Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CCDC27	148870	broad.mit.edu	37	1	3684010	3684010	+	Splice_Site	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3684010G>A	uc001akv.2	+	10	1824	c.1743_splice	c.e10+1	p.R581_splice		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27											skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CCAGTCCAGGGTATGCCCAGC	0.647																0.088235	0.706238	6.527857	3	31	KEEP	---	---	---	---	2	1	14	18	-1	capture	Splice_Site	SNP	3684010	3684010	CCDC27	1	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	2775	235
CASZ1	54897	broad.mit.edu	37	1	10702922	10702922	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10702922C>T	uc001aro.2	-	20	4476	c.4156G>A	c.(4156-4158)GCG>ACG	p.A1386T		NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	1386					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TCACCTGCCGCGGTGCTCTCG	0.687																0.148148	7.007348	10.195393	4	23	KEEP	---	---	---	---	5	3	22	15	-1	capture	Missense_Mutation	SNP	10702922	10702922	CASZ1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2661	235
HSPG2	3339	broad.mit.edu	37	1	22170742	22170742	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22170742C>G	uc001bfj.2	-	65	8555	c.8515G>C	c.(8515-8517)GCA>CCA	p.A2839P	HSPG2_uc009vqd.2_Missense_Mutation_p.A2840P	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	2839	Ig-like C2-type 14.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGCCCTTCTGCCACTCGGGAG	0.682																0.322034	122.708978	126.0276	38	80	KEEP	---	---	---	---	25	27	53	46	-1	capture	Missense_Mutation	SNP	22170742	22170742	HSPG2	1	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	7355	235
GRIK3	2899	broad.mit.edu	37	1	37282846	37282846	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37282846G>A	uc001caz.2	-	13	2041	c.1906C>T	c.(1906-1908)CGC>TGC	p.R636C	GRIK3_uc001cba.1_Missense_Mutation_p.R636C	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	636	Cytoplasmic (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CCAATGATGCGTGTGGACAGG	0.547																0.214286	40.4023	46.736098	18	66	KEEP	---	---	---	---	9	11	33	49	-1	capture	Missense_Mutation	SNP	37282846	37282846	GRIK3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6708	235
PIK3R3	8503	broad.mit.edu	37	1	46509434	46509434	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46509434G>T	uc001cpb.3	-	10	2053	c.1297C>A	c.(1297-1299)CAG>AAG	p.Q433K	PIK3R3_uc009vyb.2_Missense_Mutation_p.Q374K|PIK3R3_uc009vyc.2_Missense_Mutation_p.Q450K|PIK3R3_uc001cpc.3_Missense_Mutation_p.Q433K|PIK3R3_uc010olw.1_Missense_Mutation_p.Q479K|PIK3R3_uc010olv.1_Missense_Mutation_p.Q223K	NM_003629	NP_003620	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3	433	SH2 2.				insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					GATGTCTGCTGGTAATGGAGC	0.532																0.042857	-7.839253	7.854811	3	67	KEEP	---	---	---	---	1	2	36	36	0.333333333333	capture	Missense_Mutation	SNP	46509434	46509434	PIK3R3	1	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	11823	235
PARS2	25973	broad.mit.edu	37	1	55224003	55224003	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55224003A>T	uc001cxy.2	-	2	915	c.832T>A	c.(832-834)TTC>ATC	p.F278I		NM_152268	NP_689481	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase (mitochondrial)(putative)	278					prolyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|proline-tRNA ligase activity			ovary(2)	2					L-Proline(DB00172)	TTGGCTGAGAAGCTGCAGCGG	0.562																0.045455	-7.223492	7.33508	3	63	KEEP	---	---	---	---	1	3	33	38	-1	capture	Missense_Mutation	SNP	55224003	55224003	PARS2	1	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	11370	235
LRRIQ3	127255	broad.mit.edu	37	1	74507037	74507037	+	Silent	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:74507037A>G	uc001dfy.3	-	7	1770	c.1578T>C	c.(1576-1578)ACT>ACC	p.T526T	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	526										ovary(2)	2						TGGTCAAAAGAGTGCGCTCAT	0.358					2											0.257862	126.61264	135.052152	41	118	KEEP	---	---	---	---	25	18	60	80	-1	capture	Silent	SNP	74507037	74507037	LRRIQ3	1	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	8945	235
SF3B4	10262	broad.mit.edu	37	1	149898406	149898406	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:149898406C>G	uc001etj.1	-	3	619	c.568G>C	c.(568-570)GCA>CCA	p.A190P	SF3B4_uc001eti.1_5'Flank|SF3B4_uc001etk.1_Missense_Mutation_p.A190P|SF3B4_uc009wll.1_Missense_Mutation_p.A190P	NM_005850	NP_005841	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4	190						nucleoplasm|U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CGTTCGGCTGCTGAGCCATGG	0.562																0.026549	-20.449976	7.520502	3	110	KEEP	---	---	---	---	0	3	72	67	-1	capture	Missense_Mutation	SNP	149898406	149898406	SF3B4	1	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	14046	235
FMO3	2328	broad.mit.edu	37	1	171079944	171079944	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:171079944G>A	uc001ghi.2	+	6	744	c.633G>A	c.(631-633)ATG>ATA	p.M211I	FMO3_uc001ghh.2_Missense_Mutation_p.M211I|FMO3_uc010pmb.1_Missense_Mutation_p.M191I|FMO3_uc010pmc.1_Missense_Mutation_p.M148I	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	211					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTAAGGTCATGATCAGTTCCA	0.338																0.302083	147.567073	154.288468	58	134	KEEP	---	---	---	---	37	29	70	87	-1	capture	Missense_Mutation	SNP	171079944	171079944	FMO3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	5900	235
ABL2	27	broad.mit.edu	37	1	179086548	179086548	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179086548C>T	uc001gmj.3	-	8	1614	c.1327G>A	c.(1327-1329)GCT>ACT	p.A443T	ABL2_uc010pnf.1_Missense_Mutation_p.A443T|ABL2_uc010png.1_Missense_Mutation_p.A422T|ABL2_uc010pnh.1_Missense_Mutation_p.A422T|ABL2_uc009wxe.2_Missense_Mutation_p.A422T|ABL2_uc001gmg.3_Missense_Mutation_p.A428T|ABL2_uc001gmi.3_Missense_Mutation_p.A428T|ABL2_uc001gmh.3_Missense_Mutation_p.A407T|ABL2_uc010pne.1_Missense_Mutation_p.A407T|ABL2_uc009wxf.1_Missense_Mutation_p.A428T|ABL2_uc001gmk.2_Missense_Mutation_p.A407T	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	443	Protein kinase.|Kinase activation loop (By similarity).				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TTGGCTCCAGCATGAGCAGTA	0.443					285	T	ETV6	AML								0.264317	140.386498	151.794579	60	167	KEEP	---	---	---	---	30	37	91	99	-1	capture	Missense_Mutation	SNP	179086548	179086548	ABL2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	93	235
PTPRC	5788	broad.mit.edu	37	1	198685877	198685877	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:198685877C>T	uc001gur.1	+	13	1532	c.1352C>T	c.(1351-1353)ACG>ATG	p.T451M	PTPRC_uc001gus.1_Missense_Mutation_p.T403M|PTPRC_uc001gut.1_Missense_Mutation_p.T290M|PTPRC_uc009wzf.1_Missense_Mutation_p.T339M|PTPRC_uc010ppg.1_Missense_Mutation_p.T387M	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	451	Extracellular (Potential).|Fibronectin type-III 1.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						AAACCTTATACGAAATATGTT	0.313					815											0.28125	23.06231	24.438062	9	23	KEEP	---	---	---	---	6	3	12	11	-1	capture	Missense_Mutation	SNP	198685877	198685877	PTPRC	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12692	235
OPTC	26254	broad.mit.edu	37	1	203466194	203466194	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:203466194G>C	uc001gzu.1	+	3	437	c.321G>C	c.(319-321)ATG>ATC	p.M107I		NM_014359	NP_055174	Q9UBM4	OPT_HUMAN	opticin precursor	107	Ser/Thr-rich.					proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.109)			ACCCCACGATGACCAGACCTA	0.562																0.04	-5.095268	6.3078	2	48	KEEP	---	---	---	---	2	0	23	30	-1	capture	Missense_Mutation	SNP	203466194	203466194	OPTC	1	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	10792	235
OBSCN	84033	broad.mit.edu	37	1	228404990	228404990	+	Splice_Site	SNP	G	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228404990G>T	uc009xez.1	+	8	2697	c.2653_splice	c.e8+1	p.E885_splice	OBSCN_uc001hsn.2_Splice_Site_p.E885_splice	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CGCGTCTCTGGTGAGCACGCT	0.652					4006											0.226415	31.371262	35.014033	12	41	KEEP	---	---	---	---	7	7	22	27	0.5	capture	Splice_Site	SNP	228404990	228404990	OBSCN	1	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	10717	235
CHML	1122	broad.mit.edu	37	1	241797601	241797601	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:241797601G>A	uc001hzd.2	-	1	1632	c.1468C>T	c.(1468-1470)CGG>TGG	p.R490W	OPN3_uc001hza.2_Intron|OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron	NM_001821	NP_001812	P26374	RAE2_HUMAN	choroideremia-like Rab escort protein 2	490					intracellular protein transport|visual perception	Rab-protein geranylgeranyltransferase complex	GTPase activator activity|Rab geranylgeranyltransferase activity			ovary(4)|skin(2)	6	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TCTGTGACCCGTACAGCACAA	0.418																0.023256	-26.172029	6.449846	3	126	KEEP	---	---	---	---	3	0	42	92	-1	capture	Missense_Mutation	SNP	241797601	241797601	CHML	1	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	3316	235
OR2G6	391211	broad.mit.edu	37	1	248685648	248685648	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248685648G>A	uc001ien.1	+	1	701	c.701G>A	c.(700-702)CGC>CAC	p.R234H		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTGCGGGCCGCCAAAAGGCC	0.473																0.382857	192.878372	194.985383	67	108	KEEP	---	---	---	---	37	37	62	57	-1	capture	Missense_Mutation	SNP	248685648	248685648	OR2G6	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10904	235
IDI2	91734	broad.mit.edu	37	10	1065753	1065753	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:1065753A>T	uc001ifv.1	-	5	453	c.388T>A	c.(388-390)TTC>ATC	p.F130I	C10orf110_uc010qaf.1_5'Flank|C10orf110_uc001ifx.3_5'Flank|C10orf110_uc001ifw.3_5'Flank|C10orf110_uc001ify.3_5'Flank	NM_033261	NP_150286	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	130	Nudix hydrolase.				carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		ATTGTCATGAACACAATGTCC	0.373																0.033708	-14.35308	6.738461	3	86	KEEP	---	---	---	---	3	0	50	54	-1	capture	Missense_Mutation	SNP	1065753	1065753	IDI2	10	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	7425	235
SYT15	83849	broad.mit.edu	37	10	46962073	46962073	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:46962073A>G	uc001jea.2	-	8	1316	c.1163T>C	c.(1162-1164)ATG>ACG	p.M388T	SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_Missense_Mutation_p.M266T|SYT15_uc010qfp.1_RNA	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a	388	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0						GCGGGTGTACATGTAGGGGCC	0.672	Ovarian(57;1152 1428 19651 37745)															0.131579	3.129621	8.197755	5	33	KEEP	---	---	---	---	4	2	24	15	-1	capture	Missense_Mutation	SNP	46962073	46962073	SYT15	10	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	15359	235
JMJD1C	221037	broad.mit.edu	37	10	64950737	64950737	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64950737G>A	uc001jmn.2	-	17	6508	c.6208C>T	c.(6208-6210)CTG>TTG	p.L2070L	JMJD1C_uc001jml.2_Silent_p.L1833L|JMJD1C_uc001jmm.2_Silent_p.L1782L|JMJD1C_uc010qiq.1_Silent_p.L1888L|JMJD1C_uc009xpi.2_Silent_p.L1888L|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc001jmo.2_5'UTR	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	2070	LXXLL motif.				blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					GTTGTAGTCAGCAAATCCCGT	0.463																0.022222	-28.003017	6.387187	3	132	KEEP	---	---	---	---	3	0	59	92	-1	capture	Silent	SNP	64950737	64950737	JMJD1C	10	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	7873	235
CALHM2	51063	broad.mit.edu	37	10	105207008	105207008	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105207008C>G	uc001kwz.2	-	3	1259	c.873G>C	c.(871-873)CAG>CAC	p.Q291H	CALHM2_uc001kxa.2_Missense_Mutation_p.Q291H|CALHM2_uc001kxc.2_3'UTR|CALHM2_uc001kxb.2_Missense_Mutation_p.Q291H	NM_015916	NP_057000	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	291						integral to membrane				skin(1)	1						GTGGGAGGCCCTGGTTCTCAC	0.627																0.060606	-0.178325	6.477955	2	31	KEEP	---	---	---	---	0	2	22	19	-1	capture	Missense_Mutation	SNP	105207008	105207008	CALHM2	10	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	2559	235
MUC2	4583	broad.mit.edu	37	11	1093681	1093681	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1093681G>C	uc001lsx.1	+	32	12601	c.12574G>C	c.(12574-12576)GGC>CGC	p.G4192R		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4192				GTQ -> TGS (in Ref. 4).		inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGGAAGCACGGGGCCCCCCAC	0.617																0.029126	-18.201182	6.84519	3	100	KEEP	---	---	---	---	1	2	44	60	-1	capture	Missense_Mutation	SNP	1093681	1093681	MUC2	11	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	9885	235
CHRNA10	57053	broad.mit.edu	37	11	3688949	3688949	+	Silent	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3688949C>T	uc001lyf.2	-	4	480	c.408G>A	c.(406-408)CTG>CTA	p.L136L	CHRNA10_uc010qxt.1_5'UTR|CHRNA10_uc010qxu.1_5'UTR	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	136	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	CATCGTGGCGCAGGACCACGT	0.731	Melanoma(153;17 1869 2949 7120 36888)															0.4	6.949124	6.992813	2	3	KEEP	---	---	---	---	0	3	0	3	-1	capture	Silent	SNP	3688949	3688949	CHRNA10	11	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	3347	235
QSER1	79832	broad.mit.edu	37	11	32979551	32979551	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32979551C>T	uc001mty.2	+	8	4768	c.4501C>T	c.(4501-4503)CGG>TGG	p.R1501W	QSER1_uc001mtz.1_Missense_Mutation_p.R1262W|QSER1_uc001mua.2_Missense_Mutation_p.R1006W	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1501										ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					ACCAAAGAAACGGAAAAAATG	0.413																0.25	58.137299	63.607367	24	72	KEEP	---	---	---	---	13	14	39	42	-1	capture	Missense_Mutation	SNP	32979551	32979551	QSER1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	12777	235
AGBL2	79841	broad.mit.edu	37	11	47726094	47726094	+	Splice_Site	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47726094C>G	uc001ngg.2	-	6	686	c.586_splice	c.e6+1	p.E196_splice	AGBL2_uc010rhq.1_Splice_Site_p.E158_splice|AGBL2_uc001ngh.1_Splice_Site_p.E140_splice	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2						AGTCATATTACCAATATGATG	0.318																0.023256	-25.494608	7.145349	3	126	KEEP	---	---	---	---	3	0	74	70	-1	capture	Splice_Site	SNP	47726094	47726094	AGBL2	11	C	G	G	G	1	0	0	0	0	0	0	1	0	234	18	5	4	376	235
EML3	256364	broad.mit.edu	37	11	62378668	62378668	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62378668C>A	uc001ntu.1	-	3	651	c.343G>T	c.(343-345)GAG>TAG	p.E115*	EML3_uc001ntr.1_Nonsense_Mutation_p.E87*|EML3_uc001nts.1_Nonsense_Mutation_p.E87*|EML3_uc001ntt.1_Missense_Mutation_p.K11N|EML3_uc010rly.1_Nonsense_Mutation_p.E115*|EML3_uc009yny.1_5'UTR|ROM1_uc001ntv.2_5'Flank	NM_153265	NP_694997	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like	115						cytoplasm|microtubule	protein binding			ovary(1)	1						CCGCTAGGCTCTTCGCTGGCC	0.697																0.16	7.683062	10.435731	4	21	KEEP	---	---	---	---	2	2	8	16	0.5	capture	Nonsense_Mutation	SNP	62378668	62378668	EML3	11	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	5053	235
CCDC87	55231	broad.mit.edu	37	11	66358101	66358101	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66358101C>T	uc001oiq.3	-	1	2454	c.2386G>A	c.(2386-2388)GAG>AAG	p.E796K	CCS_uc001oir.2_5'Flank	NM_018219	NP_060689	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	796										ovary(1)|skin(1)	2						ATCACTGGCTCGCCAAAGATT	0.532																0.342183	332.846144	340.283327	116	223	KEEP	---	---	---	---	47	79	108	160	-1	capture	Missense_Mutation	SNP	66358101	66358101	CCDC87	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2835	235
FAT3	120114	broad.mit.edu	37	11	92535042	92535042	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92535042G>A	uc001pdj.3	+	9	8880	c.8863G>A	c.(8863-8865)GAC>AAC	p.D2955N		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2955	Cadherin 27.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGACACATCCGACGTTAATCG	0.522													TCGA Ovarian(4;0.039)			0.270588	60.688558	64.722897	23	62	KEEP	---	---	---	---	16	12	40	38	-1	capture	Missense_Mutation	SNP	92535042	92535042	FAT3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5637	235
HEPHL1	341208	broad.mit.edu	37	11	93839268	93839268	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93839268A>G	uc001pep.2	+	17	3174	c.3017A>G	c.(3016-3018)CAT>CGT	p.H1006R	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	1006	Extracellular (Potential).|Plastocyanin-like 6.	Copper 1; type 2 (By similarity).			copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CATACCATCCATTATCATGCT	0.353																0.2125	41.530823	47.642239	17	63	KEEP	---	---	---	---	8	12	37	41	-1	capture	Missense_Mutation	SNP	93839268	93839268	HEPHL1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	6981	235
RNF26	79102	broad.mit.edu	37	11	119206267	119206267	+	Silent	SNP	T	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119206267T>A	uc001pwh.2	+	1	1031	c.435T>A	c.(433-435)GCT>GCA	p.A145A		NM_032015	NP_114404	Q9BY78	RNF26_HUMAN	ring finger protein 26	145	Leu-rich.						zinc ion binding			ovary(1)	1		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		GCCTGGTGGCTTATGTGATCA	0.592																0.048387	-6.029358	7.416898	3	59	KEEP	---	---	---	---	1	3	32	31	-1	capture	Silent	SNP	119206267	119206267	RNF26	11	T	A	A	A	1	0	0	0	0	0	0	0	1	717	56	4	4	13378	235
C12orf45	121053	broad.mit.edu	37	12	105380235	105380235	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:105380235C>G	uc001tlb.2	+	1	138	c.105C>G	c.(103-105)GAC>GAG	p.D35E		NM_152318	NP_689531	Q8N5I9	CL045_HUMAN	hypothetical protein LOC121053	35											0						CGGGAAGCGACGGCCGCGGAG	0.706																0.153846	4.842468	6.330757	2	11	KEEP	---	---	---	---	2	0	6	8	-1	capture	Missense_Mutation	SNP	105380235	105380235	C12orf45	12	C	G	G	G	1	0	0	0	0	1	0	0	0	246	19	4	4	1677	235
HVCN1	84329	broad.mit.edu	37	12	111099056	111099056	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111099056G>A	uc001trs.1	-	4	384	c.219C>T	c.(217-219)GAC>GAT	p.D73D	HVCN1_uc001trq.1_Silent_p.D73D|HVCN1_uc001trt.1_Silent_p.D73D|HVCN1_uc010syd.1_Silent_p.D53D	NM_032369	NP_115745	Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	73	Cytoplasmic (Potential).				response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity			skin(1)	1						CAGGGGCAACGTCAGGGGCTG	0.527																0.290323	45.137169	47.57277	18	44	KEEP	---	---	---	---	8	13	29	32	-1	capture	Silent	SNP	111099056	111099056	HVCN1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7387	235
RB1	5925	broad.mit.edu	37	13	48955550	48955550	+	Nonsense_Mutation	SNP	C	T	T	rs121913304		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48955550C>T	uc001vcb.2	+	17	1832	c.1666C>T	c.(1666-1668)CGA>TGA	p.R556*		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	556	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.R556*(5)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ATGTGAACATCGAATCATGGA	0.333			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.409091	28.771227	28.929997	9	13	KEEP	---	---	---	---	6	5	6	8	-1	capture	Nonsense_Mutation	SNP	48955550	48955550	RB1	13	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	12993	235
OLFM4	10562	broad.mit.edu	37	13	53624151	53624151	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:53624151G>C	uc001vhl.2	+	5	778	c.778G>C	c.(778-780)GTT>CTT	p.V260L	OLFM4_uc001vhk.1_Intron	NM_006418	NP_006409	Q6UX06	OLFM4_HUMAN	olfactomedin 4 precursor	260	Olfactomedin-like.				cell adhesion	extracellular space				skin(1)	1		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		ACCGTCTGTGGTTCAGCTCAA	0.448					717											0.022222	-26.202963	8.184814	3	132	KEEP	---	---	---	---	0	3	85	77	-1	capture	Missense_Mutation	SNP	53624151	53624151	OLFM4	13	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	10760	235
DCT	1638	broad.mit.edu	37	13	95121065	95121065	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95121065G>A	uc001vlv.3	-	2	957	c.530C>T	c.(529-531)GCC>GTC	p.A177V	DCT_uc010afh.2_Missense_Mutation_p.A177V	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	177	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		ACTGCAGTTGGCAAACTGCGG	0.458																0.02451	-43.212151	8.019791	5	199	KEEP	---	---	---	---	1	4	122	120	-1	capture	Missense_Mutation	SNP	95121065	95121065	DCT	13	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4263	235
AKAP6	9472	broad.mit.edu	37	14	33014783	33014783	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:33014783G>T	uc001wrq.2	+	4	1094	c.924G>T	c.(922-924)GAG>GAT	p.E308D	AKAP6_uc010aml.2_Missense_Mutation_p.E305D	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	308					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GTGGATGTGAGGAAGACAATG	0.488	Melanoma(49;821 1200 7288 13647 42351)				483											0.036697	-17.801496	7.569684	4	105	KEEP	---	---	---	---	2	2	46	63	0.5	capture	Missense_Mutation	SNP	33014783	33014783	AKAP6	14	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	455	235
SERPINA6	866	broad.mit.edu	37	14	94776220	94776220	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94776220G>A	uc001ycv.2	-	3	841	c.737C>T	c.(736-738)GCG>GTG	p.A246V	SERPINA6_uc010auv.2_RNA	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	246					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	GGGGAGCTCCGAGTCATGAAG	0.542																0.344828	55.381382	56.615189	20	38	KEEP	---	---	---	---	8	14	14	31	-1	capture	Missense_Mutation	SNP	94776220	94776220	SERPINA6	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13986	235
SERPINA9	327657	broad.mit.edu	37	14	94935885	94935885	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94935885A>G	uc001ydf.2	-	2	508	c.347T>C	c.(346-348)CTG>CCG	p.L116P	SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_Intron|SERPINA9_uc001ydg.2_Missense_Mutation_p.L80P|SERPINA9_uc001ydh.1_Missense_Mutation_p.L116P|SERPINA9_uc001ydi.1_Missense_Mutation_p.L80P	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	98					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GTTGAAGCCCAGGCCCTGGAG	0.567																0.022556	-27.286977	6.506593	3	130	KEEP	---	---	---	---	2	1	72	75	-1	capture	Missense_Mutation	SNP	94935885	94935885	SERPINA9	14	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	13988	235
PCSK6	5046	broad.mit.edu	37	15	101933603	101933603	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101933603G>A	uc002bwy.2	-	9	1337	c.1023C>T	c.(1021-1023)TTC>TTT	p.F341F	PCSK6_uc010bpd.2_Silent_p.F211F|PCSK6_uc010bpe.2_Silent_p.F341F|PCSK6_uc002bxa.2_Silent_p.F341F|PCSK6_uc002bxb.2_Silent_p.F341F|PCSK6_uc002bxc.1_Silent_p.F341F|PCSK6_uc002bxd.1_Silent_p.F341F|PCSK6_uc002bxe.2_Silent_p.F341F|PCSK6_uc002bxg.1_Silent_p.F341F	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	341	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATGCCCAGACGAAAATGGAGC	0.627																0.263158	39.999461	42.890809	15	42	KEEP	---	---	---	---	12	10	29	35	-1	capture	Silent	SNP	101933603	101933603	PCSK6	15	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	11507	235
CREBBP	1387	broad.mit.edu	37	16	3820625	3820625	+	Silent	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3820625A>G	uc002cvv.2	-	14	3030	c.2826T>C	c.(2824-2826)CCT>CCC	p.P942P	CREBBP_uc002cvw.2_Silent_p.P904P	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	942					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GCGATGACTGAGGGGTAGCCA	0.627					748	T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				0.05914	-29.795377	8.900802	11	175	KEEP	---	---	---	---	32	22	179	110	-1	capture	Silent	SNP	3820625	3820625	CREBBP	16	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	3826	235
ITGAD	3681	broad.mit.edu	37	16	31422196	31422196	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31422196G>A	uc002ebv.1	+	12	1402	c.1353G>A	c.(1351-1353)ACG>ACA	p.T451T	ITGAD_uc010cap.1_Silent_p.T451T	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	451	Extracellular (Potential).|FG-GAP 5.				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TCACAGGGACGCAGGTTGGGC	0.657																0.223529	42.073163	48.053774	19	66	KEEP	---	---	---	---	10	11	38	39	-1	capture	Silent	SNP	31422196	31422196	ITGAD	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7807	235
COQ9	57017	broad.mit.edu	37	16	57492187	57492187	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57492187C>G	uc002elq.2	+	6	652	c.636C>G	c.(634-636)AAC>AAG	p.N212K	COQ9_uc002elr.2_Missense_Mutation_p.N177K|COQ9_uc002els.2_Missense_Mutation_p.N5K	NM_020312	NP_064708	O75208	COQ9_HUMAN	coenzyme Q9 homolog precursor	212					ubiquinone biosynthetic process	mitochondrion				breast(1)	1						TCCCTCACAACATCCCGTCCA	0.562																0.090909	2.731995	6.44379	2	20	KEEP	---	---	---	---	0	2	11	13	-1	capture	Missense_Mutation	SNP	57492187	57492187	COQ9	16	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	3716	235
TP53	7157	broad.mit.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577568C>A	uc002gim.2	-	7	907	c.713G>T	c.(712-714)TGT>TTT	p.C238F	TP53_uc002gig.1_Missense_Mutation_p.C238F|TP53_uc002gih.2_Missense_Mutation_p.C238F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.C106F|TP53_uc010cng.1_Missense_Mutation_p.C106F|TP53_uc002gii.1_Missense_Mutation_p.C106F|TP53_uc010cnh.1_Missense_Mutation_p.C238F|TP53_uc010cni.1_Missense_Mutation_p.C238F|TP53_uc002gij.2_Missense_Mutation_p.C238F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.C145F|TP53_uc002gio.2_Missense_Mutation_p.C106F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	238	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).	Zinc.	C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C238Y(47)|p.C238F(34)|p.C238S(18)|p.C238R(14)|p.0?(7)|p.C238*(4)|p.C238W(2)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.C238fs*9(1)|p.M237_N239delMCN(1)|p.C238fs*21(1)|p.C238del(1)|p.C238G(1)|p.C238C(1)|p.M237fs*1(1)|p.C145F(1)|p.H233fs*6(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.M237_C238insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGAACTGTTACACATGTAGTT	0.572	Pancreas(47;798 1329 9957 10801)		111	p.C238S(LN18-Tumor)|p.C238Y(MC116-Tumor)|p.C238S(MOLM16-Tumor)|p.C238S(SNU626-Tumor)|p.C238fs(SW1417-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.417582	118.634948	119.174407	38	53	KEEP	---	---	---	---	19	29	42	25	0.604166666667	capture	Missense_Mutation	SNP	7577568	7577568	TP53	17	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	16264	235
TP53	7157	broad.mit.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578265A>T	uc002gim.2	-	6	778	c.584T>A	c.(583-585)ATC>AAC	p.I195N	TP53_uc002gig.1_Missense_Mutation_p.I195N|TP53_uc002gih.2_Missense_Mutation_p.I195N|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I63N|TP53_uc010cng.1_Missense_Mutation_p.I63N|TP53_uc002gii.1_Missense_Mutation_p.I63N|TP53_uc010cnh.1_Missense_Mutation_p.I195N|TP53_uc010cni.1_Missense_Mutation_p.I195N|TP53_uc002gij.2_Missense_Mutation_p.I195N|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.I102N|TP53_uc002gio.2_Missense_Mutation_p.I63N|TP53_uc010vug.1_Missense_Mutation_p.I156N	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	195	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.I195T(61)|p.I195F(16)|p.I195N(12)|p.0?(7)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.I195fs*52(3)|p.K164_P219del(1)|p.I195L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.I195fs*12(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCCACTCGGATAAGATGCTG	0.552	Pancreas(47;798 1329 9957 10801)		111	p.I195S(SNU1077-Tumor)|p.I195T(KYSE180-Tumor)|p.H193fs(59M-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.0625	-4.652618	8.11611	4	60	KEEP	---	---	---	---	4	1	26	43	-1	capture	Missense_Mutation	SNP	7578265	7578265	TP53	17	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	16264	235
RAI1	10743	broad.mit.edu	37	17	17697820	17697820	+	Missense_Mutation	SNP	G	A	A	rs147708297		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17697820G>A	uc002grm.2	+	3	2027	c.1558G>A	c.(1558-1560)GGC>AGC	p.G520S	RAI1_uc002grn.1_Missense_Mutation_p.G520S	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	520						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		CTACCTGAGCGGCTCCGAGGA	0.687																0.478261	35.724242	35.733669	11	12	KEEP	---	---	---	---	7	4	6	9	-1	capture	Missense_Mutation	SNP	17697820	17697820	RAI1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12902	235
SLC13A2	9058	broad.mit.edu	37	17	26818573	26818573	+	Silent	SNP	C	T	T	rs146824818		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26818573C>T	uc002hbh.2	+	5	760	c.693C>T	c.(691-693)ATC>ATT	p.I231I	SLC13A2_uc010wal.1_Silent_p.I188I|SLC13A2_uc010wam.1_Silent_p.I187I|SLC13A2_uc010wan.1_Silent_p.I280I|SLC13A2_uc010wao.1_Silent_p.I188I|SLC13A2_uc002hbi.2_Silent_p.I160I	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	231	Helical; (Potential).					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	CCGCCAGCATCGGGGGCATCG	0.632																0.445946	101.769178	101.956882	33	41	KEEP	---	---	---	---	17	23	22	33	-1	capture	Silent	SNP	26818573	26818573	SLC13A2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	14285	235
VAT1	10493	broad.mit.edu	37	17	41168349	41168349	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41168349A>G	uc002icm.1	-	5	1193	c.1073T>C	c.(1072-1074)ATT>ACT	p.I358T	VAT1_uc010cyw.1_Missense_Mutation_p.I224T|VAT1_uc010whk.1_Missense_Mutation_p.I290T	NM_006373	NP_006364	Q99536	VAT1_HUMAN	vesicle amine transport protein 1	358						cytoplasm|integral to membrane	oxidoreductase activity|zinc ion binding				0		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)		GACTGAGTCAATGTGGGGCTT	0.607																0.285714	73.421241	76.591866	22	55	KEEP	---	---	---	---	16	10	21	38	-1	capture	Missense_Mutation	SNP	41168349	41168349	VAT1	17	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17011	235
GRIN2C	2905	broad.mit.edu	37	17	72851132	72851132	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72851132C>T	uc002jlt.1	-	2	256	c.100G>A	c.(100-102)GTG>ATG	p.V34M	GRIN2C_uc010wrh.1_RNA|GRIN2C_uc002jlu.1_Missense_Mutation_p.V34M|GRIN2C_uc002jlv.1_Missense_Mutation_p.V34M	NM_000835	NP_000826	Q14957	NMDE3_HUMAN	N-methyl-D-aspartate receptor subunit 2C	34	Extracellular (Potential).				glutamate signaling pathway	cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|N-methyl-D-aspartate selective glutamate receptor activity			ovary(2)|breast(2)	4	all_lung(278;0.172)|Lung NSC(278;0.207)				Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)	CTAAACACCACAGCCACCGTC	0.706																0.242424	17.984418	19.980693	8	25	KEEP	---	---	---	---	5	6	15	13	-1	capture	Missense_Mutation	SNP	72851132	72851132	GRIN2C	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6714	235
POTEC	388468	broad.mit.edu	37	18	14513764	14513764	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513764C>T	uc010dln.2	-	10	1884	c.1430G>A	c.(1429-1431)CGG>CAG	p.R477Q	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	477										skin(3)	3						AAGTTGTTTCCGGGTATCATT	0.358																0.069767	-1.310289	6.907993	3	40	KEEP	---	---	---	---	2	2	33	22	-1	capture	Missense_Mutation	SNP	14513764	14513764	POTEC	18	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12164	235
ADAMTS10	81794	broad.mit.edu	37	19	8661249	8661249	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8661249C>T	uc002mkj.1	-	10	1406	c.1132G>A	c.(1132-1134)GTC>ATC	p.V378I	ADAMTS10_uc002mkk.1_Missense_Mutation_p.V10I	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	378	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						TCCTCATTGACGCTGCAGCTT	0.662																0.136364	6.33705	9.130762	3	19	KEEP	---	---	---	---	0	3	11	10	-1	capture	Missense_Mutation	SNP	8661249	8661249	ADAMTS10	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	256	235
MUC16	94025	broad.mit.edu	37	19	9050207	9050207	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9050207G>A	uc002mkp.2	-	5	31628	c.31424C>T	c.(31423-31425)ACC>ATC	p.T10475I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10477	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCTGTGGTGGTGGTCTCCAT	0.483																0.193478	186.008042	226.348938	89	371	KEEP	---	---	---	---	48	56	189	241	-1	capture	Missense_Mutation	SNP	9050207	9050207	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	9883	235
RAVER1	125950	broad.mit.edu	37	19	10434234	10434234	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10434234G>A	uc002moa.2	-	4	896	c.816C>T	c.(814-816)TGC>TGT	p.C272C		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	255	RRM 3.					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			CATCCTGGCCGCACGCCAGCT	0.667																0.1875	12.350001	15.262042	6	26	KEEP	---	---	---	---	2	6	20	21	-1	capture	Silent	SNP	10434234	10434234	RAVER1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	12989	235
CYP4F8	11283	broad.mit.edu	37	19	15739191	15739191	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15739191G>A	uc002nbi.2	+	12	1259	c.1195G>A	c.(1195-1197)GCC>ACC	p.A399T	CYP4F8_uc010xoj.1_Missense_Mutation_p.A211T	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	399					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						CCCTACATTCGCCCGCGGCTG	0.637																0.06383	-8.751083	9.811177	6	88	KEEP	---	---	---	---	5	4	64	43	-1	capture	Missense_Mutation	SNP	15739191	15739191	CYP4F8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4151	235
OR10H1	26539	broad.mit.edu	37	19	15918727	15918727	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15918727C>A	uc002nbq.2	-	1	210	c.121G>T	c.(121-123)GGC>TGC	p.G41C		NM_013940	NP_039228	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H,	41	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGCAGGTTGCCCAGCAGCGTG	0.597																0.216783	70.346539	80.927212	31	112	KEEP	---	---	---	---	29	15	80	73	0.340909090909	capture	Missense_Mutation	SNP	15918727	15918727	OR10H1	19	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	10809	235
EPS15L1	58513	broad.mit.edu	37	19	16515514	16515514	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16515514A>G	uc002ndz.1	-	14	1319	c.1313T>C	c.(1312-1314)CTC>CCC	p.L438P	EPS15L1_uc002ndx.2_Missense_Mutation_p.L438P|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpe.1_Missense_Mutation_p.L328P|EPS15L1_uc010xpf.1_Missense_Mutation_p.L341P|EPS15L1_uc002nea.1_Missense_Mutation_p.L438P|EPS15L1_uc010eah.1_Missense_Mutation_p.L438P|EPS15L1_uc002neb.1_Missense_Mutation_p.L284P|EPS15L1_uc002nec.1_Missense_Mutation_p.L438P	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	438					endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						CTGAGCCTCGAGCTCCTGCAA	0.542																0.02381	-14.727073	6.449899	2	82	KEEP	---	---	---	---	1	1	42	45	-1	capture	Missense_Mutation	SNP	16515514	16515514	EPS15L1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5148	235
PRX	57716	broad.mit.edu	37	19	40901148	40901148	+	Silent	SNP	T	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40901148T>C	uc002onr.2	-	7	3380	c.3111A>G	c.(3109-3111)GAA>GAG	p.E1037E	PRX_uc002onq.2_Silent_p.E898E|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	1037					axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGGCACTAGTTCTGCTGCCT	0.627																0.044118	-7.931483	7.193563	3	65	KEEP	---	---	---	---	0	4	28	51	-1	capture	Silent	SNP	40901148	40901148	PRX	19	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	12537	235
C19orf54	284325	broad.mit.edu	37	19	41248416	41248416	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41248416G>A	uc002oou.1	-	6	1098	c.978C>T	c.(976-978)TAC>TAT	p.Y326Y	C19orf54_uc002oow.1_Silent_p.Y154Y|C19orf54_uc002oox.1_Intron|C19orf54_uc002ooy.1_Intron|C19orf54_uc010xvs.1_Intron	NM_198476	NP_940878	Q5BKX5	CS054_HUMAN	hypothetical protein LOC284325	326											0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CGGGCACCACGTACACCCGGC	0.662																0.2	6.044544	6.881263	2	8	KEEP	---	---	---	---	0	2	3	5	-1	capture	Silent	SNP	41248416	41248416	C19orf54	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1919	235
FOXA3	3171	broad.mit.edu	37	19	46375547	46375547	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46375547C>T	uc002pdr.2	+	2	481	c.284C>T	c.(283-285)CCG>CTG	p.P95L		NM_004497	NP_004488	P55318	FOXA3_HUMAN	forkhead box A3	95					brain development|cellular glucose homeostasis|cellular response to starvation|chromatin modification|embryo development|endocrine pancreas development|negative regulation of cell proliferation|neural plate anterior/posterior regionalization|neuron fate specification|positive regulation of hepatocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|spermatogenesis	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(1)	1		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		TACGGGGCCCCGGGTCCTGGG	0.682																0.065217	-2.710656	6.319764	3	43	KEEP	---	---	---	---	2	1	19	33	-1	capture	Missense_Mutation	SNP	46375547	46375547	FOXA3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5935	235
MYH14	79784	broad.mit.edu	37	19	50713834	50713834	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50713834G>A	uc002prr.1	+	2	259	c.212G>A	c.(211-213)CGG>CAG	p.R71Q	MYH14_uc010enu.1_Missense_Mutation_p.R71Q|MYH14_uc002prq.1_Missense_Mutation_p.R71Q	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	71	Myosin head-like.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GCGGCGCTGCGGGACGAAGGC	0.736																0.4	7.749119	7.792827	2	3	KEEP	---	---	---	---	0	2	4	0	-1	capture	Missense_Mutation	SNP	50713834	50713834	MYH14	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9943	235
ZNF347	84671	broad.mit.edu	37	19	53644386	53644386	+	Silent	SNP	T	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53644386T>A	uc002qbb.1	-	5	1764	c.1695A>T	c.(1693-1695)GGA>GGT	p.G565G	ZNF347_uc010eql.1_Silent_p.G566G|ZNF347_uc002qbc.1_Silent_p.G566G	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	565					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		AAGGTTTTTCTCCAGTATGGA	0.408	Melanoma(64;205 1597 17324 45721)															0.019231	-59.865214	7.680024	5	255	KEEP	---	---	---	---	1	4	121	170	-1	capture	Silent	SNP	53644386	53644386	ZNF347	19	T	A	A	A	1	0	0	0	0	0	0	0	1	691	54	4	4	17741	235
BIRC8	112401	broad.mit.edu	37	19	53793037	53793037	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53793037G>A	uc002qbk.2	-	1	1839	c.591C>T	c.(589-591)ATC>ATT	p.I197I		NM_033341	NP_203127	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat-containing 8	197	RING-type.				apoptosis		zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(134;0.00304)		AAACAACAGCGATATGTCTGT	0.443																0.036585	-12.047524	7.046639	3	79	KEEP	---	---	---	---	2	1	41	40	-1	capture	Silent	SNP	53793037	53793037	BIRC8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	1428	235
LILRB1	10859	broad.mit.edu	37	19	55144009	55144009	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55144009C>A	uc002qgj.2	+	7	1096	c.756C>A	c.(754-756)TAC>TAA	p.Y252*	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Nonsense_Mutation_p.Y252*|LILRB1_uc002qgk.2_Nonsense_Mutation_p.Y252*|LILRB1_uc002qgm.2_Nonsense_Mutation_p.Y252*|LILRB1_uc010erq.2_Nonsense_Mutation_p.Y252*|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	252	Ig-like C2-type 3.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		ATGCTGGCTACAACAGATTTG	0.587													HNSCC(37;0.09)			0.059406	-14.067649	6.702848	6	95	KEEP	---	---	---	---	5	5	47	63	0.5	capture	Nonsense_Mutation	SNP	55144009	55144009	LILRB1	19	C	A	A	A	1	0	0	0	0	0	1	0	0	220	17	5	4	8710	235
GDF7	151449	broad.mit.edu	37	2	20870425	20870425	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:20870425G>A	uc002rdz.1	+	2	1169	c.593G>A	c.(592-594)CGG>CAG	p.R198Q		NM_182828	NP_878248	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7 preproprotein	198					activin receptor signaling pathway|BMP signaling pathway|growth|pathway-restricted SMAD protein phosphorylation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGTACTCGCGGGCAGCTGAG	0.731																0.4	7.849194	7.892878	2	3	KEEP	---	---	---	---	2	0	2	1	-1	capture	Missense_Mutation	SNP	20870425	20870425	GDF7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6258	235
CAPN13	92291	broad.mit.edu	37	2	30986009	30986009	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:30986009G>C	uc002rnn.2	-	7	889	c.713C>G	c.(712-714)GCA>GGA	p.A238G	CAPN13_uc002rnp.1_Missense_Mutation_p.A238G	NM_144575	NP_653176	Q6MZZ7	CAN13_HUMAN	calpain 13	238	Calpain catalytic.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			large_intestine(1)|ovary(1)	2	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CATCGCCTGTGCTGTATCTGT	0.522																0.064516	0.4232	6.533977	2	29	KEEP	---	---	---	---	2	0	16	22	-1	capture	Missense_Mutation	SNP	30986009	30986009	CAPN13	2	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	2602	235
EHBP1	23301	broad.mit.edu	37	2	63086375	63086375	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:63086375G>C	uc002sby.2	+	9	1293	c.811G>C	c.(811-813)GAT>CAT	p.D271H	EHBP1_uc010fcp.2_Missense_Mutation_p.D236H|EHBP1_uc002sbx.2_Missense_Mutation_p.D236H|EHBP1_uc002sbz.2_Missense_Mutation_p.D236H|EHBP1_uc002scb.2_Missense_Mutation_p.D236H	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	271						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AAATCCATTTGATGATCCTGA	0.358					379							Hereditary_Prostate_Cancer				0.02459	-22.09102	8.517896	3	119	KEEP	---	---	---	---	4	1	62	75	-1	capture	Missense_Mutation	SNP	63086375	63086375	EHBP1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	4930	235
SMYD5	10322	broad.mit.edu	37	2	73449902	73449902	+	Missense_Mutation	SNP	G	A	A	rs116053390	by1000genomes	TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73449902G>A	uc002siw.2	+	7	691	c.662G>A	c.(661-663)CGG>CAG	p.R221Q	SMYD5_uc010yre.1_Missense_Mutation_p.R105Q|SMYD5_uc002six.1_RNA	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	221							metal ion binding				0						GAACTTCTGCGGAGACTCTTC	0.592																0.16	8.084508	10.835743	4	21	KEEP	---	---	---	---	1	4	10	14	-1	capture	Missense_Mutation	SNP	73449902	73449902	SMYD5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14717	235
CLASP1	23332	broad.mit.edu	37	2	122220134	122220134	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:122220134C>T	uc002tnc.2	-	10	1303	c.913G>A	c.(913-915)GCA>ACA	p.A305T	CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.A305T|CLASP1_uc010yza.1_Missense_Mutation_p.A305T|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tng.1_Missense_Mutation_p.A305T	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	305					axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					TCATCAAATGCTTTAATAAAA	0.328																0.181818	5.343846	6.389466	2	9	KEEP	---	---	---	---	0	4	7	5	-1	capture	Missense_Mutation	SNP	122220134	122220134	CLASP1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	3419	235
MYO3B	140469	broad.mit.edu	37	2	171358331	171358331	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:171358331A>G	uc002ufy.2	+	28	3469	c.3326A>G	c.(3325-3327)AAA>AGA	p.K1109R	MYO3B_uc002ufv.2_Missense_Mutation_p.K1096R|MYO3B_uc010fqb.1_Missense_Mutation_p.K1096R|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	1109	IQ 2.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						AAATTTAAGAAAATAAGCAAC	0.348					1118											0.321839	97.672408	100.123191	28	59	KEEP	---	---	---	---	20	14	33	39	-1	capture	Missense_Mutation	SNP	171358331	171358331	MYO3B	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	9987	235
DFNB59	494513	broad.mit.edu	37	2	179325759	179325759	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179325759C>A	uc002umi.3	+	7	1173	c.817C>A	c.(817-819)CTT>ATT	p.L273I	DFNB59_uc002umj.3_Missense_Mutation_p.L273I	NM_001042702	NP_001036167	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	273					sensory perception of sound						0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CTTGGATGATCTTTTTTCTGA	0.348																0.280405	205.479431	218.324658	83	213	KEEP	---	---	---	---	44	50	91	154	0.531914893617	capture	Missense_Mutation	SNP	179325759	179325759	DFNB59	2	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	4414	235
TTN	7273	broad.mit.edu	37	2	179423224	179423224	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179423224T>A	uc010zfg.1	-	276	79482	c.79258A>T	c.(79258-79260)AAC>TAC	p.N26420Y	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.N20115Y|TTN_uc010zfi.1_Missense_Mutation_p.N20048Y|TTN_uc010zfj.1_Missense_Mutation_p.N19923Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27347							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTAACCCAGTTTTTCTGTCCT	0.438					8722											0.197802	37.195568	44.936631	18	73	KEEP	---	---	---	---	6	12	24	61	-1	capture	Missense_Mutation	SNP	179423224	179423224	TTN	2	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	16617	235
TTN	7273	broad.mit.edu	37	2	179424446	179424446	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179424446C>A	uc010zfg.1	-	275	78933	c.78709G>T	c.(78709-78711)GAC>TAC	p.D26237Y	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.D19932Y|TTN_uc010zfi.1_Missense_Mutation_p.D19865Y|TTN_uc010zfj.1_Missense_Mutation_p.D19740Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27164							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTACGAGAGTCTGTGGTATCA	0.433					8722											0.183673	50.226351	64.04198	27	120	KEEP	---	---	---	---	16	14	55	75	0.466666666667	capture	Missense_Mutation	SNP	179424446	179424446	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	16617	235
SGPP2	130367	broad.mit.edu	37	2	223339305	223339305	+	Missense_Mutation	SNP	G	A	A	rs147179845		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223339305G>A	uc010zlo.1	+	2	238	c.238G>A	c.(238-240)GTC>ATC	p.V80I	SGPP2_uc010zlp.1_5'UTR	NM_152386	NP_689599	Q8IWX5	SGPP2_HUMAN	sphingosine-1-phosphate phosphotase 2	80					sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)		ACAGAAGTACGTCGTGAAGAA	0.363																0.245614	107.373374	117.445235	42	129	KEEP	---	---	---	---	21	31	70	89	-1	capture	Missense_Mutation	SNP	223339305	223339305	SGPP2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14113	235
SP140	11262	broad.mit.edu	37	2	231106159	231106159	+	Silent	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231106159C>T	uc002vql.2	+	4	562	c.447C>T	c.(445-447)AAC>AAT	p.N149N	SP140_uc010zma.1_RNA|SP140_uc002vqk.2_Silent_p.N149N|SP140_uc002vqn.2_Silent_p.N149N|SP140_uc002vqm.2_Silent_p.N149N|SP140_uc010fxl.2_Silent_p.N149N	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	149					defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ATAATGTAAACGATTTAGAAG	0.373					802											0.25	17.710592	19.301981	7	21	KEEP	---	---	---	---	2	7	16	10	-1	capture	Silent	SNP	231106159	231106159	SP140	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14854	235
RBM44	375316	broad.mit.edu	37	2	238726827	238726827	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238726827A>G	uc002vxi.3	+	3	1400	c.1268A>G	c.(1267-1269)CAG>CGG	p.Q423R		NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	422							nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		AGAGATAATCAGGCAATAGAA	0.368																0.055556	-0.980647	6.500102	2	34	KEEP	---	---	---	---	0	2	18	16	-1	capture	Missense_Mutation	SNP	238726827	238726827	RBM44	2	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	13033	235
C20orf118	140711	broad.mit.edu	37	20	35507541	35507541	+	Missense_Mutation	SNP	G	A	A	rs147682253		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:35507541G>A	uc002xgg.1	+	3	295	c.287G>A	c.(286-288)CGG>CAG	p.R96Q		NM_080628	NP_542195	A0PJX2	CT118_HUMAN	hypothetical protein LOC140711	96	TLD.										0		Myeloproliferative disorder(115;0.00874)				CTGTACCGGCGGATGGAGGGC	0.667																0.228916	48.626476	54.189237	19	64	KEEP	---	---	---	---	11	17	45	42	-1	capture	Missense_Mutation	SNP	35507541	35507541	C20orf118	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2066	235
NEURL2	140825	broad.mit.edu	37	20	44519558	44519558	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44519558G>A	uc002xqg.1	-	1	344	c.73C>T	c.(73-75)CGC>TGC	p.R25C	CTSA_uc002xqh.2_5'Flank|CTSA_uc002xqj.3_5'Flank|CTSA_uc002xqi.2_5'Flank|CTSA_uc010zxi.1_5'Flank|CTSA_uc002xqk.3_5'Flank	NM_080749	NP_542787	Q9BR09	NEUL2_HUMAN	neuralized-like protein 2	25	NHR.				intracellular signal transduction						0		Myeloproliferative disorder(115;0.0122)				CGATGGAAGCGGGTGGGAGGG	0.711																0.125	4.139745	6.336721	2	14	KEEP	---	---	---	---	0	2	11	9	-1	capture	Missense_Mutation	SNP	44519558	44519558	NEURL2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10253	235
NFATC2	4773	broad.mit.edu	37	20	50140360	50140360	+	Silent	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50140360C>T	uc002xwd.2	-	2	640	c.420G>A	c.(418-420)CCG>CCA	p.P140P	NFATC2_uc002xwc.2_Silent_p.P140P|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Silent_p.P120P|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Silent_p.P120P	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	140	Trans-activation domain A (TAD-A).				B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					CGGCCAGGGGCGGCTGCTCCA	0.721																0.363636	8.690512	8.872844	4	7	KEEP	---	---	---	---	3	2	5	10	-1	capture	Silent	SNP	50140360	50140360	NFATC2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10269	235
LAMA5	3911	broad.mit.edu	37	20	60912694	60912694	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60912694G>A	uc002ycq.2	-	16	2183	c.2116C>T	c.(2116-2118)CGG>TGG	p.R706W		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	706	Laminin EGF-like 8.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTGTCACACCGCAGCCCCGTC	0.667																0.107143	3.10699	7.392386	3	25	KEEP	---	---	---	---	1	2	16	13	-1	capture	Missense_Mutation	SNP	60912694	60912694	LAMA5	20	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8529	235
APP	351	broad.mit.edu	37	21	27369692	27369692	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:27369692G>A	uc002ylz.2	-	8	1273	c.1073C>T	c.(1072-1074)GCC>GTC	p.A358V	APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Missense_Mutation_p.A302V|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor	358	Extracellular (Potential).				adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)				AGGATCTCGGGCAAGAGGTTC	0.438																0.034483	-13.55639	6.968251	3	84	KEEP	---	---	---	---	1	2	58	48	-1	capture	Missense_Mutation	SNP	27369692	27369692	APP	21	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	808	235
TOP3B	8940	broad.mit.edu	37	22	22317253	22317253	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22317253C>A	uc002zvs.2	-	12	1652	c.1217G>T	c.(1216-1218)TGG>TTG	p.W406L	TOP3B_uc010gtm.1_5'UTR|TOP3B_uc002zvr.2_Missense_Mutation_p.W131L|TOP3B_uc010gtl.2_Missense_Mutation_p.W406L|TOP3B_uc002zvt.3_Missense_Mutation_p.W406L	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	406					DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		ATAGAGCCGCCACGCGTCACC	0.617																0.075	-0.906489	6.506485	3	37	KEEP	---	---	---	---	3	0	19	29	-1	capture	Missense_Mutation	SNP	22317253	22317253	TOP3B	22	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	16251	235
ADRBK2	157	broad.mit.edu	37	22	26086159	26086159	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26086159G>A	uc003abx.3	+	12	1108	c.961G>A	c.(961-963)GCA>ACA	p.A321T	ADRBK2_uc010gux.2_Missense_Mutation_p.A321T|ADRBK2_uc003abw.2_Missense_Mutation_p.A208T|ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2	321	Protein kinase.						ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	TGTTTAGCCAGCAAATATTCT	0.398					345											0.052632	-5.326837	6.732218	3	54	KEEP	---	---	---	---	5	0	28	31	-1	capture	Missense_Mutation	SNP	26086159	26086159	ADRBK2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	344	235
OSBP2	23762	broad.mit.edu	37	22	31137264	31137264	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31137264T>G	uc003aiy.1	+	2	865	c.761T>G	c.(760-762)CTC>CGC	p.L254R	OSBP2_uc011ala.1_Missense_Mutation_p.L89R|OSBP2_uc010gwc.1_Missense_Mutation_p.L81R|OSBP2_uc003aix.1_Missense_Mutation_p.L254R|OSBP2_uc011alb.1_Missense_Mutation_p.L254R|OSBP2_uc003aiz.1_Missense_Mutation_p.L254R	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a	254	PH.				lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						AGCTACCACCTCAAGGCCAGC	0.612																0.054054	-1.279483	6.475758	2	35	KEEP	---	---	---	---	3	0	14	24	-1	capture	Missense_Mutation	SNP	31137264	31137264	OSBP2	22	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	11178	235
MORC2	22880	broad.mit.edu	37	22	31336801	31336801	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:31336801C>T	uc003aje.1	-	11	2026	c.662G>A	c.(661-663)CGT>CAT	p.R221H		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	283	Potential.						ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2						GGTCTTGAAACGGCTTGACGT	0.567																0.25	79.581546	86.615468	31	93	KEEP	---	---	---	---	17	25	47	70	-1	capture	Missense_Mutation	SNP	31336801	31336801	MORC2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9614	235
ZFYVE20	64145	broad.mit.edu	37	3	15115967	15115967	+	Silent	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:15115967C>A	uc003bzm.1	-	14	2291	c.1677G>T	c.(1675-1677)CTG>CTT	p.L559L	ZFYVE20_uc010hek.1_Silent_p.L559L	NM_022340	NP_071735	Q9H1K0	RBNS5_HUMAN	FYVE-finger-containing Rab5 effector protein	559	Necessary for the interaction with EHD1.				blood coagulation|endosome transport|protein transport	early endosome membrane|plasma membrane	protein binding|zinc ion binding			skin(2)	2						TGCTGGGCTCCAGCTGAAAAG	0.572																0.056338	-6.963873	7.731757	4	67	KEEP	---	---	---	---	3	1	44	34	0.25	capture	Silent	SNP	15115967	15115967	ZFYVE20	3	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	17546	235
DHX30	22907	broad.mit.edu	37	3	47888187	47888187	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47888187G>A	uc003cru.2	+	11	2051	c.1625G>A	c.(1624-1626)CGT>CAT	p.R542H	DHX30_uc003crt.2_Missense_Mutation_p.R503H|MIR1226_hsa-mir-1226|MI0006313_5'Flank	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	542	Helicase ATP-binding.					mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		ATCCTGCTGCGTAAGCTGCAG	0.627																0.052632	-7.937064	8.109639	4	72	KEEP	---	---	---	---	0	4	41	43	-1	capture	Missense_Mutation	SNP	47888187	47888187	DHX30	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4462	235
MST1	4485	broad.mit.edu	37	3	49724639	49724639	+	Missense_Mutation	SNP	A	G	G	rs41291704		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49724639A>G	uc003cxg.2	-	5	622	c.550T>C	c.(550-552)TAC>CAC	p.Y184H	MST1_uc011bcs.1_Missense_Mutation_p.Y184H|MST1_uc010hkx.2_Missense_Mutation_p.Y105H|MST1_uc011bct.1_Missense_Mutation_p.Y184H|MST1_uc011bcu.1_RNA|RNF123_uc003cxh.2_5'Flank	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	170	Kringle 1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTGTTGTGTAGCACCAAGGA	0.627	GBM(110;181 1524 8005 22865 46297)															0.044118	-8.832212	6.305838	3	65	KEEP	---	---	---	---	0	3	36	35	-1	capture	Missense_Mutation	SNP	49724639	49724639	MST1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	9800	235
NEK4	6787	broad.mit.edu	37	3	52778291	52778291	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52778291G>A	uc003dfq.3	-	11	2047	c.1858C>T	c.(1858-1860)CGA>TGA	p.R620*	NEK4_uc011bej.1_Nonsense_Mutation_p.R531*|NEK4_uc003dfr.2_Nonsense_Mutation_p.R574*	NM_003157	NP_003148	P51957	NEK4_HUMAN	NIMA-related kinase 4	620					cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		TGCTTTAGTCGCCTCCTCTCT	0.413					346											0.252964	151.833733	165.824061	64	189	KEEP	---	---	---	---	30	46	91	134	-1	capture	Nonsense_Mutation	SNP	52778291	52778291	NEK4	3	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	10233	235
ACOX2	8309	broad.mit.edu	37	3	58510285	58510285	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58510285G>A	uc003dkl.2	-	11	1569	c.1394C>T	c.(1393-1395)ACG>ATG	p.T465M		NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2	465					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		TCTCTGTGGCGTGGAGCCAGG	0.617																0.308511	76.935717	80.010107	29	65	KEEP	---	---	---	---	12	20	39	44	-1	capture	Missense_Mutation	SNP	58510285	58510285	ACOX2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	159	235
C3orf67	200844	broad.mit.edu	37	3	58853638	58853638	+	Missense_Mutation	SNP	G	A	A	rs141916956	byFrequency	TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58853638G>A	uc003dkt.1	-	10	1074	c.665C>T	c.(664-666)CCG>CTG	p.P222L	C3orf67_uc003dks.1_Missense_Mutation_p.P37L|uc003dku.1_Intron|C3orf67_uc003dkv.1_Missense_Mutation_p.P37L|C3orf67_uc003dkw.2_Intron	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	222											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		AGGGGGATGCGGATGCATAAT	0.388																0.2	45.396821	52.930795	18	72	KEEP	---	---	---	---	12	11	40	41	-1	capture	Missense_Mutation	SNP	58853638	58853638	C3orf67	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2221	235
ZXDC	79364	broad.mit.edu	37	3	126160628	126160628	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126160628C>G	uc003eiv.2	-	8	2428	c.2374G>C	c.(2374-2376)GTC>CTC	p.V792L	ZXDC_uc010hsh.2_RNA	NM_025112	NP_079388	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C isoform 1	792	Interaction with CIITA.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|LRR domain binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.155)		TGGACCTGGACGCCCTGCGCC	0.677																0.04	-7.836525	9.261999	3	72	KEEP	---	---	---	---	0	3	32	44	-1	capture	Missense_Mutation	SNP	126160628	126160628	ZXDC	3	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	18128	235
TRIM42	287015	broad.mit.edu	37	3	140397352	140397352	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140397352G>A	uc003eto.1	+	1	472	c.281G>A	c.(280-282)CGC>CAC	p.R94H		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	94	Cys-rich.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TATGAGAGCCGCTGCTGCCGC	0.557				p.R94H(NCCSTCK140-Tumor)	261											0.137931	6.582175	10.257249	4	25	KEEP	---	---	---	---	5	5	23	17	-1	capture	Missense_Mutation	SNP	140397352	140397352	TRIM42	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16400	235
CP	1356	broad.mit.edu	37	3	148901264	148901264	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148901264A>T	uc003ewy.3	-	13	2667	c.2414T>A	c.(2413-2415)CTG>CAG	p.L805Q	CP_uc011bnr.1_RNA|CP_uc003ewx.3_Missense_Mutation_p.L586Q|CP_uc003ewz.2_Missense_Mutation_p.L805Q	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	805	Plastocyanin-like 5.|F5/8 type A 3.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TAGAATTCCCAGATGTTCTTC	0.398																0.254335	119.816758	129.291777	44	129	KEEP	---	---	---	---	25	28	67	81	-1	capture	Missense_Mutation	SNP	148901264	148901264	CP	3	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	3752	235
PIK3CA	5290	broad.mit.edu	37	3	178952072	178952072	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178952072A>G	uc003fjk.2	+	21	3284	c.3127A>G	c.(3127-3129)ATG>GTG	p.M1043V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1043	PI3K/PI4K.		M -> I (in cancer; shows an increase in lipid kinase activity).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.M1043I(31)|p.M1043V(15)|p.M1043T(3)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			CATGAAACAAATGAATGATGC	0.368	Colon(199;1504 1750 3362 26421 31210 32040)		57		621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.287356	81.441808	84.968203	25	62	KEEP	---	---	---	---	14	12	34	35	-1	capture	Missense_Mutation	SNP	178952072	178952072	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11816	235
DRD5	1816	broad.mit.edu	37	4	9784905	9784905	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784905G>A	uc003gmb.3	+	1	1648	c.1252G>A	c.(1252-1254)GTT>ATT	p.V418I		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	418	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GCCCAACGCCGTTACCCCCGG	0.557																0.282258	93.477291	98.756313	35	89	KEEP	---	---	---	---	15	26	43	68	-1	capture	Missense_Mutation	SNP	9784905	9784905	DRD5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4715	235
KLB	152831	broad.mit.edu	37	4	39408665	39408665	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39408665C>A	uc003gua.2	+	1	193	c.96C>A	c.(94-96)AAC>AAA	p.N32K	KLB_uc011byj.1_Missense_Mutation_p.N32K	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	32	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						CAATGTCCAACGGGGGATTGC	0.453																0.021898	-28.399695	6.570683	3	134	KEEP	---	---	---	---	2	1	67	71	0.333333333333	capture	Missense_Mutation	SNP	39408665	39408665	KLB	4	C	A	A	A	1	0	0	0	0	1	0	0	0	246	19	4	4	8253	235
FRAS1	80144	broad.mit.edu	37	4	79173649	79173649	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79173649A>G	uc003hlb.2	+	5	853	c.413A>G	c.(412-414)CAG>CGG	p.Q138R	FRAS1_uc003hkw.2_Missense_Mutation_p.Q138R|FRAS1_uc003hky.1_5'UTR|FRAS1_uc003hkz.2_5'Flank	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	138	VWFC 2.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGTGGACACCAGGAGCTGGCA	0.562																0.285714	56.524762	59.119951	18	45	KEEP	---	---	---	---	7	13	24	25	-1	capture	Missense_Mutation	SNP	79173649	79173649	FRAS1	4	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	5986	235
CENPE	1062	broad.mit.edu	37	4	104117134	104117134	+	Silent	SNP	T	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104117134T>C	uc003hxb.1	-	4	390	c.300A>G	c.(298-300)GAA>GAG	p.E100E	CENPE_uc003hxc.1_Silent_p.E100E	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	100	Kinesin-motor.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CCAAATGATCTTCTGAACCCA	0.348																0.047619	-2.787387	6.36265	2	40	KEEP	---	---	---	---	0	4	19	21	-1	capture	Silent	SNP	104117134	104117134	CENPE	4	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	3198	235
PRSS12	8492	broad.mit.edu	37	4	119239641	119239641	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:119239641G>A	uc003ica.1	-	5	1089	c.1042C>T	c.(1042-1044)CGC>TGC	p.R348C		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	348	SRCR 2.					membrane	scavenger receptor activity			skin(1)	1						CCAGTGCAGCGTACTTCATCC	0.478																0.205128	35.87024	42.151226	16	62	KEEP	---	---	---	---	11	7	25	43	-1	capture	Missense_Mutation	SNP	119239641	119239641	PRSS12	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12510	235
TLL1	7092	broad.mit.edu	37	4	166910622	166910622	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:166910622G>A	uc003irh.1	+	2	906	c.259G>A	c.(259-261)GGA>AGA	p.G87R	TLL1_uc011cjn.1_Missense_Mutation_p.G87R|TLL1_uc011cjo.1_5'UTR	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	87					cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GAACCCCTTTGGAAACCTTGG	0.333																0.338028	74.976356	76.624483	24	47	KEEP	---	---	---	---	13	17	44	17	-1	capture	Missense_Mutation	SNP	166910622	166910622	TLL1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15830	235
ENPP6	133121	broad.mit.edu	37	4	185018423	185018423	+	Silent	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185018423C>G	uc003iwc.2	-	7	1234	c.1092G>C	c.(1090-1092)CGG>CGC	p.R364R		NM_153343	NP_699174	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	364	Extracellular (Potential).				lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		GGAAGATGCCCCGCATGTCCA	0.587																0.221154	53.183357	60.61968	23	81	KEEP	---	---	---	---	12	12	39	45	-1	capture	Silent	SNP	185018423	185018423	ENPP6	4	C	G	G	G	1	0	0	0	0	0	0	0	1	275	22	4	4	5089	235
PRDM9	56979	broad.mit.edu	37	5	23527861	23527861	+	Silent	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23527861C>T	uc003jgo.2	+	11	2846	c.2664C>T	c.(2662-2664)TAC>TAT	p.Y888Y		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	888					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						AGAAGCCCTACGTCTGCAGGG	0.527													HNSCC(3;0.000094)			0.2625	57.942841	62.021931	21	59	KEEP	---	---	---	---	11	16	35	37	-1	capture	Silent	SNP	23527861	23527861	PRDM9	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12359	235
FAM170A	340069	broad.mit.edu	37	5	118970068	118970068	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:118970068G>A	uc003ksm.2	+	3	835	c.625G>A	c.(625-627)GTT>ATT	p.V209I	FAM170A_uc003ksl.2_Intron|FAM170A_uc003ksn.2_Missense_Mutation_p.V209I|FAM170A_uc003kso.2_Missense_Mutation_p.V162I	NM_182761	NP_877438	A1A519	F170A_HUMAN	family with sequence similarity 170, member A	209						intracellular	zinc ion binding			skin(1)	1						CTCACCCACCGTTGAGGACAC	0.587																0.298507	109.749624	114.611153	40	94	KEEP	---	---	---	---	23	35	59	79	-1	capture	Missense_Mutation	SNP	118970068	118970068	FAM170A	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5442	235
PCDHA7	56141	broad.mit.edu	37	5	140215694	140215694	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140215694G>A	uc003lhq.2	+	1	1726	c.1726G>A	c.(1726-1728)GCA>ACA	p.A576T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.A576T	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	576	Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACTGGTGGCGCAGTGAGAGA	0.662	NSCLC(160;258 2013 5070 22440 28951)															0.263736	59.058637	63.652378	24	67	KEEP	---	---	---	---	8	17	35	35	-1	capture	Missense_Mutation	SNP	140215694	140215694	PCDHA7	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11432	235
PCDHA8	56140	broad.mit.edu	37	5	140221979	140221979	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140221979C>G	uc003lhs.2	+	1	1073	c.1073C>G	c.(1072-1074)CCT>CGT	p.P358R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.P358R	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	358	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTATCCTTGCCTGTACGTGAA	0.502																0.3125	109.44756	113.45688	40	88	KEEP	---	---	---	---	25	34	155	170	-1	capture	Missense_Mutation	SNP	140221979	140221979	PCDHA8	5	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	11433	235
PCDHGA2	56113	broad.mit.edu	37	5	140720522	140720522	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140720522G>A	uc003ljk.1	+	1	2169	c.1984G>A	c.(1984-1986)GTG>ATG	p.V662M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.V662M	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	662	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACGCTCACCGTGGCCGTGGC	0.682																0.39726	88.467298	89.138962	29	44	KEEP	---	---	---	---	19	18	42	69	-1	capture	Missense_Mutation	SNP	140720522	140720522	PCDHGA2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11457	235
PCDHGA2	56113	broad.mit.edu	37	5	140720558	140720558	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140720558G>A	uc003ljk.1	+	1	2205	c.2020G>A	c.(2020-2022)GAC>AAC	p.D674N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.D674N	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	674	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCCTGGCCGACCTGGGCAG	0.687																0.039216	-14.963053	8.386208	4	98	KEEP	---	---	---	---	1	3	67	63	-1	capture	Missense_Mutation	SNP	140720558	140720558	PCDHGA2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11457	235
TBC1D9B	23061	broad.mit.edu	37	5	179318430	179318430	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179318430G>A	uc003mlh.2	-	6	1030	c.993C>T	c.(991-993)TGC>TGT	p.C331C	TBC1D9B_uc003mli.2_Silent_p.C331C|TBC1D9B_uc003mlj.2_Silent_p.C331C	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	331	GRAM 2.					integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCTGGCGAAGCAGATGTAGT	0.592																0.032	-23.075094	6.845386	4	121	KEEP	---	---	---	---	0	4	58	88	-1	capture	Silent	SNP	179318430	179318430	TBC1D9B	5	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	15515	235
DSP	1832	broad.mit.edu	37	6	7582878	7582878	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7582878T>C	uc003mxp.1	+	24	5662	c.5383T>C	c.(5383-5385)TCT>CCT	p.S1795P	DSP_uc003mxq.1_Missense_Mutation_p.S1196P	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1795	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATTCCAGGCATCTAATAGGAT	0.353																0.02439	-24.478886	6.409996	3	120	KEEP	---	---	---	---	2	1	73	55	-1	capture	Missense_Mutation	SNP	7582878	7582878	DSP	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	4736	235
PHACTR1	221692	broad.mit.edu	37	6	13278556	13278556	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:13278556C>G	uc010jpc.2	+	12	1836	c.1504C>G	c.(1504-1506)CGA>GGA	p.R502G	PHACTR1_uc003nah.1_Missense_Mutation_p.R502G|TBC1D7_uc003naj.2_Intron|TBC1D7_uc011dis.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	502	RPEL 4.					cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GAGGCTAACCCGAAAGGTAGG	0.507																0.153846	5.941257	7.430488	2	11	KEEP	---	---	---	---	0	2	5	7	-1	capture	Missense_Mutation	SNP	13278556	13278556	PHACTR1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	295	23	4	4	11712	235
BAT1	7919	broad.mit.edu	37	6	31508154	31508154	+	Silent	SNP	G	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31508154G>C	uc003ntt.2	-	2	787	c.156C>G	c.(154-156)CTC>CTG	p.L52L	BAT1_uc003nts.2_Silent_p.L52L|BAT1_uc011dnn.1_Nonsense_Mutation_p.S48*|BAT1_uc003ntu.2_Silent_p.L52L|BAT1_uc003ntv.2_Silent_p.L52L|BAT1_uc003ntw.2_Silent_p.L52L|BAT1_uc003ntx.2_Silent_p.L52L|BAT1_uc011dno.1_Nonsense_Mutation_p.S48*|BAT1_uc011dnp.1_Nonsense_Mutation_p.S48*|BAT1_uc011dnq.1_RNA	NM_004640	NP_004631	Q13838	DX39B_HUMAN	HLA-B associated transcript 1	52	Q motif.				intronless viral mRNA export from host nucleus|RNA secondary structure unwinding|spliceosome assembly	nuclear speck|spliceosomal complex|transcription export complex	ATP binding|ATP-dependent protein binding|ATP-dependent RNA helicase activity|identical protein binding|U4 snRNA binding|U6 snRNA binding				0						ACTCTGGCTTGAGCAGGAAGT	0.547																0.219178	46.463539	51.764143	16	57	KEEP	---	---	---	---	10	12	40	35	-1	capture	Silent	SNP	31508154	31508154	BAT1	6	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	1307	235
SKIV2L	6499	broad.mit.edu	37	6	31933760	31933760	+	Silent	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31933760C>A	uc003nyn.1	+	18	2561	c.2172C>A	c.(2170-2172)CCC>CCA	p.P724P	SKIV2L_uc011dou.1_Silent_p.P566P|SKIV2L_uc011dov.1_Silent_p.P531P	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	724	Helicase C-terminal.					nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						GCCGAGTGCCCGAGATGGCAG	0.652																0.083333	2.133359	6.36527	2	22	KEEP	---	---	---	---	2	0	10	15	-1	capture	Silent	SNP	31933760	31933760	SKIV2L	6	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	14252	235
C6orf168	84553	broad.mit.edu	37	6	99729047	99729047	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:99729047C>A	uc003ppj.3	-	6	1506	c.1223G>T	c.(1222-1224)TGC>TTC	p.C408F	C6orf168_uc003ppi.3_Missense_Mutation_p.C128F	NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553	408										ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)		ACGTCACTTGCACTGTTCGTG	0.517																0.05	-8.767021	8.416022	4	76	KEEP	---	---	---	---	2	2	30	55	0.5	capture	Missense_Mutation	SNP	99729047	99729047	C6orf168	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	2320	235
BCLAF1	9774	broad.mit.edu	37	6	136597032	136597032	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136597032C>T	uc003qgx.1	-	5	1884	c.1631G>A	c.(1630-1632)CGT>CAT	p.R544H	BCLAF1_uc003qgw.1_Missense_Mutation_p.R371H|BCLAF1_uc003qgy.1_Missense_Mutation_p.R542H|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R542H	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	544					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GACTTCAGGACGGTGAGAATC	0.433	Colon(142;1534 1789 5427 7063 28491)															0.100897	33.433025	104.354807	45	401	KEEP	---	---	---	---	26	25	210	251	-1	capture	Missense_Mutation	SNP	136597032	136597032	BCLAF1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1372	235
SYNE1	23345	broad.mit.edu	37	6	152685991	152685991	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152685991C>T	uc010kiw.2	-	63	10738	c.10136G>A	c.(10135-10137)CGT>CAT	p.R3379H	SYNE1_uc003qot.3_Missense_Mutation_p.R3386H|SYNE1_uc003qou.3_Missense_Mutation_p.R3379H|SYNE1_uc010kja.1_Missense_Mutation_p.R84H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3379	Spectrin 7.|HAT 6.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTTTTACAACGAATCCCTGC	0.448													HNSCC(10;0.0054)			0.256	78.229674	84.989291	32	93	KEEP	---	---	---	---	13	26	45	66	-1	capture	Missense_Mutation	SNP	152685991	152685991	SYNE1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15333	235
INMT	11185	broad.mit.edu	37	7	30795056	30795056	+	Silent	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30795056G>A	uc003tbs.1	+	3	397	c.381G>A	c.(379-381)AAG>AAA	p.K127K	FAM188B_uc010kwe.2_Intron|INMT_uc010kwc.1_RNA|INMT_uc010kwd.1_Silent_p.K126K	NM_006774	NP_006765	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	127						cytoplasm	amine N-methyltransferase activity				0						GGGAGGAGAAGGAGGAGAAGC	0.637																0.111111	3.745687	6.428787	2	16	KEEP	---	---	---	---	0	2	9	10	-1	capture	Silent	SNP	30795056	30795056	INMT	7	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7668	235
SEPT7	989	broad.mit.edu	37	7	35872442	35872442	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:35872442C>T	uc010kxc.2	+	2	294	c.101C>T	c.(100-102)GCC>GTC	p.A34V	SEPT7_uc011kat.1_Missense_Mutation_p.A33V|SEPT7_uc011kau.1_Intron|SEPT7_uc011kav.1_5'UTR	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1	34					cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						GTGGGATTTGCCAATCTCCCA	0.363																0.031008	-24.410513	6.677332	4	125	KEEP	---	---	---	---	1	3	74	78	-1	capture	Missense_Mutation	SNP	35872442	35872442	SEPT7	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13962	235
COL1A2	1278	broad.mit.edu	37	7	94034005	94034005	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94034005G>T	uc003ung.1	+	8	796	c.325G>T	c.(325-327)GGC>TGC	p.G109C	COL1A2_uc011kib.1_Missense_Mutation_p.G109C|COL1A2_uc010lfh.1_5'Flank	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	109					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TTTCTTTTAGGGCCCTCAAGG	0.403													HNSCC(75;0.22)			0.236453	112.416493	125.293766	48	155	KEEP	---	---	---	---	12	38	77	94	0.24	capture	Missense_Mutation	SNP	94034005	94034005	COL1A2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	3643	235
MUC17	140453	broad.mit.edu	37	7	100675953	100675953	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100675953A>G	uc003uxp.1	+	3	1309	c.1256A>G	c.(1255-1257)GAC>GGC	p.D419G	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	419	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ATTCCTGTTGACTCCAAAACT	0.463																0.203343	183.996113	213.321705	73	286	KEEP	---	---	---	---	26	54	145	162	-1	capture	Missense_Mutation	SNP	100675953	100675953	MUC17	7	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	9884	235
MGAM	8972	broad.mit.edu	37	7	141736731	141736731	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141736731C>T	uc003vwy.2	+	18	2239	c.2185C>T	c.(2185-2187)CGT>TGT	p.R729C		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	729	Lumenal (Potential).|Maltase.				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTCTTCTTCCGTGCTCACAG	0.493																0.181675	251.622563	311.937105	115	518	KEEP	---	---	---	---	78	79	287	392	-1	capture	Missense_Mutation	SNP	141736731	141736731	MGAM	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	9453	235
TRYX3	136541	broad.mit.edu	37	7	141954883	141954883	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141954883C>T	uc003vxb.2	-	3	748	c.428G>A	c.(427-429)TGT>TAT	p.C143Y	TRYX3_uc003vxc.3_Missense_Mutation_p.C143Y	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor	143	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					ACAGATATCACACACATTGTA	0.433																0.201681	152.080545	181.619991	72	285	KEEP	---	---	---	---	43	39	150	177	-1	capture	Missense_Mutation	SNP	141954883	141954883	TRYX3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16487	235
ZNF282	8427	broad.mit.edu	37	7	148921339	148921339	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148921339G>A	uc003wfm.2	+	8	1721	c.1616G>A	c.(1615-1617)AGC>AAC	p.S539N	ZNF282_uc011kun.1_Splice_Site_p.P454_splice|ZNF282_uc003wfo.2_Missense_Mutation_p.A216T	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	539	C2H2-type 1.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CACCACCGCAGCCACACCAAG	0.682																0.103448	2.801839	7.344081	3	26	KEEP	---	---	---	---	2	2	23	20	-1	capture	Missense_Mutation	SNP	148921339	148921339	ZNF282	7	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	17699	235
TEX15	56154	broad.mit.edu	37	8	30694497	30694497	+	Silent	SNP	C	T	T	rs142941425		TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30694497C>T	uc003xil.2	-	3	8154	c.8154G>A	c.(8152-8154)GCG>GCA	p.A2718A		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	2718										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTGGCTCCCCCGCAAAATAAG	0.423																0.236641	69.8359	78.168023	31	100	KEEP	---	---	---	---	17	17	47	83	-1	capture	Silent	SNP	30694497	30694497	TEX15	8	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15664	235
PXDNL	137902	broad.mit.edu	37	8	52387561	52387561	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52387561G>A	uc003xqu.3	-	7	766	c.665C>T	c.(664-666)GCT>GTT	p.A222V		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	222	LRRCT.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TGTTACTGAAGCAACTGCACG	0.463																0.133333	4.838909	6.796396	2	13	KEEP	---	---	---	---	2	0	4	9	-1	capture	Missense_Mutation	SNP	52387561	52387561	PXDNL	8	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	12743	235
TSNARE1	203062	broad.mit.edu	37	8	143436006	143436006	+	Missense_Mutation	SNP	T	C	C	rs117184426	byFrequency;by1000genomes	TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143436006T>C	uc003ywk.2	-	2	198	c.80A>G	c.(79-81)CAG>CGG	p.Q27R	TSNARE1_uc011lju.1_Missense_Mutation_p.Q27R|TSNARE1_uc003ywj.2_Missense_Mutation_p.Q27R|TSNARE1_uc003ywl.3_Missense_Mutation_p.Q27R	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	27					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ACCTAGGGGCTGACAGCCTTG	0.602																0.078947	1.595033	8.474308	3	35	KEEP	---	---	---	---	0	3	19	21	-1	capture	Missense_Mutation	SNP	143436006	143436006	TSNARE1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	16513	235
SPATC1	375686	broad.mit.edu	37	8	145095019	145095019	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145095019C>G	uc011lkw.1	+	2	523	c.421C>G	c.(421-423)CTG>GTG	p.L141V	SPATC1_uc011lkx.1_Missense_Mutation_p.L141V	NM_198572	NP_940974	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	141										ovary(1)|central_nervous_system(1)	2	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CACCAGCTTCCTGACCAGTCC	0.682																0.117647	3.946761	6.38152	2	15	KEEP	---	---	---	---	0	2	3	14	-1	capture	Missense_Mutation	SNP	145095019	145095019	SPATC1	8	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	14909	235
ADAMTSL1	92949	broad.mit.edu	37	9	18777020	18777020	+	Silent	SNP	T	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:18777020T>C	uc003zne.3	+	19	2920	c.2793T>C	c.(2791-2793)TAT>TAC	p.Y931Y		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	931	Ig-like C2-type 1.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		CCTTCGGCTATCTCAAGATCC	0.662																0.371795	92.457255	93.582527	29	49	KEEP	---	---	---	---	16	20	28	32	-1	capture	Silent	SNP	18777020	18777020	ADAMTSL1	9	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	274	235
NOL6	65083	broad.mit.edu	37	9	33467806	33467806	+	Silent	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33467806C>T	uc003zsz.2	-	12	1586	c.1485G>A	c.(1483-1485)CTG>CTA	p.L495L	SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zsy.2_5'Flank|NOL6_uc003zta.2_Silent_p.L495L|NOL6_uc010mjv.2_Silent_p.L492L|NOL6_uc011lob.1_Silent_p.L443L|NOL6_uc003ztb.1_Silent_p.L495L	NM_022917	NP_075068	Q9H6R4	NOL6_HUMAN	nucleolar protein family 6 alpha isoform	495					rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		CATTGTCCTGCAGCTCTGGCC	0.637																0.066667	-2.213386	6.549426	3	42	KEEP	---	---	---	---	0	3	17	34	-1	capture	Silent	SNP	33467806	33467806	NOL6	9	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	10432	235
C9orf139	401563	broad.mit.edu	37	9	139929144	139929144	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139929144C>T	uc004ckp.1	+	3	1725	c.211C>T	c.(211-213)CGC>TGC	p.R71C	FUT7_uc004ckq.2_5'Flank	NM_207511	NP_997394	Q6ZV77	CI139_HUMAN	hypothetical protein LOC401563	71											0	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		TGTCCTGCCACGCCTGCGGGT	0.657																0.233333	40.525586	46.392724	21	69	KEEP	---	---	---	---	32	22	71	61	-1	capture	Missense_Mutation	SNP	139929144	139929144	C9orf139	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2436	235
DACH2	117154	broad.mit.edu	37	X	85403790	85403790	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:85403790G>A	uc004eew.2	+	1	336	c.166G>A	c.(166-168)GGA>AGA	p.G56R	DACH2_uc004eex.2_Missense_Mutation_p.G56R|DACH2_uc010nmq.2_5'UTR	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	56	Poly-Gly.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						CAACAGTGCCGGAGGCGGCGG	0.567																0.1	2.010246	6.799847	3	27	KEEP	---	---	---	---	1	3	17	15	-1	capture	Missense_Mutation	SNP	85403790	85403790	DACH2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4181	235
SRPX2	27286	broad.mit.edu	37	X	99925877	99925877	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99925877T>C	uc004egb.2	+	11	1771	c.1291T>C	c.(1291-1293)TAC>CAC	p.Y431H		NM_014467	NP_055282	O60687	SRPX2_HUMAN	sushi-repeat-containing protein, X-linked 2	431					angiogenesis|cell motility|cell-cell adhesion|positive regulation of cell migration involved in sprouting angiogenesis|regulation of phosphorylation	cytoplasm|extracellular region	receptor binding			ovary(2)	2						CCGAGACCGCTACATGGAACC	0.512														OREG0019890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.539683	129.459033	129.545762	34	29	KEEP	---	---	---	---	19	30	19	19	-1	capture	Missense_Mutation	SNP	99925877	99925877	SRPX2	23	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	15057	235
GPRASP2	114928	broad.mit.edu	37	X	101972268	101972268	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101972268C>G	uc004ejk.2	+	4	3805	c.2471C>G	c.(2470-2472)GCC>GGC	p.A824G	GPRASP2_uc004ejl.2_Missense_Mutation_p.A824G|GPRASP2_uc004ejm.2_Missense_Mutation_p.A824G|GPRASP2_uc011mrp.1_Missense_Mutation_p.A163G	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	824						cytoplasm	protein binding			ovary(1)	1						CAACTACAAGCCCAAATAGAC	0.403																0.039062	-16.941472	12.418784	5	123	KEEP	---	---	---	---	3	2	68	68	-1	capture	Missense_Mutation	SNP	101972268	101972268	GPRASP2	23	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	6656	235
ZCCHC18	644353	broad.mit.edu	37	X	103359839	103359839	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103359839C>G	uc011msh.1	+	3	2353	c.1037C>G	c.(1036-1038)ACA>AGA	p.T346R	MCART6_uc004elu.2_Intron|ZCCHC18_uc011msg.1_Intron	NM_001143978	NP_001137450	P0CG32	ZCC18_HUMAN	zinc finger, CCHC domain containing 18	346							nucleic acid binding|zinc ion binding				0						CGAAAATACACAACCCGCTGT	0.483																0.142857	4.64025	6.360871	2	12	KEEP	---	---	---	---	2	0	3	12	-1	capture	Missense_Mutation	SNP	103359839	103359839	ZCCHC18	23	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	17466	235
KIAA0528	9847	broad.mit.edu	37	12	22602814	22602815	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:22602814_22602815delAA	uc001rfq.2	-	25	3110_3111	c.2882_2883delTT	c.(2881-2883)CTTfs	p.L961fs	KIAA0528_uc010sir.1_Frame_Shift_Del_p.L817fs|KIAA0528_uc010sis.1_Frame_Shift_Del_p.L1012fs|KIAA0528_uc010sit.1_Frame_Shift_Del_p.L1014fs|KIAA0528_uc010siu.1_Frame_Shift_Del_p.L1012fs|KIAA0528_uc001rfr.2_Frame_Shift_Del_p.L1003fs	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	961							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						TTACATTTATAAGACACTGTGC	0.411																0.26			50	143		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	22602814	22602815	KIAA0528	12	AA	-	-	-	1	0	1	0	1	0	0	0	0	158	13	5	5	8104	235
SEMA4F	10505	broad.mit.edu	37	2	74907015	74907016	+	Frame_Shift_Ins	INS	-	G	G			TCGA-32-2491-01	TCGA-32-2491-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74907015_74907016insG	uc002sna.1	+	14	2103_2104	c.1992_1993insG	c.(1990-1995)GCTGGCfs	p.A664fs	SEMA4F_uc010ffr.1_Frame_Shift_Ins_p.A276fs|SEMA4F_uc002snb.1_Frame_Shift_Ins_p.A276fs|SEMA4F_uc002snc.1_Frame_Shift_Ins_p.A509fs	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	664_665	Helical; (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CGGGACTGGCTGGCTTCTTCTT	0.619																0.07			7	100		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	74907015	74907016	SEMA4F	2	-	G	G	G	1	0	1	1	0	0	0	0	0	704	55	5	5	13928	235
