Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CLCA1	1179	broad.mit.edu	37	1	86954794	86954794	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86954794A>G	uc001dlt.2	+	8	1427	c.1298A>G	c.(1297-1299)CAC>CGC	p.H433R	CLCA1_uc001dls.1_Missense_Mutation_p.H372R	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	433	VWFA.				calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GCCATCATCCACACAGTCGCT	0.473																0.333333	94.35055	96.488529	29	58	KEEP	---	---	---	---	15	16	31	32	-1	capture	Missense_Mutation	SNP	86954794	86954794	CLCA1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	3422	206
DCLRE1B	64858	broad.mit.edu	37	1	114454356	114454356	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114454356G>A	uc001eeg.2	+	4	1313	c.1142G>A	c.(1141-1143)TGG>TAG	p.W381*	DCLRE1B_uc001eeh.2_Nonsense_Mutation_p.W255*|DCLRE1B_uc001eei.2_Nonsense_Mutation_p.W255*	NM_022836	NP_073747	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B (PSO2 homolog, S.	381					cell cycle checkpoint|DNA repair|protection from non-homologous end joining at telomere|telomeric 3' overhang formation|telomeric loop formation	centrosome|chromosome, telomeric region|nucleus	5'-3' exonuclease activity|protein binding				0	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTTTCTCCCTGGCCTGCGGAC	0.483											Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					0.402913	243.906209	245.596536	83	123	KEEP	---	---	---	---	40	46	51	76	-1	capture	Nonsense_Mutation	SNP	114454356	114454356	DCLRE1B	1	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	4254	206
HMCN1	83872	broad.mit.edu	37	1	186120829	186120829	+	Silent	SNP	C	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186120829C>A	uc001grq.1	+	95	15079	c.14850C>A	c.(14848-14850)CTC>CTA	p.L4950L	HMCN1_uc001grs.1_Silent_p.L519L	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4950	Nidogen G2 beta-barrel.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GCTTTACCCTCACCAATGCAG	0.348																0.021459	-51.649137	8.021751	5	228	KEEP	---	---	---	---	3	3	129	133	0.5	capture	Silent	SNP	186120829	186120829	HMCN1	1	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	7145	206
PLA2G4A	5321	broad.mit.edu	37	1	186948519	186948519	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186948519T>G	uc001gsc.2	+	17	2238	c.2033T>G	c.(2032-2034)TTT>TGT	p.F678C	PLA2G4A_uc010pos.1_Missense_Mutation_p.F618C	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA	678	PLA2c.				phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	GAATCACCATTTTCAACCTTC	0.358																0.368132	240.099935	242.873092	67	115	KEEP	---	---	---	---	35	36	48	72	-1	capture	Missense_Mutation	SNP	186948519	186948519	PLA2G4A	1	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	11904	206
NCAM1	4684	broad.mit.edu	37	11	113076266	113076266	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:113076266C>T	uc009yyq.1	+	4	708	c.14C>T	c.(13-15)GCG>GTG	p.A5V	NCAM1_uc001pno.2_Missense_Mutation_p.A5V	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3	123	Ig-like C2-type 2.|Extracellular (Potential).				axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TTCAAGAATGCGCCAACCCCA	0.522				p.A5V(SW1271-Tumor)	700											0.030769	-24.779079	6.566579	4	126	KEEP	---	---	---	---	1	3	81	59	-1	capture	Missense_Mutation	SNP	113076266	113076266	NCAM1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10109	206
FAM55A	120400	broad.mit.edu	37	11	114400948	114400948	+	Missense_Mutation	SNP	C	T	T	rs150857743	byFrequency	TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:114400948C>T	uc001ppa.2	-	3	773	c.356G>A	c.(355-357)CGG>CAG	p.R119Q	FAM55A_uc010rxd.1_5'UTR|FAM55A_uc001ppb.1_Missense_Mutation_p.R261Q	NM_152315	NP_689528	Q8N323	FA55A_HUMAN	hypothetical protein LOC120400	261						extracellular region					0		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)		CTCTCTATTCCGGGTGGTCAT	0.458																0.071429	-3.619641	28.161972	12	156	KEEP	---	---	---	---	10	3	84	83	-1	capture	Missense_Mutation	SNP	114400948	114400948	FAM55A	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5532	206
CD163L1	283316	broad.mit.edu	37	12	7531814	7531814	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7531814C>T	uc001qsy.2	-	9	2157	c.2131G>A	c.(2131-2133)GTG>ATG	p.V711M	CD163L1_uc010sge.1_Missense_Mutation_p.V721M	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	711	SRCR 7.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						AGAATTCCCACGGCACCCTGG	0.502																0.318681	78.446073	81.103348	29	62	KEEP	---	---	---	---	17	19	41	50	-1	capture	Missense_Mutation	SNP	7531814	7531814	CD163L1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2939	206
PPM1H	57460	broad.mit.edu	37	12	63195712	63195712	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:63195712C>T	uc001srk.3	-	3	789	c.640G>A	c.(640-642)GGA>AGA	p.G214R		NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)	214	PP2C-like.						phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CCCACCCCTCCGCGCAGGGAG	0.682																0.476923	99.026558	99.056111	31	34	KEEP	---	---	---	---	23	18	34	21	-1	capture	Missense_Mutation	SNP	63195712	63195712	PPM1H	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12242	206
ATP11A	23250	broad.mit.edu	37	13	113527920	113527920	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113527920A>T	uc001vsi.3	+	27	3179	c.3091A>T	c.(3091-3093)AAC>TAC	p.N1031Y	ATP11A_uc001vsj.3_Missense_Mutation_p.N1031Y|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	1031	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GACTTGGATCAACCATTTTGT	0.448					1064									OREG0003854	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	0.060345	-7.670325	15.765277	7	109	KEEP	---	---	---	---	8	1	63	68	-1	capture	Missense_Mutation	SNP	113527920	113527920	ATP11A	13	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	1110	206
AK7	122481	broad.mit.edu	37	14	96953242	96953242	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96953242G>A	uc001yfn.2	+	17	2026	c.1982G>A	c.(1981-1983)CGA>CAA	p.R661Q		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	661	Potential.|Glu-rich.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TAGAATAAACGACTGGAGGAA	0.393																0.386364	99.535948	100.529509	34	54	KEEP	---	---	---	---	17	19	29	30	-1	capture	Missense_Mutation	SNP	96953242	96953242	AK7	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	444	206
RYR3	6263	broad.mit.edu	37	15	33944995	33944995	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33944995G>A	uc001zhi.2	+	32	4289	c.4219G>A	c.(4219-4221)GTG>ATG	p.V1407M	RYR3_uc010bar.2_Missense_Mutation_p.V1407M	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1407	4 X approximate repeats.|B30.2/SPRY 3.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCGGAGCAACGTGGACCTGGA	0.557																0.319149	80.316995	83.049318	30	64	KEEP	---	---	---	---	24	19	38	41	-1	capture	Missense_Mutation	SNP	33944995	33944995	RYR3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13662	206
ZSCAN29	146050	broad.mit.edu	37	15	43658464	43658464	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43658464C>T	uc001zrk.1	-	3	1213	c.1066G>A	c.(1066-1068)GAT>AAT	p.D356N	ZSCAN29_uc001zrj.1_Missense_Mutation_p.D236N|ZSCAN29_uc010bdf.1_Missense_Mutation_p.D355N|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Intron|ZSCAN29_uc001zrm.2_Missense_Mutation_p.D355N	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	356					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		GTCTCAGCATCGCTGCCTACC	0.572																0.424528	130.749736	131.277707	45	61	KEEP	---	---	---	---	30	32	40	46	-1	capture	Missense_Mutation	SNP	43658464	43658464	ZSCAN29	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	18112	206
SLC28A2	9153	broad.mit.edu	37	15	45555359	45555359	+	Silent	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45555359G>A	uc001zva.2	+	5	428	c.363G>A	c.(361-363)TCG>TCA	p.S121S		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	121	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		TGGTTCACTCGTTTTTGAAAA	0.458	NSCLC(92;493 1501 26361 28917 47116)															0.361702	144.276996	146.654145	51	90	KEEP	---	---	---	---	33	22	52	44	-1	capture	Silent	SNP	45555359	45555359	SLC28A2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	14424	206
GRIN2A	2903	broad.mit.edu	37	16	10273879	10273879	+	Silent	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10273879G>A	uc002czo.3	-	2	938	c.390C>T	c.(388-390)GGC>GGT	p.G130G	GRIN2A_uc010uym.1_Silent_p.G130G|GRIN2A_uc002czr.3_Silent_p.G130G|GRIN2A_uc010buk.2_Silent_p.G130G	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	130	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCATAGATGCGCCCCCATGAA	0.597					324											0.336634	94.951707	97.320313	34	67	KEEP	---	---	---	---	17	20	36	38	-1	capture	Silent	SNP	10273879	10273879	GRIN2A	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6712	206
HS3ST3A1	9955	broad.mit.edu	37	17	13400088	13400088	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:13400088G>A	uc002gob.1	-	2	1445	c.647C>T	c.(646-648)ACG>ATG	p.T216M		NM_006042	NP_006033	Q9Y663	HS3SA_HUMAN	heparan sulfate D-glucosaminyl	216	Substrate binding.|Lumenal (Potential).					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GTAACTGGGCGTCTTCTCCAT	0.622																0.401786	125.629015	126.579663	45	67	KEEP	---	---	---	---	29	22	47	38	-1	capture	Missense_Mutation	SNP	13400088	13400088	HS3ST3A1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7290	206
ABCA9	10350	broad.mit.edu	37	17	67016638	67016638	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67016638C>T	uc002jhu.2	-	19	2634	c.2491G>A	c.(2491-2493)GAA>AAA	p.E831K	ABCA9_uc010dez.2_Missense_Mutation_p.E831K	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	831					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					TTCCTTGTTTCGTGGAAGGAA	0.413																0.374408	230.498293	233.409587	79	132	KEEP	---	---	---	---	51	37	58	79	-1	capture	Missense_Mutation	SNP	67016638	67016638	ABCA9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	39	206
LIPG	9388	broad.mit.edu	37	18	47101837	47101837	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:47101837C>T	uc002ldv.2	+	5	922	c.670C>T	c.(670-672)CGT>TGT	p.R224C	LIPG_uc002ldu.1_Missense_Mutation_p.R224C|LIPG_uc010xdh.1_Intron	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor	224					cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						CACCTACACGCGTTCCTTCGG	0.557	Pancreas(126;280 1778 12814 26243 34948)															0.378049	87.815707	88.881555	31	51	KEEP	---	---	---	---	22	19	37	27	-1	capture	Missense_Mutation	SNP	47101837	47101837	LIPG	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8743	206
TUBB4	10382	broad.mit.edu	37	19	6495585	6495585	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6495585G>A	uc002mfg.1	-	4	1032	c.925C>T	c.(925-927)CGC>TGC	p.R309C	TUBB4_uc002mff.1_Missense_Mutation_p.R237C|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	309					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		GTCAGGTAGCGGCCGTGGCGC	0.662																0.285714	73.261355	77.299103	28	70	KEEP	---	---	---	---	34	14	64	34	-1	capture	Missense_Mutation	SNP	6495585	6495585	TUBB4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16640	206
MUC16	94025	broad.mit.edu	37	19	9073488	9073488	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9073488G>T	uc002mkp.2	-	3	14162	c.13958C>A	c.(13957-13959)ACA>AAA	p.T4653K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4655	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGGGAACTTTGTTGACTGAGC	0.458																0.379747	188.363988	190.367842	60	98	KEEP	---	---	---	---	32	31	53	50	0.507936507937	capture	Missense_Mutation	SNP	9073488	9073488	MUC16	19	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	9883	206
GRAMD1A	57655	broad.mit.edu	37	19	35500871	35500871	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35500871T>C	uc010xse.1	+	4	457	c.320T>C	c.(319-321)ATT>ACT	p.I107T	GRAMD1A_uc002nxi.1_Missense_Mutation_p.I194T|GRAMD1A_uc002nxk.2_Missense_Mutation_p.I100T|GRAMD1A_uc002nxl.2_5'UTR|GRAMD1A_uc010xsf.1_Missense_Mutation_p.I112T	NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1	107	GRAM.					integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GAACGCCTCATTGTGGGTGAG	0.607																0.402299	246.421727	247.87231	70	104	KEEP	---	---	---	---	34	40	61	57	-1	capture	Missense_Mutation	SNP	35500871	35500871	GRAMD1A	19	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	6680	206
ZNF610	162963	broad.mit.edu	37	19	52868955	52868955	+	Silent	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52868955G>A	uc002pyx.3	+	6	730	c.324G>A	c.(322-324)AGG>AGA	p.R108R	ZNF610_uc002pyy.3_Silent_p.R108R|ZNF610_uc002pyz.3_Silent_p.R65R|ZNF610_uc002pza.2_Silent_p.R108R	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	108					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		TTCTAGGGAGGAGCTGTGTAT	0.453																0.305221	205.411758	213.839184	76	173	KEEP	---	---	---	---	48	36	99	100	-1	capture	Silent	SNP	52868955	52868955	ZNF610	19	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	17914	206
PTPRH	5794	broad.mit.edu	37	19	55693262	55693262	+	Missense_Mutation	SNP	C	T	T	rs140496718		TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55693262C>T	uc002qjq.2	-	20	3281	c.3208G>A	c.(3208-3210)GTA>ATA	p.V1070I	PTPRH_uc010esv.2_Missense_Mutation_p.V892I|SYT5_uc002qjm.1_5'Flank|SYT5_uc002qjp.2_5'Flank|SYT5_uc002qjn.1_5'Flank|SYT5_uc002qjo.1_5'Flank	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1070	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TGCAGGAATACGTACTGAGCC	0.622																0.326633	177.224727	182.520959	65	134	KEEP	---	---	---	---	40	28	59	87	-1	capture	Missense_Mutation	SNP	55693262	55693262	PTPRH	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12698	206
NT5C1B	93034	broad.mit.edu	37	2	18766137	18766137	+	Silent	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:18766137C>T	uc002rcz.2	-	5	650	c.546G>A	c.(544-546)TCG>TCA	p.S182S	NT5C1B_uc002rcy.2_Silent_p.S182S|NT5C1B_uc010exr.2_Silent_p.S124S|NT5C1B_uc010yju.1_Silent_p.S122S|NT5C1B_uc002rda.2_Silent_p.S122S|NT5C1B_uc010yjv.1_Silent_p.S199S|NT5C1B_uc010yjw.1_Silent_p.S165S|NT5C1B_uc010exs.2_Silent_p.S184S|NT5C1B_uc002rdb.1_5'UTR	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	182	Pro-rich.				purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				GCAGCTGGGGCGACGCGGGTG	0.716																0.454545	29.852801	29.891491	10	12	KEEP	---	---	---	---	9	5	10	7	-1	capture	Silent	SNP	18766137	18766137	NT5C1B	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10593	206
CALCRL	10203	broad.mit.edu	37	2	188223966	188223966	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:188223966A>T	uc002upv.3	-	11	1363	c.815T>A	c.(814-816)ATT>AAT	p.I272N	CALCRL_uc010frt.2_Missense_Mutation_p.I272N	NM_005795	NP_005786	Q16602	CALRL_HUMAN	calcitonin receptor-like precursor	272	Helical; Name=4; (Potential).					integral to plasma membrane				lung(3)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			GCTTCTAGCAATGGCATGTAT	0.244																0.3125	27.938216	28.939798	10	22	KEEP	---	---	---	---	4	6	8	14	-1	capture	Missense_Mutation	SNP	188223966	188223966	CALCRL	2	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	2556	206
BMPR2	659	broad.mit.edu	37	2	203397336	203397336	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:203397336A>G	uc002uzf.3	+	9	2305	c.1157A>G	c.(1156-1158)GAA>GGA	p.E386G	BMPR2_uc010ftr.2_Missense_Mutation_p.E386G	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II	386	Protein kinase.|Cytoplasmic (Potential).				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						ATGGCACCAGAAGTGCTAGAA	0.318					409											0.374101	184.269573	186.202855	52	87	KEEP	---	---	---	---	26	32	54	45	-1	capture	Missense_Mutation	SNP	203397336	203397336	BMPR2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	1459	206
SCG2	7857	broad.mit.edu	37	2	224463759	224463759	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:224463759T>C	uc002vnm.2	-	2	375	c.242A>G	c.(241-243)TAC>TGC	p.Y81C		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	81					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GACACCTTGGTAGGGATTATA	0.448																0.384615	315.976919	318.712816	90	144	KEEP	---	---	---	---	57	37	87	71	-1	capture	Missense_Mutation	SNP	224463759	224463759	SCG2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	13783	206
ANGPT4	51378	broad.mit.edu	37	20	853677	853677	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:853677G>A	uc002wei.2	-	9	1541	c.1438C>T	c.(1438-1440)CGC>TGC	p.R480C	ANGPT4_uc010zpn.1_3'UTR	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	480	Fibrinogen C-terminal.				anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						TAGTGCCAGCGGATGCCGTCC	0.587	Pancreas(181;481 2077 3259 31286 49856)															0.345794	113.650347	115.89338	37	70	KEEP	---	---	---	---	26	21	38	42	-1	capture	Missense_Mutation	SNP	853677	853677	ANGPT4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	609	206
MOCS3	27304	broad.mit.edu	37	20	49576424	49576424	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49576424G>C	uc002xvy.1	+	1	1062	c.1045G>C	c.(1045-1047)GCA>CCA	p.A349P	DPM1_uc002xvw.1_5'Flank|DPM1_uc002xvx.1_5'Flank	NM_014484	NP_055299	O95396	MOCS3_HUMAN	molybdenum cofactor synthesis 3	349	Rhodanese.				enzyme active site formation via L-cysteine persulfide|Mo-molybdopterin cofactor biosynthetic process|tRNA thio-modification|tRNA wobble uridine modification|water-soluble vitamin metabolic process	cytosol	ATP binding|metal ion binding|nucleotidyltransferase activity|protein binding|thiosulfate sulfurtransferase activity|URM1 activating enzyme activity			skin(2)|ovary(1)	3						GGATTCTGGGGCATTCCACCT	0.552																0.331742	453.477921	463.941269	139	280	KEEP	---	---	---	---	78	80	151	159	-1	capture	Missense_Mutation	SNP	49576424	49576424	MOCS3	20	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	9604	206
TRPM2	7226	broad.mit.edu	37	21	45798938	45798938	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45798938G>A	uc002zet.1	+	9	1286	c.1073G>A	c.(1072-1074)CGC>CAC	p.R358H	TRPM2_uc002zeu.1_Missense_Mutation_p.R358H|TRPM2_uc002zew.1_Missense_Mutation_p.R358H|TRPM2_uc010gpt.1_Missense_Mutation_p.R358H|TRPM2_uc002zex.1_Missense_Mutation_p.R144H	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	358	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GGCTCGGGCCGCGTGGCCGAC	0.622																0.348837	77.624925	79.358405	30	56	KEEP	---	---	---	---	18	19	32	38	-1	capture	Missense_Mutation	SNP	45798938	45798938	TRPM2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16469	206
OR5K4	403278	broad.mit.edu	37	3	98072818	98072818	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98072818G>A	uc011bgv.1	+	1	121	c.121G>A	c.(121-123)GGG>AGG	p.G41R		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	41	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						CACCATGGTGGGGAATCTTGG	0.458																0.360771	611.78011	621.485845	206	365	KEEP	---	---	---	---	103	111	199	199	-1	capture	Missense_Mutation	SNP	98072818	98072818	OR5K4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11073	206
ADAM29	11086	broad.mit.edu	37	4	175897608	175897608	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175897608G>A	uc003iuc.2	+	5	1602	c.932G>A	c.(931-933)CGT>CAT	p.R311H	ADAM29_uc003iud.2_Missense_Mutation_p.R311H|ADAM29_uc010irr.2_Missense_Mutation_p.R311H|ADAM29_uc011cki.1_Missense_Mutation_p.R311H	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	311	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		ACACCACACCGTAGTTGTGCA	0.428	Ovarian(140;1727 1835 21805 25838 41440)				106											0.400593	397.555681	400.467834	135	202	KEEP	---	---	---	---	74	68	116	97	-1	capture	Missense_Mutation	SNP	175897608	175897608	ADAM29	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	247	206
SLC6A3	6531	broad.mit.edu	37	5	1409844	1409844	+	Missense_Mutation	SNP	C	T	T	rs140401978		TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1409844C>T	uc003jck.2	-	10	1511	c.1390G>A	c.(1390-1392)GTC>ATC	p.V464I		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	464	Helical; Name=9; (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	ACGTTGGTGACGCAGAACAGG	0.612																0.321739	100.143943	103.384563	37	78	KEEP	---	---	---	---	20	24	47	44	-1	capture	Missense_Mutation	SNP	1409844	1409844	SLC6A3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14577	206
ZFYVE16	9765	broad.mit.edu	37	5	79768699	79768699	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79768699G>A	uc003kgr.3	+	16	4446	c.4144G>A	c.(4144-4146)GTG>ATG	p.V1382M	ZFYVE16_uc003kgq.3_Missense_Mutation_p.V1382M|ZFYVE16_uc003kgs.3_Missense_Mutation_p.V1382M|ZFYVE16_uc003kgt.3_Missense_Mutation_p.V470M|ZFYVE16_uc003kgu.3_Missense_Mutation_p.V134M	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1382					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		GAGAGAATACGTGGATATCTG	0.368	Melanoma(150;1452 1854 16018 17851 37292)															0.335937	121.981668	125.031679	43	85	KEEP	---	---	---	---	29	23	40	54	-1	capture	Missense_Mutation	SNP	79768699	79768699	ZFYVE16	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17544	206
ACOT12	134526	broad.mit.edu	37	5	80643625	80643625	+	Silent	SNP	C	T	T	rs150238683	byFrequency	TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:80643625C>T	uc003khl.3	-	6	676	c.621G>A	c.(619-621)GCG>GCA	p.A207A	RNU5E_uc011cto.1_Intron	NM_130767	NP_570123	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	207	Acyl coenzyme A hydrolase 2.				acyl-CoA metabolic process|fatty acid metabolic process	cytosol	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(1)|kidney(1)	2		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TCTCCATCCACGCCATAATCT	0.502																0.373626	485.040347	491.41891	170	285	KEEP	---	---	---	---	111	111	174	201	-1	capture	Silent	SNP	80643625	80643625	ACOT12	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	150	206
PCSK1	5122	broad.mit.edu	37	5	95735874	95735874	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:95735874G>A	uc003kls.1	-	10	1419	c.1213C>T	c.(1213-1215)CGA>TGA	p.R405*	PCSK1_uc010jbi.1_Nonsense_Mutation_p.R95*	NM_000439	NP_000430	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	405	Catalytic.				cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TGCATATCTCGCCAGGTGAGA	0.478																0.306569	103.691501	108.267252	42	95	KEEP	---	---	---	---	18	25	49	52	-1	capture	Nonsense_Mutation	SNP	95735874	95735874	PCSK1	5	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	11503	206
PCDHA9	9752	broad.mit.edu	37	5	140230084	140230084	+	Silent	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140230084G>A	uc003lhu.2	+	1	2728	c.2004G>A	c.(2002-2004)TCG>TCA	p.S668S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.S668S	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	668	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding	p.S668L(1)		large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGTGTCGCTGGTGGAGA	0.677	Melanoma(55;1800 1972 14909)															0.333333	48.895596	50.303074	19	38	KEEP	---	---	---	---	22	14	26	42	-1	capture	Silent	SNP	140230084	140230084	PCDHA9	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11434	206
PCDHGA12	26025	broad.mit.edu	37	5	140811313	140811313	+	Silent	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140811313G>A	uc003lkt.1	+	1	1156	c.987G>A	c.(985-987)GCG>GCA	p.A329A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Silent_p.A329A	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	329	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATATTCTGCGCGAGCCAAAG	0.512																0.06875	-14.836387	15.960709	11	149	KEEP	---	---	---	---	7	5	93	72	-1	capture	Silent	SNP	140811313	140811313	PCDHGA12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11456	206
FAM50B	26240	broad.mit.edu	37	6	3850733	3850733	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:3850733G>A	uc003mvu.2	+	2	800	c.688G>A	c.(688-690)GCC>ACC	p.A230T		NM_012135	NP_036267	Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	230						nucleus				pancreas(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				GCTGCGCTCCGCCGGCGTGGA	0.652																0.288136	41.452749	43.827255	17	42	KEEP	---	---	---	---	7	13	31	16	-1	capture	Missense_Mutation	SNP	3850733	3850733	FAM50B	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5526	206
GPX5	2880	broad.mit.edu	37	6	28497327	28497327	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28497327C>T	uc003nll.2	+	2	189	c.187C>T	c.(187-189)CAC>TAC	p.H63Y	GPX5_uc003nlm.2_Missense_Mutation_p.H63Y|GPX5_uc003nln.2_RNA	NM_001509	NP_001500	O75715	GPX5_HUMAN	glutathione peroxidase 5 isoform 1 precursor	63					lipid metabolic process|response to oxidative stress	extracellular region	glutathione peroxidase activity			skin(1)	1					Glutathione(DB00143)	TGTGGGCAAGCACATCCTCTT	0.443																0.396739	202.619932	204.341294	73	111	KEEP	---	---	---	---	41	38	63	57	-1	capture	Missense_Mutation	SNP	28497327	28497327	GPX5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	6676	206
FAM83B	222584	broad.mit.edu	37	6	54805279	54805279	+	Missense_Mutation	SNP	C	T	T	rs115872183	byFrequency;by1000genomes	TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54805279C>T	uc003pck.2	+	5	1626	c.1510C>T	c.(1510-1512)CAT>TAT	p.H504Y		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	504										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					CTTAAATGATCATTCAGAAGC	0.408																0.355556	174.817892	178.139921	64	116	KEEP	---	---	---	---	39	30	50	73	-1	capture	Missense_Mutation	SNP	54805279	54805279	FAM83B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	5580	206
DNAH11	8701	broad.mit.edu	37	7	21658736	21658736	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21658736G>A	uc003svc.2	+	24	4319	c.4288G>A	c.(4288-4290)GAA>AAA	p.E1430K		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1430	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTTAATAAATGAAGCCACAAC	0.418												Kartagener_syndrome				0.059524	-10.039661	6.998591	5	79	KEEP	---	---	---	---	11	4	59	39	-1	capture	Missense_Mutation	SNP	21658736	21658736	DNAH11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	4557	206
EGFR	1956	broad.mit.edu	37	7	55211079	55211079	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55211079A>G	uc003tqk.2	+	3	568	c.322A>G	c.(322-324)AGA>GGA	p.R108G	EGFR_uc003tqh.2_Missense_Mutation_p.R108G|EGFR_uc003tqi.2_Missense_Mutation_p.R108G|EGFR_uc003tqj.2_Missense_Mutation_p.R108G|EGFR_uc010kzg.1_Missense_Mutation_p.R108G|EGFR_uc011kco.1_Missense_Mutation_p.R55G	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	108	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.R108K(7)|p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GCAGATCATCAGAGGAAATAT	0.418			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.055731	-76.034777	121.420669	53	898	KEEP	---	---	---	---	28	22	451	499	-1	capture	Missense_Mutation	SNP	55211079	55211079	EGFR	7	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	4922	206
EGFR	1956	broad.mit.edu	37	7	55223543	55223543	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55223543C>T	uc003tqk.2	+	8	1156	c.910C>T	c.(910-912)CAC>TAC	p.H304Y	EGFR_uc003tqh.2_Missense_Mutation_p.H304Y|EGFR_uc003tqi.2_Missense_Mutation_p.H304Y|EGFR_uc003tqj.2_Missense_Mutation_p.H304Y|EGFR_uc010kzg.1_Missense_Mutation_p.H259Y|EGFR_uc011kco.1_Missense_Mutation_p.H251Y|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	304	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGTGACAGATCACGGCTCGTG	0.592			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.221719	193.922015	225.450559	98	344	KEEP	---	---	---	---	114	119	380	387	-1	capture	Missense_Mutation	SNP	55223543	55223543	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4922	206
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.115847	96.219995	229.187458	106	809	KEEP	---	---	---	---	53	62	423	462	0.460869565217	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	206
PCLO	27445	broad.mit.edu	37	7	82585035	82585035	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82585035G>A	uc003uhx.2	-	5	5523	c.5234C>T	c.(5233-5235)CCG>CTG	p.P1745L	PCLO_uc003uhv.2_Missense_Mutation_p.P1745L	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1676					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTTGTGACTCGGGCTACTGTC	0.488																0.261538	283.184041	303.184223	102	288	KEEP	---	---	---	---	72	49	201	148	-1	capture	Missense_Mutation	SNP	82585035	82585035	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11486	206
DYNC1I1	1780	broad.mit.edu	37	7	95442583	95442583	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95442583C>T	uc003uoc.3	+	4	576	c.299C>T	c.(298-300)TCG>TTG	p.S100L	DYNC1I1_uc003uod.3_Missense_Mutation_p.S83L|DYNC1I1_uc003uob.2_Missense_Mutation_p.S83L|DYNC1I1_uc003uoe.3_Missense_Mutation_p.S100L|DYNC1I1_uc010lfl.2_Missense_Mutation_p.S89L	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	100	Interaction with DCTN1 (By similarity).				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCTCCCTCCTCGAAATCAGTG	0.468																0.035714	-42.424652	16.555824	9	243	KEEP	---	---	---	---	7	2	140	123	-1	capture	Missense_Mutation	SNP	95442583	95442583	DYNC1I1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4797	206
OR2A7	401427	broad.mit.edu	37	7	143956670	143956670	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143956670C>T	uc011kuc.1	-	1	52	c.52G>A	c.(52-54)GTT>ATT	p.V18I	OR2A9P_uc003wec.1_Intron|OR2A7_uc003wef.2_3'UTR	NM_001005328	NP_001005328	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.14)					CTTGGGCCAACGGGAAATCCC	0.498																0.076797	-9.611592	102.578908	47	565	KEEP	---	---	---	---	26	46	366	404	-1	capture	Missense_Mutation	SNP	143956670	143956670	OR2A7	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10886	206
MTUS1	57509	broad.mit.edu	37	8	17503489	17503489	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:17503489C>A	uc003wxv.2	-	15	4233	c.3759G>T	c.(3757-3759)TTG>TTT	p.L1253F	MTUS1_uc003wxt.2_Missense_Mutation_p.L500F|MTUS1_uc011kyg.1_Missense_Mutation_p.L398F|MTUS1_uc010lsy.2_RNA|MTUS1_uc003wxw.2_Missense_Mutation_p.L1199F|MTUS1_uc003wxs.2_Missense_Mutation_p.L419F	NM_001001924	NP_001001924	Q9ULD2	MTUS1_HUMAN	mitochondrial tumor suppressor 1 isoform 1	1253						Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)		TTGGTGACTGCAAAGGGATGG	0.537																0.051724	-5.826742	6.506608	3	55	KEEP	---	---	---	---	3	0	39	21	-1	capture	Missense_Mutation	SNP	17503489	17503489	MTUS1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	9875	206
TG	7038	broad.mit.edu	37	8	133925395	133925395	+	Silent	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:133925395C>T	uc003ytw.2	+	20	4304	c.4263C>T	c.(4261-4263)ACC>ACT	p.T1421T	TG_uc010mdw.2_Silent_p.T180T	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	1421					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAGCGGAAACCATCCGCTTCC	0.562					1778											0.416667	138.071382	138.721776	45	63	KEEP	---	---	---	---	25	26	42	27	-1	capture	Silent	SNP	133925395	133925395	TG	8	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	15698	206
AKNA	80709	broad.mit.edu	37	9	117099371	117099371	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:117099371C>T	uc004biq.3	-	21	4418	c.4283G>A	c.(4282-4284)CGC>CAC	p.R1428H	AKNA_uc004bin.3_Missense_Mutation_p.R675H|AKNA_uc004bio.3_Missense_Mutation_p.R888H|AKNA_uc004bip.3_Missense_Mutation_p.R1347H|AKNA_uc004bir.3_Missense_Mutation_p.R1428H|AKNA_uc004bis.3_Missense_Mutation_p.R1428H|AKNA_uc010mve.2_Missense_Mutation_p.R1309H	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1428					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						GTGAGCCTGGCGCAGGTCGGC	0.682																0.315789	14.540917	15.115679	6	13	KEEP	---	---	---	---	3	3	9	5	-1	capture	Missense_Mutation	SNP	117099371	117099371	AKNA	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	463	206
C9orf98	158067	broad.mit.edu	37	9	135702270	135702270	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135702270T>G	uc004cbu.1	-	8	1284	c.728A>C	c.(727-729)GAC>GCC	p.D243A	C9orf98_uc010mzx.1_RNA|C9orf98_uc004cbv.1_Missense_Mutation_p.D39A	NM_152572	NP_689785	Q96MA6	KAD8_HUMAN	putative adenylate kinase-like protein C9orf98	243						cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity				0				OV - Ovarian serous cystadenocarcinoma(145;4.89e-06)|Epithelial(140;0.00016)		ACATGGCTGGTCAGCACTGAT	0.557																0.10303	-21.085009	7.537155	17	148	KEEP	---	---	---	---	22	25	83	92	-1	capture	Missense_Mutation	SNP	135702270	135702270	C9orf98	9	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	2485	206
ALX4	60529	broad.mit.edu	37	11	44297101	44297101	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:44297101delC	uc001myb.2	-	2	678	c.574delG	c.(574-576)GACfs	p.D192fs		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	192					hair follicle development						0						CTGGCCCGGTCCTGGGGCCCC	0.632																0.36			88	155		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	44297101	44297101	ALX4	11	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	558	206
HEXIM1	10614	broad.mit.edu	37	17	43226653	43226653	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43226653delC	uc002iig.2	+	1	1970	c.96delC	c.(94-96)CGCfs	p.R32fs		NM_006460	NP_006451	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	32					negative regulation of cyclin-dependent protein kinase activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	cyclin-dependent protein kinase inhibitor activity|protein binding|snRNA binding			ovary(1)	1						ACCCTGAGCGCCCCCCAGGCG	0.632														OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.35			77	144		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	43226653	43226653	HEXIM1	17	C	-	-	-	1	0	1	0	1	0	0	0	0	327	26	5	5	7001	206
IL18R1	8809	broad.mit.edu	37	2	102988458	102988459	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102988458_102988459delAC	uc002tbw.3	+	4	498_499	c.348_349delAC	c.(346-351)AAACACfs	p.K116fs	IL18R1_uc010ywb.1_Frame_Shift_Del_p.K116fs|IL18R1_uc010ywc.1_Frame_Shift_Del_p.K116fs|IL18R1_uc010ywd.1_5'UTR|IL18R1_uc010fiy.2_Frame_Shift_Del_p.K116fs	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor	116_117	Ig-like C2-type 1.|Extracellular (Potential).				innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						GAAGAAATAAACACAGCTGTTT	0.277																0.28			25	65		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	102988458	102988459	IL18R1	2	AC	-	-	-	1	0	1	0	1	0	0	0	0	24	2	5	5	7570	206
SFRS15	57466	broad.mit.edu	37	21	33044257	33044259	+	In_Frame_Del	DEL	GCT	-	-			TCGA-28-1747-01	TCGA-28-1747-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:33044257_33044259delGCT	uc002ypd.2	-	20	3323_3325	c.2897_2899delAGC	c.(2896-2901)CAGCCA>CCA	p.Q966del	SFRS15_uc002ype.2_In_Frame_Del_p.Q944del|SFRS15_uc010glu.2_In_Frame_Del_p.Q951del	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	966	Poly-Gln.					nucleus	nucleotide binding|RNA binding				0						GATGGTGgtggctgctgctgctg	0.291																0.05			8	158		---	---	---	---						capture_indel	In_Frame_Del	DEL	33044257	33044259	SFRS15	21	GCT	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	14064	206
