Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SLC1A7	6512	broad.mit.edu	37	1	53559217	53559217	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53559217C>T	uc001cuy.2	-	6	881	c.713G>A	c.(712-714)CGC>CAC	p.R238H	SLC1A7_uc001cux.2_5'Flank	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	238						integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	GTCACCCATGCGGCCCAGCAT	0.617	NSCLC(128;80 1811 21245 38490 51715)															0.085714	0.89993	6.987335	3	32	KEEP	---	---	---	---	0	3	15	18	-1	capture	Missense_Mutation	SNP	53559217	53559217	SLC1A7	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14330	218
ODF2L	57489	broad.mit.edu	37	1	86838137	86838137	+	Missense_Mutation	SNP	T	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86838137T>A	uc001dll.1	-	9	1237	c.897A>T	c.(895-897)GAA>GAT	p.E299D	ODF2L_uc001dlm.1_Missense_Mutation_p.E299D|ODF2L_uc001dln.2_Missense_Mutation_p.E299D|ODF2L_uc001dlo.2_Missense_Mutation_p.E168D|ODF2L_uc001dlp.2_Missense_Mutation_p.E299D|ODF2L_uc010osg.1_Missense_Mutation_p.E299D|ODF2L_uc001dlq.1_Missense_Mutation_p.E129D|ODF2L_uc009wcr.1_Missense_Mutation_p.E168D	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform	299	Potential.					centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		CAATCTGTACTTCCAATTCGG	0.259																0.285714	16.641367	17.506626	6	15	KEEP	---	---	---	---	2	4	8	7	-1	capture	Missense_Mutation	SNP	86838137	86838137	ODF2L	1	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	10733	218
SPAG17	200162	broad.mit.edu	37	1	118574428	118574428	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118574428C>A	uc001ehk.2	-	25	3564	c.3496G>T	c.(3496-3498)GTT>TTT	p.V1166F		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1166						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ATAACAGGAACCACTGTTGGA	0.353																0.390977	305.841831	308.610146	104	162	KEEP	---	---	---	---	57	56	93	78	0.495575221239	capture	Missense_Mutation	SNP	118574428	118574428	SPAG17	1	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	14871	218
FCER1A	2205	broad.mit.edu	37	1	159272655	159272655	+	Missense_Mutation	SNP	G	A	A	rs142162478		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159272655G>A	uc001ftq.2	+	3	166	c.67G>A	c.(67-69)GTG>ATG	p.V23M		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	23						integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TCCAGATGGCGTGTTAGCAGG	0.463																0.443709	612.315346	613.565957	201	252	KEEP	---	---	---	---	100	133	156	144	-1	capture	Missense_Mutation	SNP	159272655	159272655	FCER1A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5720	218
PLA2G4A	5321	broad.mit.edu	37	1	186863266	186863266	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186863266A>T	uc001gsc.2	+	5	506	c.301A>T	c.(301-303)ACT>TCT	p.T101S	PLA2G4A_uc010pos.1_Missense_Mutation_p.T101S	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA	101	C2.|Phospholipid binding (Probable).				phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	CATGGATGAAACTCTAGGGAC	0.328																0.388571	193.149833	195.056523	68	107	KEEP	---	---	---	---	55	33	67	59	-1	capture	Missense_Mutation	SNP	186863266	186863266	PLA2G4A	1	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	11904	218
MIA3	375056	broad.mit.edu	37	1	222833136	222833136	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222833136A>G	uc001hnl.2	+	22	4876	c.4867A>G	c.(4867-4869)AGA>GGA	p.R1623G	MIA3_uc001hnm.2_Missense_Mutation_p.R501G	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1623	Cytoplasmic (Potential).|Potential.				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)		TGCCAATTTGAGACACAAGTA	0.358																0.03	-16.767091	7.481135	3	97	KEEP	---	---	---	---	3	1	54	56	-1	capture	Missense_Mutation	SNP	222833136	222833136	MIA3	1	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	9477	218
ARMC4	55130	broad.mit.edu	37	10	28228843	28228843	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28228843C>T	uc009xky.2	-	14	2178	c.2080G>A	c.(2080-2082)GCC>ACC	p.A694T	ARMC4_uc010qds.1_Missense_Mutation_p.A219T|ARMC4_uc010qdt.1_Missense_Mutation_p.A386T|ARMC4_uc001itz.2_Missense_Mutation_p.A694T	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	694	ARM 4.|HEAT.						binding			ovary(4)|skin(2)	6						ATGGCCATGGCGCAGTGCTCC	0.458																0.918033	179.242053	190.083365	56	5	KEEP	---	---	---	---	33	29	3	2	-1	capture	Missense_Mutation	SNP	28228843	28228843	ARMC4	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	946	218
HNRNPF	3185	broad.mit.edu	37	10	43882701	43882701	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:43882701T>C	uc009xmh.1	-	3	1119	c.632A>G	c.(631-633)GAC>GGC	p.D211G	HNRNPF_uc001jar.2_Missense_Mutation_p.D211G|HNRNPF_uc001jas.2_Missense_Mutation_p.D211G|HNRNPF_uc001jat.2_Missense_Mutation_p.D211G|HNRNPF_uc001jav.2_Missense_Mutation_p.D211G|HNRNPF_uc001jau.2_Missense_Mutation_p.D211G|uc010qfa.1_Missense_Mutation_p.V128A	NM_001098208	NP_001091678	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	211					regulation of RNA splicing	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding				0						CCCGGGCCGGTCATAGGGCCC	0.592																0.04	-9.732338	7.363192	3	72	KEEP	---	---	---	---	2	1	36	47	-1	capture	Missense_Mutation	SNP	43882701	43882701	HNRNPF	10	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	7190	218
PI4K2A	55361	broad.mit.edu	37	10	99426254	99426254	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:99426254G>T	uc001kog.1	+	7	1201	c.1144G>T	c.(1144-1146)GAT>TAT	p.D382Y	PI4K2A_uc010qoy.1_Missense_Mutation_p.D352Y|PI4K2A_uc009xvw.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	382	PI3K/PI4K.				phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		GGAGATCAAAGATCTGATCCT	0.468					218											0.875	204.068568	213.955433	63	9	KEEP	---	---	---	---	27	40	4	5	0.402985074627	capture	Missense_Mutation	SNP	99426254	99426254	PI4K2A	10	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	11774	218
BTRC	8945	broad.mit.edu	37	10	103190197	103190197	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:103190197C>T	uc001kta.2	+	2	257	c.144C>T	c.(142-144)CTC>CTT	p.L48L	BTRC_uc001ksz.1_Intron|BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Silent_p.L48L	NM_033637	NP_378663	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing protein	48					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CTGGCGCACTCACAGCTTTCC	0.527					243											0.753247	184.980356	189.471684	58	19	KEEP	---	---	---	---	26	37	14	6	-1	capture	Silent	SNP	103190197	103190197	BTRC	10	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	1557	218
DMBT1	1755	broad.mit.edu	37	10	124345651	124345651	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124345651G>A	uc001lgk.1	+	16	1641	c.1535G>A	c.(1534-1536)CGA>CAA	p.R512Q	DMBT1_uc001lgl.1_Missense_Mutation_p.R502Q|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Missense_Mutation_p.R512Q|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yaa.1_Intron	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	512	SRCR 4.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				GTCCTATACCGAGGCTCCTGG	0.592	Ovarian(182;93 2026 18125 22222 38972)															0.021176	-94.355512	14.594793	9	416	KEEP	---	---	---	---	7	6	227	246	-1	capture	Missense_Mutation	SNP	124345651	124345651	DMBT1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4535	218
TRIM6-TRIM34	445372	broad.mit.edu	37	11	5625849	5625849	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5625849C>A	uc001mbf.2	+	3	837	c.593C>A	c.(592-594)ACA>AAA	p.T198K	HBG2_uc001mak.1_Intron|TRIM6_uc009yeo.1_Missense_Mutation_p.T144K|TRIM6_uc010qzj.1_5'UTR|TRIM6_uc001mbc.1_Missense_Mutation_p.T170K|TRIM6_uc001mbe.2_5'UTR|TRIM6_uc010qzk.1_5'UTR|TRIM6_uc010qzl.1_Intron|TRIM6_uc001mbd.2_Missense_Mutation_p.T198K|TRIM6_uc001mbg.1_5'Flank|TRIM6_uc009yep.1_5'Flank	NM_001003819	NP_001003819	B2RNG4	B2RNG4_HUMAN	tripartite motif-containing 6 and tripartite	198						intracellular	zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;1.01e-08)|BRCA - Breast invasive adenocarcinoma(625;0.145)		GAGAAGAAAACATCCTGGAAG	0.468																0.453552	254.399384	254.743979	83	100	KEEP	---	---	---	---	39	50	51	56	0.561797752809	capture	Missense_Mutation	SNP	5625849	5625849	TRIM6-TRIM34	11	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	16417	218
COPB1	1315	broad.mit.edu	37	11	14498486	14498486	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:14498486C>A	uc001mli.2	-	12	1741	c.1434G>T	c.(1432-1434)GAG>GAT	p.E478D	COPB1_uc001mlg.2_Missense_Mutation_p.E478D|COPB1_uc001mlh.2_Missense_Mutation_p.E478D	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	478					COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						ACCTGCGGATCTCAGTCATCA	0.373																0.462633	371.102502	371.446028	130	151	KEEP	---	---	---	---	59	88	78	96	0.598639455782	capture	Missense_Mutation	SNP	14498486	14498486	COPB1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	3693	218
KCNA4	3739	broad.mit.edu	37	11	30033178	30033178	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:30033178A>T	uc001msk.2	-	2	2200	c.1048T>A	c.(1048-1050)TTG>ATG	p.L350M		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	350						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TCATTCAACAACCCACCATGC	0.478																0.527174	260.32454	260.429778	97	87	KEEP	---	---	---	---	54	57	51	47	-1	capture	Missense_Mutation	SNP	30033178	30033178	KCNA4	11	A	T	T	T	1	0	0	0	0	1	0	0	0	24	2	4	4	7927	218
LRP4	4038	broad.mit.edu	37	11	46900805	46900805	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46900805T>C	uc001ndn.3	-	21	3022	c.2876A>G	c.(2875-2877)TAT>TGT	p.Y959C		NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	959	Extracellular (Potential).|LDL-receptor class B 10.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		GTCAGTCCAATAGATGCGCTC	0.567																0.493023	396.871866	396.880367	106	109	KEEP	---	---	---	---	51	64	59	63	-1	capture	Missense_Mutation	SNP	46900805	46900805	LRP4	11	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8875	218
MS4A15	219995	broad.mit.edu	37	11	60531221	60531221	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60531221C>T	uc009ynf.1	+	2	235	c.15C>T	c.(13-15)CCC>CCT	p.P5P	MS4A15_uc001npx.2_Intron|MS4A15_uc001npy.2_RNA|MS4A15_uc009yng.1_Silent_p.P5P	NM_001098835	NP_001092305	Q8N5U1	M4A15_HUMAN	membrane-spanning 4-domains, subfamily A, member	5						integral to membrane	receptor activity			lung(1)	1						CTGCAGCTCCCGCCAGCAATG	0.527																0.454874	416.844197	417.331874	126	151	KEEP	---	---	---	---	71	66	91	73	-1	capture	Silent	SNP	60531221	60531221	MS4A15	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9769	218
PGA5	5222	broad.mit.edu	37	11	61018718	61018718	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61018718G>A	uc001nqz.2	+	9	1162	c.1132G>A	c.(1132-1134)GCA>ACA	p.A378T		NM_014224	NP_055039	P00790	PEPA_HUMAN	pepsinogen 5, group I precursor	378					digestion|proteolysis	extracellular region	aspartic-type endopeptidase activity			skin(1)	1						CTTCGACAGGGCAAACAACCA	0.557																0.013544	-111.465959	8.109551	6	437	KEEP	---	---	---	---	4	3	279	311	-1	capture	Missense_Mutation	SNP	61018718	61018718	PGA5	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11675	218
MMP27	64066	broad.mit.edu	37	11	102573550	102573550	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102573550G>A	uc001phd.1	-	4	576	c.553C>T	c.(553-555)CCT>TCT	p.P185S		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	185					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		CCCGGACCAGGAGGAAAGGCA	0.458																0.472789	428.89614	429.0863	139	155	KEEP	---	---	---	---	66	80	68	94	-1	capture	Missense_Mutation	SNP	102573550	102573550	MMP27	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	9576	218
DSCAML1	57453	broad.mit.edu	37	11	117342628	117342628	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117342628C>T	uc001prh.1	-	15	3091	c.3089G>A	c.(3088-3090)CGC>CAC	p.R1030H		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	970	Extracellular (Potential).|Fibronectin type-III 1.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGTTCACTGCGGCCAATCTT	0.587																0.464481	251.153743	251.354889	85	98	KEEP	---	---	---	---	55	32	46	59	-1	capture	Missense_Mutation	SNP	117342628	117342628	DSCAML1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4724	218
DPPA3	359787	broad.mit.edu	37	12	7869602	7869602	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7869602G>A	uc001qtf.2	+	4	487	c.409G>A	c.(409-411)GTG>ATG	p.V137M		NM_199286	NP_954980	Q6W0C5	DPPA3_HUMAN	stella	137						cytoplasm|nucleus					0				Kidney(36;0.0887)		CAGTTTCTGCGTGTCTAATGG	0.378																0.408257	267.233489	268.836726	89	129	KEEP	---	---	---	---	56	42	62	93	-1	capture	Missense_Mutation	SNP	7869602	7869602	DPPA3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4690	218
CLEC4E	26253	broad.mit.edu	37	12	8689778	8689778	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8689778G>A	uc001quo.1	-	4	470	c.305C>T	c.(304-306)GCG>GTG	p.A102V		NM_014358	NP_055173	Q9ULY5	CLC4E_HUMAN	C-type lectin domain family 4, member E	102	C-type lectin.|Extracellular (Potential).					integral to membrane	sugar binding			central_nervous_system(1)	1	Lung SC(5;0.184)					TAAACTTAACGCCCAGGAAAT	0.458																0.434286	219.288749	219.943534	76	99	KEEP	---	---	---	---	38	41	51	53	-1	capture	Missense_Mutation	SNP	8689778	8689778	CLEC4E	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3480	218
ABCC9	10060	broad.mit.edu	37	12	21991021	21991021	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21991021C>T	uc001rfi.1	-	28	3577	c.3557G>A	c.(3556-3558)CGG>CAG	p.R1186Q	ABCC9_uc001rfh.2_Missense_Mutation_p.R1186Q|ABCC9_uc001rfj.1_Missense_Mutation_p.R1150Q	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1186	Extracellular (Potential).|ABC transmembrane type-1 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCTAAAGGCCCGAATGGTGGT	0.423																0.429752	172.782857	173.303466	52	69	KEEP	---	---	---	---	25	30	42	37	-1	capture	Missense_Mutation	SNP	21991021	21991021	ABCC9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	59	218
ADCY6	112	broad.mit.edu	37	12	49164592	49164592	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49164592C>T	uc001rsh.3	-	19	3873	c.3213G>A	c.(3211-3213)AAG>AAA	p.K1071K	ADCY6_uc001rsj.3_Silent_p.K1071K|ADCY6_uc001rsi.3_Silent_p.K1018K|ADCY6_uc010slw.1_3'UTR	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	1071	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						CATTGATGTGCTTCATCTGCT	0.552																0.80799	2178.823862	2247.623285	627	149	KEEP	---	---	---	---	368	363	88	89	-1	capture	Silent	SNP	49164592	49164592	ADCY6	12	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	298	218
CACNB3	784	broad.mit.edu	37	12	49221583	49221583	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49221583G>A	uc001rsl.1	+	13	1557	c.1356G>A	c.(1354-1356)GGG>GGA	p.G452G	CACNB3_uc010sly.1_Silent_p.G439G|CACNB3_uc010slz.1_Silent_p.G451G|CACNB3_uc001rsk.1_Silent_p.G299G	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	452					axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	GTGCTAACGGGCATGACCCCC	0.622																0.013187	-114.569569	8.532838	6	449	KEEP	---	---	---	---	3	5	221	316	-1	capture	Silent	SNP	49221583	49221583	CACNB3	12	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	2530	218
TUBA1B	10376	broad.mit.edu	37	12	49523423	49523423	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49523423C>T	uc001rtm.2	-	2	307	c.86G>A	c.(85-87)GGC>GAC	p.G29D	TUBA1B_uc001rto.2_Intron|TUBA1B_uc001rtk.2_5'UTR|TUBA1B_uc001rtl.2_5'UTR|TUBA1B_uc001rtn.2_5'UTR	NM_006082	NP_006073	P68363	TBA1B_HUMAN	tubulin, alpha, ubiquitous	29					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0						GGGCTGGATGCCGTGTTCCAG	0.582																0.023256	-37.029602	6.474256	4	168	KEEP	---	---	---	---	1	3	97	106	-1	capture	Missense_Mutation	SNP	49523423	49523423	TUBA1B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16626	218
KRT1	3848	broad.mit.edu	37	12	53072002	53072002	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53072002T>C	uc001sau.1	-	3	871	c.812A>G	c.(811-813)GAG>GGG	p.E271G	KRT1_uc001sav.1_Missense_Mutation_p.E271G	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	271	Coil 1B.|Rod.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						GATTTCATCCTCATACCTGCA	0.403																0.02459	-23.485377	7.119154	3	119	KEEP	---	---	---	---	3	2	59	73	-1	capture	Missense_Mutation	SNP	53072002	53072002	KRT1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	8367	218
TRHDE	29953	broad.mit.edu	37	12	73046818	73046818	+	Missense_Mutation	SNP	T	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:73046818T>A	uc001sxa.2	+	17	2761	c.2731T>A	c.(2731-2733)TCT>ACT	p.S911T		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	911	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GTCACTGAATTCTGAGGTGGT	0.343																0.441341	225.295109	225.832387	79	100	KEEP	---	---	---	---	40	50	55	63	-1	capture	Missense_Mutation	SNP	73046818	73046818	TRHDE	12	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	16362	218
NUDT4	11163	broad.mit.edu	37	12	93792556	93792556	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:93792556C>T	uc001tcm.2	+	4	663	c.265C>T	c.(265-267)CGA>TGA	p.R89*	NUDT4_uc010sup.1_Nonsense_Mutation_p.R89*|NUDT4_uc001tcn.2_Nonsense_Mutation_p.R37*|NUDT4_uc010suq.1_Nonsense_Mutation_p.R38*|NUDT4_uc001tco.2_Nonsense_Mutation_p.R37*	NM_019094	NP_061967	Q9NZJ9	NUDT4_HUMAN	nudix-type motif 4 isoform alpha	89	Substrate binding (By similarity).|Nudix hydrolase.				calcium-mediated signaling|cyclic nucleotide metabolic process|cyclic-nucleotide-mediated signaling|intracellular transport|regulation of RNA export from nucleus	cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0						GAACCAAGACCGAAAGCACAG	0.343																0.023952	-34.220159	7.81784	4	163	KEEP	---	---	---	---	1	3	97	88	-1	capture	Nonsense_Mutation	SNP	93792556	93792556	NUDT4	12	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	10648	218
MTERFD3	80298	broad.mit.edu	37	12	107371336	107371336	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107371336C>T	uc001tme.1	-	2	2976	c.1157G>A	c.(1156-1158)TGA>TAA	p.*386*	MTERFD3_uc001tmf.1_Silent_p.*386*|MTERFD3_uc001tmg.1_Silent_p.*386*|MTERFD3_uc001tmh.1_3'UTR	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein	386					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						GTCAGTATGTCATTCTTCAAC	0.358																0.39899	231.97625	233.745969	79	119	KEEP	---	---	---	---	45	46	76	53	-1	capture	Silent	SNP	107371336	107371336	MTERFD3	12	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	9831	218
WSCD2	9671	broad.mit.edu	37	12	108603986	108603986	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108603986G>A	uc001tms.2	+	4	1330	c.586G>A	c.(586-588)GAC>AAC	p.D196N	WSCD2_uc001tmt.2_Missense_Mutation_p.D196N	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	196	WSC 1.					integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						GGCAGAGTGCGACATGGAGTG	0.682																0.479167	68.720196	68.738437	23	25	KEEP	---	---	---	---	8	17	12	15	-1	capture	Missense_Mutation	SNP	108603986	108603986	WSCD2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17288	218
TUBA3C	7278	broad.mit.edu	37	13	19752451	19752451	+	Missense_Mutation	SNP	C	T	T	rs145210942		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:19752451C>T	uc009zzj.2	-	3	359	c.310G>A	c.(310-312)GCC>ACC	p.A104T		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	104					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TGGCCTCTGGCGTAATTATTG	0.532																0.442149	313.497749	314.20168	107	135	KEEP	---	---	---	---	62	53	69	73	-1	capture	Missense_Mutation	SNP	19752451	19752451	TUBA3C	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16628	218
FLT3	2322	broad.mit.edu	37	13	28636176	28636176	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28636176C>T	uc001urw.2	-	3	278	c.196G>A	c.(196-198)GCG>ACG	p.A66T	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.A66T	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	66	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	p.599_560>LTGSSDNEYFYVDFREYEY(1)		haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	GGTCTCAACGCACACCCGAGG	0.532					630	Mis|O		AML|ALL								0.395833	152.228229	153.628924	57	87	KEEP	---	---	---	---	35	37	54	44	-1	capture	Missense_Mutation	SNP	28636176	28636176	FLT3	13	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	5886	218
SUCLA2	8803	broad.mit.edu	37	13	48571116	48571116	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48571116C>T	uc001vbs.2	-	2	190	c.133G>A	c.(133-135)GTA>ATA	p.V45I	SUCLA2_uc010tgb.1_5'UTR|SUCLA2_uc010tgc.1_5'UTR|SUCLA2_uc010tgd.1_5'UTR|SUCLA2_uc001vbt.1_RNA|SUCLA2_uc001vbu.1_Missense_Mutation_p.V45I	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	45					succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TGCTGCTGTACTTGGAGTCCA	0.403																0.427673	217.175966	217.901214	68	91	KEEP	---	---	---	---	40	41	53	54	-1	capture	Missense_Mutation	SNP	48571116	48571116	SUCLA2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	15253	218
KLF5	688	broad.mit.edu	37	13	73636601	73636601	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:73636601G>A	uc001vje.2	+	2	1188	c.864G>A	c.(862-864)ATG>ATA	p.M288I	KLF5_uc001vjd.2_Missense_Mutation_p.M197I	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5	288					transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		CATACACAATGCCAAGTCAGT	0.522																0.478261	183.565976	183.626467	66	72	KEEP	---	---	---	---	37	35	34	42	-1	capture	Missense_Mutation	SNP	73636601	73636601	KLF5	13	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	8269	218
FOXG1	2290	broad.mit.edu	37	14	29237185	29237185	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:29237185T>G	uc001wqe.2	+	1	899	c.700T>G	c.(700-702)TCC>GCC	p.S234A		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	234	Fork-head.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CCACAATCTGTCCCTCAACAA	0.587																0.4375	93.39964	93.61562	28	36	KEEP	---	---	---	---	23	18	25	32	-1	capture	Missense_Mutation	SNP	29237185	29237185	FOXG1	14	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	5951	218
SIPA1L1	26037	broad.mit.edu	37	14	72176033	72176033	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:72176033G>A	uc001xms.2	+	15	4271	c.3923G>A	c.(3922-3924)CGC>CAC	p.R1308H	SIPA1L1_uc001xmt.2_Missense_Mutation_p.R1287H|SIPA1L1_uc001xmu.2_Missense_Mutation_p.R1287H|SIPA1L1_uc001xmv.2_Missense_Mutation_p.R1308H|SIPA1L1_uc010ttm.1_Missense_Mutation_p.R762H|SIPA1L1_uc001xmw.2_Missense_Mutation_p.R73H	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	1308	Ser-rich.				actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GATGGGGACCGCACAGAATCC	0.537																0.025	-33.139512	6.8965	4	156	KEEP	---	---	---	---	4	0	86	79	-1	capture	Missense_Mutation	SNP	72176033	72176033	SIPA1L1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14222	218
AHNAK2	113146	broad.mit.edu	37	14	105413876	105413876	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105413876C>T	uc010axc.1	-	7	8032	c.7912G>A	c.(7912-7914)GAC>AAC	p.D2638N	AHNAK2_uc001ypx.2_Missense_Mutation_p.D2538N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2638						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACACCCTTGTCGGCCAGGGAC	0.602																0.493805	852.12707	852.145307	279	286	KEEP	---	---	---	---	149	169	179	152	-1	capture	Missense_Mutation	SNP	105413876	105413876	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	415	218
SPG11	80208	broad.mit.edu	37	15	44858195	44858195	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44858195G>A	uc001ztx.2	-	38	6887	c.6856C>T	c.(6856-6858)CGA>TGA	p.R2286*	SPG11_uc010bdw.2_Nonsense_Mutation_p.R416*|SPG11_uc010ueh.1_Nonsense_Mutation_p.R2173*|SPG11_uc010uei.1_Intron	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	2286	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TGGGCCTGTCGCACACAGGAG	0.532																0.4	81.884633	82.497128	28	42	KEEP	---	---	---	---	17	17	26	19	-1	capture	Nonsense_Mutation	SNP	44858195	44858195	SPG11	15	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	14933	218
ACSM2A	123876	broad.mit.edu	37	16	20492203	20492203	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20492203A>T	uc010bwe.2	+	13	1708	c.1469A>T	c.(1468-1470)GAG>GTG	p.E490V	ACSM2A_uc010vax.1_Missense_Mutation_p.E411V|ACSM2A_uc002dhf.3_Missense_Mutation_p.E490V|ACSM2A_uc002dhg.3_Missense_Mutation_p.E490V|ACSM2A_uc010vay.1_Missense_Mutation_p.E411V|ACSM2A_uc002dhh.3_Missense_Mutation_p.E120V	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	490					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						GCTGTGGTTGAGACGGCTGTG	0.527																0.391304	180.390602	182.055611	63	98	KEEP	---	---	---	---	40	41	61	63	-1	capture	Missense_Mutation	SNP	20492203	20492203	ACSM2A	16	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	183	218
DNAH3	55567	broad.mit.edu	37	16	21128600	21128600	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21128600C>T	uc010vbe.1	-	12	1738	c.1738G>A	c.(1738-1740)GCA>ACA	p.A580T	DNAH3_uc002die.2_Missense_Mutation_p.A520T	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	580	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TTTTCTTCTGCGTTAACAGTT	0.358																0.056452	-12.175148	13.463313	7	117	KEEP	---	---	---	---	4	4	58	77	-1	capture	Missense_Mutation	SNP	21128600	21128600	DNAH3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4560	218
CHP2	63928	broad.mit.edu	37	16	23768582	23768582	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23768582C>T	uc002dmb.1	+	6	898	c.475C>T	c.(475-477)CGC>TGC	p.R159C		NM_022097	NP_071380	O43745	CHP2_HUMAN	hepatocellular carcinoma antigen gene 520	159	EF-hand 4.						calcium ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(48;0.0144)		CATCGCTGACCGCACGGTGCA	0.577																0.438017	162.457203	162.861879	53	68	KEEP	---	---	---	---	34	22	38	37	-1	capture	Missense_Mutation	SNP	23768582	23768582	CHP2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3332	218
SLC38A7	55238	broad.mit.edu	37	16	58709937	58709937	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58709937C>T	uc002eod.1	-	8	1183	c.790G>A	c.(790-792)GTC>ATC	p.V264I	SLC38A7_uc002eob.1_Intron|SLC38A7_uc002eoc.1_Missense_Mutation_p.V264I|SLC38A7_uc010vil.1_Missense_Mutation_p.V175I|SLC38A7_uc002eoe.1_Missense_Mutation_p.V264I	NM_018231	NP_060701	Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	264					amino acid transport|sodium ion transport	integral to membrane				ovary(1)	1						CTGTTGAAGACGGGCACACTG	0.572																0.436364	70.194396	70.387872	24	31	KEEP	---	---	---	---	16	10	17	18	-1	capture	Missense_Mutation	SNP	58709937	58709937	SLC38A7	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14501	218
ATP2A3	489	broad.mit.edu	37	17	3840720	3840720	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3840720C>T	uc002fxb.1	-	15	2462	c.2311G>A	c.(2311-2313)GAG>AAG	p.E771K	ATP2A3_uc002fwx.1_Missense_Mutation_p.E771K|ATP2A3_uc002fwy.1_Missense_Mutation_p.E771K|ATP2A3_uc002fwz.1_Missense_Mutation_p.E771K|ATP2A3_uc002fxa.1_Missense_Mutation_p.E771K|ATP2A3_uc002fxc.1_Missense_Mutation_p.E771K|ATP2A3_uc002fxd.1_Missense_Mutation_p.E771K	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b	771	Helical; Name=5; (By similarity).	Calcium 1 (By similarity).			ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CAGACGACCTCGCCAACATTG	0.602	GBM(32;29 774 15719 37967)															0.290323	46.026316	48.468146	18	44	KEEP	---	---	---	---	10	9	25	21	-1	capture	Missense_Mutation	SNP	3840720	3840720	ATP2A3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1129	218
C17orf59	54785	broad.mit.edu	37	17	8092644	8092645	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8092644_8092645CC>AA	uc010vut.1	-	1	920_921	c.814_815GG>TT	c.(814-816)GGA>TTA	p.G272L		NM_017622	NP_060092	Q96GS4	CQ059_HUMAN	hypothetical protein LOC54785	272											0						CACCCGGCCTCCCAGCTCCCGA	0.703																0.413793	35.093586	35.28208	12	17	KEEP	---	---	---	---	0	0	0	0	-1	capture	Missense_Mutation	DNP	8092644	8092645	C17orf59	17	CC	AA	AA	AA	1	0	0	0	0	1	0	0	0	390	30	4	4	1852	218
LAMA1	284217	broad.mit.edu	37	18	6965403	6965403	+	Missense_Mutation	SNP	C	A	A	rs141811330		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6965403C>A	uc002knm.2	-	50	7173	c.7079G>T	c.(7078-7080)CGT>CTT	p.R2360L	LAMA1_uc002knl.2_5'UTR|LAMA1_uc010wzj.1_Missense_Mutation_p.R1836L	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2360	Laminin G-like 2.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CACTCTGCCACGAAACAGCTC	0.443					1597											0.467662	320.145126	320.327071	94	107	KEEP	---	---	---	---	60	53	61	60	0.469026548673	capture	Missense_Mutation	SNP	6965403	6965403	LAMA1	18	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	8525	218
AFG3L2	10939	broad.mit.edu	37	18	12351333	12351333	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:12351333C>T	uc002kqz.1	-	11	1511	c.1398G>A	c.(1396-1398)CCG>CCA	p.P466P		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	466					cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	CGAAACGCCCCGGCCTAAGCA	0.463																0.363636	176.356101	179.054322	60	105	KEEP	---	---	---	---	33	28	53	61	-1	capture	Silent	SNP	12351333	12351333	AFG3L2	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	360	218
TMPRSS9	360200	broad.mit.edu	37	19	2418090	2418090	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2418090G>A	uc010xgx.1	+	12	2006	c.2006G>A	c.(2005-2007)CGC>CAC	p.R669H		NM_182973	NP_892018	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	669	Extracellular (Potential).|Peptidase S1 2.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCACAGACCGCATGATCTGC	0.557																0.013592	-129.656066	9.307703	7	508	KEEP	---	---	---	---	4	3	258	313	-1	capture	Missense_Mutation	SNP	2418090	2418090	TMPRSS9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16136	218
ZNF358	140467	broad.mit.edu	37	19	7585507	7585507	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7585507G>A	uc002mgn.2	+	2	1549	c.1379G>A	c.(1378-1380)CGC>CAC	p.R460H	MCOLN1_uc010dvh.1_5'Flank|MCOLN1_uc002mgo.2_5'Flank|MCOLN1_uc002mgp.2_5'Flank	NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	460					embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						agctctggccgcaaccctgac	0.209																0.1875	6.118878	7.57964	3	13	KEEP	---	---	---	---	2	1	5	9	-1	capture	Missense_Mutation	SNP	7585507	7585507	ZNF358	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17747	218
ICAM1	3383	broad.mit.edu	37	19	10394191	10394191	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10394191C>T	uc002mnq.2	+	3	685	c.366C>T	c.(364-366)CCC>CCT	p.P122P	ICAM1_uc010xle.1_Intron	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	122	Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	CACCCCTCCCCTCTTGGCAGC	0.637					72											0.326861	286.645891	294.874521	101	208	KEEP	---	---	---	---	57	56	113	131	-1	capture	Silent	SNP	10394191	10394191	ICAM1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	7404	218
MAN2B1	4125	broad.mit.edu	37	19	12759205	12759205	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12759205C>G	uc002mub.2	-	21	2524	c.2448G>C	c.(2446-2448)AGG>AGC	p.R816S	MAN2B1_uc010dyv.1_Missense_Mutation_p.R815S	NM_000528	NP_000519	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	816					protein deglycosylation	lysosome	alpha-mannosidase activity|zinc ion binding			ovary(4)|central_nervous_system(2)	6						CCTTCAGCAGCCTTCGGTGCA	0.652																0.343284	75.2221	76.667473	23	44	KEEP	---	---	---	---	13	11	22	25	-1	capture	Missense_Mutation	SNP	12759205	12759205	MAN2B1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	337	26	4	4	9130	218
EMR2	30817	broad.mit.edu	37	19	14865775	14865775	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14865775G>A	uc002mzp.1	-	14	2037	c.1581C>T	c.(1579-1581)TAC>TAT	p.Y527Y	EMR2_uc010dzs.1_Intron|EMR2_uc010xnw.1_Intron|EMR2_uc002mzo.1_Silent_p.Y516Y|EMR2_uc002mzq.1_Silent_p.Y467Y|EMR2_uc002mzr.1_Silent_p.Y478Y|EMR2_uc002mzs.1_Silent_p.Y385Y|EMR2_uc002mzt.1_Silent_p.Y423Y|EMR2_uc002mzu.1_Silent_p.Y434Y|EMR2_uc010xnx.1_RNA|EMR2_uc010xny.1_Intron	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	527	Extracellular (Potential).|GPS.				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						CCTGCACATCGTAGTGGGCCA	0.423																0.327731	220.681496	226.93835	78	160	KEEP	---	---	---	---	44	42	85	102	-1	capture	Silent	SNP	14865775	14865775	EMR2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5060	218
UBA52	7311	broad.mit.edu	37	19	18684505	18684505	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18684505C>T	uc002njr.2	+	3	251	c.137C>T	c.(136-138)GCC>GTC	p.A46V	UBA52_uc002njs.2_Missense_Mutation_p.A46V|UBA52_uc002njt.2_Missense_Mutation_p.A46V	NM_001033930	NP_001029102	P62987	RL40_HUMAN	ubiquitin and ribosomal protein L40 precursor	46	Ubiquitin-like.				activation of MAPK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|apoptosis|cellular membrane organization|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|endocrine pancreas development|endosome transport|epidermal growth factor receptor signaling pathway|G1/S transition of mitotic cell cycle|I-kappaB kinase/NF-kappaB cascade|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|M/G1 transition of mitotic cell cycle|mRNA metabolic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of type I interferon production|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|translational elongation|translational termination|viral transcription	cytosol|endocytic vesicle membrane|endosome membrane|nucleoplasm|plasma membrane|ribosome	protein binding|structural constituent of ribosome				0						CTGATATTTGCCGGCAAACAG	0.597																0.022321	-50.018931	7.014843	5	219	KEEP	---	---	---	---	5	2	116	154	-1	capture	Missense_Mutation	SNP	18684505	18684505	UBA52	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16713	218
ZNF98	148198	broad.mit.edu	37	19	22575722	22575722	+	Silent	SNP	T	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22575722T>C	uc002nqt.2	-	4	437	c.315A>G	c.(313-315)CAA>CAG	p.Q105Q		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	105					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				GTATCACTTTTTGGAAATAAT	0.299																0.235955	63.529851	69.202686	21	68	KEEP	---	---	---	---	13	11	45	31	-1	capture	Silent	SNP	22575722	22575722	ZNF98	19	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	18079	218
GPATCH1	55094	broad.mit.edu	37	19	33585093	33585093	+	Silent	SNP	C	T	T	rs149673951		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33585093C>T	uc002nug.1	+	5	785	c.471C>T	c.(469-471)TTC>TTT	p.F157F		NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	157	G-patch.					catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					CTGTTGGTTTCGAATTGCTAA	0.393	Pancreas(67;88 1713 4567 18227)															0.353211	223.004575	227.14891	77	141	KEEP	---	---	---	---	51	30	76	79	-1	capture	Silent	SNP	33585093	33585093	GPATCH1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	6524	218
NPHS1	4868	broad.mit.edu	37	19	36336653	36336653	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36336653G>A	uc002oby.2	-	13	1675	c.1675C>T	c.(1675-1677)CCG>TCG	p.P559S		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	559	Ig-like C2-type 6.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCGTCTCCCGGGCGCAGTGCG	0.622																0.263736	63.556255	68.151014	24	67	KEEP	---	---	---	---	15	14	37	40	-1	capture	Missense_Mutation	SNP	36336653	36336653	NPHS1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10489	218
PLEKHG2	64857	broad.mit.edu	37	19	39913516	39913516	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39913516G>A	uc010xuz.1	+	18	2147	c.1822G>A	c.(1822-1824)GGG>AGG	p.G608R	PLEKHG2_uc010xuy.1_Missense_Mutation_p.G549R|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Missense_Mutation_p.G386R	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	608					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GGATGAACGGGGGCCTTCCCC	0.587																0.363636	174.566612	177.26113	60	105	KEEP	---	---	---	---	27	34	46	61	-1	capture	Missense_Mutation	SNP	39913516	39913516	PLEKHG2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11972	218
C5AR1	728	broad.mit.edu	37	19	47823297	47823297	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47823297C>T	uc002pgj.1	+	2	312	c.263C>T	c.(262-264)GCG>GTG	p.A88V		NM_001736	NP_001727	P21730	C5AR_HUMAN	complement component 5 receptor 1	88	Helical; Name=2; (Potential).				activation of MAPK activity|activation of phospholipase C activity|cellular defense response|elevation of cytosolic calcium ion concentration|immune response|sensory perception of chemical stimulus	integral to plasma membrane	C5a anaphylatoxin receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		TCCTGCCTGGCGCTGCCCATC	0.602																0.273543	150.672443	160.981961	61	162	KEEP	---	---	---	---	36	32	91	86	-1	capture	Missense_Mutation	SNP	47823297	47823297	C5AR1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2259	218
SHANK1	50944	broad.mit.edu	37	19	51205832	51205832	+	Missense_Mutation	SNP	G	A	A	rs148526987		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51205832G>A	uc002psx.1	-	11	1658	c.1639C>T	c.(1639-1641)CGG>TGG	p.R547W		NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	547					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		AGCTTCCTCCGCCTCCCGCGG	0.711																0.340909	32.044299	33.013145	15	29	KEEP	---	---	---	---	7	10	24	25	-1	capture	Missense_Mutation	SNP	51205832	51205832	SHANK1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	14157	218
CD33	945	broad.mit.edu	37	19	51729289	51729289	+	Missense_Mutation	SNP	G	A	A	rs150408980	byFrequency	TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51729289G>A	uc002pwa.2	+	3	689	c.649G>A	c.(649-651)GCT>ACT	p.A217T	CD33_uc010eos.1_Missense_Mutation_p.A217T|CD33_uc010eot.1_Missense_Mutation_p.A90T|CD33_uc010eou.1_RNA	NM_001772	NP_001763	P20138	CD33_HUMAN	CD33 antigen isoform 1 precursor	217	Extracellular (Potential).|Ig-like C2-type.				cell adhesion|cell-cell signaling|negative regulation of cell proliferation	external side of plasma membrane|integral to plasma membrane	receptor activity|sugar binding				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	GGTGAAGTTCGCTGGAGCTGG	0.622																0.29878	123.696757	129.640998	49	115	KEEP	---	---	---	---	21	32	56	67	-1	capture	Missense_Mutation	SNP	51729289	51729289	CD33	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2976	218
PEG3	5178	broad.mit.edu	37	19	57326473	57326473	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57326473C>T	uc002qnu.2	-	7	3688	c.3337G>A	c.(3337-3339)GGC>AGC	p.G1113S	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.G1084S|PEG3_uc002qnv.2_Missense_Mutation_p.G1113S|PEG3_uc002qnw.2_Missense_Mutation_p.G989S|PEG3_uc002qnx.2_Missense_Mutation_p.G987S|PEG3_uc010etr.2_Missense_Mutation_p.G1113S	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1113	C2H2-type 6.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AAGCCCAGGCCACAGTCCTCA	0.488																0.251685	278.231569	303.206675	112	333	KEEP	---	---	---	---	53	65	182	172	-1	capture	Missense_Mutation	SNP	57326473	57326473	PEG3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11623	218
ZNF543	125919	broad.mit.edu	37	19	57839653	57839653	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57839653C>T	uc002qoi.1	+	4	1168	c.823C>T	c.(823-825)CGG>TGG	p.R275W		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	275	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ACGGCACCAGCGGATTCACAG	0.527																0.279762	120.256593	127.582094	47	121	KEEP	---	---	---	---	22	31	67	64	-1	capture	Missense_Mutation	SNP	57839653	57839653	ZNF543	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17855	218
USP39	10713	broad.mit.edu	37	2	85863233	85863233	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85863233G>A	uc002sqe.2	+	7	1043	c.1007G>A	c.(1006-1008)GGC>GAC	p.G336D	USP39_uc002sqb.2_Missense_Mutation_p.G67D|USP39_uc010ysu.1_Missense_Mutation_p.G258D|USP39_uc010ysv.1_Missense_Mutation_p.G233D|USP39_uc010fgn.1_Missense_Mutation_p.G336D|USP39_uc002sqf.2_Missense_Mutation_p.G336D|USP39_uc002sqg.2_Missense_Mutation_p.G336D|USP39_uc010fgo.2_Missense_Mutation_p.G336D	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39	336					spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						GCTCTGGGGGGCACAAAGAAG	0.348																0.014458	-103.123134	8.178729	6	409	KEEP	---	---	---	---	2	6	212	243	-1	capture	Missense_Mutation	SNP	85863233	85863233	USP39	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16952	218
TTN	7273	broad.mit.edu	37	2	179631234	179631234	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179631234G>A	uc010zfg.1	-	41	9801	c.9577C>T	c.(9577-9579)CGA>TGA	p.R3193*	TTN_uc010zfh.1_Nonsense_Mutation_p.R3147*|TTN_uc010zfi.1_Nonsense_Mutation_p.R3147*|TTN_uc010zfj.1_Nonsense_Mutation_p.R3147*|TTN_uc002umz.1_5'Flank|TTN_uc002unb.2_Nonsense_Mutation_p.R3193*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	3193							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTTGTGTCGTTCTTGAACT	0.423					8722											0.415094	259.462724	260.796684	88	124	KEEP	---	---	---	---	44	46	61	69	-1	capture	Nonsense_Mutation	SNP	179631234	179631234	TTN	2	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	16617	218
RSPO4	343637	broad.mit.edu	37	20	948682	948682	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:948682C>T	uc002wej.2	-	2	276	c.179G>A	c.(178-180)CGG>CAG	p.R60Q	RSPO4_uc002wek.2_Missense_Mutation_p.R60Q	NM_001029871	NP_001025042	Q2I0M5	RSPO4_HUMAN	R-spondin family, member 4 isoform 1 precursor	60					Wnt receptor signaling pathway	extracellular region	heparin binding				0						GATGCCTTCCCGGCGGATGAA	0.622																0.030864	-30.242736	8.809816	5	157	KEEP	---	---	---	---	4	3	106	94	-1	capture	Missense_Mutation	SNP	948682	948682	RSPO4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13604	218
PROKR2	128674	broad.mit.edu	37	20	5283318	5283318	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5283318C>T	uc010zqw.1	-	2	523	c.523G>A	c.(523-525)GCC>ACC	p.A175T	PROKR2_uc010zqx.1_Missense_Mutation_p.A175T|PROKR2_uc010zqy.1_Missense_Mutation_p.A175T	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	175	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CAGACCAAGGCGATCAGGAAG	0.493													HNSCC(71;0.22)			0.349481	275.884699	281.663359	101	188	KEEP	---	---	---	---	64	49	122	96	-1	capture	Missense_Mutation	SNP	5283318	5283318	PROKR2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12449	218
PROKR2	128674	broad.mit.edu	37	20	5294853	5294853	+	Missense_Mutation	SNP	C	T	T	rs146963803	by1000genomes	TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5294853C>T	uc010zqw.1	-	1	163	c.163G>A	c.(163-165)GTC>ATC	p.V55I	PROKR2_uc010zqx.1_Missense_Mutation_p.V55I|PROKR2_uc010zqy.1_Missense_Mutation_p.V55I|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	55	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						ATGCCAATGACGATCTTGGCT	0.517													HNSCC(71;0.22)			0.398876	201.682525	203.2762	71	107	KEEP	---	---	---	---	38	39	57	60	-1	capture	Missense_Mutation	SNP	5294853	5294853	PROKR2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12449	218
PCSK2	5126	broad.mit.edu	37	20	17434533	17434533	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:17434533C>T	uc002wpm.2	+	9	1352	c.1032C>T	c.(1030-1032)GAC>GAT	p.D344D	PCSK2_uc002wpl.2_Silent_p.D325D|PCSK2_uc010zrm.1_Silent_p.D309D	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	344	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CCCTGTACGACGAGAGCTGCT	0.597																0.428571	177.879336	178.501363	60	80	KEEP	---	---	---	---	23	46	47	48	-1	capture	Silent	SNP	17434533	17434533	PCSK2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11504	218
TPTE	7179	broad.mit.edu	37	21	10951332	10951332	+	Missense_Mutation	SNP	C	T	T	rs113140892	byFrequency	TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10951332C>T	uc002yip.1	-	10	748	c.380G>A	c.(379-381)CGT>CAT	p.R127H	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.R109H|TPTE_uc002yir.1_Missense_Mutation_p.R89H|TPTE_uc010gkv.1_5'UTR	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	127					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AGAAATAGAACGATACTCCAA	0.338																0.164	74.716309	101.524909	41	209	KEEP	---	---	---	---	24	22	107	139	-1	capture	Missense_Mutation	SNP	10951332	10951332	TPTE	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16313	218
ITGB2	3689	broad.mit.edu	37	21	46320316	46320316	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46320316G>A	uc002zgd.2	-	6	860	c.816C>T	c.(814-816)GAC>GAT	p.D272D	ITGB2_uc002zge.2_Silent_p.D272D|ITGB2_uc002zgf.3_Silent_p.D272D|ITGB2_uc011afl.1_Silent_p.D194D|ITGB2_uc010gpw.2_Silent_p.D215D|ITGB2_uc002zgg.2_Silent_p.D272D	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	272	Extracellular (Potential).|VWFA.				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	CCAGCTTCCCGTCGCCCGCGA	0.632																0.427481	152.876569	153.476854	56	75	KEEP	---	---	---	---	31	26	33	50	-1	capture	Silent	SNP	46320316	46320316	ITGB2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7817	218
ZNF280B	140883	broad.mit.edu	37	22	22842526	22842526	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22842526C>T	uc002zwc.1	-	4	1974	c.1198G>A	c.(1198-1200)GAA>AAA	p.E400K	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	400					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TAGGGCATTTCGCCAGGCTTA	0.433																0.021277	-62.004364	10.270491	6	276	KEEP	---	---	---	---	18	6	134	157	-1	capture	Missense_Mutation	SNP	22842526	22842526	ZNF280B	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17695	218
ZNF280A	129025	broad.mit.edu	37	22	22868784	22868784	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22868784C>T	uc002zwe.2	-	2	1424	c.1171G>A	c.(1171-1173)GAA>AAA	p.E391K	LOC96610_uc011aim.1_Intron	NM_080740	NP_542778	P59817	Z280A_HUMAN	zinc finger protein 280A	391					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TAGGGCATTTCGCCAGGCTTA	0.453																0.222222	99.092481	113.15374	44	154	KEEP	---	---	---	---	53	75	60	105	-1	capture	Missense_Mutation	SNP	22868784	22868784	ZNF280A	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17694	218
AP1B1	162	broad.mit.edu	37	22	29754763	29754763	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29754763C>A	uc003afj.2	-	5	661	c.477G>T	c.(475-477)CAG>CAT	p.Q159H	AP1B1_uc003afi.2_Missense_Mutation_p.Q159H|AP1B1_uc003afk.2_Missense_Mutation_p.Q159H|AP1B1_uc003afl.2_Missense_Mutation_p.Q159H	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	159					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						CCAGGAAGCCCTGGTCCTCCA	0.597																0.021622	-40.473694	6.842721	4	181	KEEP	---	---	---	---	2	2	86	101	0.5	capture	Missense_Mutation	SNP	29754763	29754763	AP1B1	22	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	724	218
CPT1B	1375	broad.mit.edu	37	22	51008725	51008725	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51008725G>A	uc003bmk.3	-	16	2301	c.2139C>T	c.(2137-2139)GGC>GGT	p.G713G	CPT1B_uc003bml.2_Silent_p.G713G|CPT1B_uc003bmm.2_Silent_p.G713G|CPT1B_uc003bmo.2_Silent_p.G713G|CPT1B_uc011asa.1_Silent_p.G679G|CPT1B_uc003bmn.2_Silent_p.G713G|CPT1B_uc011asb.1_Silent_p.G632G|CHKB-CPT1B_uc003bmp.2_Silent_p.G508G|uc003bmr.1_5'Flank	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a	713	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity	p.G713G(1)		ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		CACTCACAGGGCCAAAGCCAC	0.652	Esophageal Squamous(170;988 1933 25577 30295 48163)															0.021739	-40.562503	6.359983	4	180	KEEP	---	---	---	---	1	6	101	103	-1	capture	Silent	SNP	51008725	51008725	CPT1B	22	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	3797	218
MKRN2	23609	broad.mit.edu	37	3	12616291	12616291	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:12616291A>G	uc003bxd.2	+	5	699	c.643A>G	c.(643-645)ATC>GTC	p.I215V	MKRN2_uc003bxe.2_Missense_Mutation_p.I213V|MKRN2_uc011aus.1_Missense_Mutation_p.I172V	NM_014160	NP_054879	Q9H000	MKRN2_HUMAN	makorin ring finger protein 2	215	Makorin-type Cys-His.					intracellular	ligase activity|nucleic acid binding|zinc ion binding				0						TGTGCTTCAGATCTGCATGTT	0.542																0.453271	338.143062	338.550528	97	117	KEEP	---	---	---	---	63	50	75	57	-1	capture	Missense_Mutation	SNP	12616291	12616291	MKRN2	3	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	9519	218
MST1R	4486	broad.mit.edu	37	3	49940348	49940348	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49940348A>T	uc003cxy.3	-	1	959	c.695T>A	c.(694-696)TTT>TAT	p.F232Y	MST1R_uc011bdd.1_Missense_Mutation_p.F232Y|MST1R_uc011bde.1_Missense_Mutation_p.F232Y|MST1R_uc011bdf.1_Missense_Mutation_p.F232Y|MST1R_uc011bdg.1_Missense_Mutation_p.F232Y	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor	232	Extracellular (Potential).|Sema.				cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CAACGCCACAAAGCCCGGTGC	0.577					205											0.454545	111.984941	112.143738	40	48	KEEP	---	---	---	---	18	24	17	33	-1	capture	Missense_Mutation	SNP	49940348	49940348	MST1R	3	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	9801	218
CACNA1D	776	broad.mit.edu	37	3	53837549	53837549	+	Nonsense_Mutation	SNP	T	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53837549T>G	uc003dgv.3	+	44	5698	c.5535T>G	c.(5533-5535)TAT>TAG	p.Y1845*	CACNA1D_uc003dgu.3_Nonsense_Mutation_p.Y1865*|CACNA1D_uc003dgy.3_Nonsense_Mutation_p.Y1821*|CACNA1D_uc003dgw.3_Nonsense_Mutation_p.Y1512*|CACNA1D_uc011bes.1_RNA	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1845	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	AGCAGGAGTATTTCAGTAGTG	0.597																0.480106	644.778148	644.906378	181	196	KEEP	---	---	---	---	90	119	100	124	-1	capture	Nonsense_Mutation	SNP	53837549	53837549	CACNA1D	3	T	G	G	G	1	0	0	0	0	0	1	0	0	673	52	5	4	2517	218
ACAD11	84129	broad.mit.edu	37	3	132360955	132360955	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132360955G>C	uc003eov.3	-	4	778	c.398C>G	c.(397-399)ACA>AGA	p.T133R	ACAD11_uc003eoy.2_Missense_Mutation_p.T133R	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	133						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						TCCAGGAATTGTTAAATCACG	0.378																0.354067	259.591515	263.514293	74	135	KEEP	---	---	---	---	49	40	71	78	-1	capture	Missense_Mutation	SNP	132360955	132360955	ACAD11	3	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	109	218
ABCG2	9429	broad.mit.edu	37	4	89053763	89053763	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89053763G>A	uc003hrg.2	-	3	721	c.228C>T	c.(226-228)AAC>AAT	p.N76N	ABCG2_uc003hrh.2_Silent_p.N76N|ABCG2_uc003hrf.2_5'Flank|ABCG2_uc003hri.1_Silent_p.N76N|ABCG2_uc003hrj.1_Silent_p.N76N|ABCG2_uc003hrk.1_Silent_p.N76N	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2	76	ABC transporter.|Cytoplasmic (Potential).				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	CCAGGATGGCGTTGAGACCAG	0.393																0.454545	283.795308	284.172049	95	114	KEEP	---	---	---	---	51	60	67	70	-1	capture	Silent	SNP	89053763	89053763	ABCG2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	69	218
UNC5C	8633	broad.mit.edu	37	4	96256705	96256705	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96256705G>C	uc003htp.1	-	2	356	c.202C>G	c.(202-204)CCT>GCT	p.P68A	UNC5C_uc010ilc.1_Missense_Mutation_p.P68A|UNC5C_uc003htq.2_Missense_Mutation_p.P68A	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	68	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GCTTCTTCAGGCTCAATAAGG	0.418																0.021127	-29.508411	6.919551	3	139	KEEP	---	---	---	---	2	1	77	73	-1	capture	Missense_Mutation	SNP	96256705	96256705	UNC5C	4	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	16875	218
PDHA2	5161	broad.mit.edu	37	4	96762205	96762205	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96762205C>T	uc003htr.3	+	1	967	c.904C>T	c.(904-906)CGA>TGA	p.R302*		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	302					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	TTATCGTACACGAGAAGAAAT	0.423																0.403974	181.04366	182.261325	61	90	KEEP	---	---	---	---	28	37	48	48	-1	capture	Nonsense_Mutation	SNP	96762205	96762205	PDHA2	4	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	11568	218
ADAD1	132612	broad.mit.edu	37	4	123317517	123317517	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123317517T>C	uc003ieo.2	+	7	941	c.709T>C	c.(709-711)TTT>CTT	p.F237L	ADAD1_uc003iep.2_Missense_Mutation_p.F237L|ADAD1_uc003ieq.2_Missense_Mutation_p.F219L	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1	237					multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						ATTGGCTGCTTTTATAATTGA	0.279																0.390728	216.499863	218.076529	59	92	KEEP	---	---	---	---	37	29	43	65	-1	capture	Missense_Mutation	SNP	123317517	123317517	ADAD1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	231	218
RASGRF2	5924	broad.mit.edu	37	5	80382758	80382758	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:80382758C>T	uc003kha.1	+	9	1376	c.1376C>T	c.(1375-1377)ACG>ATG	p.T459M	RASGRF2_uc011ctn.1_RNA|RASGRF2_uc003khb.1_Missense_Mutation_p.T287M	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	459					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ACCAGCCAAACGTTCATCCGC	0.532					847											0.391304	129.273972	130.455097	45	70	KEEP	---	---	---	---	26	30	28	51	-1	capture	Missense_Mutation	SNP	80382758	80382758	RASGRF2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12968	218
SLC22A5	6584	broad.mit.edu	37	5	131729923	131729923	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131729923G>T	uc003kww.3	+	10	1897	c.1633G>T	c.(1633-1635)GGT>TGT	p.G545C	SLC22A5_uc003kwx.3_Missense_Mutation_p.G569C	NM_003060	NP_003051	O76082	S22A5_HUMAN	solute carrier family 22 member 5	545					positive regulation of intestinal epithelial structure maintenance|quorum sensing involved in interaction with host|sodium ion transport|sodium-dependent organic cation transport	apical plasma membrane|brush border membrane|integral to membrane	ATP binding|carnitine transporter activity|PDZ domain binding|symporter activity				0		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	GTTAAAAGATGGTCAAGAAAG	0.393																0.426901	222.050866	222.847041	73	98	KEEP	---	---	---	---	41	42	55	58	0.493975903614	capture	Missense_Mutation	SNP	131729923	131729923	SLC22A5	5	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	14349	218
PCDHGB3	56102	broad.mit.edu	37	5	140751480	140751480	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140751480G>A	uc003ljw.1	+	1	1519	c.1519G>A	c.(1519-1521)GTG>ATG	p.V507M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.V507M|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	507	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACGTGTCCGTGAGCGCGCG	0.667																0.451613	161.275315	161.529007	56	68	KEEP	---	---	---	---	27	40	42	35	-1	capture	Missense_Mutation	SNP	140751480	140751480	PCDHGB3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11467	218
GRM6	2916	broad.mit.edu	37	5	178408768	178408768	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178408768C>T	uc003mjr.2	-	10	2703	c.2524G>A	c.(2524-2526)GTC>ATC	p.V842I	GRM6_uc003mjq.2_Missense_Mutation_p.V245I	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	842	Helical; Name=7; (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		AAGAGGATGACGTAGGTTTTG	0.587																0.515823	474.275368	474.342476	163	153	KEEP	---	---	---	---	85	86	70	90	-1	capture	Missense_Mutation	SNP	178408768	178408768	GRM6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6734	218
LRFN2	57497	broad.mit.edu	37	6	40359728	40359728	+	Missense_Mutation	SNP	C	T	T	rs146316351	byFrequency	TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:40359728C>T	uc003oph.1	-	3	2789	c.2324G>A	c.(2323-2325)CGG>CAG	p.R775Q		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	775	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					AAAAGTCCCCCGGGCCCCCAC	0.607																0.507692	210.045853	210.052449	66	64	KEEP	---	---	---	---	35	39	38	38	-1	capture	Missense_Mutation	SNP	40359728	40359728	LRFN2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8854	218
TTBK1	84630	broad.mit.edu	37	6	43222352	43222352	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43222352C>T	uc003ouq.1	+	6	818	c.539C>T	c.(538-540)GCC>GTC	p.A180V		NM_032538	NP_115927	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	180	Protein kinase.					cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TTCGGGCTGGCCCGGCAGTAC	0.652					85											0.029762	-32.5219	8.234934	5	163	KEEP	---	---	---	---	5	1	88	99	-1	capture	Missense_Mutation	SNP	43222352	43222352	TTBK1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16558	218
DEFB114	245928	broad.mit.edu	37	6	49928132	49928132	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49928132C>T	uc011dwp.1	-	2	83	c.83G>A	c.(82-84)CGT>CAT	p.R28H		NM_001037499	NP_001032588	Q30KQ6	DB114_HUMAN	beta-defensin 114 precursor	28					defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					TTTGGTGCAACGATCAGCATT	0.353																0.33871	120.811773	123.664138	42	82	KEEP	---	---	---	---	25	26	48	49	-1	capture	Missense_Mutation	SNP	49928132	49928132	DEFB114	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4361	218
SYNJ2	8871	broad.mit.edu	37	6	158483053	158483053	+	Silent	SNP	C	T	T	rs142499089		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158483053C>T	uc003qqx.1	+	8	1059	c.984C>T	c.(982-984)GGC>GGT	p.G328G	SYNJ2_uc011efm.1_Intron|SYNJ2_uc003qqw.1_Silent_p.G328G|SYNJ2_uc003qqy.1_Silent_p.G41G|SYNJ2_uc011efn.1_Intron|SYNJ2_uc010kjo.1_Silent_p.G277G|SYNJ2_uc003qqz.1_5'UTR	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	328	SAC.						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GCCACGCGGGCGACACGCCTA	0.388																0.851064	774.016002	807.646313	240	42	KEEP	---	---	---	---	135	149	22	29	-1	capture	Silent	SNP	158483053	158483053	SYNJ2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15341	218
CARD11	84433	broad.mit.edu	37	7	2953020	2953020	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2953020G>A	uc003smv.2	-	22	3324	c.2920C>T	c.(2920-2922)CGC>TGC	p.R974C		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	974	Guanylate kinase-like.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		ACGGGCCGGCGGCGCTCGCAG	0.652					1492	Mis		DLBCL								0.317949	181.882871	187.626689	62	133	KEEP	---	---	---	---	33	40	61	88	-1	capture	Missense_Mutation	SNP	2953020	2953020	CARD11	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2621	218
CCDC129	223075	broad.mit.edu	37	7	31682505	31682505	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31682505G>A	uc003tcj.1	+	11	2514	c.1521G>A	c.(1519-1521)CTG>CTA	p.L507L	CCDC129_uc011kad.1_Silent_p.L517L|CCDC129_uc003tci.1_Silent_p.L358L|CCDC129_uc011kae.1_Silent_p.L533L|CCDC129_uc003tck.1_Silent_p.L415L	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	507											0						AAGAGTTTCTGCTTGAGGCCA	0.532																0.296703	264.253813	277.711434	108	256	KEEP	---	---	---	---	60	54	132	138	-1	capture	Silent	SNP	31682505	31682505	CCDC129	7	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	2738	218
AEBP1	165	broad.mit.edu	37	7	44146386	44146386	+	Silent	SNP	G	A	A	rs144974496		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44146386G>A	uc003tkb.2	+	2	800	c.495G>A	c.(493-495)CCG>CCA	p.P165P		NM_001129	NP_001120	Q8IUX7	AEBP1_HUMAN	adipocyte enhancer binding protein 1 precursor	165	Pro-rich.				cell adhesion|muscle organ development|proteolysis|skeletal system development	cytoplasm|extracellular space|nucleus	DNA binding|metallocarboxypeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGAAGCCCCCGTCAGGGAAGA	0.652																0.397059	75.909673	76.540371	27	41	KEEP	---	---	---	---	9	21	23	29	-1	capture	Silent	SNP	44146386	44146386	AEBP1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	349	218
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	C	C	rs139236063		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>C	uc003tqk.2	+	15	2039	c.1793G>C	c.(1792-1794)GGA>GCA	p.G598A	EGFR_uc003tqi.2_Missense_Mutation_p.G598A|EGFR_uc003tqj.2_Missense_Mutation_p.G598A|EGFR_uc010kzg.1_Missense_Mutation_p.G553A|EGFR_uc011kco.1_Missense_Mutation_p.G545A|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.127368	227.034203	355.682887	121	829	KEEP	---	---	---	---	57	70	412	459	-1	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	218
EGFR	1956	broad.mit.edu	37	7	55268064	55268064	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55268064C>T	uc003tqk.2	+	24	3150	c.2904C>T	c.(2902-2904)TTC>TTT	p.F968F	EGFR_uc010kzg.1_Silent_p.F923F|EGFR_uc011kco.1_Silent_p.F915F	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	968	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.F968L(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCATCGAATTCTCCAAAATGG	0.478			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.654799	1472.39671	1486.056616	423	223	KEEP	---	---	---	---	377	396	115	112	-1	capture	Silent	SNP	55268064	55268064	EGFR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	4922	218
EGFR	1956	broad.mit.edu	37	7	55268067	55268067	+	Silent	SNP	C	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55268067C>G	uc003tqk.2	+	24	3153	c.2907C>G	c.(2905-2907)TCC>TCG	p.S969S	EGFR_uc010kzg.1_Silent_p.S924S|EGFR_uc011kco.1_Silent_p.S916S	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	969	Cytoplasmic (Potential).|Protein kinase.				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TCGAATTCTCCAAAATGGCCC	0.483			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.654519	1632.536679	1646.983152	449	237	KEEP	---	---	---	---	365	395	117	122	-1	capture	Silent	SNP	55268067	55268067	EGFR	7	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	4922	218
CALN1	83698	broad.mit.edu	37	7	71252855	71252855	+	Missense_Mutation	SNP	C	T	T	rs144352678	by1000genomes	TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71252855C>T	uc003twa.3	-	6	1092	c.565G>A	c.(565-567)GTC>ATC	p.V189I	CALN1_uc003twb.3_Missense_Mutation_p.V231I|CALN1_uc003twc.3_Missense_Mutation_p.V189I	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	189	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				CTCTTCCGGACGCAGGTCTGT	0.537																0.355556	177.739382	181.052384	64	116	KEEP	---	---	---	---	30	42	65	71	-1	capture	Missense_Mutation	SNP	71252855	71252855	CALN1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2567	218
SEMA3E	9723	broad.mit.edu	37	7	83032082	83032082	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:83032082G>A	uc003uhy.1	-	10	1475	c.1009C>T	c.(1009-1011)CGA>TGA	p.R337*		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	337	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				GCATGCCCTCGAAAAATATTA	0.403																0.272059	96.109816	102.483747	37	99	KEEP	---	---	---	---	22	17	61	47	-1	capture	Nonsense_Mutation	SNP	83032082	83032082	SEMA3E	7	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	13921	218
ABCB4	5244	broad.mit.edu	37	7	87074204	87074204	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87074204A>G	uc003uiv.1	-	10	1169	c.1093T>C	c.(1093-1095)TAT>CAT	p.Y365H	ABCB4_uc003uiw.1_Missense_Mutation_p.Y365H|ABCB4_uc003uix.1_Missense_Mutation_p.Y365H	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	365	Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					AAGATCACATATGCTGCTCCT	0.343																0.258065	78.263273	83.190956	24	69	KEEP	---	---	---	---	19	9	44	35	-1	capture	Missense_Mutation	SNP	87074204	87074204	ABCB4	7	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	43	218
COL1A2	1278	broad.mit.edu	37	7	94054949	94054949	+	Missense_Mutation	SNP	G	T	T	rs72659309		TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94054949G>T	uc003ung.1	+	43	3280	c.2809G>T	c.(2809-2811)GGT>TGT	p.G937C	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	937					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging	p.G937S(1)	COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTCCCCCAGGTCGCGATGG	0.478													HNSCC(75;0.22)			0.26506	172.133746	184.557687	66	183	KEEP	---	---	---	---	38	46	110	104	0.452380952381	capture	Missense_Mutation	SNP	94054949	94054949	COL1A2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	3643	218
CUX1	1523	broad.mit.edu	37	7	101926060	101926060	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:101926060C>T	uc003uyt.2	+	22	1978	c.1959C>T	c.(1957-1959)TGC>TGT	p.C653C	CUX1_uc011kkn.1_Silent_p.C614C|CUX1_uc003uyw.2_Silent_p.C607C|CUX1_uc003uyv.2_Silent_p.C637C|CUX1_uc003uyu.2_Silent_p.C651C|CUX1_uc003uyz.2_RNA|SH2B2_uc011kko.1_5'Flank	NM_001913	NP_001904	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform b	Error:Variant_position_missing_in_P39880_after_alignment					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						CCACCTTCTGCGCCAAGAAGT	0.662																0.142857	22.190142	34.231261	14	84	KEEP	---	---	---	---	12	6	49	50	-1	capture	Silent	SNP	101926060	101926060	CUX1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	4024	218
SVOPL	136306	broad.mit.edu	37	7	138305873	138305873	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138305873G>A	uc011kqh.1	-	13	1271	c.1271C>T	c.(1270-1272)CCC>CTC	p.P424L	SVOPL_uc003vue.2_Missense_Mutation_p.P272L	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1	424						integral to membrane	transmembrane transporter activity				0						CATCGTGGTGGGGTAGACCTG	0.587																0.269565	86.373609	91.883841	31	84	KEEP	---	---	---	---	15	20	49	51	-1	capture	Missense_Mutation	SNP	138305873	138305873	SVOPL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15312	218
EPPK1	83481	broad.mit.edu	37	8	144940353	144940353	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940353C>T	uc003zaa.1	-	2	15092	c.15079G>A	c.(15079-15081)GTG>ATG	p.V5027M		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	5027	Plectin 64.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCACGGGCACGCGGTGGCTG	0.692																0.074597	-16.305765	75.754451	37	459	KEEP	---	---	---	---	29	25	317	333	-1	capture	Missense_Mutation	SNP	144940353	144940353	EPPK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5145	218
MAGEB1	4112	broad.mit.edu	37	X	30268850	30268850	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30268850C>T	uc004dcc.2	+	4	560	c.240C>T	c.(238-240)GAC>GAT	p.D80D	MAGEB1_uc004dcd.2_Silent_p.D80D|MAGEB1_uc004dce.2_Silent_p.D80D	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	80											0						CCGAATCTGACGAAGGTGCCA	0.557																0.089286	1.430313	10.972246	5	51	KEEP	---	---	---	---	1	4	30	35	-1	capture	Silent	SNP	30268850	30268850	MAGEB1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9086	218
ZNF157	7712	broad.mit.edu	37	X	47272323	47272323	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47272323G>A	uc004dhr.1	+	4	920	c.851G>A	c.(850-852)CGT>CAT	p.R284H		NM_003446	NP_003437	P51786	ZN157_HUMAN	zinc finger protein 157	284	C2H2-type 5.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AAAACATTTCGTGTAAAGATA	0.443																0.43038	101.637364	101.971314	34	45	KEEP	---	---	---	---	15	21	18	29	-1	capture	Missense_Mutation	SNP	47272323	47272323	ZNF157	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17617	218
SUV39H1	6839	broad.mit.edu	37	X	48564987	48564987	+	Silent	SNP	C	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48564987C>T	uc004dkn.2	+	5	1119	c.1074C>T	c.(1072-1074)GGC>GGT	p.G358G	SUV39H1_uc011mmf.1_Silent_p.G369G|SUV39H1_uc011mmg.1_RNA	NM_003173	NP_003164	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1	358	Mediates interaction with MECOM (By similarity).|SET.				cell cycle|cell differentiation|chromatin silencing at rDNA|interspecies interaction between organisms|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|chromosome, centromeric region|condensed nuclear chromosome|rDNA heterochromatin	chromatin binding|histone methyltransferase activity (H3-K9 specific)|protein N-terminus binding|zinc ion binding				0						TCCGGGCAGGCGAGGAGCTCA	0.592																0.473684	52.046078	52.068975	18	20	KEEP	---	---	---	---	7	12	9	13	-1	capture	Silent	SNP	48564987	48564987	SUV39H1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15300	218
ZC3H12B	340554	broad.mit.edu	37	X	64722205	64722205	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64722205C>A	uc010nko.2	+	5	1603	c.1594C>A	c.(1594-1596)CAT>AAT	p.H532N		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	532							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CATGGGGGACCATGGCTACTA	0.478																0.474359	225.73111	225.820958	74	82	KEEP	---	---	---	---	36	42	38	46	0.538461538462	capture	Missense_Mutation	SNP	64722205	64722205	ZC3H12B	23	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	17442	218
GPR174	84636	broad.mit.edu	37	X	78427065	78427065	+	Silent	SNP	C	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:78427065C>A	uc004edg.1	+	1	597	c.561C>A	c.(559-561)ACC>ACA	p.T187T		NM_032553	NP_115942	Q9BXC1	GP174_HUMAN	putative purinergic receptor FKSG79	187	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)|central_nervous_system(1)	2						TTATGATGACCATTGGCGAGT	0.458													HNSCC(63;0.18)			0.466102	340.524069	340.760754	110	126	KEEP	---	---	---	---	58	61	69	69	0.512605042017	capture	Silent	SNP	78427065	78427065	GPR174	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	6606	218
BRWD3	254065	broad.mit.edu	37	X	79960260	79960260	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79960260G>A	uc004edt.2	-	23	2901	c.2638C>T	c.(2638-2640)CGT>TGT	p.R880C	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.R476C|BRWD3_uc004edp.2_Missense_Mutation_p.R709C|BRWD3_uc004edq.2_Missense_Mutation_p.R476C|BRWD3_uc010nmj.1_Missense_Mutation_p.R476C|BRWD3_uc004edr.2_Missense_Mutation_p.R550C|BRWD3_uc004eds.2_Missense_Mutation_p.R476C|BRWD3_uc004edu.2_Missense_Mutation_p.R550C|BRWD3_uc004edv.2_Missense_Mutation_p.R476C|BRWD3_uc004edw.2_Missense_Mutation_p.R476C|BRWD3_uc004edx.2_Missense_Mutation_p.R476C|BRWD3_uc004edy.2_Missense_Mutation_p.R476C|BRWD3_uc004edz.2_Missense_Mutation_p.R550C|BRWD3_uc004eea.2_Missense_Mutation_p.R550C|BRWD3_uc004eeb.2_Missense_Mutation_p.R476C	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	880										ovary(4)	4						CATATTTTACGTGTTGTCTGT	0.368																0.320917	307.676652	317.619292	112	237	KEEP	---	---	---	---	49	69	131	116	-1	capture	Missense_Mutation	SNP	79960260	79960260	BRWD3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1514	218
NRK	203447	broad.mit.edu	37	X	105156744	105156744	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105156744T>G	uc004emd.2	+	14	2649	c.2346T>G	c.(2344-2346)ATT>ATG	p.I782M	NRK_uc010npc.1_Missense_Mutation_p.I450M	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	782							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CTAAAAAAATTGAGGTAAATT	0.249					430								HNSCC(51;0.14)			0.4375	26.724021	26.778288	7	9	KEEP	---	---	---	---	5	7	6	5	-1	capture	Missense_Mutation	SNP	105156744	105156744	NRK	23	T	G	G	G	1	0	0	0	0	1	0	0	0	809	63	4	4	10562	218
MTMR1	8776	broad.mit.edu	37	X	149898608	149898608	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149898608A>G	uc004fei.2	+	6	694	c.559A>G	c.(559-561)AAA>GAA	p.K187E	MTMR1_uc011mya.1_Missense_Mutation_p.K93E|MTMR1_uc004feg.1_Missense_Mutation_p.K187E|MTMR1_uc004feh.1_Missense_Mutation_p.K195E|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_RNA	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	187						plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GCTTGCTTATAAACAGGAAGA	0.383																0.464516	255.532837	255.695682	72	83	KEEP	---	---	---	---	40	41	44	50	-1	capture	Missense_Mutation	SNP	149898608	149898608	MTMR1	23	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	9848	218
PLXNB3	5365	broad.mit.edu	37	X	153032873	153032873	+	Silent	SNP	G	A	A			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153032873G>A	uc004fii.2	+	3	765	c.591G>A	c.(589-591)TCG>TCA	p.S197S	PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Intron|PLXNB3_uc010nuk.2_Silent_p.S220S|PLXNB3_uc011mzd.1_Intron	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	197	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAAGCTGTCGGCAGGGGTGC	0.716																0.352941	16.545941	16.869647	6	11	KEEP	---	---	---	---	5	2	10	8	-1	capture	Silent	SNP	153032873	153032873	PLXNB3	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	12028	218
AKR7A3	22977	broad.mit.edu	37	1	19611245	19611245	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19611245delG	uc001bbv.1	-	5	716	c.639delC	c.(637-639)GACfs	p.D213fs		NM_012067	NP_036199	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3	213					cellular aldehyde metabolic process	cytosol	aldo-keto reductase (NADP) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCATTCTTGTCCTCATACT	0.597																0.37			112	193		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	19611245	19611245	AKR7A3	1	G	-	-	-	1	0	1	0	1	0	0	0	0	620	48	5	5	476	218
PTEN	5728	broad.mit.edu	37	10	89717695	89717696	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717695_89717696insT	uc001kfb.2	+	8	1751_1752	c.720_721insT	c.(718-723)TACTTTfs	p.Y240fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	240_241	C2 tensin-type.		F -> S (in MCEPHAS).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.F241L(1)|p.G165_*404del(1)|p.?(1)|p.G165_K342del(1)|p.F241fs*1(1)|p.R234fs*9(1)|p.K237_Y240>N(1)|p.F241fs*17(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGTTCATGTACTTTGAGTTCCC	0.411			31	p.F241L(SNU449-Tumor)	264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.76			108	35		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	89717695	89717696	PTEN	10	-	T	T	T	1	0	1	1	0	0	0	0	0	259	20	5	5	12633	218
TAOK1	57551	broad.mit.edu	37	17	27778581	27778593	+	Frame_Shift_Del	DEL	CAGAGCAGGCAGC	-	-			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27778581_27778593delCAGAGCAGGCAGC	uc002hdz.1	+	2	209_221	c.15_27delCAGAGCAGGCAGC	c.(13-27)AACAGAGCAGGCAGCfs	p.N5fs	TAOK1_uc010wbe.1_Frame_Shift_Del_p.N5fs|TAOK1_uc010wbf.1_Frame_Shift_Del_p.N5fs	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	5_9					mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			CATCAACTAACAGAGCAGGCAGCCTGAAGGACC	0.460					290											0.35			35	65		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	27778581	27778593	TAOK1	17	CAGAGCAGGCAGC	-	-	-	1	0	1	0	1	0	0	0	0	220	17	5	5	15435	218
RNF168	165918	broad.mit.edu	37	3	196229875	196229876	+	Frame_Shift_Del	DEL	CG	-	-			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196229875_196229876delCG	uc003fwq.2	-	1	707_708	c.169_170delCG	c.(169-171)CGGfs	p.R57fs	RNF168_uc010iah.2_5'UTR	NM_152617	NP_689830	Q8IYW5	RN168_HUMAN	ring finger protein 168	57					double-strand break repair|histone H2A K63-linked ubiquitination|positive regulation of DNA repair|response to ionizing radiation	nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CGACGATACCCGGCGGCGACAG	0.545																0.27			46	124		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	196229875	196229876	RNF168	3	CG	-	-	-	1	0	1	0	1	0	0	0	0	299	23	5	5	13351	218
CHCHD2	51142	broad.mit.edu	37	7	56170668	56170670	+	In_Frame_Del	DEL	GCT	-	-			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56170668_56170670delGCT	uc003tsa.2	-	3	416_418	c.335_337delAGC	c.(334-339)CAGCCT>CCT	p.Q112del	PSPH_uc003trj.2_Intron	NM_016139	NP_057223	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain	112	CHCH.					mitochondrion					0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TAGAGGCAAGGCTGCTGCTGCTG	0.488																0.00			9	2138		---	---	---	---						capture_indel	In_Frame_Del	DEL	56170668	56170670	CHCHD2	7	GCT	-	-	-	1	0	1	0	1	0	0	0	0	546	42	5	5	3282	218
OR13C5	138799	broad.mit.edu	37	9	107361451	107361452	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107361451_107361452delGC	uc011lvp.1	-	1	243_244	c.243_244delGC	c.(241-246)ACGCTAfs	p.T81fs		NM_001004482	NP_001004482	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C,	81_82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4						AAGCTCACTAGCGTGGAGGGAA	0.510																0.09			8	82		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	107361451	107361452	OR13C5	9	GC	-	-	-	1	0	1	0	1	0	0	0	0	438	34	5	5	10841	218
DOCK11	139818	broad.mit.edu	37	X	117748723	117748723	+	Frame_Shift_Del	DEL	C	-	-			TCGA-28-5209-01	TCGA-28-5209-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117748723delC	uc004eqp.2	+	29	3228	c.3165delC	c.(3163-3165)AGCfs	p.S1055fs	DOCK11_uc004eqq.2_Frame_Shift_Del_p.S821fs	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1055					blood coagulation	cytosol	GTP binding			ovary(3)	3						CTGGATTCAGCCCCAAAGATC	0.343																0.72			124	48		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	117748723	117748723	DOCK11	23	C	-	-	-	1	0	1	0	1	0	0	0	0	337	26	5	5	4642	218
