Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GRHL3	57822	broad.mit.edu	37	1	24669384	24669384	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24669384G>A	uc001biy.2	+	11	1349	c.1303G>A	c.(1303-1305)GTC>ATC	p.V435I	GRHL3_uc001bix.2_Missense_Mutation_p.V430I|GRHL3_uc001biz.2_Missense_Mutation_p.V337I	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform	430					regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		CCCATCAGGCGTCAAGGGCTG	0.632																0.313953	139.147729	144.470358	54	118	KEEP	---	---	---	---	32	27	54	75	-1	capture	Missense_Mutation	SNP	24669384	24669384	GRHL3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6698	230
YTHDF2	51441	broad.mit.edu	37	1	29069013	29069013	+	Silent	SNP	G	A	A	rs11553689		TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:29069013G>A	uc001brc.2	+	4	728	c.231G>A	c.(229-231)ACG>ACA	p.T77T	YTHDF2_uc001brd.2_Silent_p.T74T|YTHDF2_uc010ofx.1_Silent_p.T27T|YTHDF2_uc001bre.2_Silent_p.T27T	NM_016258	NP_057342	Q9Y5A9	YTHD2_HUMAN	high glucose-regulated protein 8	77					humoral immune response					ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CTTGGTCTACGGGGGGTGACA	0.502																0.300448	183.551212	191.423915	67	156	KEEP	---	---	---	---	33	42	65	106	-1	capture	Silent	SNP	29069013	29069013	YTHDF2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17380	230
BRDT	676	broad.mit.edu	37	1	92445139	92445139	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92445139C>T	uc001dok.3	+	8	1461	c.1112C>T	c.(1111-1113)ACG>ATG	p.T371M	BRDT_uc001dol.3_Missense_Mutation_p.T371M|BRDT_uc010osz.1_Missense_Mutation_p.T375M|BRDT_uc009wdf.2_Missense_Mutation_p.T298M|BRDT_uc010ota.1_Missense_Mutation_p.T325M|BRDT_uc010otb.1_Missense_Mutation_p.T325M|BRDT_uc001dom.3_Missense_Mutation_p.T371M	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	371					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		GTTTTCGAAACGCATTTTTCA	0.318					576											0.347368	89.943024	91.898049	33	62	KEEP	---	---	---	---	21	16	26	45	-1	capture	Missense_Mutation	SNP	92445139	92445139	BRDT	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1496	230
APH1A	51107	broad.mit.edu	37	1	150241179	150241179	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150241179A>G	uc001ety.1	-	1	354	c.32T>C	c.(31-33)TTC>TCC	p.F11S	APH1A_uc010pbx.1_Missense_Mutation_p.F11S|APH1A_uc001etz.1_Missense_Mutation_p.F11S|APH1A_uc001eua.1_Missense_Mutation_p.F11S|APH1A_uc010pby.1_Missense_Mutation_p.F11S|APH1A_uc001eub.1_5'UTR|APH1A_uc010pbz.1_5'UTR	NM_001077628	NP_001071096	Q96BI3	APH1A_HUMAN	anterior pharynx defective 1 homolog A isoform	11	Helical; Name=1; (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding			ovary(1)|lung(1)	2	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAACGCGACGAAAGTGCAGCC	0.662																0.555556	17.575937	17.600113	5	4	KEEP	---	---	---	---	2	5	1	4	-1	capture	Missense_Mutation	SNP	150241179	150241179	APH1A	1	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	764	230
OR6N2	81442	broad.mit.edu	37	1	158746549	158746549	+	Missense_Mutation	SNP	G	A	A	rs144962739		TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158746549G>A	uc010pir.1	-	1	877	c.877C>T	c.(877-879)CGT>TGT	p.R293C		NM_001005278	NP_001005278	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_hematologic(112;0.0378)					TCCTTGTTACGAAGACTGTAG	0.418																0.30303	55.574627	57.860327	20	46	KEEP	---	---	---	---	7	14	15	42	-1	capture	Missense_Mutation	SNP	158746549	158746549	OR6N2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11111	230
GPR25	2848	broad.mit.edu	37	1	200842843	200842843	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:200842843G>A	uc001gvn.1	+	1	678	c.678G>A	c.(676-678)TCG>TCA	p.S226S		NM_005298	NP_005289	O00155	GPR25_HUMAN	G protein-coupled receptor 25	226	Cytoplasmic (Potential).					integral to plasma membrane				ovary(1)	1						GCCGCATCTCGCGCCGCCTGC	0.682																0.377778	47.091359	47.670538	17	28	KEEP	---	---	---	---	12	10	20	16	-1	capture	Silent	SNP	200842843	200842843	GPR25	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6617	230
DUSP10	11221	broad.mit.edu	37	1	221879666	221879666	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:221879666C>G	uc001hmy.1	-	3	1136	c.954G>C	c.(952-954)GAG>GAC	p.E318D	DUSP10_uc001hmx.1_5'UTR|DUSP10_uc001hmz.1_5'UTR	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	318					inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		GCTCAGCGTTCTCGATGTCAG	0.632																0.067485	-6.614026	24.969057	11	152	KEEP	---	---	---	---	10	2	87	88	-1	capture	Missense_Mutation	SNP	221879666	221879666	DUSP10	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	4765	230
RET	5979	broad.mit.edu	37	10	43606701	43606701	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:43606701A>T	uc001jal.2	+	7	1500	c.1310A>T	c.(1309-1311)AAC>ATC	p.N437I	RET_uc001jak.1_Missense_Mutation_p.N437I|RET_uc010qez.1_Missense_Mutation_p.N183I	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	437	Extracellular (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	AGTGGCATCAACGTCCAGTAC	0.582	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		1		536	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				0.492754	100.068707	100.071167	34	35	KEEP	---	---	---	---	15	23	21	17	-1	capture	Missense_Mutation	SNP	43606701	43606701	RET	10	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	13130	230
DNMBP	23268	broad.mit.edu	37	10	101716663	101716663	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:101716663G>A	uc001kqj.2	-	4	660	c.568C>T	c.(568-570)CGA>TGA	p.R190*	NCRNA00093_uc001kqk.1_RNA	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	190	SH3 3.				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		ATGCCTCTTCGGCCCTCTAAC	0.488																0.036364	-17.382895	8.251779	4	106	KEEP	---	---	---	---	1	4	36	86	-1	capture	Nonsense_Mutation	SNP	101716663	101716663	DNMBP	10	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	4630	230
ATHL1	80162	broad.mit.edu	37	11	294169	294169	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:294169C>T	uc010qvu.1	+	12	1896	c.1781C>T	c.(1780-1782)GCG>GTG	p.A594V	ATHL1_uc001lor.3_Missense_Mutation_p.A346V|ATHL1_uc001lou.3_Missense_Mutation_p.A169V|ATHL1_uc001lov.3_Missense_Mutation_p.A55V	NM_025092	NP_079368	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1	594					carbohydrate metabolic process		hydrolase activity, acting on glycosyl bonds			liver(1)|central_nervous_system(1)|skin(1)	3		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		TTCCTGCAGGCGGTGGTCTTC	0.652																0.353846	61.102191	62.327523	23	42	KEEP	---	---	---	---	12	18	26	27	-1	capture	Missense_Mutation	SNP	294169	294169	ATHL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1095	230
TNNT3	7140	broad.mit.edu	37	11	1956149	1956149	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1956149C>T	uc001luu.3	+	14	893	c.681C>T	c.(679-681)GAC>GAT	p.D227D	TNNT3_uc001lun.2_Silent_p.D123D|TNNT3_uc001luw.3_Silent_p.D219D|TNNT3_uc001luo.3_Silent_p.D219D|TNNT3_uc001lup.3_Silent_p.D225D|TNNT3_uc001luq.3_Silent_p.D219D|TNNT3_uc001lur.2_Silent_p.D219D|TNNT3_uc010qxf.1_Silent_p.D225D|TNNT3_uc010qxg.1_Silent_p.D159D	NM_006757	NP_006748	P45378	TNNT3_HUMAN	troponin T3, skeletal, fast isoform 1	238					muscle filament sliding|regulation of ATPase activity|regulation of striated muscle contraction|skeletal muscle contraction	cytosol|troponin complex	calcium-dependent protein binding|tropomyosin binding|troponin C binding|troponin I binding			ovary(1)	1		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		AGAAATATGACGTGAGTCCCG	0.617																0.042945	-22.625753	13.811783	7	156	KEEP	---	---	---	---	3	5	66	94	-1	capture	Silent	SNP	1956149	1956149	TNNT3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16215	230
SLC6A5	9152	broad.mit.edu	37	11	20648387	20648387	+	Missense_Mutation	SNP	C	T	T	rs146647574	byFrequency	TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20648387C>T	uc001mqd.2	+	8	1667	c.1394C>T	c.(1393-1395)ACG>ATG	p.T465M	SLC6A5_uc009yic.2_Missense_Mutation_p.T230M	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	465					synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	ACGGATGCCACGGTGGGCTTC	0.562																0.048544	-11.971374	10.306729	5	98	KEEP	---	---	---	---	3	3	40	72	-1	capture	Missense_Mutation	SNP	20648387	20648387	SLC6A5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14579	230
CHST1	8534	broad.mit.edu	37	11	45671489	45671489	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45671489C>T	uc001mys.1	-	4	1656	c.985G>A	c.(985-987)GCC>ACC	p.A329T		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	329	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		ATCCAGCGGGCCACGTGGCTG	0.632																0.317308	85.073346	88.14157	33	71	KEEP	---	---	---	---	27	12	31	54	-1	capture	Missense_Mutation	SNP	45671489	45671489	CHST1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3362	230
TCN1	6947	broad.mit.edu	37	11	59629106	59629106	+	Missense_Mutation	SNP	G	C	C	rs139772818	by1000genomes	TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59629106G>C	uc001noj.2	-	4	548	c.450C>G	c.(448-450)GAC>GAG	p.D150E		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	150					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGCCAAAACGTCCAGGCTGA	0.438																0.294118	47.609298	49.541303	15	36	KEEP	---	---	---	---	6	10	21	22	-1	capture	Missense_Mutation	SNP	59629106	59629106	TCN1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	15591	230
KDELC2	143888	broad.mit.edu	37	11	108352840	108352840	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:108352840G>C	uc001pkj.2	-	4	860	c.794C>G	c.(793-795)TCT>TGT	p.S265C	KDELC2_uc001pki.2_Missense_Mutation_p.S209C	NM_153705	NP_714916	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2 precursor	265						endoplasmic reticulum lumen				ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TGAATCCAGAGAGCCACACCA	0.453																0.357664	160.904371	163.362199	49	88	KEEP	---	---	---	---	28	31	41	61	-1	capture	Missense_Mutation	SNP	108352840	108352840	KDELC2	11	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	8040	230
AMICA1	120425	broad.mit.edu	37	11	118085599	118085599	+	Translation_Start_Site	SNP	A	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118085599A>T	uc001psk.2	-	2	157	c.-17T>A	c.(-19--15)ATTTG>ATATG		AMICA1_uc001psh.2_5'Flank|AMICA1_uc009yzw.1_5'Flank|AMICA1_uc001psi.2_5'Flank|AMICA1_uc001psj.2_Translation_Start_Site|AMICA1_uc010rxw.1_Intron|AMICA1_uc010rxx.1_Translation_Start_Site|AMICA1_uc001psl.1_5'Flank	NM_001098526	NP_001091996	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen						blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	cell junction|integral to membrane				ovary(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TCAACTTTCAAATCTTAAGAT	0.299																0.281553	69.827421	74.247423	29	74	KEEP	---	---	---	---	13	19	29	49	-1	capture	Translation_Start_Site	SNP	118085599	118085599	AMICA1	11	A	T	T	T	1	0	0	0	0	0	0	0	0	1	1	4	4	574	230
ALG10B	144245	broad.mit.edu	37	12	38714180	38714180	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:38714180G>A	uc001rln.3	+	3	726	c.587G>A	c.(586-588)TGT>TAT	p.C196Y	ALG10B_uc001rlo.3_Missense_Mutation_p.C166Y|ALG10B_uc010skk.1_Missense_Mutation_p.C136Y	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	196	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				GCTGTCTTCTGTGCAGGGAAT	0.398																0.23301	53.55345	60.2729	24	79	KEEP	---	---	---	---	13	12	42	52	-1	capture	Missense_Mutation	SNP	38714180	38714180	ALG10B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	512	230
MYO1A	4640	broad.mit.edu	37	12	57442017	57442017	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57442017G>A	uc001smw.3	-	2	334	c.91C>T	c.(91-93)CGC>TGC	p.R31C	MYO1A_uc010sqz.1_5'Flank|MYO1A_uc009zpd.2_Missense_Mutation_p.R31C	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	31	Myosin head-like.				sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						TTTTCATAGCGAAGCTGAAGA	0.542																0.484375	94.118901	94.132608	31	33	KEEP	---	---	---	---	19	20	16	23	-1	capture	Missense_Mutation	SNP	57442017	57442017	MYO1A	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9978	230
SLC17A8	246213	broad.mit.edu	37	12	100787226	100787226	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100787226G>A	uc010svi.1	+	4	866	c.553G>A	c.(553-555)GTC>ATC	p.V185I	SLC17A8_uc009ztx.2_Missense_Mutation_p.V185I	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	185	Helical; (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TTACGGATGCGTCATGTGTGT	0.448																0.480519	110.767609	110.793176	37	40	KEEP	---	---	---	---	15	25	29	21	-1	capture	Missense_Mutation	SNP	100787226	100787226	SLC17A8	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14316	230
CLEC14A	161198	broad.mit.edu	37	14	38724727	38724727	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38724727G>A	uc001wum.1	-	1	848	c.501C>T	c.(499-501)AAC>AAT	p.N167N		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	167	Extracellular (Potential).|C-type lectin.					integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		ACAGGTAGCCGTTGGCGCGCA	0.577																0.325	33.96018	35.047795	13	27	KEEP	---	---	---	---	6	9	14	19	-1	capture	Silent	SNP	38724727	38724727	CLEC14A	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3464	230
SOS2	6655	broad.mit.edu	37	14	50626273	50626273	+	Silent	SNP	T	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50626273T>C	uc001wxs.3	-	10	1826	c.1728A>G	c.(1726-1728)GTA>GTG	p.V576V	SOS2_uc010tql.1_Silent_p.V543V|SOS2_uc010tqm.1_RNA|SOS2_uc001wxt.2_Silent_p.V264V	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	576					apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					AGTCTTTTACTACAAAACGAT	0.333																0.307692	157.454017	162.589643	48	108	KEEP	---	---	---	---	21	34	52	67	-1	capture	Silent	SNP	50626273	50626273	SOS2	14	T	C	C	C	1	0	0	0	0	0	0	0	1	678	53	3	3	14829	230
C14orf145	145508	broad.mit.edu	37	14	81223256	81223256	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:81223256G>A	uc001xux.2	-	17	2764	c.2593C>T	c.(2593-2595)CGC>TGC	p.R865C	C14orf145_uc010asz.1_RNA	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	865						centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		GCTAACCAGCGATGTGGGTCA	0.289					1											0.305556	31.014077	32.226625	11	25	KEEP	---	---	---	---	7	4	15	13	-1	capture	Missense_Mutation	SNP	81223256	81223256	C14orf145	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1735	230
KIF26A	26153	broad.mit.edu	37	14	104639702	104639702	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104639702C>T	uc001yos.3	+	9	1719	c.1719C>T	c.(1717-1719)GCC>GCT	p.A573A		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	573	Kinesin-motor.				blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CACCCACGGCCGAGAAGGCGG	0.692																0.3	6.616251	6.976945	3	7	KEEP	---	---	---	---	1	2	3	4	-1	capture	Silent	SNP	104639702	104639702	KIF26A	14	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8216	230
SH3GL3	6457	broad.mit.edu	37	15	84237359	84237359	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:84237359C>T	uc002bjw.2	+	4	461	c.266C>T	c.(265-267)ACG>ATG	p.T89M	SH3GL3_uc010uot.1_Missense_Mutation_p.T89M|SH3GL3_uc002bjx.2_Missense_Mutation_p.T20M|SH3GL3_uc002bju.2_Missense_Mutation_p.T97M|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	89	BAR.				central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						TACCCGCAGACGGAAGGCTTG	0.507																0.276596	64.888195	69.063464	26	68	KEEP	---	---	---	---	12	15	43	41	-1	capture	Missense_Mutation	SNP	84237359	84237359	SH3GL3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14145	230
UNC45A	55898	broad.mit.edu	37	15	91483616	91483616	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91483616G>C	uc002bqg.2	+	6	940	c.600G>C	c.(598-600)TTG>TTC	p.L200F	UNC45A_uc002bqd.2_Missense_Mutation_p.L185F|UNC45A_uc010uqo.1_Missense_Mutation_p.L192F|UNC45A_uc010uqp.1_RNA|UNC45A_uc010uqq.1_Missense_Mutation_p.L200F	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	200					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TTCAGCTCTTGCAACGTTTAC	0.567																0.344828	132.76979	135.234228	40	76	KEEP	---	---	---	---	22	25	41	42	-1	capture	Missense_Mutation	SNP	91483616	91483616	UNC45A	15	G	C	C	C	1	0	0	0	0	1	0	0	0	594	46	4	4	16870	230
SEZ6L2	26470	broad.mit.edu	37	16	29884701	29884701	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29884701G>A	uc002duq.3	-	14	2588	c.2348C>T	c.(2347-2349)ACG>ATG	p.T783M	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.T713M|SEZ6L2_uc002dur.3_Missense_Mutation_p.T713M|SEZ6L2_uc002dus.3_Missense_Mutation_p.T669M|SEZ6L2_uc010vec.1_Missense_Mutation_p.T783M|SEZ6L2_uc010ved.1_Missense_Mutation_p.T739M	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	783	Sushi 5.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						CTTGTACAGCGTCTGGTAGCC	0.622																0.316327	80.317436	83.243412	31	67	KEEP	---	---	---	---	19	21	41	45	-1	capture	Missense_Mutation	SNP	29884701	29884701	SEZ6L2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14037	230
MYH1	4619	broad.mit.edu	37	17	10406199	10406199	+	Silent	SNP	C	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10406199C>A	uc002gmo.2	-	24	3061	c.2967G>T	c.(2965-2967)CTG>CTT	p.L989L	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	989	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TGGTTTCATCCAGACCCGCCA	0.507					585											0.351351	145.73138	148.62641	52	96	KEEP	---	---	---	---	38	20	48	71	0.344827586207	capture	Silent	SNP	10406199	10406199	MYH1	17	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	9939	230
SLFN13	146857	broad.mit.edu	37	17	33767745	33767745	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33767745G>A	uc002hjk.1	-	4	2893	c.2563C>T	c.(2563-2565)CGG>TGG	p.R855W	SLFN13_uc010wch.1_Missense_Mutation_p.R855W|SLFN13_uc002hjl.2_Missense_Mutation_p.R855W|SLFN13_uc010ctt.2_Missense_Mutation_p.R537W|SLFN13_uc002hjm.2_Missense_Mutation_p.R524W	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	855						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		GAGAATCGCCGGACACTGTCC	0.483																0.35461	149.842568	152.45464	50	91	KEEP	---	---	---	---	18	38	34	63	-1	capture	Missense_Mutation	SNP	33767745	33767745	SLFN13	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	14628	230
KRTAP1-3	81850	broad.mit.edu	37	17	39190659	39190659	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39190659C>T	uc002hvv.2	-	1	449	c.415G>A	c.(415-417)GCC>ACC	p.A139T		NM_030966	NP_112228	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	149						extracellular region|keratin filament	structural constituent of epidermis				0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GAGGCCTCGGCGTGGTGCAGC	0.652																0.428571	52.54558	52.73173	18	24	KEEP	---	---	---	---	14	5	17	14	-1	capture	Missense_Mutation	SNP	39190659	39190659	KRTAP1-3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8423	230
OR4D2	124538	broad.mit.edu	37	17	56247206	56247206	+	Nonsense_Mutation	SNP	C	T	T	rs148589207		TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56247206C>T	uc010wnp.1	+	1	190	c.190C>T	c.(190-192)CGA>TGA	p.R64*		NM_001004707	NP_001004707	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D,	64	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						CTTTCTGCTCCGAAACCTGGC	0.483																0.380645	174.577364	176.51612	59	96	KEEP	---	---	---	---	35	29	44	65	-1	capture	Nonsense_Mutation	SNP	56247206	56247206	OR4D2	17	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	10960	230
EPB41L3	23136	broad.mit.edu	37	18	5395100	5395100	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5395100A>G	uc002kmt.1	-	21	3205	c.3119T>C	c.(3118-3120)GTC>GCC	p.V1040A	EPB41L3_uc010wzh.1_Missense_Mutation_p.V871A|EPB41L3_uc002kmu.1_Missense_Mutation_p.V818A|EPB41L3_uc010dkq.1_Missense_Mutation_p.V709A|EPB41L3_uc002kms.1_Missense_Mutation_p.V275A|EPB41L3_uc010wze.1_Missense_Mutation_p.V345A|EPB41L3_uc010wzf.1_Missense_Mutation_p.V337A|EPB41L3_uc010wzg.1_Missense_Mutation_p.V312A|EPB41L3_uc010dkr.2_Missense_Mutation_p.V432A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1040	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CCCCGTGATGACTATTCGCTT	0.448																0.172414	18.203687	24.106076	10	48	KEEP	---	---	---	---	7	5	22	34	-1	capture	Missense_Mutation	SNP	5395100	5395100	EPB41L3	18	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	5109	230
MC5R	4161	broad.mit.edu	37	18	13826447	13826447	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:13826447C>T	uc010xaf.1	+	1	683	c.683C>T	c.(682-684)GCG>GTG	p.A228V		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	228	Cytoplasmic (Potential).			ALPGASSARQRTSM -> LCPGPALRGRGPAW (in Ref. 1).	G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						GCCAGCTCTGCGCGGCAGAGG	0.612																0.333333	300.538216	308.657517	110	220	KEEP	---	---	---	---	61	58	113	122	-1	capture	Missense_Mutation	SNP	13826447	13826447	MC5R	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9280	230
CDH19	28513	broad.mit.edu	37	18	64218345	64218345	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:64218345G>A	uc002lkc.1	-	5	899	c.761C>T	c.(760-762)CCT>CTT	p.P254L	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Missense_Mutation_p.P254L|CDH19_uc002lkd.2_Missense_Mutation_p.P254L	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	254	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				TTTAAATATAGGCTTATTGTC	0.294																0.470588	25.498305	25.51115	8	9	KEEP	---	---	---	---	3	6	7	3	-1	capture	Missense_Mutation	SNP	64218345	64218345	CDH19	18	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3075	230
NFIX	4784	broad.mit.edu	37	19	13189498	13189498	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13189498C>T	uc010xmx.1	+	7	1104	c.1051C>T	c.(1051-1053)CGC>TGC	p.R351C	NFIX_uc002mwd.2_Missense_Mutation_p.R343C|NFIX_uc002mwe.2_Missense_Mutation_p.R335C|NFIX_uc002mwf.2_Intron|NFIX_uc002mwg.1_Missense_Mutation_p.R342C			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	343					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			CAGCTCCCCGCGCATGGCTTT	0.642																0.333333	8.422834	8.643823	3	6	KEEP	---	---	---	---	2	1	3	4	-1	capture	Missense_Mutation	SNP	13189498	13189498	NFIX	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10281	230
CYP4F22	126410	broad.mit.edu	37	19	15648390	15648390	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15648390C>T	uc002nbh.3	+	6	633	c.466C>T	c.(466-468)CGT>TGT	p.R156C		NM_173483	NP_775754	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F,	156						endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2						GAGCCGGCACCGTCGCCTGCT	0.542																0.120482	12.705528	24.417485	10	73	KEEP	---	---	---	---	7	5	40	38	-1	capture	Missense_Mutation	SNP	15648390	15648390	CYP4F22	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4149	230
UPF1	5976	broad.mit.edu	37	19	18968250	18968250	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18968250G>A	uc002nkg.2	+	15	2398	c.2123G>A	c.(2122-2124)CGC>CAC	p.R708H	UPF1_uc002nkf.2_Missense_Mutation_p.R697H|UPF1_uc002nkh.2_5'Flank	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	708					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CGGCCCATCCGCCTGCAGGTC	0.642																0.290909	40.123035	42.251528	16	39	KEEP	---	---	---	---	8	9	25	21	-1	capture	Missense_Mutation	SNP	18968250	18968250	UPF1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16885	230
ZNF676	163223	broad.mit.edu	37	19	22363727	22363727	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22363727G>A	uc002nqs.1	-	3	1110	c.792C>T	c.(790-792)AGC>AGT	p.S264S		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	264	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GGGTTGAGACGCTACTAAATC	0.398																0.166667	9.519642	12.630113	5	25	KEEP	---	---	---	---	2	4	12	16	-1	capture	Silent	SNP	22363727	22363727	ZNF676	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	17961	230
FAM187B	148109	broad.mit.edu	37	19	35719014	35719014	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35719014G>A	uc002nyk.1	-	1	615	c.570C>T	c.(568-570)AGC>AGT	p.S190S		NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	190	Extracellular (Potential).					integral to membrane				ovary(2)	2						GCCGCAAGCGGCTAGACCACA	0.577																0.307692	42.184732	43.896765	16	36	KEEP	---	---	---	---	8	9	16	23	-1	capture	Silent	SNP	35719014	35719014	FAM187B	19	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5465	230
RYR1	6261	broad.mit.edu	37	19	39051893	39051893	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39051893C>T	uc002oit.2	+	90	12553	c.12423C>T	c.(12421-12423)AAC>AAT	p.N4141N	RYR1_uc002oiu.2_Silent_p.N4136N|RYR1_uc002oiv.1_Silent_p.N1050N	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	4141					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TCGGCTTCAACGTGGCGGTGC	0.592																0.297297	55.820633	58.539764	22	52	KEEP	---	---	---	---	7	22	24	48	-1	capture	Silent	SNP	39051893	39051893	RYR1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13660	230
CYP2B6	1555	broad.mit.edu	37	19	41512823	41512823	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41512823C>T	uc002opr.1	+	4	505	c.498C>T	c.(496-498)GAC>GAT	p.D166D	CYP2A7_uc002opo.2_Intron|CYP2B6_uc010xvu.1_Intron	NM_000767	NP_000758	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B,	166					cellular ketone metabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(20;0.00322)		Bupropion(DB01156)|Butalbital(DB00241)|Carbamazepine(DB00564)|Clopidogrel(DB00758)|Cyclophosphamide(DB00531)|Efavirenz(DB00625)|Ifosfamide(DB01181)|Memantine(DB01043)|Meperidine(DB00454)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicotine(DB00184)|Orphenadrine(DB01173)|Phenytoin(DB00252)|Propofol(DB00818)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Ticlopidine(DB00208)|Troleandomycin(DB01361)	CCCTCATGGACCCCACCTTCC	0.512					56											0.075	-1.00885	6.406517	3	37	KEEP	---	---	---	---	2	1	21	18	-1	capture	Silent	SNP	41512823	41512823	CYP2B6	19	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	4124	230
MYH14	79784	broad.mit.edu	37	19	50812362	50812362	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50812362G>A	uc002prr.1	+	40	5812	c.5765G>A	c.(5764-5766)CGT>CAT	p.R1922H	MYH14_uc010enu.1_Missense_Mutation_p.R1963H|MYH14_uc002prq.1_Missense_Mutation_p.R1930H|MYH14_uc010ycb.1_Missense_Mutation_p.R273H|MYH14_uc002prs.1_Missense_Mutation_p.R273H	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	1922	Potential.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		AGGCTGCAGCGTGAGCTGGAA	0.632																0.053191	-10.586242	9.216734	5	89	KEEP	---	---	---	---	4	2	47	59	-1	capture	Missense_Mutation	SNP	50812362	50812362	MYH14	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9943	230
ZNF135	7694	broad.mit.edu	37	19	58579130	58579130	+	Silent	SNP	C	T	T	rs141591921		TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58579130C>T	uc010yhq.1	+	5	1410	c.1314C>T	c.(1312-1314)ACC>ACT	p.T438T	ZNF135_uc002qre.2_Silent_p.T426T|ZNF135_uc002qrd.1_Intron|ZNF135_uc002qrf.2_Silent_p.T384T|ZNF135_uc002qrg.2_Silent_p.T396T|ZNF135_uc010yhr.1_Silent_p.T247T	NM_003436	NP_003427	B4DHH9	B4DHH9_HUMAN	zinc finger protein 135 isoform 2	438					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CACTCCTGACCGAGCATCGGA	0.547																0.204545	21.952368	25.514412	9	35	KEEP	---	---	---	---	5	4	16	22	-1	capture	Silent	SNP	58579130	58579130	ZNF135	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17605	230
APOB	338	broad.mit.edu	37	2	21233457	21233457	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21233457C>T	uc002red.2	-	26	6411	c.6283G>A	c.(6283-6285)GTA>ATA	p.V2095I		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2095	Heparin-binding.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TTTCTCTGTACGTTTTCCAGT	0.368																0.386364	47.527457	48.036729	17	27	KEEP	---	---	---	---	9	11	14	17	-1	capture	Missense_Mutation	SNP	21233457	21233457	APOB	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	778	230
TMEM150A	129303	broad.mit.edu	37	2	85828199	85828199	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85828199C>G	uc002spw.1	-	3	866	c.145G>C	c.(145-147)GCT>CCT	p.A49P	USP39_uc002sqb.2_5'Flank|TMEM150A_uc002spx.1_5'UTR|TMEM150A_uc002spz.1_Silent_p.L18L|TMEM150A_uc002sqa.1_5'UTR|TMEM150A_uc002spy.1_Missense_Mutation_p.A49P	NM_001031738	NP_001026908	Q86TG1	T150A_HUMAN	transmembrane protein 150A isoform 1	49	Extracellular (Potential).					integral to membrane|plasma membrane					0						CCTTGCTCAGCAGGGTCAGGA	0.642																0.055556	-3.722627	7.501033	3	51	KEEP	---	---	---	---	1	2	27	31	-1	capture	Missense_Mutation	SNP	85828199	85828199	TMEM150A	2	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	15951	230
BAZ2B	29994	broad.mit.edu	37	2	160241783	160241783	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:160241783T>C	uc002uao.2	-	23	3921	c.3569A>G	c.(3568-3570)CAA>CGA	p.Q1190R	BAZ2B_uc002uap.2_Missense_Mutation_p.Q1154R	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1190					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						AAGCTCAGTTTGTCCACAGTG	0.438																0.2	8.887582	10.56353	4	16	KEEP	---	---	---	---	2	2	4	12	-1	capture	Missense_Mutation	SNP	160241783	160241783	BAZ2B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	1321	230
UGT1A5	54579	broad.mit.edu	37	2	234621782	234621782	+	Missense_Mutation	SNP	C	T	T	rs41270755	byFrequency	TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234621782C>T	uc002vuw.2	+	1	145	c.145C>T	c.(145-147)CGG>TGG	p.R49W	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Missense_Mutation_p.R49W	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	49					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		GGAGGCCTTGCGGGACCTCCA	0.582																0.392857	61.935447	62.498934	22	34	KEEP	---	---	---	---	7	16	17	19	-1	capture	Missense_Mutation	SNP	234621782	234621782	UGT1A5	2	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	16830	230
RSPO4	343637	broad.mit.edu	37	20	944738	944738	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:944738G>A	uc002wej.2	-	4	532	c.435C>T	c.(433-435)GGC>GGT	p.G145G	RSPO4_uc002wek.2_Intron	NM_001029871	NP_001025042	Q2I0M5	RSPO4_HUMAN	R-spondin family, member 4 isoform 1 precursor	145	TSP type-1.				Wnt receptor signaling pathway	extracellular region	heparin binding				0						GGCTCCAGCCGCCCCAGGGAC	0.597																0.217391	20.156114	23.52272	10	36	KEEP	---	---	---	---	5	6	21	24	-1	capture	Silent	SNP	944738	944738	RSPO4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13604	230
FAM83C	128876	broad.mit.edu	37	20	33880014	33880014	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:33880014G>A	uc010zux.1	-	1	212	c.94C>T	c.(94-96)CGG>TGG	p.R32W	FAM83C_uc002xcb.1_5'UTR	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	32										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GAGCTCTCCCGCCACCACGGC	0.746																0.538462	20.631675	20.649511	7	6	KEEP	---	---	---	---	3	5	7	7	-1	capture	Missense_Mutation	SNP	33880014	33880014	FAM83C	20	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	5581	230
HNF4A	3172	broad.mit.edu	37	20	43052742	43052742	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43052742G>A	uc002xma.2	+	8	1066	c.977G>A	c.(976-978)CGC>CAC	p.R326H	HNF4A_uc002xlt.2_Missense_Mutation_p.R304H|HNF4A_uc002xlu.2_Missense_Mutation_p.R304H|HNF4A_uc002xlv.2_Missense_Mutation_p.R304H|HNF4A_uc002xly.2_Missense_Mutation_p.R326H|HNF4A_uc002xlz.2_Missense_Mutation_p.R326H|HNF4A_uc010ggq.2_Missense_Mutation_p.R319H	NM_000457	NP_000448	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4 alpha isoform b	326					blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ATCAACGACCGCCAGTATGAC	0.582	Colon(79;2 1269 8820 14841 52347)															0.307692	20.390297	21.247485	8	18	KEEP	---	---	---	---	7	4	10	12	-1	capture	Missense_Mutation	SNP	43052742	43052742	HNF4A	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7178	230
SEMG1	6406	broad.mit.edu	37	20	43837052	43837052	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43837052C>T	uc002xni.2	+	2	1171	c.1114C>T	c.(1114-1116)CGC>TGC	p.R372C	SEMG1_uc002xnj.2_Missense_Mutation_p.R312C|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Intron	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	372	58 AA repeat 2.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				TGTATCCCAACGCAGTATTTA	0.418																0.306452	52.101702	54.172844	19	43	KEEP	---	---	---	---	9	11	24	24	-1	capture	Missense_Mutation	SNP	43837052	43837052	SEMG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13937	230
CBR1	873	broad.mit.edu	37	21	37442646	37442646	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:37442646G>A	uc002yvb.1	+	1	362	c.233G>A	c.(232-234)CGC>CAC	p.R78H	uc011aea.1_RNA|SETD4_uc002yva.2_Intron|CBR1_uc010gmx.1_Missense_Mutation_p.R78H|CBR1_uc010gmy.1_Missense_Mutation_p.R78H	NM_001757	NP_001748	P16152	CBR1_HUMAN	carbonyl reductase 1	78					drug metabolic process|vitamin K metabolic process	cytoplasm	15-hydroxyprostaglandin dehydrogenase (NADP+) activity|carbonyl reductase (NADPH) activity|prostaglandin-E2 9-reductase activity|protein binding				0					Acetohexamide(DB00414)|Lubiprostone(DB01046)	GACTTCCTGCGCAAGGAGTAC	0.672																0.073171	-1.206547	6.47326	3	38	KEEP	---	---	---	---	2	3	25	18	-1	capture	Missense_Mutation	SNP	37442646	37442646	CBR1	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2684	230
RIPK4	54101	broad.mit.edu	37	21	43161157	43161157	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43161157G>A	uc002yzn.1	-	8	2244	c.2196C>T	c.(2194-2196)GAC>GAT	p.D732D		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	732						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						GCCCCTGCTCGTCGAACAGGT	0.692					268											0.15625	33.816382	48.177118	20	108	KEEP	---	---	---	---	10	13	51	69	-1	capture	Silent	SNP	43161157	43161157	RIPK4	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13275	230
C21orf58	54058	broad.mit.edu	37	21	47738114	47738114	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47738114C>A	uc002zjf.2	-	3	1255	c.121G>T	c.(121-123)GCC>TCC	p.A41S	C21orf58_uc002ziz.2_5'UTR|C21orf58_uc002zja.2_5'UTR|C21orf58_uc011afw.1_5'UTR|C21orf58_uc002zjc.2_5'UTR|C21orf58_uc011afx.1_5'UTR|C21orf58_uc010gqj.1_RNA|C21orf58_uc002zjg.1_RNA	NM_058180	NP_478060	P58505	CU058_HUMAN	hypothetical protein LOC54058	41										pancreas(1)	1	Breast(49;0.112)			Colorectal(79;0.239)		GCAGGGCGGGCCTTACCTCCT	0.652																0.302326	65.29255	68.308998	26	60	KEEP	---	---	---	---	13	15	30	38	0.535714285714	capture	Missense_Mutation	SNP	47738114	47738114	C21orf58	21	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	2110	230
DIP2A	23181	broad.mit.edu	37	21	47954567	47954567	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47954567C>T	uc002zjo.2	+	13	1792	c.1609C>T	c.(1609-1611)CGG>TGG	p.R537W	DIP2A_uc011afy.1_Missense_Mutation_p.R473W|DIP2A_uc011afz.1_Missense_Mutation_p.R533W|DIP2A_uc002zjl.2_Missense_Mutation_p.R537W|DIP2A_uc002zjm.2_Missense_Mutation_p.R537W|DIP2A_uc010gql.2_Missense_Mutation_p.R494W|DIP2A_uc002zjn.2_Missense_Mutation_p.R537W|DIP2A_uc002zjp.1_Missense_Mutation_p.R282W	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	537					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGCACAGTGCCGGGCTCTGAC	0.562																0.297297	28.211014	29.571027	11	26	KEEP	---	---	---	---	9	4	15	16	-1	capture	Missense_Mutation	SNP	47954567	47954567	DIP2A	21	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	4485	230
WDR82	80335	broad.mit.edu	37	3	52304745	52304745	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52304745C>G	uc003ddl.2	-	2	524	c.242G>C	c.(241-243)AGC>ACC	p.S81T	WDR82_uc003ddk.2_5'Flank|uc011bee.1_5'Flank|MIRLET7G_hsa-let-7g|MI0000433_5'Flank	NM_025222	NP_079498	Q6UXN9	WDR82_HUMAN	WD repeat domain 82	81					histone H3-K4 methylation	chromatin|PTW/PP1 phosphatase complex|Set1C/COMPASS complex	protein binding				0				BRCA - Breast invasive adenocarcinoma(193;2.67e-05)|Kidney(197;0.00198)|KIRC - Kidney renal clear cell carcinoma(197;0.00223)|OV - Ovarian serous cystadenocarcinoma(275;0.246)		TTTGTTAGAGCTGTAAACAAC	0.378																0.027027	-41.734862	13.090099	6	216	KEEP	---	---	---	---	4	3	111	135	-1	capture	Missense_Mutation	SNP	52304745	52304745	WDR82	3	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	17212	230
AADACL2	344752	broad.mit.edu	37	3	151475339	151475339	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151475339G>A	uc003ezc.2	+	5	1283	c.1163G>A	c.(1162-1164)AGG>AAG	p.R388K	AADACL2_uc010hvn.2_Missense_Mutation_p.R175K	NM_207365	NP_997248	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2 precursor	388						extracellular region|integral to membrane	carboxylesterase activity				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			CTAGGTCTTAGGATAAGAGAT	0.328																0.235294	19.784097	21.962044	8	26	KEEP	---	---	---	---	5	3	16	13	-1	capture	Missense_Mutation	SNP	151475339	151475339	AADACL2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11	230
PIK3CA	5290	broad.mit.edu	37	3	178952152	178952152	+	Nonstop_Mutation	SNP	A	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178952152A>G	uc003fjk.2	+	21	3364	c.3207A>G	c.(3205-3207)TGA>TGG	p.*1069W		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1069					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.*1069_*1069insWKDN*(3)|p.*1069fs*3(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CATTGAACTGAAAAGATAACT	0.393	Colon(199;1504 1750 3362 26421 31210 32040)		57	p.*1069W(IGROV1-Tumor)|p.*1069W(KYSE70-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.352941	20.54577	20.869614	6	11	KEEP	---	---	---	---	2	5	5	9	-1	capture	Nonstop_Mutation	SNP	178952152	178952152	PIK3CA	3	A	G	G	G	1	0	0	0	0	0	0	0	0	117	9	5	3	11816	230
GABRG1	2565	broad.mit.edu	37	4	46043099	46043099	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46043099C>T	uc003gxb.2	-	9	1456	c.1304G>A	c.(1303-1305)CGC>CAC	p.R435H		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	435	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TTTGGCAATGCGTATGTGTAT	0.403																0.411765	20.621395	20.737126	7	10	KEEP	---	---	---	---	4	4	7	3	-1	capture	Missense_Mutation	SNP	46043099	46043099	GABRG1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6113	230
FRYL	285527	broad.mit.edu	37	4	48536560	48536560	+	Splice_Site	SNP	A	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48536560A>C	uc003gyh.1	-	49	7310	c.6705_splice	c.e49+1	p.Q2235_splice	FRYL_uc003gyg.1_Splice_Site_p.Q931_splice|FRYL_uc003gyi.1_Splice_Site_p.Q1123_splice|FRYL_uc003gyj.1_Splice_Site_p.Q530_splice	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						gtggtcacTCACCTGTACATA	0.194																0.314286	34.913631	35.986995	11	24	KEEP	---	---	---	---	3	9	14	11	-1	capture	Splice_Site	SNP	48536560	48536560	FRYL	4	A	C	C	C	1	0	0	0	0	0	0	1	0	78	6	5	4	6007	230
UGT2B28	54490	broad.mit.edu	37	4	70160487	70160487	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70160487G>A	uc003hej.2	+	6	1552	c.1550G>A	c.(1549-1551)TGG>TAG	p.W517*	UGT2B28_uc010ihr.2_3'UTR	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	517	Helical; (Potential).				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	TTTTGTTTCTGGAAGTTTGCT	0.413																0.388889	21.320502	21.515355	7	11	KEEP	---	---	---	---	6	1	8	4	-1	capture	Nonsense_Mutation	SNP	70160487	70160487	UGT2B28	4	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	16842	230
ANKRD17	26057	broad.mit.edu	37	4	73959897	73959897	+	Silent	SNP	T	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:73959897T>C	uc003hgp.2	-	28	5343	c.5226A>G	c.(5224-5226)GGA>GGG	p.G1742G	ANKRD17_uc003hgo.2_Silent_p.G1629G|ANKRD17_uc003hgq.2_Silent_p.G1491G|ANKRD17_uc003hgr.2_Silent_p.G1741G	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1742	KH.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGCCTCCTCTTCCAATCACTC	0.333																0.314607	87.893443	90.601581	28	61	KEEP	---	---	---	---	11	21	31	37	-1	capture	Silent	SNP	73959897	73959897	ANKRD17	4	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	643	230
TRAM1L1	133022	broad.mit.edu	37	4	118005491	118005491	+	Missense_Mutation	SNP	T	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:118005491T>G	uc003ibv.3	-	1	1246	c.1059A>C	c.(1057-1059)GAA>GAC	p.E353D		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	353	Cytoplasmic (Potential).				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1						TATTTGAAGTTTCCACTCCCA	0.393																0.337017	198.23567	202.480416	61	120	KEEP	---	---	---	---	30	34	56	75	-1	capture	Missense_Mutation	SNP	118005491	118005491	TRAM1L1	4	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	16335	230
TKTL2	84076	broad.mit.edu	37	4	164394680	164394680	+	Silent	SNP	G	A	A	rs114941835	by1000genomes	TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:164394680G>A	uc003iqp.3	-	1	368	c.207C>T	c.(205-207)AAC>AAT	p.N69N		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	69						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TGAACCGGTCGTTGTCCGGGT	0.557																0.297297	29.010614	30.369896	11	26	KEEP	---	---	---	---	6	5	18	13	-1	capture	Silent	SNP	164394680	164394680	TKTL2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15821	230
IRX2	153572	broad.mit.edu	37	5	2749815	2749815	+	Silent	SNP	G	A	A	rs138413279	byFrequency;by1000genomes	TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:2749815G>A	uc003jda.2	-	2	578	c.336C>T	c.(334-336)CTC>CTT	p.L112L	C5orf38_uc003jdc.2_5'Flank|C5orf38_uc011cmg.1_5'Flank|C5orf38_uc011cmh.1_5'Flank|C5orf38_uc011cmi.1_5'Flank|C5orf38_uc011cmj.1_5'Flank|IRX2_uc003jdb.2_Silent_p.L112L	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	112	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		CGGGGTCGTTGAGCTGGTACG	0.682																0.25	42.513242	46.605625	18	54	KEEP	---	---	---	---	9	9	34	22	-1	capture	Silent	SNP	2749815	2749815	IRX2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	7767	230
UGT3A2	167127	broad.mit.edu	37	5	36036029	36036029	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36036029G>A	uc003jjz.1	-	7	1436	c.1343C>T	c.(1342-1344)CCG>CTG	p.P448L	UGT3A2_uc011cos.1_Missense_Mutation_p.P414L|UGT3A2_uc011cot.1_Missense_Mutation_p.P146L	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	448	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGGGCTGAGCGGGTGGGAGCG	0.597																0.2	17.578337	20.926116	8	32	KEEP	---	---	---	---	11	2	21	17	-1	capture	Missense_Mutation	SNP	36036029	36036029	UGT3A2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16846	230
HCN1	348980	broad.mit.edu	37	5	45303809	45303809	+	Nonsense_Mutation	SNP	G	A	A	rs35229491		TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45303809G>A	uc003jok.2	-	6	1535	c.1510C>T	c.(1510-1512)CGA>TGA	p.R504*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	504	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GCTCCTTCTCGTATGATATAA	0.403																0.264151	34.720086	37.391454	14	39	KEEP	---	---	---	---	7	8	20	23	-1	capture	Nonsense_Mutation	SNP	45303809	45303809	HCN1	5	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	6922	230
P4HA2	8974	broad.mit.edu	37	5	131544873	131544873	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131544873C>T	uc003kwh.2	-	7	1425	c.861G>A	c.(859-861)AGG>AGA	p.R287R	P4HA2_uc003kwg.2_Silent_p.R287R|P4HA2_uc003kwi.2_Silent_p.R287R|P4HA2_uc003kwk.2_Silent_p.R287R|P4HA2_uc003kwl.2_Silent_p.R287R|P4HA2_uc003kwj.2_Silent_p.R287R	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	287						endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CGTAAACATCCCTCTCAGGCA	0.542	Esophageal Squamous(68;117 1135 17362 19256 34242)															0.283401	189.048465	199.459175	70	177	KEEP	---	---	---	---	36	45	86	111	-1	capture	Silent	SNP	131544873	131544873	P4HA2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	285	22	2	2	11261	230
PCDH12	51294	broad.mit.edu	37	5	141336339	141336339	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141336339G>C	uc003llx.2	-	1	2289	c.1078C>G	c.(1078-1080)CCA>GCA	p.P360A		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	360	Cadherin 4.|Extracellular (Potential).				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCAGTGATGGCTGGGAGGCC	0.507																0.283186	94.648053	99.421702	32	81	KEEP	---	---	---	---	21	14	47	46	-1	capture	Missense_Mutation	SNP	141336339	141336339	PCDH12	5	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	11413	230
PDE6A	5145	broad.mit.edu	37	5	149265912	149265912	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149265912G>A	uc003lrg.3	-	14	1874	c.1754C>T	c.(1753-1755)ACG>ATG	p.T585M		NM_000440	NP_000431	P16499	PDE6A_HUMAN	phosphodiesterase 6A	585					cytosolic calcium ion homeostasis|GMP metabolic process|platelet activation|signal transduction|visual perception	cytosol|plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CTCTAGGTCCGTGAAGTAGCG	0.532																0.217391	21.722792	25.112523	10	36	KEEP	---	---	---	---	5	5	25	16	-1	capture	Missense_Mutation	SNP	149265912	149265912	PDE6A	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11548	230
FAM71B	153745	broad.mit.edu	37	5	156590194	156590194	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156590194G>A	uc003lwn.2	-	2	1182	c.1082C>T	c.(1081-1083)GCG>GTG	p.A361V		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	361						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGCGGCCCCCGCCATCGAGGT	0.567																0.382979	45.412676	45.984227	18	29	KEEP	---	---	---	---	6	12	16	18	-1	capture	Missense_Mutation	SNP	156590194	156590194	FAM71B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5556	230
GABRB2	2561	broad.mit.edu	37	5	160721114	160721114	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160721114C>T	uc003lys.1	-	11	1731	c.1513G>A	c.(1513-1515)GTC>ATC	p.V505I	GABRB2_uc011deh.1_Missense_Mutation_p.V306I|GABRB2_uc003lyr.1_Missense_Mutation_p.V467I|GABRB2_uc003lyt.1_Missense_Mutation_p.V467I|GABRB2_uc010jiu.1_Missense_Mutation_p.V404I	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	505	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	AGCCAATAGACGATGTTGAAG	0.453																0.263158	36.497965	39.39067	15	42	KEEP	---	---	---	---	6	10	15	30	-1	capture	Missense_Mutation	SNP	160721114	160721114	GABRB2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6109	230
KIF13A	63971	broad.mit.edu	37	6	17779855	17779855	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17779855C>T	uc003ncg.3	-	32	4012	c.3907G>A	c.(3907-3909)GTA>ATA	p.V1303I	KIF13A_uc003ncf.2_Missense_Mutation_p.V1290I|KIF13A_uc003nch.3_Missense_Mutation_p.V1303I|KIF13A_uc003nci.3_Missense_Mutation_p.V1290I|KIF13A_uc003nce.1_5'Flank	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1303					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCATAGGTTACACCACAGGAA	0.229																0.063492	-5.635945	6.857585	4	59	KEEP	---	---	---	---	3	2	37	35	-1	capture	Missense_Mutation	SNP	17779855	17779855	KIF13A	6	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8196	230
DEF6	50619	broad.mit.edu	37	6	35280250	35280250	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35280250C>T	uc003okk.2	+	4	634	c.595C>T	c.(595-597)CGG>TGG	p.R199W	DEF6_uc010jvs.2_Missense_Mutation_p.R199W|DEF6_uc010jvt.2_Intron	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	199						cytoplasm|nucleus|plasma membrane					0						GGGCGTGGGCCGGGACACCCT	0.652																0.380282	79.63897	80.483064	27	44	KEEP	---	---	---	---	14	15	25	26	-1	capture	Missense_Mutation	SNP	35280250	35280250	DEF6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	4344	230
MOCS1	4337	broad.mit.edu	37	6	39877612	39877612	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39877612C>T	uc003opb.2	-	8	1207	c.1069G>A	c.(1069-1071)GCT>ACT	p.A357T	MOCS1_uc003opa.2_Missense_Mutation_p.A357T|MOCS1_uc003opc.2_Missense_Mutation_p.A357T|MOCS1_uc003opd.2_Missense_Mutation_p.A357T|MOCS1_uc003ope.2_Missense_Mutation_p.A270T	NM_005942	NP_005933	Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis-step 1 protein	357	Molybdenum cofactor biosynthesis protein A.				Mo-molybdopterin cofactor biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex|nucleus	4 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|catalytic activity|GTP binding|metal ion binding	p.A357V(1)		ovary(1)|liver(1)|central_nervous_system(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CCCACAGCAGCCCCAATGATT	0.622	NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)															0.33913	107.49959	110.126083	39	76	KEEP	---	---	---	---	15	27	33	48	-1	capture	Missense_Mutation	SNP	39877612	39877612	MOCS1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9602	230
KIAA1244	57221	broad.mit.edu	37	6	138531138	138531138	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138531138C>T	uc003qhu.2	+	4	311	c.311C>T	c.(310-312)ACG>ATG	p.T104M		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	104					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GTGAAAGTGACGCCTTCGCTC	0.502																0.430556	92.918543	93.220098	31	41	KEEP	---	---	---	---	17	16	24	20	-1	capture	Missense_Mutation	SNP	138531138	138531138	KIAA1244	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8139	230
IGF2R	3482	broad.mit.edu	37	6	160501272	160501272	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160501272A>G	uc003qta.2	+	39	5946	c.5798A>G	c.(5797-5799)TAC>TGC	p.Y1933C		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	1933	13.|Lumenal (Potential).|Fibronectin type-II.				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		ACTGCGGACTACGACAGAGAC	0.577																0.31	96.808173	100.012959	31	69	KEEP	---	---	---	---	16	15	41	36	-1	capture	Missense_Mutation	SNP	160501272	160501272	IGF2R	6	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	7501	230
SCIN	85477	broad.mit.edu	37	7	12683930	12683930	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:12683930C>T	uc003ssn.3	+	12	1959	c.1749C>T	c.(1747-1749)GGC>GGT	p.G583G	SCIN_uc010ktt.2_Intron|SCIN_uc003sso.3_Silent_p.G336G	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1	583	Ca(2+)-dependent actin binding.				actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TCCAAGAAGGCGAGGAGCCAG	0.448																0.318182	18.416036	19.063177	7	15	KEEP	---	---	---	---	3	5	11	6	-1	capture	Silent	SNP	12683930	12683930	SCIN	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13798	230
IKZF1	10320	broad.mit.edu	37	7	50467929	50467929	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50467929G>A	uc003tow.3	+	9	1332	c.1164G>A	c.(1162-1164)GCG>GCA	p.A388A	IKZF1_uc003tox.3_Silent_p.A346A|IKZF1_uc003toy.3_Silent_p.A346A|IKZF1_uc011kck.1_Silent_p.A301A|IKZF1_uc003toz.3_Silent_p.A358A|IKZF1_uc010kyx.2_Silent_p.A128A|IKZF1_uc003tpa.3_Silent_p.A130A	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	388					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				AGCGCGAGGCGTCCCCGAGCA	0.672				p.A388A(WM88-Tumor)	226	D		ALL								0.266667	10.293742	11.031098	4	11	KEEP	---	---	---	---	1	3	4	8	-1	capture	Silent	SNP	50467929	50467929	IKZF1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7537	230
EGFR	1956	broad.mit.edu	37	7	55221765	55221765	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221765A>G	uc003tqk.2	+	7	1055	c.809A>G	c.(808-810)TAC>TGC	p.Y270C	EGFR_uc003tqh.2_Missense_Mutation_p.Y270C|EGFR_uc003tqi.2_Missense_Mutation_p.Y270C|EGFR_uc003tqj.2_Missense_Mutation_p.Y270C|EGFR_uc010kzg.1_Missense_Mutation_p.Y225C|EGFR_uc011kco.1_Missense_Mutation_p.Y217C|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	270	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTCATGCTCTACAACCCCACC	0.587			8		608	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			0.068966	-13.364429	164.637313	64	864	KEEP	---	---	---	---	34	43	409	514	-1	capture	Missense_Mutation	SNP	55221765	55221765	EGFR	7	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	4922	230
AZGP1	563	broad.mit.edu	37	7	99565820	99565820	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99565820G>A	uc003ush.2	-	3	615	c.571C>T	c.(571-573)CGG>TGG	p.R191W		NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc	191					antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					AGGTATTTCCGCAGAGTCGCA	0.552																0.259542	84.894725	91.751357	34	97	KEEP	---	---	---	---	14	22	63	45	-1	capture	Missense_Mutation	SNP	99565820	99565820	AZGP1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	1229	230
OR6V1	346517	broad.mit.edu	37	7	142749461	142749461	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142749461C>T	uc011ksv.1	+	1	24	c.24C>T	c.(22-24)TCC>TCT	p.S8S		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					GCCAGCCCTCCGAATTTGTCC	0.408																0.284553	196.555057	206.801554	70	176	KEEP	---	---	---	---	41	34	86	114	-1	capture	Silent	SNP	142749461	142749461	OR6V1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11115	230
CNTNAP2	26047	broad.mit.edu	37	7	147259237	147259237	+	Silent	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147259237C>T	uc003weu.1	+	12	2301	c.1785C>T	c.(1783-1785)TAC>TAT	p.Y595Y		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	595	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TAGCTATCTACGAGCCTTCCT	0.448													HNSCC(39;0.1)			0.184211	14.300867	17.857243	7	31	KEEP	---	---	---	---	5	4	14	22	-1	capture	Silent	SNP	147259237	147259237	CNTNAP2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3612	230
SSPO	23145	broad.mit.edu	37	7	149489760	149489760	+	Missense_Mutation	SNP	A	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:149489760A>C	uc010lpk.2	+	39	5816	c.5816A>C	c.(5815-5817)AAC>ACC	p.N1939T		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1939	TSP type-1 3.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGCTCCAACAACCCCCGCCCC	0.692																0.153846	2.624869	7.165869	6	33	KEEP	---	---	---	---	5	7	21	27	-1	capture	Missense_Mutation	SNP	149489760	149489760	SSPO	7	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	15081	230
PRKDC	5591	broad.mit.edu	37	8	48805878	48805878	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:48805878G>A	uc003xqi.2	-	31	3725	c.3668C>T	c.(3667-3669)ACC>ATC	p.T1223I	PRKDC_uc003xqj.2_Missense_Mutation_p.T1223I|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	1223					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				CCCCTCAAAGGTGTTGATGAG	0.522	Esophageal Squamous(79;1091 1253 12329 31680 40677)				1566						NHEJ					0.291667	17.813819	18.747791	7	17	KEEP	---	---	---	---	2	5	11	12	-1	capture	Missense_Mutation	SNP	48805878	48805878	PRKDC	8	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	12417	230
PENK	5179	broad.mit.edu	37	8	57353950	57353950	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:57353950G>A	uc003xsz.2	-	2	766	c.685C>T	c.(685-687)CGG>TGG	p.R229W	PENK_uc003xta.3_Missense_Mutation_p.R229W	NM_006211	NP_006202	P01210	PENK_HUMAN	proenkephalin	229					neuropeptide signaling pathway	extracellular region	neuropeptide hormone activity|opioid peptide activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			CCTCCATACCGTTTCTGGTAG	0.517																0.311927	92.316158	95.745758	34	75	KEEP	---	---	---	---	19	19	35	49	-1	capture	Missense_Mutation	SNP	57353950	57353950	PENK	8	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	11630	230
OXR1	55074	broad.mit.edu	37	8	107722899	107722899	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:107722899G>T	uc011lht.1	+	9	1776	c.1677G>T	c.(1675-1677)TTG>TTT	p.L559F	OXR1_uc003ymf.2_Missense_Mutation_p.L558F|OXR1_uc011lhu.1_Missense_Mutation_p.L551F|OXR1_uc010mcg.2_Intron|OXR1_uc010mch.2_Missense_Mutation_p.L256F	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1	559					cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			ATAAGTTCTTGTGTCTCAGAG	0.358																0.1875	6.930602	8.382061	3	13	KEEP	---	---	---	---	1	2	9	5	0.333333333333	capture	Missense_Mutation	SNP	107722899	107722899	OXR1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	11238	230
ST3GAL1	6482	broad.mit.edu	37	8	134488106	134488106	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134488106G>C	uc003yuk.2	-	5	991	c.162C>G	c.(160-162)ATC>ATG	p.I54M	ST3GAL1_uc003yum.2_Missense_Mutation_p.I54M	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	54	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			GCCTGTGCTTGATCAGTCTCT	0.597																0.263158	46.299299	49.190434	15	42	KEEP	---	---	---	---	8	9	23	26	-1	capture	Missense_Mutation	SNP	134488106	134488106	ST3GAL1	8	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	15104	230
BNC2	54796	broad.mit.edu	37	9	16436735	16436735	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:16436735C>T	uc003zml.2	-	6	1597	c.1457G>A	c.(1456-1458)CGT>CAT	p.R486H	BNC2_uc011lmw.1_Missense_Mutation_p.R391H|BNC2_uc003zmm.2_Missense_Mutation_p.R444H|BNC2_uc003zmq.1_Missense_Mutation_p.R500H|BNC2_uc003zmr.1_Missense_Mutation_p.R523H|BNC2_uc003zmp.1_Missense_Mutation_p.R514H|BNC2_uc010mij.1_Missense_Mutation_p.R408H|BNC2_uc011lmv.1_Missense_Mutation_p.R312H|BNC2_uc003zmo.1_Missense_Mutation_p.R408H|BNC2_uc003zmj.2_Missense_Mutation_p.R251H|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Missense_Mutation_p.R251H|BNC2_uc003zmn.1_Missense_Mutation_p.R251H	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	486					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		GTGGCGATTACGACTTCGGAG	0.463																0.559633	188.081761	188.418759	61	48	KEEP	---	---	---	---	33	32	22	30	-1	capture	Missense_Mutation	SNP	16436735	16436735	BNC2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1463	230
C9orf64	84267	broad.mit.edu	37	9	86559803	86559803	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86559803A>T	uc004anb.2	-	3	947	c.699T>A	c.(697-699)AGT>AGA	p.S233R	C9orf64_uc004anc.2_Missense_Mutation_p.S92R	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267	233											0						ACATGGTGATACTGGAGATGT	0.428																0.305556	84.113975	87.769885	33	75	KEEP	---	---	---	---	10	25	31	47	-1	capture	Missense_Mutation	SNP	86559803	86559803	C9orf64	9	A	T	T	T	1	0	0	0	0	1	0	0	0	180	14	4	4	2465	230
HDHD3	81932	broad.mit.edu	37	9	116136378	116136378	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116136378G>A	uc004bhi.1	-	2	1041	c.257C>T	c.(256-258)GCG>GTG	p.A86V	HDHD3_uc004bhj.2_Missense_Mutation_p.A86V|HDHD3_uc004bhk.2_Missense_Mutation_p.A86V	NM_031219	NP_112496	Q9BSH5	HDHD3_HUMAN	haloacid dehalogenase-like hydrolase domain	86							phosphoglycolate phosphatase activity|protein binding				0						CTGGACACCCGCCAGGTGGAA	0.617																0.055556	-8.403268	10.305231	5	85	KEEP	---	---	---	---	4	3	43	57	-1	capture	Missense_Mutation	SNP	116136378	116136378	HDHD3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6951	230
FAM129B	64855	broad.mit.edu	37	9	130272452	130272452	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130272452G>A	uc004brh.2	-	9	1336	c.1134C>T	c.(1132-1134)AAC>AAT	p.N378N	FAM129B_uc004bri.2_Silent_p.N365N|FAM129B_uc004brj.3_Silent_p.N378N	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1	378							protein binding				0						TGCCGCCCTCGTTGATGACGT	0.637																0.4375	141.014236	141.401461	49	63	KEEP	---	---	---	---	25	33	37	39	-1	capture	Silent	SNP	130272452	130272452	FAM129B	9	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5391	230
ZMYM3	9203	broad.mit.edu	37	X	70469493	70469493	+	Silent	SNP	G	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70469493G>T	uc004dzh.1	-	7	1375	c.1288C>A	c.(1288-1290)CGG>AGG	p.R430R	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Silent_p.R430R|ZMYM3_uc004dzj.1_Silent_p.R430R|ZMYM3_uc011mpu.1_Silent_p.R161R|ZMYM3_uc004dzk.3_Silent_p.R430R|ZMYM3_uc004dzl.3_Silent_p.R430R|ZMYM3_uc004dzm.3_Silent_p.R430R	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	430	MYM-type 3.				multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					CTGCAGAGCCGGTGTACCACG	0.587																0.275862	22.587763	23.89919	8	21	KEEP	---	---	---	---	4	4	13	11	0.5	capture	Silent	SNP	70469493	70469493	ZMYM3	23	G	T	T	T	1	0	0	0	0	0	0	0	1	506	39	4	4	17581	230
COL4A6	1288	broad.mit.edu	37	X	107431199	107431199	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107431199A>T	uc004enw.3	-	22	1752	c.1649T>A	c.(1648-1650)CTC>CAC	p.L550H	COL4A6_uc004env.3_Missense_Mutation_p.L549H|COL4A6_uc011msn.1_Missense_Mutation_p.L549H|COL4A6_uc010npk.2_Missense_Mutation_p.L549H	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	550	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GATTGTACTGAGAATTGGTTC	0.512	Melanoma(87;1895 1945 2589 7165)											Alport_syndrome_with_Diffuse_Leiomyomatosis				0.1	8.373714	29.158622	13	117	KEEP	---	---	---	---	9	5	57	70	-1	capture	Missense_Mutation	SNP	107431199	107431199	COL4A6	23	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	3660	230
DCAF12L1	139170	broad.mit.edu	37	X	125685359	125685359	+	Silent	SNP	G	A	A			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125685359G>A	uc004eul.2	-	1	1484	c.1233C>T	c.(1231-1233)CTC>CTT	p.L411L		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	411										skin(3)|ovary(1)	4						CATTGTGGTTGAGCCAGCCTC	0.552																0.322148	123.744075	127.931461	48	101	KEEP	---	---	---	---	25	34	59	53	-1	capture	Silent	SNP	125685359	125685359	DCAF12L1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	4223	230
MKI67	4288	broad.mit.edu	37	10	129901328	129901329	+	Frame_Shift_Del	DEL	GA	-	-	rs61729202	byFrequency;by1000genomes	TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129901328_129901329delGA	uc001lke.2	-	13	8970_8971	c.8775_8776delTC	c.(8773-8778)TCTCAAfs	p.S2925fs	MKI67_uc001lkf.2_Frame_Shift_Del_p.S2565fs|MKI67_uc009yav.1_Frame_Shift_Del_p.S2500fs|MKI67_uc009yaw.1_Frame_Shift_Del_p.S2075fs	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	2925_2926	16 X 122 AA approximate repeats.|16.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CCTGGTGTTTGAGAGAGCTCTT	0.505																0.38			70	116		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	129901328	129901329	MKI67	10	GA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	9510	230
ATP13A1	57130	broad.mit.edu	37	19	19758484	19758484	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19758484delC	uc002nnh.3	-	20	2745	c.2717delG	c.(2716-2718)GGCfs	p.G906fs	ATP13A1_uc002nne.2_Frame_Shift_Del_p.G46fs|ATP13A1_uc002nnf.3_Frame_Shift_Del_p.G274fs|ATP13A1_uc002nng.2_Frame_Shift_Del_p.G788fs	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	906	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6						GGCTCTGATGCCACTGTTGCT	0.697	Esophageal Squamous(142;920 1789 9047 14684 24777)															0.46			23	27		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	19758484	19758484	ATP13A1	19	C	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	1114	230
ARPC2	10109	broad.mit.edu	37	2	219103491	219103492	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-32-1979-01	TCGA-32-1979-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219103491_219103492delTT	uc002vhd.2	+	6	485_486	c.373_374delTT	c.(373-375)TTTfs	p.F125fs	ARPC2_uc002vhe.2_Frame_Shift_Del_p.F125fs|ARPC2_uc002vhf.2_Frame_Shift_Del_p.F11fs	NM_152862	NP_690601	O15144	ARPC2_HUMAN	actin related protein 2/3 complex subunit 2	125					cellular component movement	Arp2/3 protein complex|cell projection|Golgi apparatus	actin binding|structural constituent of cytoskeleton			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		TGCCTCTGTCTTTGAAAAATAC	0.416																0.32			55	119		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	219103491	219103492	ARPC2	2	TT	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	964	230
