Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GJB3	2707	broad.mit.edu	37	1	35250842	35250842	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:35250842G>A	uc001bxx.2	+	2	1094	c.479G>A	c.(478-480)CGC>CAC	p.R160H	GJB3_uc001bxy.2_Missense_Mutation_p.R160H|GJB3_uc001bxz.3_Missense_Mutation_p.R160H|uc010ohs.1_RNA	NM_024009	NP_076872	O75712	CXB3_HUMAN	connexin 31	160	Extracellular (Potential).				cell communication	connexon complex|integral to membrane	gap junction channel activity				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				AATATGCCGCGCCTGGTGCAG	0.552																0.031646	-29.737028	8.171897	5	153	KEEP	---	---	---	---	1	4	78	92	-1	capture	Missense_Mutation	SNP	35250842	35250842	GJB3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6346	192
EPHA10	284656	broad.mit.edu	37	1	38227109	38227109	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38227109G>A	uc009vvi.2	-	3	904	c.818C>T	c.(817-819)GCG>GTG	p.A273V	EPHA10_uc001cbw.3_Missense_Mutation_p.A273V	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	273	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGGAATCCCGCGCTGCAGCT	0.677					328											0.410959	79.322343	79.830909	30	43	KEEP	---	---	---	---	13	20	20	30	-1	capture	Missense_Mutation	SNP	38227109	38227109	EPHA10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5121	192
LRRIQ3	127255	broad.mit.edu	37	1	74507363	74507363	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:74507363G>A	uc001dfy.3	-	7	1444	c.1252C>T	c.(1252-1254)CGA>TGA	p.R418*	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	418										ovary(2)	2						CTAAATGTTCGGAGTTTCATA	0.363					2											0.373563	199.223009	201.668409	65	109	KEEP	---	---	---	---	34	34	67	48	-1	capture	Nonsense_Mutation	SNP	74507363	74507363	LRRIQ3	1	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	8945	192
NBPF9	400818	broad.mit.edu	37	1	144615288	144615288	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144615288C>T	uc009wig.1	+	4	236	c.160C>T	c.(160-162)CGA>TGA	p.R54*	NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_5'UTR|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_5'UTR|NBPF9_uc010oyg.1_Missense_Mutation_p.P53L|NBPF9_uc009wii.1_5'UTR|NBPF9_uc009wif.1_RNA|C1orf152_uc001elf.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	54						cytoplasm					0						CCTGGCCAACCGACAGAAGAA	0.448					20											0.395918	299.426555	301.748309	97	148	KEEP	---	---	---	---	58	75	136	177	-1	capture	Nonsense_Mutation	SNP	144615288	144615288	NBPF9	1	C	T	T	T	1	0	0	0	0	0	1	0	0	299	23	5	1	10106	192
ILDR2	387597	broad.mit.edu	37	1	166904584	166904584	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:166904584A>T	uc001gdx.1	-	6	890	c.834T>A	c.(832-834)CAT>CAA	p.H278Q		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	278	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						AGGGAGGTGGATGCGGCTTGT	0.617																0.344086	98.775793	100.770741	32	61	KEEP	---	---	---	---	32	14	44	40	-1	capture	Missense_Mutation	SNP	166904584	166904584	ILDR2	1	A	T	T	T	1	0	0	0	0	1	0	0	0	154	12	4	4	7633	192
MPP7	143098	broad.mit.edu	37	10	28345469	28345469	+	Silent	SNP	T	C	C			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28345469T>C	uc001iua.1	-	18	1895	c.1491A>G	c.(1489-1491)ACA>ACG	p.T497T	MPP7_uc009xkz.1_RNA|MPP7_uc001iub.1_Silent_p.T497T|MPP7_uc009xla.2_Silent_p.T497T|MPP7_uc010qdv.1_RNA	NM_173496	NP_775767	Q5T2T1	MPP7_HUMAN	palmitoylated membrane protein 7	497	Guanylate kinase-like.				establishment of cell polarity|positive regulation of protein complex assembly|protein localization to adherens junction|tight junction assembly	MPP7-DLG1-LIN7 complex|tight junction	protein complex scaffold|protein domain specific binding|protein heterodimerization activity|signaling adaptor activity			ovary(1)	1						CATTTTTTCTTGTTTCTCTCA	0.333																0.208333	91.190981	106.320657	40	152	KEEP	---	---	---	---	24	20	87	83	-1	capture	Silent	SNP	28345469	28345469	MPP7	10	T	C	C	C	1	0	0	0	0	0	0	0	1	808	63	3	3	9651	192
OGDHL	55753	broad.mit.edu	37	10	50943387	50943387	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50943387G>A	uc001jie.2	-	23	3062	c.2920C>T	c.(2920-2922)CGG>TGG	p.R974W	OGDHL_uc009xog.2_Missense_Mutation_p.R1001W|OGDHL_uc010qgt.1_Missense_Mutation_p.R917W|OGDHL_uc010qgu.1_Missense_Mutation_p.R765W	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	974					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GCTGGGTCCCGGCCAACATAC	0.622																0.604651	87.858773	88.271005	26	17	KEEP	---	---	---	---	20	23	13	12	-1	capture	Missense_Mutation	SNP	50943387	50943387	OGDHL	10	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	10745	192
A1CF	29974	broad.mit.edu	37	10	52596064	52596064	+	Missense_Mutation	SNP	C	T	T	rs148254279		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:52596064C>T	uc001jjj.2	-	6	562	c.374G>A	c.(373-375)CGC>CAC	p.R125H	A1CF_uc010qhn.1_Missense_Mutation_p.R133H|A1CF_uc001jji.2_Missense_Mutation_p.R125H|A1CF_uc001jjh.2_Missense_Mutation_p.R133H|A1CF_uc010qho.1_Missense_Mutation_p.R133H|A1CF_uc009xov.2_Missense_Mutation_p.R125H	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	125	RRM 1.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						CCCTAAGAGGCGCCCATTTCT	0.438																0.655172	122.964554	124.19804	38	20	KEEP	---	---	---	---	22	16	12	11	-1	capture	Missense_Mutation	SNP	52596064	52596064	A1CF	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2	192
CNNM1	26507	broad.mit.edu	37	10	101147663	101147663	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101147663C>T	uc001kpp.3	+	8	2716	c.2427C>T	c.(2425-2427)GAC>GAT	p.D809D	CNNM1_uc010qpi.1_Silent_p.D830D|CNNM1_uc009xwf.2_Silent_p.D809D|CNNM1_uc009xwg.2_Silent_p.D209D	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1	809					ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CCTTCACAGACGGGGACTCCA	0.602																0.709677	70.359354	71.579977	22	9	KEEP	---	---	---	---	7	15	4	5	-1	capture	Silent	SNP	101147663	101147663	CNNM1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3577	192
DCHS1	8642	broad.mit.edu	37	11	6654846	6654846	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6654846C>T	uc001mem.1	-	5	2662	c.2252G>A	c.(2251-2253)CGG>CAG	p.R751Q		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	751	Cadherin 7.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAATTGGCCCGTCTGGCCAA	0.547																0.461538	16.241615	16.258917	6	7	KEEP	---	---	---	---	1	10	3	5	-1	capture	Missense_Mutation	SNP	6654846	6654846	DCHS1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4246	192
OR4C6	219432	broad.mit.edu	37	11	55432767	55432767	+	Missense_Mutation	SNP	T	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55432767T>A	uc001nht.3	+	3	390	c.125T>A	c.(124-126)CTT>CAT	p.L42H	OR4C6_uc010rik.1_Missense_Mutation_p.L42H	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						GAAAATCTACTTATTGTGGTA	0.393																0.456825	504.755655	505.339268	164	195	KEEP	---	---	---	---	74	98	114	95	-1	capture	Missense_Mutation	SNP	55432767	55432767	OR4C6	11	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	10956	192
TMEM109	79073	broad.mit.edu	37	11	60687272	60687272	+	Missense_Mutation	SNP	G	A	A	rs139328208		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60687272G>A	uc001nqg.2	+	2	485	c.107G>A	c.(106-108)CGT>CAT	p.R36H	TMEM109_uc001nqh.2_Missense_Mutation_p.R36H	NM_024092	NP_076997	Q9BVC6	TM109_HUMAN	transmembrane protein 109 precursor	36						integral to membrane|nuclear outer membrane|sarcoplasmic reticulum membrane					0						GCCCAGTCCCGTCGAGACTTT	0.547																0.364929	219.924329	223.307549	77	134	KEEP	---	---	---	---	40	44	70	81	-1	capture	Missense_Mutation	SNP	60687272	60687272	TMEM109	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15910	192
NXF1	10482	broad.mit.edu	37	11	62561731	62561731	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62561731T>C	uc001nvf.1	-	19	1895	c.1759A>G	c.(1759-1761)AAG>GAG	p.K587E	TMEM223_uc001nve.2_5'Flank|NXF1_uc001nvg.1_3'UTR|NXF1_uc009yog.1_3'UTR	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1	587	TAP-C.				gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						CGCACTCACTTCTGGGACCAC	0.493																0.419355	136.835039	137.356155	39	54	KEEP	---	---	---	---	18	26	29	34	-1	capture	Missense_Mutation	SNP	62561731	62561731	NXF1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	10689	192
SLCO1B3	28234	broad.mit.edu	37	12	21229466	21229466	+	Nonsense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21229466C>T	uc010sil.1	+	15	2076	c.2011C>T	c.(2011-2013)CGA>TGA	p.R671*	LST-3TM12_uc010sim.1_Nonsense_Mutation_p.R610*|LST-3TM12_uc010sin.1_Nonsense_Mutation_p.R563*			Q9NPD5	SO1B3_HUMAN	SubName: Full=Liver-specific organic anion transporter 3TM13; SubName: Full=Organic anion transporter LST-3c;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					CTGTGGAGCACGAGGGGCTTG	0.353																0.361111	309.580494	314.445059	104	184	KEEP	---	---	---	---	58	65	116	97	-1	capture	Nonsense_Mutation	SNP	21229466	21229466	SLCO1B3	12	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	14616	192
STAC3	246329	broad.mit.edu	37	12	57642900	57642900	+	Silent	SNP	G	A	A	rs148939626		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57642900G>A	uc001snp.2	-	3	453	c.258C>T	c.(256-258)AAC>AAT	p.N86N	STAC3_uc009zpl.2_Intron|STAC3_uc001snq.2_Silent_p.N47N|STAC3_uc010srm.1_Intron	NM_145064	NP_659501	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	86					intracellular signal transduction		identical protein binding|metal ion binding			ovary(2)|skin(1)	3						GGGGCTTATCGTTGACCAGCT	0.408																0.283871	115.835701	122.336857	44	111	KEEP	---	---	---	---	32	18	50	71	-1	capture	Silent	SNP	57642900	57642900	STAC3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15131	192
SACS	26278	broad.mit.edu	37	13	23908788	23908788	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23908788G>T	uc001uon.2	-	10	9816	c.9227C>A	c.(9226-9228)ACT>AAT	p.T3076N	SACS_uc001uoo.2_Missense_Mutation_p.T2929N|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	3076					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAGATTAGCAGTTTCATCACA	0.358					738											0.436364	146.783504	147.171915	48	62	KEEP	---	---	---	---	26	24	29	35	0.52	capture	Missense_Mutation	SNP	23908788	23908788	SACS	13	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	13696	192
SPTB	6710	broad.mit.edu	37	14	65270332	65270332	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:65270332C>T	uc001xht.2	-	3	521	c.467G>A	c.(466-468)CGC>CAC	p.R156H	SPTB_uc001xhr.2_Missense_Mutation_p.R156H|SPTB_uc001xhs.2_Missense_Mutation_p.R156H|SPTB_uc001xhu.2_Missense_Mutation_p.R156H	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	156	CH 1.|Actin-binding.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CACCTGGAAGCGGAGGATGAT	0.572																0.393103	167.042179	168.4931	57	88	KEEP	---	---	---	---	26	38	55	52	-1	capture	Missense_Mutation	SNP	65270332	65270332	SPTB	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15010	192
WDR72	256764	broad.mit.edu	37	15	53992060	53992060	+	Missense_Mutation	SNP	A	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53992060A>T	uc002acj.2	-	13	1694	c.1652T>A	c.(1651-1653)CTG>CAG	p.L551Q	WDR72_uc010bfi.1_Missense_Mutation_p.L551Q	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	551	WD 7.									lung(1)|skin(1)	2				all cancers(107;0.0511)		CCGGGCATGCAGGAGGCAACT	0.463																0.367089	270.76497	274.445189	87	150	KEEP	---	---	---	---	48	49	80	82	-1	capture	Missense_Mutation	SNP	53992060	53992060	WDR72	15	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	17203	192
MEF2A	4205	broad.mit.edu	37	15	100230497	100230497	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:100230497G>A	uc010urw.1	+	7	1087	c.728G>A	c.(727-729)GGT>GAT	p.G243D	MEF2A_uc010urv.1_Missense_Mutation_p.G173D|MEF2A_uc010bos.2_Missense_Mutation_p.G241D|MEF2A_uc002bvf.2_Missense_Mutation_p.G243D|MEF2A_uc002bve.2_Missense_Mutation_p.G241D|MEF2A_uc002bvg.2_Missense_Mutation_p.G241D|MEF2A_uc002bvi.2_Missense_Mutation_p.G241D|MEF2A_uc010bot.2_Missense_Mutation_p.G173D	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	243					apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			GGAGCTACTGGTGCAAATAGC	0.413					195											0.414634	52.667891	52.928762	17	24	KEEP	---	---	---	---	8	12	13	13	-1	capture	Missense_Mutation	SNP	100230497	100230497	MEF2A	15	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9368	192
CACNA1H	8912	broad.mit.edu	37	16	1255218	1255218	+	Nonsense_Mutation	SNP	C	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1255218C>A	uc002cks.2	+	11	2804	c.2556C>A	c.(2554-2556)TAC>TAA	p.Y852*	CACNA1H_uc002ckt.2_Nonsense_Mutation_p.Y852*	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	852	II.|Cytoplasmic (Potential).				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	CTCTGGGCTACATCCGGAACC	0.597																0.36	81.701981	82.997048	27	48	KEEP	---	---	---	---	16	13	28	29	0.448275862069	capture	Nonsense_Mutation	SNP	1255218	1255218	CACNA1H	16	C	A	A	A	1	0	0	0	0	0	1	0	0	220	17	5	4	2521	192
MAPK8IP3	23162	broad.mit.edu	37	16	1816093	1816093	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1816093G>A	uc002cmk.2	+	21	2696	c.2576G>A	c.(2575-2577)CGG>CAG	p.R859Q	MAPK8IP3_uc002cml.2_Missense_Mutation_p.R853Q|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.R860Q	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	859					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						AACGTGCCGCGGAGCAACTGC	0.662																0.333333	61.856918	63.405298	21	42	KEEP	---	---	---	---	11	13	16	33	-1	capture	Missense_Mutation	SNP	1816093	1816093	MAPK8IP3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9199	192
SCNN1G	6340	broad.mit.edu	37	16	23200784	23200784	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23200784G>A	uc002dlm.1	+	3	549	c.410G>A	c.(409-411)CGC>CAC	p.R137H		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	137	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	TCCCGGAAGCGCCGAGAGGCG	0.577																0.459184	401.384835	401.811347	135	159	KEEP	---	---	---	---	73	75	89	88	-1	capture	Missense_Mutation	SNP	23200784	23200784	SCNN1G	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13823	192
IL4R	3566	broad.mit.edu	37	16	27357789	27357789	+	Silent	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27357789G>A	uc002don.2	+	6	605	c.363G>A	c.(361-363)GTG>GTA	p.V121V	IL4R_uc002dom.2_Silent_p.V121V|IL4R_uc002dop.3_Silent_p.V106V|IL4R_uc010bxy.2_Silent_p.V121V|IL4R_uc002doo.2_5'UTR	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	121	Extracellular (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CTCCCGCAGTGAAACCCAGGG	0.567																0.315789	63.384806	65.672283	24	52	KEEP	---	---	---	---	18	8	22	34	-1	capture	Silent	SNP	27357789	27357789	IL4R	16	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	7621	192
DNAH9	1770	broad.mit.edu	37	17	11684359	11684359	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11684359G>A	uc002gne.2	+	39	7654	c.7586G>A	c.(7585-7587)GGC>GAC	p.G2529D	DNAH9_uc010coo.2_Missense_Mutation_p.G1823D	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2529	AAA 3 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AAGAAGGCTGGCAGAAACTAT	0.542																0.391892	84.256829	85.014667	29	45	KEEP	---	---	---	---	17	16	27	23	-1	capture	Missense_Mutation	SNP	11684359	11684359	DNAH9	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4564	192
CDRT15	146822	broad.mit.edu	37	17	14140072	14140072	+	Nonsense_Mutation	SNP	G	A	A	rs147270904	byFrequency	TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:14140072G>A	uc010vvu.1	-	1	79	c.79C>T	c.(79-81)CGA>TGA	p.R27*	CDRT15_uc010coq.2_RNA	NM_001007530	NP_001007531	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15	27											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		AGCCTTCTTCGGCATCGTCGG	0.597																0.364865	82.207327	83.395096	27	47	KEEP	---	---	---	---	19	14	41	20	-1	capture	Nonsense_Mutation	SNP	14140072	14140072	CDRT15	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	3144	192
CCL3	6348	broad.mit.edu	37	17	34416095	34416095	+	Nonsense_Mutation	SNP	G	A	A	rs5029409		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34416095G>A	uc002hkv.2	-	3	304	c.202C>T	c.(202-204)CGA>TGA	p.R68*		NM_002983	NP_002974	P10147	CCL3_HUMAN	chemokine (C-C motif) ligand 3	68		Involved in GAG binding.		R->A: Strongly reduces heparin binding.	cell-cell signaling|cellular calcium ion homeostasis|cellular component movement|cytoskeleton organization|exocytosis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response|regulation of viral genome replication	extracellular space|soluble fraction	chemoattractant activity|chemokine activity|signal transducer activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGCCGGCTTCGCTTGGTTAGG	0.597					50											0.1	13.35892	50.122721	23	207	KEEP	---	---	---	---	16	9	120	135	-1	capture	Nonsense_Mutation	SNP	34416095	34416095	CCL3	17	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	2874	192
JUP	3728	broad.mit.edu	37	17	39680449	39680449	+	Missense_Mutation	SNP	G	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39680449G>T	uc010wfs.1	-	8	1391	c.1383C>A	c.(1381-1383)GAC>GAA	p.D461E	KRT15_uc002hxb.1_5'Flank|uc002hxc.1_5'Flank|KRT19_uc002hxd.3_Missense_Mutation_p.D298E	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin	Error:Variant_position_missing_in_P14923_after_alignment					adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TGCGCCGCAGGTCAGTAACCT	0.577	Colon(16;42 520 6044 17852 28530)															0.375	76.713368	77.698416	27	45	KEEP	---	---	---	---	11	19	19	29	0.366666666667	capture	Missense_Mutation	SNP	39680449	39680449	JUP	17	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	7895	192
IGF2BP1	10642	broad.mit.edu	37	17	47115648	47115648	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47115648C>T	uc002iom.2	+	6	854	c.520C>T	c.(520-522)CGG>TGG	p.R174W	IGF2BP1_uc010dbj.2_Intron	NM_006546	NP_006537	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding	174					CRD-mediated mRNA stabilization|negative regulation of translation|regulation of mRNA stability involved in response to stress	CRD-mediated mRNA stability complex|cytosol|dendritic spine|lamellipodium|nucleus|plasma membrane|stress granule	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			kidney(1)	1						CTTTGGCTCTCGGGGTCAGCC	0.652	Esophageal Squamous(198;1041 2123 8248 37119 38268)															0.166667	24.764938	33.564205	14	70	KEEP	---	---	---	---	5	9	45	39	-1	capture	Missense_Mutation	SNP	47115648	47115648	IGF2BP1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	7498	192
SOX9	6662	broad.mit.edu	37	17	70117782	70117782	+	Missense_Mutation	SNP	T	G	G			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:70117782T>G	uc002jiw.2	+	1	622	c.250T>G	c.(250-252)TAC>GAC	p.Y84D	uc002jiv.2_5'Flank	NM_000346	NP_000337	P48436	SOX9_HUMAN	transcription factor SOX9	84					cAMP-mediated signaling|negative regulation of transcription, DNA-dependent|positive regulation of branching involved in ureteric bud morphogenesis|protein complex assembly|renal vesicle induction	nucleus|protein complex	core promoter sequence-specific DNA binding|enhancer binding|protein kinase A catalytic subunit binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription				0		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCTCAAAGGCTACGACTGGAC	0.637	Pancreas(42;83 1041 2320 35205 39456)															0.45	26.671869	26.715489	9	11	KEEP	---	---	---	---	7	3	6	5	-1	capture	Missense_Mutation	SNP	70117782	70117782	SOX9	17	T	G	G	G	1	0	0	0	0	1	0	0	0	689	53	4	4	14850	192
EPB41L3	23136	broad.mit.edu	37	18	5406824	5406824	+	Silent	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5406824G>A	uc002kmt.1	-	16	2387	c.2301C>T	c.(2299-2301)GCC>GCT	p.A767A	EPB41L3_uc010wzh.1_Silent_p.A598A|EPB41L3_uc002kmu.1_Silent_p.A586A|EPB41L3_uc010dkq.1_Silent_p.A477A|EPB41L3_uc002kms.1_Silent_p.A39A|EPB41L3_uc010wze.1_Silent_p.A39A|EPB41L3_uc010wzf.1_Silent_p.A39A|EPB41L3_uc010wzg.1_Silent_p.A39A|EPB41L3_uc010dkr.2_Silent_p.A159A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	767	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CCTGCCTGGCGGCCAGTCGCA	0.527																0.346405	156.735055	159.91883	53	100	KEEP	---	---	---	---	31	33	52	55	-1	capture	Silent	SNP	5406824	5406824	EPB41L3	18	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5109	192
SERPINB2	5055	broad.mit.edu	37	18	61569672	61569672	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61569672G>A	uc010xeu.1	+	8	1046	c.713G>A	c.(712-714)CGT>CAT	p.R238H	SERPINB2_uc002ljo.2_Missense_Mutation_p.R238H|SERPINB2_uc010dqh.2_Missense_Mutation_p.R168H|SERPINB2_uc002ljp.1_Missense_Mutation_p.R43H|SERPINB2_uc002ljq.1_Missense_Mutation_p.R43H	NM_001143818	NP_001137290	P05120	PAI2_HUMAN	serine (or cysteine) proteinase inhibitor, clade	238					anti-apoptosis|blood coagulation|fibrinolysis|regulation of proteolysis	extracellular space|Golgi apparatus|plasma membrane	serine-type endopeptidase inhibitor activity			lung(1)|skin(1)	2		Esophageal squamous(42;0.131)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	ATGTACTTGCGTGAAAAGCTA	0.363																0.342857	139.560193	142.61315	48	92	KEEP	---	---	---	---	21	31	49	50	-1	capture	Missense_Mutation	SNP	61569672	61569672	SERPINB2	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13994	192
CACNA1A	773	broad.mit.edu	37	19	13410023	13410023	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13410023C>T	uc010dze.2	-	19	2663	c.2427G>A	c.(2425-2427)ACG>ACA	p.T809T	CACNA1A_uc010dzc.2_Silent_p.T334T|CACNA1A_uc002mwy.3_Silent_p.T808T|CACNA1A_uc010xne.1_Silent_p.T337T	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	809	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	GCAGGTGCCGCGTGTAGGCAG	0.642																0.231481	58.051557	65.170076	25	83	KEEP	---	---	---	---	18	15	47	57	-1	capture	Silent	SNP	13410023	13410023	CACNA1A	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2514	192
FCGBP	8857	broad.mit.edu	37	19	40368357	40368357	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40368357C>T	uc002omp.3	-	28	12999	c.12991G>A	c.(12991-12993)GCC>ACC	p.A4331T		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4331						extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCTGGCAGGCGGCCACGTAG	0.647																0.141304	48.07396	82.283139	39	237	KEEP	---	---	---	---	15	32	148	169	-1	capture	Missense_Mutation	SNP	40368357	40368357	FCGBP	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5724	192
GPR4	2828	broad.mit.edu	37	19	46094683	46094683	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46094683C>T	uc002pcm.2	-	2	1387	c.442G>A	c.(442-444)GCC>ACC	p.A148T	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	148	Helical; Name=4; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GCCGAGTTGGCGCCCAGCTCC	0.672	Esophageal Squamous(117;181 1612 1673 14956 42937)															0.304498	228.493248	238.3502	88	201	KEEP	---	---	---	---	42	55	115	106	-1	capture	Missense_Mutation	SNP	46094683	46094683	GPR4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6628	192
GPR4	2828	broad.mit.edu	37	19	46094825	46094825	+	Silent	SNP	A	G	G			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46094825A>G	uc002pcm.2	-	2	1245	c.300T>C	c.(298-300)AAT>AAC	p.N100N	OPA3_uc010xxk.1_Intron	NM_005282	NP_005273	P46093	GPR4_HUMAN	G protein-coupled receptor 4	100	Helical; Name=3; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		TGATGTAGATATTGGTGTAGA	0.622	Esophageal Squamous(117;181 1612 1673 14956 42937)															0.237154	171.15962	187.077046	60	193	KEEP	---	---	---	---	28	38	95	113	-1	capture	Silent	SNP	46094825	46094825	GPR4	19	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	6628	192
CCDC114	93233	broad.mit.edu	37	19	48807021	48807021	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48807021C>T	uc002pir.2	-	8	1446	c.763G>A	c.(763-765)GTC>ATC	p.V255I	CCDC114_uc002piq.2_Missense_Mutation_p.V64I|CCDC114_uc002pio.2_Missense_Mutation_p.V292I|CCDC114_uc002pis.1_5'Flank|CCDC114_uc002pit.1_Missense_Mutation_p.V292I|CCDC114_uc002piu.1_Missense_Mutation_p.V292I	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	255										ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GTCTTCCAGACGCCCTCGGCC	0.632																0.302083	228.318145	238.390965	87	201	KEEP	---	---	---	---	61	50	113	170	-1	capture	Missense_Mutation	SNP	48807021	48807021	CCDC114	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2725	192
CD33	945	broad.mit.edu	37	19	51728525	51728525	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51728525C>T	uc002pwa.2	+	2	129	c.89C>T	c.(88-90)ACG>ATG	p.T30M	CD33_uc010eos.1_Missense_Mutation_p.T30M|CD33_uc010eot.1_Intron|CD33_uc010eou.1_5'Flank	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	30	Extracellular (Potential).|Ig-like V-type.				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	GAGTCAGTGACGGTACAGGAG	0.582																0.04375	-21.712806	13.964823	7	153	KEEP	---	---	---	---	5	5	85	86	-1	capture	Missense_Mutation	SNP	51728525	51728525	CD33	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2976	192
CD33	945	broad.mit.edu	37	19	51729331	51729331	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51729331G>A	uc002pwa.2	+	3	731	c.691G>A	c.(691-693)GTC>ATC	p.V231I	CD33_uc010eos.1_Missense_Mutation_p.V231I|CD33_uc010eot.1_Missense_Mutation_p.V104I|CD33_uc010eou.1_RNA	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	231	Extracellular (Potential).				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	CCAGCTCAACGTCACCTGTAA	0.607																0.235294	46.052766	51.503642	20	65	KEEP	---	---	---	---	6	15	20	49	-1	capture	Missense_Mutation	SNP	51729331	51729331	CD33	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2976	192
CPS1	1373	broad.mit.edu	37	2	211481222	211481222	+	Missense_Mutation	SNP	C	T	T	rs148519116		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:211481222C>T	uc002vee.3	+	21	2776	c.2644C>T	c.(2644-2646)CGT>TGT	p.R882C	CPS1_uc010fur.2_Missense_Mutation_p.R888C|CPS1_uc010fus.2_Missense_Mutation_p.R431C|LOC29034_uc002vef.2_5'Flank	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	882					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GTATAAGATGCGTGATATTTT	0.408																0.477987	235.59034	235.657363	76	83	KEEP	---	---	---	---	38	38	48	44	-1	capture	Missense_Mutation	SNP	211481222	211481222	CPS1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3788	192
NCL	4691	broad.mit.edu	37	2	232326477	232326477	+	Silent	SNP	G	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232326477G>T	uc002vru.2	-	3	528	c.387C>A	c.(385-387)ATC>ATA	p.I129I	SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin	129	8.|8 X 8 AA tandem repeats of X-T-P-X-K-K-X- X.				angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CCTTGGCTGGGATGGCAGCAC	0.393																0.146199	34.649979	55.246707	25	146	KEEP	---	---	---	---	38	27	105	91	0.584615384615	capture	Silent	SNP	232326477	232326477	NCL	2	G	T	T	T	1	0	0	0	0	0	0	0	1	525	41	4	4	10133	192
SH3BP4	23677	broad.mit.edu	37	2	235950763	235950763	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:235950763C>T	uc002vvp.2	+	4	1743	c.1350C>T	c.(1348-1350)TAC>TAT	p.Y450Y	SH3BP4_uc010fym.2_Silent_p.Y450Y|SH3BP4_uc002vvq.2_Silent_p.Y450Y	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	450					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CCTGTATGTACGTGGCTGTCG	0.577																0.367089	80.546195	81.775975	29	50	KEEP	---	---	---	---	19	16	26	31	-1	capture	Silent	SNP	235950763	235950763	SH3BP4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14139	192
D2HGDH	728294	broad.mit.edu	37	2	242683167	242683167	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242683167C>T	uc002wce.1	+	5	794	c.621C>T	c.(619-621)AAC>AAT	p.N207N	D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Silent_p.N73N|D2HGDH_uc002wcg.1_RNA	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor	207	FAD-binding PCMH-type.				2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		TGGCAACCAACGCTGGAGGCC	0.617																0.4	24.698648	24.872699	8	12	KEEP	---	---	---	---	8	5	11	15	-1	capture	Silent	SNP	242683167	242683167	D2HGDH	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4173	192
SEMG2	6407	broad.mit.edu	37	20	43851621	43851621	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43851621G>A	uc010ggz.2	+	2	1405	c.1348G>A	c.(1348-1350)GTA>ATA	p.V450I	SEMG2_uc002xnk.2_Missense_Mutation_p.V450I|SEMG2_uc002xnl.2_Intron	NM_003008	NP_002999	Q02383	SEMG2_HUMAN	semenogelin II precursor	450	Repeat-rich region.|4 X 60 AA tandem repeats, type I.				sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(1)	1		Myeloproliferative disorder(115;0.0122)				TCAAAACCAGGTAACAATTCC	0.383																0.317073	144.038602	148.919605	52	112	KEEP	---	---	---	---	27	27	58	60	-1	capture	Missense_Mutation	SNP	43851621	43851621	SEMG2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	13938	192
SULF2	55959	broad.mit.edu	37	20	46292214	46292214	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:46292214G>A	uc002xto.2	-	16	2540	c.2210C>T	c.(2209-2211)ACG>ATG	p.T737M	SULF2_uc002xtr.2_Missense_Mutation_p.T737M|SULF2_uc002xtq.2_Missense_Mutation_p.T737M|SULF2_uc010zyd.1_Missense_Mutation_p.T16M	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	737					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						GAAAGGCGCCGTCTGCCAGTG	0.597					709									OREG0026005	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.30742	233.361921	242.695514	87	196	KEEP	---	---	---	---	60	45	119	123	-1	capture	Missense_Mutation	SNP	46292214	46292214	SULF2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15261	192
ZFP64	55734	broad.mit.edu	37	20	50803594	50803594	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50803594C>T	uc002xwl.2	-	2	412	c.63G>A	c.(61-63)ACG>ACA	p.T21T	ZFP64_uc002xwk.2_Silent_p.T21T|ZFP64_uc002xwm.2_Silent_p.T19T|ZFP64_uc002xwn.2_Silent_p.T21T	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	21					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CCACCAGCACCGTTGTGCCAC	0.483																0.107143	9.115847	21.97723	9	75	KEEP	---	---	---	---	3	7	38	42	-1	capture	Silent	SNP	50803594	50803594	ZFP64	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17532	192
LAMA5	3911	broad.mit.edu	37	20	60921843	60921843	+	Silent	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60921843G>A	uc002ycq.2	-	8	1153	c.1086C>T	c.(1084-1086)TAC>TAT	p.Y362Y		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	362	Laminin EGF-like 2.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGCATGGCCGTAGCAGTTAC	0.667																0.066667	-1.912186	6.846794	3	42	KEEP	---	---	---	---	3	1	33	21	-1	capture	Silent	SNP	60921843	60921843	LAMA5	20	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8529	192
TMPRSS15	5651	broad.mit.edu	37	21	19770222	19770222	+	Silent	SNP	A	G	G			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19770222A>G	uc002ykw.2	-	3	349	c.318T>C	c.(316-318)TAT>TAC	p.Y106Y		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	106	Extracellular (Potential).|SEA.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTGAGTTCTTATATTCATTCT	0.249																0.545455	66.353536	66.412938	18	15	KEEP	---	---	---	---	12	14	9	8	-1	capture	Silent	SNP	19770222	19770222	TMPRSS15	21	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	16129	192
RIPK4	54101	broad.mit.edu	37	21	43161519	43161519	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43161519C>T	uc002yzn.1	-	8	1882	c.1834G>A	c.(1834-1836)GCA>ACA	p.A612T		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	612						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						CCGCGCTGTGCGGCCAGGTGC	0.687					268											0.416185	203.884475	204.939948	72	101	KEEP	---	---	---	---	41	39	55	53	-1	capture	Missense_Mutation	SNP	43161519	43161519	RIPK4	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13275	192
A4GALT	53947	broad.mit.edu	37	22	43089430	43089430	+	Silent	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43089430G>A	uc003bdb.2	-	3	789	c.528C>T	c.(526-528)GAC>GAT	p.D176D	A4GALT_uc010gzd.2_Silent_p.D176D	NM_017436	NP_059132	Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	176	Lumenal (Potential).				glycosphingolipid biosynthetic process|plasma membrane organization	Golgi stack|integral to Golgi membrane|membrane fraction	lactosylceramide 4-alpha-galactosyltransferase activity			central_nervous_system(2)	2						TCCTGGAGGCGTCGGAGAGCA	0.652																0.484076	233.692699	233.727252	76	81	KEEP	---	---	---	---	46	38	44	49	-1	capture	Silent	SNP	43089430	43089430	A4GALT	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6	192
SHANK3	85358	broad.mit.edu	37	22	51159629	51159629	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51159629C>T	uc003bne.1	+	22	3416	c.3416C>T	c.(3415-3417)GCG>GTG	p.A1139V	SHANK3_uc003bnf.1_Missense_Mutation_p.A586V|SHANK3_uc010hbg.1_Missense_Mutation_p.A321V	NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	1139										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GCCTCCCAGGCGCCCTCCCGG	0.711																0.545455	36.801001	36.840517	12	10	KEEP	---	---	---	---	8	4	2	10	-1	capture	Missense_Mutation	SNP	51159629	51159629	SHANK3	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14159	192
CNTN6	27255	broad.mit.edu	37	3	1418745	1418745	+	Missense_Mutation	SNP	G	A	A	rs140014929		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:1418745G>A	uc003boz.2	+	17	2419	c.2152G>A	c.(2152-2154)GTC>ATC	p.V718I	CNTN6_uc011asj.1_Missense_Mutation_p.V646I|CNTN6_uc003bpa.2_Missense_Mutation_p.V718I	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	718	Fibronectin type-III 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane		p.V718I(1)		skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GTCTGAACTCGTCATTACGTG	0.373				p.V718L(ES2-Tumor)	1038											0.394118	197.487338	199.155986	67	103	KEEP	---	---	---	---	39	44	71	50	-1	capture	Missense_Mutation	SNP	1418745	1418745	CNTN6	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3610	192
RARB	5915	broad.mit.edu	37	3	25215958	25215958	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:25215958C>A	uc011awl.1	+	1	136	c.70C>A	c.(70-72)CCC>ACC	p.P24T		NM_016152	NP_057236	P10826	RARB_HUMAN	retinoic acid receptor, beta isoform 2	24	Modulating.				embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TCCAGCCACACCCTACCCGTT	0.592					250											0.4	77.437164	78.005269	26	39	KEEP	---	---	---	---	28	36	40	52	0.5625	capture	Missense_Mutation	SNP	25215958	25215958	RARB	3	C	A	A	A	1	0	0	0	0	1	0	0	0	222	18	4	4	12948	192
CYP8B1	1582	broad.mit.edu	37	3	42916827	42916827	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42916827G>A	uc003cmh.2	-	1	807	c.482C>T	c.(481-483)GCC>GTC	p.A161V	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.A161V	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B,	161					bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CCAGCAACTGGCATCCAGACT	0.522																0.333333	127.182357	130.648891	47	94	KEEP	---	---	---	---	23	31	56	54	-1	capture	Missense_Mutation	SNP	42916827	42916827	CYP8B1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4158	192
WHSC1	7468	broad.mit.edu	37	4	1955109	1955109	+	Silent	SNP	A	G	G			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1955109A>G	uc003gdz.3	+	12	2372	c.2196A>G	c.(2194-2196)GTA>GTG	p.V732V	WHSC1_uc003geb.3_Silent_p.V732V|WHSC1_uc003gec.3_Silent_p.V732V|WHSC1_uc003ged.3_Silent_p.V732V|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_5'UTR|WHSC1_uc011bvh.1_5'UTR|WHSC1_uc010icf.2_Silent_p.V80V	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	732	PHD-type 2.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GCTGTGTGGTAACTCAGTGTG	0.458					355	T	IGH@	MM								0.420904	532.74464	534.670485	149	205	KEEP	---	---	---	---	86	78	122	104	-1	capture	Silent	SNP	1955109	1955109	WHSC1	4	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	17243	192
PKHD1	5314	broad.mit.edu	37	6	51523917	51523917	+	Silent	SNP	C	T	T	rs142855690	by1000genomes	TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51523917C>T	uc003pah.1	-	61	11283	c.11007G>A	c.(11005-11007)TCG>TCA	p.S3669S		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3669	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTACTGTTGGCGAATCACCAA	0.423				p.S3669S(NCIH1793-Tumor)|p.S3669S(TE9-Tumor)	1537											0.117647	29.597849	61.375567	26	195	KEEP	---	---	---	---	14	13	111	102	-1	capture	Silent	SNP	51523917	51523917	PKHD1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11874	192
TRAF3IP2	10758	broad.mit.edu	37	6	111912560	111912560	+	Missense_Mutation	SNP	A	G	G			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111912560A>G	uc011ebc.1	-	3	1345	c.730T>C	c.(730-732)TAT>CAT	p.Y244H	TRAF3IP2_uc003pvg.2_Missense_Mutation_p.Y244H|TRAF3IP2_uc003pvf.2_Missense_Mutation_p.Y244H|TRAF3IP2_uc010kdw.2_Missense_Mutation_p.Y244H|TRAF3IP2_uc010kdx.2_Missense_Mutation_p.Y244H	NM_147686	NP_679211	O43734	CIKS_HUMAN	TRAF3 interacting protein 2 isoform 2	253					intracellular signal transduction|positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular				ovary(2)|central_nervous_system(1)	3		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		CATGCTGGATACCTCTGAGGT	0.572																0.324786	125.720661	128.902315	38	79	KEEP	---	---	---	---	22	20	39	43	-1	capture	Missense_Mutation	SNP	111912560	111912560	TRAF3IP2	6	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	16324	192
PON1	5444	broad.mit.edu	37	7	94953757	94953757	+	Missense_Mutation	SNP	C	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94953757C>A	uc003uns.2	-	1	128	c.31G>T	c.(31-33)GGG>TGG	p.G11W	PON1_uc011kih.1_Intron	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor	11					aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	AGTCCCATCCCCAAGAGGGTG	0.607	GBM(119;715 1622 17358 22490 33240)															0.136986	14.909323	24.212598	10	63	KEEP	---	---	---	---	8	6	39	36	0.428571428571	capture	Missense_Mutation	SNP	94953757	94953757	PON1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	12150	192
PIK3CG	5294	broad.mit.edu	37	7	106513286	106513286	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106513286C>T	uc003vdv.3	+	4	2275	c.2190C>T	c.(2188-2190)CAC>CAT	p.H730H	PIK3CG_uc003vdu.2_Silent_p.H730H|PIK3CG_uc003vdw.2_Silent_p.H730H	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	730					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CCATGCTGCACGACTTTACCC	0.473					292											0.364055	228.994636	232.510714	79	138	KEEP	---	---	---	---	37	50	75	73	-1	capture	Silent	SNP	106513286	106513286	PIK3CG	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11819	192
AKR1B15	441282	broad.mit.edu	37	7	134260192	134260192	+	Silent	SNP	C	T	T	rs4035285		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134260192C>T	uc011kpr.1	+	7	833	c.534C>T	c.(532-534)GAC>GAT	p.D178D	AKR1B15_uc011kps.1_Silent_p.D150D	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	178							oxidoreductase activity			ovary(1)	1						AGCTGGTGGACGAGGGGCTGG	0.517																0.289308	115.770265	122.108346	46	113	KEEP	---	---	---	---	27	32	72	55	-1	capture	Silent	SNP	134260192	134260192	AKR1B15	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	468	192
MLL3	58508	broad.mit.edu	37	7	151877846	151877846	+	Missense_Mutation	SNP	T	C	C			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151877846T>C	uc003wla.2	-	36	7318	c.7099A>G	c.(7099-7101)ACA>GCA	p.T2367A	MLL3_uc003wkz.2_Missense_Mutation_p.T1428A|MLL3_uc003wky.2_5'Flank	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2367					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GTATTCTGTGTATCAGTTACT	0.428	Colon(68;14 1149 1884 27689 34759)				1780	N		medulloblastoma								0.204545	103.51043	117.756008	36	140	KEEP	---	---	---	---	22	19	84	69	-1	capture	Missense_Mutation	SNP	151877846	151877846	MLL3	7	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	9534	192
FLJ43860	389690	broad.mit.edu	37	8	142476586	142476586	+	Silent	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142476586G>A	uc003ywi.2	-	19	2481	c.2400C>T	c.(2398-2400)CAC>CAT	p.H800H	FLJ43860_uc011ljs.1_RNA|FLJ43860_uc010meu.1_RNA	NM_207414	NP_997297	Q6ZUA9	Q6ZUA9_HUMAN	hypothetical protein LOC389690	800							binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GGGTGATGGCGTGCAGGGTCT	0.632																0.333333	28.412598	29.225121	11	22	KEEP	---	---	---	---	10	7	16	12	-1	capture	Silent	SNP	142476586	142476586	FLJ43860	8	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5874	192
HSF1	3297	broad.mit.edu	37	8	145537533	145537533	+	Missense_Mutation	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145537533C>T	uc003zbt.3	+	11	1443	c.1273C>T	c.(1273-1275)CCC>TCC	p.P425S	HSF1_uc003zbu.3_RNA	NM_005526	NP_005517	Q00613	HSF1_HUMAN	heat shock transcription factor 1	425	Transactivation domain.					cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			GGTGACCGTGCCCGACATGAG	0.532					10											0.047059	-10.943723	7.611911	4	81	KEEP	---	---	---	---	1	3	41	46	-1	capture	Missense_Mutation	SNP	145537533	145537533	HSF1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7320	192
EXD3	54932	broad.mit.edu	37	9	140201615	140201615	+	Silent	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140201615G>A	uc004cmp.2	-	22	2614	c.2418C>T	c.(2416-2418)GCC>GCT	p.A806A	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Silent_p.A444A	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	806					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						GGGTGCCGTCGGCCAGCATGT	0.697																0.5	15.875418	15.875418	5	5	KEEP	---	---	---	---	2	4	7	0	-1	capture	Silent	SNP	140201615	140201615	EXD3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5254	192
MAGEB4	4115	broad.mit.edu	37	X	30260469	30260469	+	Missense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30260469G>A	uc004dcb.2	+	1	301	c.217G>A	c.(217-219)GCA>ACA	p.A73T	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	73										ovary(1)	1						CTCTGCTGCTGCAGCTATGTC	0.527																0.425	48.366543	48.563174	17	23	KEEP	---	---	---	---	14	12	15	13	-1	capture	Missense_Mutation	SNP	30260469	30260469	MAGEB4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	9092	192
CCDC120	90060	broad.mit.edu	37	X	48923077	48923077	+	Missense_Mutation	SNP	C	T	T	rs148446381		TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48923077C>T	uc010nik.2	+	8	1282	c.775C>T	c.(775-777)CGG>TGG	p.R259W	CCDC120_uc011mmq.1_Missense_Mutation_p.R247W|CCDC120_uc004dmf.2_Missense_Mutation_p.R259W|CCDC120_uc010nil.2_Missense_Mutation_p.R259W|CCDC120_uc011mmr.1_Missense_Mutation_p.R259W|CCDC120_uc011mms.1_Missense_Mutation_p.R247W	NM_033626	NP_296375	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120 isoform 3	259							protein binding			pancreas(1)	1						GAGCCCTGAGCGGCGAACCCC	0.642																0.415094	62.372846	62.69704	22	31	KEEP	---	---	---	---	9	14	12	19	-1	capture	Missense_Mutation	SNP	48923077	48923077	CCDC120	23	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	2730	192
BRWD3	254065	broad.mit.edu	37	X	79938109	79938109	+	Nonsense_Mutation	SNP	G	A	A			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79938109G>A	uc004edt.2	-	38	4515	c.4252C>T	c.(4252-4254)CGA>TGA	p.R1418*	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Nonsense_Mutation_p.R1014*|BRWD3_uc004edp.2_Nonsense_Mutation_p.R1247*|BRWD3_uc004edq.2_Nonsense_Mutation_p.R1014*|BRWD3_uc010nmj.1_Nonsense_Mutation_p.R1014*|BRWD3_uc004edr.2_Nonsense_Mutation_p.R1088*|BRWD3_uc004eds.2_Nonsense_Mutation_p.R1014*|BRWD3_uc004edu.2_Nonsense_Mutation_p.R1088*|BRWD3_uc004edv.2_Nonsense_Mutation_p.R1014*|BRWD3_uc004edw.2_Nonsense_Mutation_p.R1014*|BRWD3_uc004edx.2_Nonsense_Mutation_p.R1014*|BRWD3_uc004edy.2_Nonsense_Mutation_p.R1014*|BRWD3_uc004edz.2_Nonsense_Mutation_p.R1088*|BRWD3_uc004eea.2_Nonsense_Mutation_p.R1088*|BRWD3_uc004eeb.2_Nonsense_Mutation_p.R1014*	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1418										ovary(4)	4						GCAGATAATCGCAGCATCATG	0.338																0.539604	334.176262	334.450757	109	93	KEEP	---	---	---	---	49	69	35	61	-1	capture	Nonsense_Mutation	SNP	79938109	79938109	BRWD3	23	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	1514	192
NXF3	56000	broad.mit.edu	37	X	102334798	102334798	+	Silent	SNP	C	T	T			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102334798C>T	uc004eju.2	-	13	1124	c.1053G>A	c.(1051-1053)CAG>CAA	p.Q351Q	NXF3_uc010noi.1_Silent_p.Q201Q	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	351	NTF2.					cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3						TCAAGTAATACCTGTTGGAGA	0.493																0.46124	359.391449	359.729727	119	139	KEEP	---	---	---	---	60	66	68	81	-1	capture	Silent	SNP	102334798	102334798	NXF3	23	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	10690	192
MAP4K2	5871	broad.mit.edu	37	11	64559447	64559448	+	Frame_Shift_Ins	INS	-	G	G			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64559447_64559448insG	uc001obh.2	-	27	2117_2118	c.2025_2026insC	c.(2023-2028)GGCTGCfs	p.G675fs	MAP4K2_uc001obg.2_RNA|MAP4K2_uc001obi.2_Frame_Shift_Ins_p.G667fs	NM_004579	NP_004570	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase	675_676	CNH.				activation of JUN kinase activity|immune response|positive regulation of JNK cascade|vesicle targeting	basolateral plasma membrane|Golgi membrane|soluble fraction	ATP binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(1)|pancreas(1)	2						AGGACGCGGCAGCCGGGCCCCT	0.708					392											0.33			7	14		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	64559447	64559448	MAP4K2	11	-	G	G	G	1	0	1	1	0	0	0	0	0	91	7	5	5	9174	192
B3GNT8	374907	broad.mit.edu	37	19	41932065	41932066	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41932065_41932066delTG	uc002oqs.2	-	3	1072_1073	c.618_619delCA	c.(616-621)TACAGTfs	p.Y206fs	CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	NM_198540	NP_940942	Q7Z7M8	B3GN8_HUMAN	UDP-GlcNAc:betaGal	206_207	Lumenal (Potential).				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity				0						AGCAGGTCACTGTAGCGACGGC	0.653																0.25			38	112		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	41932065	41932066	B3GNT8	19	TG	-	-	-	1	0	1	0	1	0	0	0	0	715	55	5	5	1252	192
PAM	5066	broad.mit.edu	37	5	102360910	102360911	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:102360910_102360911delAG	uc003knw.2	+	23	2934_2935	c.2561_2562delAG	c.(2560-2562)CAGfs	p.Q854fs	PAM_uc003kns.2_Frame_Shift_Del_p.Q747fs|PAM_uc003knt.2_Frame_Shift_Del_p.Q854fs|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Frame_Shift_Del_p.Q756fs|PAM_uc003knz.2_Frame_Shift_Del_p.Q94fs	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	854	Intragranular (Potential).				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	CAAGAGAAACAGAAACTGATCA	0.460																0.39			73	116		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	102360910	102360911	PAM	5	AG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	11316	192
TRRAP	8295	broad.mit.edu	37	7	98580929	98580935	+	Frame_Shift_Del	DEL	AACGCAG	-	-			TCGA-27-1833-01	TCGA-27-1833-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98580929_98580935delAACGCAG	uc003upp.2	+	59	9057_9063	c.8848_8854delAACGCAG	c.(8848-8856)AACGCAGGCfs	p.N2950fs	TRRAP_uc011kis.1_Frame_Shift_Del_p.N2932fs|TRRAP_uc003upr.2_Frame_Shift_Del_p.N2649fs	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	2950_2952	FAT.				histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TGCACAAATCAACGCAGGCTTACAGCC	0.522					1847											0.22			27	95		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	98580929	98580935	TRRAP	7	AACGCAG	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	16484	192
