGTGGCACACG	0.701																0.5	11.500242	11.500242	4	4	KEEP	---	---	---	---	2	2	2	7	-1	capture	Silent	SNP	1719770	1719770	SFRS17A	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14066	182
CITED1	4435	broad.mit.edu	37	X	71522708	71522708	+	Silent	SNP	C	T	T	rs146201846	byFrequency	TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71522708C>T	uc011mqd.1	-	2	167	c.12G>A	c.(10-12)ACG>ACA	p.T4T	CITED1_uc011mqc.1_Silent_p.T30T|CITED1_uc004eas.2_Silent_p.T4T|CITED1_uc004eat.2_Silent_p.T4T	NM_001144887	NP_001138359	Q99966	CITE1_HUMAN	melanocyte-specific gene 1 isoform 1	4					apoptosis|branching involved in ureteric bud morphogenesis|cell proliferation|melanin biosynthetic process|melanocyte differentiation|mesenchymal to epithelial transition|metanephros development|negative regulation of neuron apoptosis|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|nucleocytoplasmic transport|placenta development|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transcription from RNA polymerase II promoter|response to cAMP|response to estrogen stimulus|response to insulin stimulus|response to interferon-gamma|response to interleukin-1|response to interleukin-11|response to interleukin-2|response to interleukin-4|response to interleukin-6|response to interleukin-9|response to lipopolysaccharide|response to parathyroid hormone stimulus|response to transforming growth factor beta stimulus|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	chromatin binding|co-SMAD binding|LBD domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding				0	Renal(35;0.156)					CAGGCCTCGACGTTGTTGGCA	0.428																0.176471	12.229298	15.583158	6	28	KEEP	---	---	---	---	6	2	18	12	-1	capture	Silent	SNP	71522708	71522708	CITED1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	3404	182
CHRDL1	91851	broad.mit.edu	37	X	109922648	109922648	+	Missense_Mutation	SNP	G	C	C			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:109922648G>C	uc004eou.3	-	11	1511	c.1162C>G	c.(1162-1164)CTC>GTC	p.L388V	CHRDL1_uc004eov.2_Missense_Mutation_p.L377V|CHRDL1_uc004eow.2_Missense_Mutation_p.L386V|CHRDL1_uc010nps.2_Missense_Mutation_p.L387V|CHRDL1_uc004eot.2_Missense_Mutation_p.L307V|CHRDL1_uc011mss.1_Missense_Mutation_p.L302V	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor	380					BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						AAGTGCTGGAGAATGCCTAGG	0.453																0.056338	-4.56266	10.126156	4	67	KEEP	---	---	---	---	2	2	30	41	-1	capture	Missense_Mutation	SNP	109922648	109922648	CHRDL1	23	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	3338	182
NBPF10	100132406	broad.mit.edu	37	1	145328401	145328406	+	In_Frame_Del	DEL	GAAGAC	-	-			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145328401_145328406delGAAGAC	uc001end.3	+	35	4509_4514	c.4474_4479delGAAGAC	c.(4474-4479)GAAGACdel	p.ED1494del	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1419_1420											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGAAGAGGAAGAAGACGAAGACCAAG	0.466																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	145328401	145328406	NBPF10	1	GAAGAC	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	10100	182
DDX10	1662	broad.mit.edu	37	11	108788635	108788637	+	In_Frame_Del	DEL	TGA	-	-			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108788635_108788637delTGA	uc001pkm.2	+	17	2405_2407	c.2340_2342delTGA	c.(2338-2343)AGTGAT>AGT	p.D788del	DDX10_uc001pkl.1_In_Frame_Del_p.D788del	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	788							ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TGGATTGGAGtgatgatgatgat	0.310					268	T	NUP98	AML*								0.05			8	153		---	---	---	---						capture_indel	In_Frame_Del	DEL	108788635	108788637	DDX10	11	TGA	-	-	-	1	0	1	0	1	0	0	0	0	764	59	5	5	4300	182
NF1	4763	broad.mit.edu	37	17	29667528	29667528	+	Frame_Shift_Del	DEL	G	-	-			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29667528delG	uc002hgg.2	+	47	7260	c.6927delG	c.(6925-6927)TCGfs	p.S2309fs	NF1_uc002hgh.2_Frame_Shift_Del_p.S2288fs|NF1_uc010cso.2_Frame_Shift_Del_p.S497fs|NF1_uc010wbt.1_5'UTR|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2309					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCCAGGACTCGCCTCTGCACA	0.443					847	D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.70			61	26		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	29667528	29667528	NF1	17	G	-	-	-	1	0	1	0	1	0	0	0	0	483	38	5	5	10263	182
PRKCD	5580	broad.mit.edu	37	3	53220653	53220653	+	Frame_Shift_Del	DEL	G	-	-			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53220653delG	uc003dgl.2	+	14	1647	c.1294delG	c.(1294-1296)GGGfs	p.G432fs	PRKCD_uc003dgm.2_Frame_Shift_Del_p.G432fs	NM_006254	NP_006245	Q05655	KPCD_HUMAN	protein kinase C, delta	432	Protein kinase.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of ceramide biosynthetic process|positive regulation of glucosylceramide catabolic process|positive regulation of protein dephosphorylation|positive regulation of sphingomyelin catabolic process|protein stabilization|regulation of receptor activity|termination of signal transduction	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(3)|stomach(1)|skin(1)	9		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)		GTTCCTCAACGGGGGGGACCT	0.602				p.G432W(QGP1-Tumor)	215											0.01			7	743		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	53220653	53220653	PRKCD	3	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	12405	182
TMEM44	93109	broad.mit.edu	37	3	194325157	194325157	+	Frame_Shift_Del	DEL	G	-	-			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194325157delG	uc010hzn.2	-	10	1345	c.1176delC	c.(1174-1176)ACCfs	p.T392fs	TMEM44_uc010hzm.2_Frame_Shift_Del_p.P76fs|TMEM44_uc003fuc.2_Frame_Shift_Del_p.T77fs|TMEM44_uc003fue.2_Frame_Shift_Del_p.T345fs|TMEM44_uc003fud.2_Frame_Shift_Del_p.T345fs|TMEM44_uc003fuf.2_Frame_Shift_Del_p.P344fs|TMEM44_uc011bsv.1_Frame_Shift_Del_p.T345fs|TMEM44_uc003fuh.1_RNA	NM_001011655	NP_001011655	Q2T9K0	TMM44_HUMAN	transmembrane protein 44 isoform b	392	Cytoplasmic (Potential).					integral to membrane					0	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		CTGGCAGCCTGGTGGCACTGC	0.597																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	194325157	194325157	TMEM44	3	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	16051	182
PCDHGB1	56104	broad.mit.edu	37	5	140729895	140729896	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-26-5133-01	TCGA-26-5133-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140729895_140729896delTC	uc003ljo.1	+	1	68_69	c.68_69delTC	c.(67-69)TTCfs	p.F23fs	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc011daq.1_Frame_Shift_Del_p.F23fs	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	23					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTCTTTGTTCTGCGGGGCCA	0.550														OREG0016856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.82			14	3		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	140729895	140729896	PCDHGB1	5	TC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	11465	182
