Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TNFRSF9	3604	broad.mit.edu	37	1	7995185	7995185	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7995185C>T	uc001aot.2	-	6	560	c.432G>A	c.(430-432)AAG>AAA	p.K144K		NM_001561	NP_001552	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily,	144	Extracellular (Potential).|TNFR-Cys 4.				induction of apoptosis|negative regulation of cell proliferation	integral to plasma membrane	binding|receptor activity			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGCACAGACTTTCCATCCA	0.468													19	59	---	---	---	---	PASS
PLOD1	5351	broad.mit.edu	37	1	12027126	12027126	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12027126A>T	uc001atm.2	+	16	1824	c.1733A>T	c.(1732-1734)CAG>CTG	p.Q578L	PLOD1_uc010obb.1_Missense_Mutation_p.Q625L	NM_000302	NP_000293	Q02809	PLOD1_HUMAN	lysyl hydroxylase 1 precursor	578					epidermis development|hydroxylysine biosynthetic process|protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein homodimerization activity			ovary(2)|breast(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Minoxidil(DB00350)|Succinic acid(DB00139)|Vitamin C(DB00126)	CACTTTGGCCAGTGGTCTCTG	0.632													36	78	---	---	---	---	PASS
RHD	6007	broad.mit.edu	37	1	25628018	25628018	+	Silent	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25628018C>G	uc001bjz.2	+	5	700	c.642C>G	c.(640-642)CTC>CTG	p.L214L	RHD_uc010oep.1_Silent_p.L214L|RHD_uc001bkc.2_Silent_p.L214L|RHD_uc009vrm.2_Silent_p.L46L|RHD_uc001bka.2_Silent_p.L214L|RHD_uc001bkb.2_Silent_p.L214L|RHD_uc009vrn.2_Silent_p.L214L|RHD_uc009vro.2_Silent_p.L214L|RHD_uc009vrp.2_Silent_p.L214L	NM_016124	NP_057208	Q02161	RHD_HUMAN	Rh blood group D antigen isoform 1	214	Helical; (Potential).					integral to plasma membrane				breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CAGGCGCCCTCTTCTTGTGGA	0.537													7	184	---	---	---	---	PASS
PTGER3	5733	broad.mit.edu	37	1	71512400	71512400	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71512400G>T	uc001dfg.1	-	1	1092	c.861C>A	c.(859-861)ATC>ATA	p.I287I	PTGER3_uc001dfh.1_RNA|PTGER3_uc001dfi.1_RNA|PTGER3_uc001dfj.1_RNA|PTGER3_uc001dfk.1_Silent_p.I287I|PTGER3_uc001dfl.1_Silent_p.I287I|PTGER3_uc009wbm.1_Silent_p.I287I|PTGER3_uc001dfm.1_RNA|PTGER3_uc001dfn.2_Silent_p.I287I|PTGER3_uc009wbn.1_Silent_p.I287I|PTGER3_uc009wbo.2_Silent_p.I287I|PTGER3_uc001dfo.2_Silent_p.I287I|PTGER3_uc001dfp.1_Silent_p.I287I|PTGER3_uc001dfq.2_Silent_p.I287I|uc001dfr.2_RNA	NM_198714	NP_942007	P43115	PE2R3_HUMAN	prostaglandin E receptor 3, subtype EP3 isoform	287	Helical; Name=6; (Potential).				cell death|positive regulation of fever generation|transcription, DNA-dependent	integral to plasma membrane|nuclear envelope	ligand-dependent nuclear receptor activity|prostaglandin E receptor activity			pancreas(1)|lung(1)|skin(1)	3					Bimatoprost(DB00905)	GCACGCACATGATCCCCATAA	0.627													23	74	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74954877	74954877	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74954877G>T	uc001dgf.1	+	22	2177	c.2126G>T	c.(2125-2127)AGA>ATA	p.R709I	TNNI3K_uc001dge.1_Missense_Mutation_p.R810I	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	709	Protein kinase.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						TTACAGGGAAGACCCGAATTT	0.343													28	91	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75078454	75078454	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75078454G>T	uc001dgg.2	-	9	1259	c.1040C>A	c.(1039-1041)CCC>CAC	p.P347H	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.P141H	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	347										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						GAGACTGAAGGGGAAACCATG	0.413													16	44	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76343990	76343990	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76343990A>G	uc001dhd.1	+	11	1568	c.1527A>G	c.(1525-1527)GTA>GTG	p.V509V		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	509					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						CAGAGATTGTAGATGACATAG	0.373								MMR					8	64	---	---	---	---	PASS
MSH4	4438	broad.mit.edu	37	1	76349469	76349469	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76349469A>T	uc001dhd.1	+	15	2111	c.2070A>T	c.(2068-2070)TTA>TTT	p.L690F		NM_002440	NP_002431	O15457	MSH4_HUMAN	mutS homolog 4	690					chiasma assembly|homologous chromosome segregation|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			lung(3)|ovary(2)	5						CCACATATTTAAAACAGATTG	0.348								MMR					39	107	---	---	---	---	PASS
DNASE2B	58511	broad.mit.edu	37	1	84880477	84880477	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84880477T>C	uc001djt.1	+	6	1045	c.1012T>C	c.(1012-1014)TTC>CTC	p.F338L	DNASE2B_uc001dju.1_Missense_Mutation_p.F130L|DNASE2B_uc009wch.1_Missense_Mutation_p.F130L	NM_021233	NP_067056	Q8WZ79	DNS2B_HUMAN	deoxyribonuclease II beta isoform 1 precursor	338					DNA metabolic process	lysosome	deoxyribonuclease II activity				0				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)		AAGTGGAGGATTCATTTGTAC	0.408								Direct_reversal_of_damage					33	64	---	---	---	---	PASS
BARHL2	343472	broad.mit.edu	37	1	91182612	91182612	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91182612G>A	uc001dns.2	-	1	183	c.141C>T	c.(139-141)GCC>GCT	p.A47A		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	47						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		GAGATGGGGTGGCCTGACTCC	0.592													59	101	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93202101	93202101	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93202101C>A	uc001dox.2	-	2	145	c.135G>T	c.(133-135)ATG>ATT	p.M45I	EVI5_uc010otf.1_Missense_Mutation_p.M45I	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	45	Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Ser-rich.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		CCTGACTGGCCATCTGACTGA	0.458													61	156	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104120169	104120169	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104120169A>T	uc001duq.2	+	10	1775	c.1159A>T	c.(1159-1161)ATT>TTT	p.I387F	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.I387F|AMY2B_uc001dus.1_RNA	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	387					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		AGAAGTTACTATTAATCCAGA	0.353													72	163	---	---	---	---	PASS
FAM102B	284611	broad.mit.edu	37	1	109143220	109143220	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109143220G>A	uc010ouy.1	+	2	250	c.170G>A	c.(169-171)AGA>AAA	p.R57K		NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611	57										large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		GTTCGCTGGAGAAAGAAGTTC	0.388													9	80	---	---	---	---	PASS
RSBN1	54665	broad.mit.edu	37	1	114308799	114308799	+	Silent	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114308799T>G	uc001edq.2	-	7	2248	c.2212A>C	c.(2212-2214)AGG>CGG	p.R738R	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	738						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTTTTTATCCTCACACATTGG	0.418													11	192	---	---	---	---	PASS
IGSF3	3321	broad.mit.edu	37	1	117150804	117150804	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117150804T>C	uc001egr.1	-	5	1687	c.982A>G	c.(982-984)ATG>GTG	p.M328V	IGSF3_uc001egq.1_Missense_Mutation_p.M328V|IGSF3_uc001egs.1_Missense_Mutation_p.M1V	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	328	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TTAGGACCCATGGTGGCGATG	0.577													7	21	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118539335	118539335	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118539335A>G	uc001ehk.2	-	33	4876	c.4808T>C	c.(4807-4809)TTA>TCA	p.L1603S		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1603						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTTTTCAGGTAATATAGTTGA	0.338													26	84	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152188349	152188349	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188349G>T	uc001ezt.1	-	3	5832	c.5756C>A	c.(5755-5757)TCA>TAA	p.S1919*		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1919	21.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGGAAGATGAACCTGAGCT	0.577													31	901	---	---	---	---	PASS
LCE4A	199834	broad.mit.edu	37	1	152681748	152681748	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152681748A>G	uc001fak.2	+	1	226	c.197A>G	c.(196-198)CAT>CGT	p.H66R		NM_178356	NP_848133	Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	66	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			CACAGACACCATAGGTCCCAC	0.627													35	76	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157667548	157667548	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157667548C>A	uc001frb.2	-	5	752	c.460G>T	c.(460-462)GTC>TTC	p.V154F	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.V154F|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'UTR|FCRL3_uc001frc.1_Missense_Mutation_p.V154F	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	154	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					TCCCTGGAGACTGAATTCACT	0.343													47	158	---	---	---	---	PASS
OR10J3	441911	broad.mit.edu	37	1	159283599	159283599	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159283599G>T	uc010piu.1	-	1	851	c.851C>A	c.(850-852)CCT>CAT	p.P284H		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	284	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)					GGGTTCAGTAGGGGAGTGATG	0.507													40	124	---	---	---	---	PASS
DCAF8	50717	broad.mit.edu	37	1	160209596	160209596	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160209596C>A	uc001fvo.2	-	4	926	c.614G>T	c.(613-615)GGC>GTC	p.G205V	DCAF8_uc001fvn.2_Missense_Mutation_p.G205V|DCAF8_uc009wth.2_Missense_Mutation_p.G205V|DCAF8_uc010pjb.1_Missense_Mutation_p.G205V|DCAF8_uc010pjc.1_Missense_Mutation_p.G359V|DCAF8_uc001fvq.3_Missense_Mutation_p.G205V|DCAF8_uc001fvp.3_Missense_Mutation_p.G205V|uc010pjd.1_Missense_Mutation_p.P43T	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8	205	WD 1.					CUL4 RING ubiquitin ligase complex	protein binding			skin(2)	2						CAGCCAGGTGCCGCGCTGGTT	0.582													26	46	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170928624	170928624	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170928624G>T	uc001ghg.2	+	5	304	c.174G>T	c.(172-174)CAG>CAT	p.Q58H	C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Missense_Mutation_p.Q58H	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	58							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCTTACTGCAGTTTGAATCTC	0.328													5	90	---	---	---	---	PASS
FMO1	2326	broad.mit.edu	37	1	171250059	171250059	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171250059G>A	uc009wvz.2	+	6	898	c.762G>A	c.(760-762)TGG>TGA	p.W254*	FMO1_uc010pme.1_Nonsense_Mutation_p.W191*|FMO1_uc001ghl.2_Nonsense_Mutation_p.W254*|FMO1_uc001ghm.2_Nonsense_Mutation_p.W254*|FMO1_uc001ghn.2_Nonsense_Mutation_p.W254*	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	254					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGTGACTTGGTTGATGGAGC	0.443													4	120	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176903441	176903441	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176903441T>C	uc001glc.2	-	16	2730	c.2518A>G	c.(2518-2520)ACA>GCA	p.T840A	ASTN1_uc001glb.1_Missense_Mutation_p.T840A|ASTN1_uc001gld.1_Missense_Mutation_p.T840A	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	848					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						GCACGAGATGTAGCCCCATCC	0.527													13	54	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	185704138	185704138	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185704138G>A	uc001grq.1	+	1	456	c.227G>A	c.(226-228)AGA>AAA	p.R76K		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	76	VWFA.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AGACCTAAAAGACCTCTTTTC	0.368													15	114	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067614	190067614	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067614A>G	uc001gse.1	-	8	2067	c.1835T>C	c.(1834-1836)TTA>TCA	p.L612S	FAM5C_uc010pot.1_Missense_Mutation_p.L510S	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	612						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					CCCCAGAGTTAATGTCCAGTT	0.453													122	285	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190068100	190068100	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190068100A>T	uc001gse.1	-	8	1581	c.1349T>A	c.(1348-1350)CTG>CAG	p.L450Q	FAM5C_uc010pot.1_Missense_Mutation_p.L348Q	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	450						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TGCGCATGTCAGGCAGGCAGA	0.637													31	58	---	---	---	---	PASS
FAM71A	149647	broad.mit.edu	37	1	212798765	212798765	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212798765C>T	uc001hjk.2	+	1	950	c.546C>T	c.(544-546)AGC>AGT	p.S182S	uc010pth.1_RNA	NM_153606	NP_705834	Q8IYT1	FA71A_HUMAN	hypothetical protein LOC149647	182										skin(3)|ovary(1)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		AGAGTAACAGCAGTACCTGTG	0.517													6	158	---	---	---	---	PASS
MOSC2	54996	broad.mit.edu	37	1	220955184	220955184	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220955184T>G	uc001hmq.2	+	7	1147	c.949T>G	c.(949-951)TAT>GAT	p.Y317D	MOSC2_uc001hmr.2_Missense_Mutation_p.Y317D|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368	Q969Z3	MOSC2_HUMAN	MOCO sulphurase C-terminal domain containing 2	317	MOSC.					mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)		TGGGATCTATTATTCAGTGGA	0.428													7	224	---	---	---	---	PASS
LIN9	286826	broad.mit.edu	37	1	226496852	226496852	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226496852C>A	uc001hqa.2	-	1	347	c.37G>T	c.(37-39)GGC>TGC	p.G13C	LIN9_uc001hqb.2_Missense_Mutation_p.G13C|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Missense_Mutation_p.G13C	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog	Error:Variant_position_missing_in_Q5TKA1_after_alignment					cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		TTGAACGAGCCGCGCCGCTTT	0.587													19	55	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235345368	235345368	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235345368G>T	uc001hwq.2	-	20	3364	c.2866C>A	c.(2866-2868)CCG>ACG	p.P956T	ARID4B_uc001hwr.2_Missense_Mutation_p.P870T|ARID4B_uc001hws.3_Missense_Mutation_p.P870T|ARID4B_uc001hwp.2_RNA|ARID4B_uc001hwt.3_Missense_Mutation_p.P637T	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	956					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			GCAGGATGCGGTGGGGAAGCT	0.512													6	140	---	---	---	---	PASS
MTR	4548	broad.mit.edu	37	1	236998969	236998969	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236998969C>T	uc001hyi.3	+	14	1734	c.1311C>T	c.(1309-1311)TCC>TCT	p.S437S	MTR_uc010pxw.1_Silent_p.S30S|MTR_uc010pxx.1_Silent_p.S437S|MTR_uc010pxy.1_Silent_p.S437S	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	437	Pterin-binding.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TAATTGCTTCCGAGCCAGACA	0.438													25	181	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237947865	237947865	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237947865T>G	uc001hyl.1	+	90	12973	c.12853T>G	c.(12853-12855)TCA>GCA	p.S4285A	RYR2_uc010pya.1_Missense_Mutation_p.S700A	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4285					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGCCTTCTTTTCATCCTACTG	0.473													18	29	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242045208	242045208	+	Intron	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242045208G>T	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTTTGATCTGGGGACTCTAGG	0.308								Direct_reversal_of_damage|Editing_and_processing_nucleases					20	57	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242511451	242511451	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242511451C>A	uc001hzn.1	-	2	410	c.283G>T	c.(283-285)GAT>TAT	p.D95Y	PLD5_uc001hzl.3_Missense_Mutation_p.D33Y|PLD5_uc001hzm.3_5'UTR|PLD5_uc001hzo.1_5'UTR			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	95						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CCATCCTCATCCTCTCCCATG	0.458													37	129	---	---	---	---	PASS
KCNF1	3754	broad.mit.edu	37	2	11053971	11053971	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11053971C>T	uc002rax.2	+	1	1909	c.1419C>T	c.(1417-1419)AGC>AGT	p.S473S		NM_002236	NP_002227	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F,	473	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		TCTCCCACAGCGACACCTTCA	0.672													11	64	---	---	---	---	PASS
EMILIN1	11117	broad.mit.edu	37	2	27303605	27303605	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27303605G>A	uc002rii.3	+	3	724	c.296G>A	c.(295-297)CGC>CAC	p.R99H	EMILIN1_uc010eyq.1_Missense_Mutation_p.R99H|EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	99	EMI.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCAGGTACCGCCGCTTCCTC	0.622											OREG0014513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	27	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28771715	28771715	+	Intron	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28771715G>T	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TAAAGCCCACGTTCCTTTCTA	0.443													4	65	---	---	---	---	PASS
C2orf34	79823	broad.mit.edu	37	2	44999172	44999172	+	Intron	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44999172C>T	uc002rum.2	+							NM_024766	NP_079042	Q7Z624	CMKMT_HUMAN	hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)				TTATTGTTTTCAGTTGAAAAA	0.333													32	97	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56420240	56420240	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56420240C>A	uc002rzn.2	+	2	1407	c.905C>A	c.(904-906)CCC>CAC	p.P302H		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	302	His-rich.									breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGGAGCAGCCCCGAAACGCTG	0.642													8	116	---	---	---	---	PASS
NAGK	55577	broad.mit.edu	37	2	71305540	71305540	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71305540C>G	uc002shp.3	+	10	1343	c.937C>G	c.(937-939)CTG>GTG	p.L313V	NAGK_uc010fea.2_RNA|NAGK_uc002shq.3_Missense_Mutation_p.L164V|NAGK_uc002shr.2_Missense_Mutation_p.L262V	NM_017567	NP_060037	Q9UJ70	NAGK_HUMAN	N-Acetylglucosamine kinase	313					N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding				0					N-Acetyl-D-glucosamine(DB00141)	CTCCTCCGCTCTGGGTGGGGC	0.592													22	68	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79385540	79385540	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79385540C>A	uc002sod.1	-	3	500	c.245G>T	c.(244-246)GGG>GTG	p.G82V	REG3A_uc002soe.1_Missense_Mutation_p.G82V|REG3A_uc002sof.1_Missense_Mutation_p.G82V	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	82	C-type lectin.				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						TCCCTCAGCCCCACTGAGCAC	0.567													30	73	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141707850	141707850	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141707850G>T	uc002tvj.1	-	20	4062	c.3090C>A	c.(3088-3090)GAC>GAA	p.D1030E	LRP1B_uc010fnl.1_Missense_Mutation_p.D212E	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1030	Extracellular (Potential).|LDL-receptor class A 7.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGTCCCCACAGTCATTGTCAC	0.403										TSP Lung(27;0.18)			23	79	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149243368	149243368	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149243368C>A	uc002twm.3	+	11	3891	c.2903C>A	c.(2902-2904)TCG>TAG	p.S968*	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Nonsense_Mutation_p.S968*|MBD5_uc002two.2_Nonsense_Mutation_p.S226*|MBD5_uc002twp.2_Nonsense_Mutation_p.S18*	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	968						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		CATCTACAGTCGCTGTTAAAC	0.378													8	58	---	---	---	---	PASS
GRB14	2888	broad.mit.edu	37	2	165404254	165404254	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165404254C>G	uc002ucl.2	-	3	938	c.397G>C	c.(397-399)GTT>CTT	p.V133L	GRB14_uc010zcv.1_Missense_Mutation_p.V46L|GRB14_uc002ucm.2_RNA	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	133	Ras-associating.				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7						AGCTGACAAACATCTCGAGCC	0.438													9	48	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171238525	171238525	+	Splice_Site	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171238525G>A	uc002ufy.2	+	10	1115	c.972_splice	c.e10-1	p.R324_splice	MYO3B_uc002ufv.2_Splice_Site_p.R311_splice|MYO3B_uc010fqb.1_Splice_Site_p.R311_splice|MYO3B_uc002ufz.2_Splice_Site_p.R324_splice|MYO3B_uc002ufw.2_Splice_Site|MYO3B_uc002ufx.2_Splice_Site|MYO3B_uc002uga.2_Splice_Site_p.R311_splice|MYO3B_uc002ugb.2_Splice_Site	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						TAAATTTCTAGGCATGAGAGG	0.408													21	101	---	---	---	---	PASS
HOXD1	3231	broad.mit.edu	37	2	177054190	177054190	+	Intron	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177054190G>T	uc002ukv.3	+						HOXD1_uc010fqy.2_Intron|HOXD1_uc010zez.1_Intron	NM_024501	NP_078777	Q9GZZ0	HXD1_HUMAN	homeobox D1							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		AGGTAAGTCCGCGGGCCTTGG	0.637													3	68	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179259114	179259114	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179259114G>T	uc002ulx.2	+	24	3026	c.2648G>T	c.(2647-2649)AGA>ATA	p.R883I	OSBPL6_uc002uly.2_Missense_Mutation_p.R908I|OSBPL6_uc010zfe.1_Missense_Mutation_p.R852I|OSBPL6_uc002ulz.2_Missense_Mutation_p.R847I|OSBPL6_uc002uma.2_Missense_Mutation_p.R887I	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	883					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AGATCTCGGAGACGATATATG	0.358													56	200	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179431458	179431458	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179431458A>G	uc010zfg.1	-	275	71921	c.71697T>C	c.(71695-71697)GCT>GCC	p.A23899A	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.A17594A|TTN_uc010zfi.1_Silent_p.A17527A|TTN_uc010zfj.1_Silent_p.A17402A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24826							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCCAACTCCAGCAGCATTTT	0.428													67	206	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179437396	179437396	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179437396T>C	uc010zfg.1	-	275	65983	c.65759A>G	c.(65758-65760)AAT>AGT	p.N21920S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.N15615S|TTN_uc010zfi.1_Missense_Mutation_p.N15548S|TTN_uc010zfj.1_Missense_Mutation_p.N15423S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22847							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGTTTACATTTCCAACAAT	0.438													3	218	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179667009	179667009	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179667009G>C	uc002und.2	-	3	376	c.151C>G	c.(151-153)CTG>GTG	p.L51V	TTN_uc010zfg.1_Missense_Mutation_p.L51V|TTN_uc010zfh.1_Missense_Mutation_p.L51V|TTN_uc010zfi.1_Missense_Mutation_p.L51V|TTN_uc010zfj.1_Missense_Mutation_p.L51V|TTN_uc002unb.2_Missense_Mutation_p.L51V			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	51							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACGCCGGGCAGAGTGGAAGTG	0.517													4	101	---	---	---	---	PASS
CERKL	375298	broad.mit.edu	37	2	182430786	182430786	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182430786C>G	uc002unx.2	-	4	777	c.676G>C	c.(676-678)GGT>CGT	p.G226R	CERKL_uc002uny.2_Missense_Mutation_p.G226R|CERKL_uc010zfm.1_Missense_Mutation_p.G182R|CERKL_uc002unz.2_Intron|CERKL_uc002uoa.2_Intron|CERKL_uc002uob.2_Intron|CERKL_uc002uoc.2_Intron|CERKL_uc010frk.2_Intron|CERKL_uc002uod.1_Missense_Mutation_p.G21R|CERKL_uc002uoe.2_Missense_Mutation_p.G226R	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	226	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)			ATAACCTACCCATCAAATCCC	0.308													3	111	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183866998	183866998	+	Splice_Site	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183866998C>T	uc002upc.2	-	5	772	c.370_splice	c.e5-1	p.T124_splice	NCKAP1_uc002upb.2_Splice_Site_p.T130_splice	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1						apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AGTTTACAGTCTAGGAGAAAA	0.284													7	64	---	---	---	---	PASS
ITGAV	3685	broad.mit.edu	37	2	187455140	187455140	+	Silent	SNP	A	G	G	rs144478131		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187455140A>G	uc002upq.2	+	1	351	c.75A>G	c.(73-75)CTA>CTG	p.L25L	ITGAV_uc010frs.2_Silent_p.L25L	NM_002210	NP_002201	P06756	ITAV_HUMAN	integrin alpha-V isoform 1 precursor	25					angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)		GACTCCTGCTACCTCTGTGCC	0.667													12	68	---	---	---	---	PASS
MARS2	92935	broad.mit.edu	37	2	198570870	198570870	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198570870C>T	uc002uuq.2	+	1	784	c.741C>T	c.(739-741)GAC>GAT	p.D247D	uc002uup.2_Intron	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN	methionine-tRNA synthetase 2 precursor	247					methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					L-Methionine(DB00134)	AGTGGCTGGACGAGGAGCTGC	0.612													5	114	---	---	---	---	PASS
SPATS2L	26010	broad.mit.edu	37	2	201305442	201305442	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201305442G>C	uc002uvn.3	+	8	1075	c.723G>C	c.(721-723)ATG>ATC	p.M241I	SPATS2L_uc010fst.2_Missense_Mutation_p.M241I|SPATS2L_uc002uvo.3_Missense_Mutation_p.M181I|SPATS2L_uc002uvp.3_Missense_Mutation_p.M241I|SPATS2L_uc002uvq.3_Missense_Mutation_p.M172I|SPATS2L_uc002uvr.3_Missense_Mutation_p.M241I|SPATS2L_uc010zhc.1_Missense_Mutation_p.M271I	NM_015535	NP_056350	Q9NUQ6	SPS2L_HUMAN	SPATS2-like protein isoform a	241						cytoplasm|nucleolus				ovary(2)|pancreas(1)	3						ATCGCGTCATGATTAAGGAAG	0.373													3	159	---	---	---	---	PASS
NIF3L1	60491	broad.mit.edu	37	2	201756740	201756740	+	Missense_Mutation	SNP	G	A	A	rs79840632	by1000genomes	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201756740G>A	uc002uwm.2	+	2	165	c.74G>A	c.(73-75)CGT>CAT	p.R25H	PPIL3_uc002uwh.2_5'Flank|PPIL3_uc002uwi.2_5'Flank|PPIL3_uc002uwj.2_5'Flank|PPIL3_uc002uwk.2_5'Flank|NIF3L1_uc002uwl.2_5'UTR|NIF3L1_uc002uwn.2_5'UTR|NIF3L1_uc002uwo.2_Missense_Mutation_p.R25H|NIF3L1_uc002uwp.2_Missense_Mutation_p.R25H|NIF3L1_uc002uwq.2_Missense_Mutation_p.R25H	NM_001136039	NP_001129511	Q9GZT8	NIF3L_HUMAN	NIF3 NGG1 interacting factor 3-like 1 isoform 1	25					positive regulation of transcription, DNA-dependent		transcription factor binding			skin(1)	1						AATTCTTCCCGTTCCTTCATG	0.463													6	146	---	---	---	---	PASS
TRAK2	66008	broad.mit.edu	37	2	202259537	202259537	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202259537C>T	uc002uyb.3	-	9	1405	c.959G>A	c.(958-960)CGG>CAG	p.R320Q		NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	320	Potential.			Missing (in Ref. 2).		early endosome|plasma membrane	GABA receptor binding				0						TGTCAGTTGCCGTTGGGCATC	0.363													4	153	---	---	---	---	PASS
STRADB	55437	broad.mit.edu	37	2	202334695	202334695	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202334695C>T	uc002uyd.3	+	4	478	c.113C>T	c.(112-114)TCC>TTC	p.S38F		NM_018571	NP_061041	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	38					activation of protein kinase activity|cell cycle arrest|insulin receptor signaling pathway|protein export from nucleus|regulation of fatty acid oxidation	cytosol|nucleus	ATP binding|protein binding|protein kinase activity			skin(2)|stomach(1)|lung(1)	4						CCAACCCTTTCCTGGTCACGT	0.388													17	117	---	---	---	---	PASS
RHBDD1	84236	broad.mit.edu	37	2	227779053	227779053	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227779053G>T	uc002voi.2	+	6	963	c.842G>T	c.(841-843)AGC>ATC	p.S281I	RHBDD1_uc010fxc.2_Missense_Mutation_p.S281I|RHBDD1_uc002voj.2_Missense_Mutation_p.S112I	NM_032276	NP_115652	Q8TEB9	RHBD1_HUMAN	rhomboid domain containing 1	281						integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		TTACAAGCCAGCCTCTGGGAC	0.463													28	11	---	---	---	---	PASS
SP110	3431	broad.mit.edu	37	2	231077723	231077723	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231077723C>T	uc002vqh.3	-	4	576	c.336G>A	c.(334-336)CGG>CGA	p.R112R	SP110_uc002vqg.3_Silent_p.R112R|SP110_uc002vqi.3_Silent_p.R112R|SP110_uc010fxk.2_Nonsense_Mutation_p.W112*	NM_004509	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform a	112					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		CTCTGCTCTGCCATTCATAGG	0.537													9	78	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241531369	241531369	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241531369C>A	uc002vzk.1	+	4	674	c.490C>A	c.(490-492)CAC>AAC	p.H164N	CAPN10_uc010zoh.1_Missense_Mutation_p.H164N|CAPN10_uc002vzl.1_Missense_Mutation_p.H164N|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Missense_Mutation_p.H36N|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	164	Calpain catalytic.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		GTCCTACGAGCACCTGTGGGC	0.637													12	14	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9788857	9788857	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9788857C>T	uc003bse.2	+	14	3868	c.3469C>T	c.(3469-3471)CTG>TTG	p.L1157L	BRPF1_uc003bsf.2_Silent_p.L1163L|BRPF1_uc003bsg.2_Silent_p.L1156L|BRPF1_uc011ati.1_Silent_p.L1062L|OGG1_uc003bsh.2_5'Flank|OGG1_uc003bsi.2_5'Flank|OGG1_uc003bsj.2_5'Flank|OGG1_uc003bsk.2_5'Flank|OGG1_uc003bsl.2_5'Flank|OGG1_uc003bsm.2_5'Flank|OGG1_uc003bsn.2_5'Flank|OGG1_uc003bso.2_5'Flank	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	1157	PWWP.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					TAGGCAGTGGCTGCCCAGGAC	0.517													22	208	---	---	---	---	PASS
DAZL	1618	broad.mit.edu	37	3	16636046	16636046	+	Silent	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16636046T>A	uc003cbb.2	-	8	909	c.615A>T	c.(613-615)GTA>GTT	p.V205V	DAZL_uc003cba.2_Silent_p.V225V	NM_001351	NP_001342	Q92904	DAZL_HUMAN	deleted in azoospermia-like	205					germ cell development|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding|translation activator activity				0						TTACCGGAGGTACAACATAGC	0.299													15	19	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19436644	19436644	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19436644C>T	uc003cbk.1	+	7	1213	c.1018C>T	c.(1018-1020)CGT>TGT	p.R340C	KCNH8_uc011awe.1_Missense_Mutation_p.R340C|KCNH8_uc010hex.1_5'UTR|KCNH8_uc011awf.1_5'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	340	Helical; Voltage-sensor; Name=Segment S4; (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						GCGTCTTTTGCGTCTGCTGCA	0.488													25	102	---	---	---	---	PASS
EOMES	8320	broad.mit.edu	37	3	27759046	27759046	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27759046G>T	uc003cdx.2	-	6	1576	c.1576C>A	c.(1576-1578)CCT>ACT	p.P526T	EOMES_uc003cdy.3_Missense_Mutation_p.P545T|EOMES_uc010hfn.2_3'UTR|EOMES_uc011axc.1_Missense_Mutation_p.P250T	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin	526					CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|positive regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|breast(1)	4						TTGGTCCCAGGTTGCTGGACA	0.532													87	88	---	---	---	---	PASS
GOLGA4	2803	broad.mit.edu	37	3	37366072	37366072	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37366072C>T	uc003cgv.2	+	14	2999	c.2695C>T	c.(2695-2697)CAG>TAG	p.Q899*	GOLGA4_uc010hgr.1_Nonsense_Mutation_p.Q460*|GOLGA4_uc003cgw.2_Nonsense_Mutation_p.Q921*|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Nonsense_Mutation_p.Q780*	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	899	Potential.|Glu-rich.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						TAACAAAGAACAGGAACAGAC	0.333													29	20	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38592636	38592636	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592636C>T	uc003cio.2	-	28	5421	c.5227G>A	c.(5227-5229)GGG>AGG	p.G1743R	SCN5A_uc003cin.2_Missense_Mutation_p.G1742R|SCN5A_uc003cil.3_Missense_Mutation_p.G1743R|SCN5A_uc010hhi.2_Missense_Mutation_p.G1725R|SCN5A_uc010hhk.2_Missense_Mutation_p.G1710R|SCN5A_uc011ayr.1_Missense_Mutation_p.G1689R	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1743			G -> E (in BRS1).|G -> R (in BRS1; yields nearly undetectable currents in transfected cells).		blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCTGGGCTCCCGCAGTCCCCC	0.607													16	18	---	---	---	---	PASS
MYL3	4634	broad.mit.edu	37	3	46901133	46901133	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46901133T>C	uc003cql.1	-	4	406	c.313A>G	c.(313-315)AAT>GAT	p.N105D		NM_000258	NP_000249	P08590	MYL3_HUMAN	slow skeletal ventricular myosin alkali light	105					cardiac muscle contraction|muscle filament sliding|positive regulation of ATPase activity|regulation of striated muscle contraction|regulation of the force of heart contraction|ventricular cardiac muscle tissue morphogenesis	A band|cytosol|I band|muscle myosin complex	actin monomer binding|calcium ion binding|myosin II heavy chain binding|structural constituent of muscle				0				BRCA - Breast invasive adenocarcinoma(193;0.00116)|KIRC - Kidney renal clear cell carcinoma(197;0.00557)|Kidney(197;0.0063)		ATCTTGGTATTGAGCTCTGCA	0.547													30	63	---	---	---	---	PASS
ARIH2	10425	broad.mit.edu	37	3	49002404	49002404	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49002404C>G	uc003cvb.2	+	5	688	c.376C>G	c.(376-378)CCA>GCA	p.P126A	ARIH2_uc003cvc.2_Missense_Mutation_p.P126A|ARIH2_uc003cvf.2_Missense_Mutation_p.P44A|ARIH2_uc010hkl.2_Missense_Mutation_p.P126A	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2	126					developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TCAGCCTAATCCATCAAAACA	0.393													29	38	---	---	---	---	PASS
PPP4R2	151987	broad.mit.edu	37	3	73108204	73108204	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73108204C>T	uc003dph.1	+	4	374	c.304C>T	c.(304-306)CAG>TAG	p.Q102*	PPP4R2_uc003dpi.1_Nonsense_Mutation_p.Q45*|FLJ10213_uc003dpj.2_5'Flank	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	102					mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		TTTTACTATTCAGCGACTATG	0.313													29	30	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	101023099	101023099	+	Missense_Mutation	SNP	C	A	A	rs147901568	byFrequency	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101023099C>A	uc003duq.1	-	3	595	c.392G>T	c.(391-393)CGT>CTT	p.R131L	IMPG2_uc011bhe.1_5'UTR	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	131	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATATTCCTCACGCCCAGGAAG	0.398													4	144	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102157338	102157338	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102157338C>A	uc003dvs.1	+	9	889	c.7C>A	c.(7-9)CAA>AAA	p.Q3K	ZPLD1_uc003dvt.1_Missense_Mutation_p.Q19K|ZPLD1_uc011bhg.1_Missense_Mutation_p.Q3K	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	3						integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TGCAATGGAACAAATATGGTT	0.458													15	32	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105290790	105290790	+	3'UTR	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105290790A>T	uc003dvx.2	+	15					ALCAM_uc003dvy.2_3'UTR|ALCAM_uc010hpp.2_3'UTR|ALCAM_uc003dvz.2_3'UTR	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						CTAAGAGAGAAACTGTCCTAG	0.368													8	33	---	---	---	---	PASS
IFT57	55081	broad.mit.edu	37	3	107938410	107938410	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107938410A>G	uc003dwx.3	-	2	470	c.222T>C	c.(220-222)TTT>TTC	p.F74F		NM_018010	NP_060480	Q9NWB7	IFT57_HUMAN	estrogen-related receptor beta like 1	74					activation of caspase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cilium|microtubule basal body	DNA binding|protein binding			ovary(1)|skin(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			TAGGCAGTGCAAAATAGTGTC	0.423													21	95	---	---	---	---	PASS
C3orf17	25871	broad.mit.edu	37	3	112727209	112727209	+	Silent	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112727209C>G	uc003dzr.2	-	8	1105	c.1044G>C	c.(1042-1044)GTG>GTC	p.V348V	GTPBP8_uc011bhy.1_Intron|C3orf17_uc003dzq.2_5'UTR|C3orf17_uc011bhz.1_5'UTR|C3orf17_uc010hqh.2_5'UTR|C3orf17_uc003dzt.2_Silent_p.V251V|C3orf17_uc003dzs.2_Silent_p.V212V|C3orf17_uc010hqg.2_Silent_p.V173V|C3orf17_uc011bia.1_Silent_p.V145V|C3orf17_uc003dzu.2_Silent_p.V277V|C3orf17_uc011bib.1_Silent_p.V237V|C3orf17_uc011bic.1_Silent_p.V181V|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	348						integral to membrane					0						GAGTTCCTATCACTTTCTGAG	0.388													17	71	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113138979	113138979	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113138979A>G	uc003eae.1	-	5	501	c.455T>C	c.(454-456)CTG>CCG	p.L152P		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	152										central_nervous_system(1)	1						ACTGTCGTCCAGAAGTTGTAG	0.428													14	46	---	---	---	---	PASS
PLA1A	51365	broad.mit.edu	37	3	119327761	119327761	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119327761C>A	uc003ecu.2	+	3	459	c.420C>A	c.(418-420)AGC>AGA	p.S140R	PLA1A_uc003ecv.2_Intron|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_5'UTR	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	140					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						TTAAGTTGAGCCTCGAGATCT	0.473													38	90	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128202856	128202856	+	Intron	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128202856G>A	uc003ekm.3	-						GATA2_uc003ekn.3_Intron|GATA2_uc003eko.2_Intron	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1						blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		CTTCTGCAGGGGAACAGGGAG	0.672			Mis		AML(CML blast transformation)								52	50	---	---	---	---	PASS
RAB43	339122	broad.mit.edu	37	3	128875486	128875486	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128875486C>T	uc003elo.1	-	5	388	c.177G>A	c.(175-177)CAG>CAA	p.Q59Q	ISY1_uc010hsz.1_5'UTR|ISY1_uc003elp.1_Silent_p.Q59Q|ISY1_uc010hta.1_Silent_p.Q59Q	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog	Error:Variant_position_missing_in_Q86YS6_after_alignment					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						CATTCTGAATCTGAGCCACTT	0.194													24	97	---	---	---	---	PASS
IFT122	55764	broad.mit.edu	37	3	129214457	129214457	+	Intron	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129214457T>A	uc003emm.2	+						IFT122_uc003eml.2_Intron|IFT122_uc003emn.2_Intron|IFT122_uc003emo.2_Intron|IFT122_uc003emp.2_Intron|IFT122_uc010htc.2_Intron|IFT122_uc011bky.1_Intron|IFT122_uc003emq.2_Intron|IFT122_uc003emr.2_Intron|IFT122_uc011bla.1_Intron|IFT122_uc010hte.2_Intron|IFT122_uc003ems.2_Intron|IFT122_uc011bkx.1_Intron|IFT122_uc010htd.1_Intron	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2						camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						CAAGGTAACCTACCCTGTCCC	0.458													6	96	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140282798	140282798	+	Intron	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140282798T>C	uc003etn.2	+							NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TTTTCCTTGTTCCAGTGGTCC	0.473										HNSCC(16;0.037)			5	453	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148562525	148562525	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148562525C>A	uc003ewl.2	+	8	772	c.749C>A	c.(748-750)CCC>CAC	p.P250H		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	250					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GGCACAGACCCCAACAGAAAT	0.403													31	113	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	161221740	161221740	+	IGR	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161221740C>G								OTOL1 (12 upstream) : None (None downstream)																							AATTTGTGTCCTGAATCCTGT	0.348													6	26	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164735594	164735594	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164735594C>T	uc003fei.2	-	30	3650	c.3588G>A	c.(3586-3588)ATG>ATA	p.M1196I		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1196	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	GGCCCAAAAACATATAAAAAT	0.328										HNSCC(35;0.089)			6	100	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907320	164907320	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907320G>A	uc003fej.3	-	2	1743	c.1299C>T	c.(1297-1299)TCC>TCT	p.S433S	SLITRK3_uc003fek.2_Silent_p.S433S	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	433	LRR 8.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						AGAGATCCAAGGAAGAAAAAT	0.408										HNSCC(40;0.11)			4	104	---	---	---	---	PASS
TBL1XR1	79718	broad.mit.edu	37	3	176756174	176756174	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176756174C>G	uc003fiw.3	-	11	1234	c.974G>C	c.(973-975)TGT>TCT	p.C325S	TBL1XR1_uc003fix.3_Missense_Mutation_p.C325S|TBL1XR1_uc011bpz.1_5'UTR	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	325	WD 4.				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			ATCTGTACTACAAGAAGCAAA	0.373													4	25	---	---	---	---	PASS
KCNMB2	10242	broad.mit.edu	37	3	178560680	178560680	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178560680G>A	uc003fjd.2	+	5	1006	c.663G>A	c.(661-663)CAG>CAA	p.Q221Q	uc003fjb.1_Intron|uc003fjc.1_Intron|KCNMB2_uc003fje.2_Silent_p.Q221Q|KCNMB2_uc003fjf.2_Silent_p.Q221Q|KCNMB2_uc011bqa.1_Intron|KCNMB2_uc011bqb.1_RNA	NM_181361	NP_852006	Q9Y691	KCMB2_HUMAN	calcium-activated potassium channel beta 2	221	Cytoplasmic (Potential).				detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)			AACTTACACAGTACCTCTCCC	0.398													16	172	---	---	---	---	PASS
CLDN16	10686	broad.mit.edu	37	3	190126224	190126224	+	Silent	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190126224C>A	uc003fsi.2	+	4	782	c.714C>A	c.(712-714)CTC>CTA	p.L238L	CLDN16_uc010hze.2_Intron	NM_006580	NP_006571	Q9Y5I7	CLD16_HUMAN	claudin 16	238	Extracellular (Potential).				calcium-independent cell-cell adhesion|cellular metal ion homeostasis|excretion	integral to membrane|tight junction	identical protein binding|magnesium ion transmembrane transporter activity|structural molecule activity			ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		CCTGTTGGCTCGGAATGGCTG	0.388													5	361	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193158357	193158357	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193158357G>A	uc003ftd.2	-	21	2617	c.2509C>T	c.(2509-2511)CAG>TAG	p.Q837*	ATP13A4_uc003fte.1_Nonsense_Mutation_p.Q837*|ATP13A4_uc011bsr.1_Nonsense_Mutation_p.Q308*|ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	837	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TCCAGTTTCTGAAATTCTTCC	0.463													5	128	---	---	---	---	PASS
C3orf43	255798	broad.mit.edu	37	3	196235205	196235205	+	Intron	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196235205A>T	uc003fws.2	-						C3orf43_uc003fwr.2_Intron	NM_001077657	NP_001071125	Q147U7	CC043_HUMAN	hypothetical protein LOC255798							integral to membrane				ovary(1)	1	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;2.13e-23)|all cancers(36;2e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00298)		AAGTGAGCCTACAAAAAATAT	0.358													126	55	---	---	---	---	PASS
SENP5	205564	broad.mit.edu	37	3	196626831	196626831	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196626831G>T	uc003fwz.3	+	4	1905	c.1656G>T	c.(1654-1656)CGG>CGT	p.R552R	SENP5_uc011bty.1_Silent_p.R552R	NM_152699	NP_689912	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	552					cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CAAACTATCGGGCCAGACATC	0.368													30	106	---	---	---	---	PASS
TNIP2	79155	broad.mit.edu	37	4	2749604	2749604	+	Silent	SNP	G	C	C	rs143687899		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2749604G>C	uc003gfg.2	-	2	432	c.345C>G	c.(343-345)CCC>CCG	p.P115P	TNIP2_uc003gff.2_Silent_p.P8P|TNIP2_uc003gfh.2_Silent_p.P115P	NM_024309	NP_077285	Q8NFZ5	TNIP2_HUMAN	A20-binding inhibitor of NF-kappaB activation 2	115	Potential.					cytosol	protein binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCTCGTGTTGGGGCTGGCTCA	0.572													20	59	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8589092	8589092	+	3'UTR	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8589092G>T	uc003glk.2	+	3					CPZ_uc003gll.2_Intron	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						ACACACTGAGGGCCTGGCAGG	0.632													7	40	---	---	---	---	PASS
CPEB2	132864	broad.mit.edu	37	4	15055755	15055755	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15055755A>C	uc003gni.1	+	7	1127	c.1040A>C	c.(1039-1041)GAA>GCA	p.E347A	CPEB2_uc003gnj.1_Missense_Mutation_p.E317A|CPEB2_uc003gnk.1_Missense_Mutation_p.E355A|CPEB2_uc003gnl.1_Missense_Mutation_p.E328A|CPEB2_uc003gnm.1_Missense_Mutation_p.E325A|CPEB2_uc003gnn.1_Missense_Mutation_p.E320A	NM_182485	NP_872291	Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding	347	RRM 1.				regulation of translation	cytoplasm	nucleotide binding|RNA binding			skin(1)	1						TCTTAAGATGAAATAACTGCT	0.323													4	126	---	---	---	---	PASS
CCKAR	886	broad.mit.edu	37	4	26490935	26490935	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26490935A>G	uc003gse.1	-	2	437	c.284T>C	c.(283-285)ATG>ACG	p.M95T		NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor	95	Helical; Name=2; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	GTTGAACGGCATGCAGAAGAG	0.547													19	80	---	---	---	---	PASS
PTTG2	10744	broad.mit.edu	37	4	37962435	37962435	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37962435G>T	uc011bye.1	+	1	380	c.380G>T	c.(379-381)AGT>ATT	p.S127I	TBC1D1_uc003gtb.2_Intron|TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron	NM_006607	NP_006598	Q9NZH5	PTTG2_HUMAN	pituitary tumor-transforming 2	127					chromosome organization|DNA metabolic process	cytoplasm|nucleus	SH3 domain binding				0						GACTTTGAGAGTTTTGACCTG	0.453													26	87	---	---	---	---	PASS
APBB2	323	broad.mit.edu	37	4	41016210	41016210	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41016210G>A	uc003gvl.2	-	6	855	c.225C>T	c.(223-225)ATC>ATT	p.I75I	APBB2_uc003gvm.2_Silent_p.I75I|APBB2_uc003gvn.2_Silent_p.I75I|APBB2_uc011byt.1_Silent_p.I58I	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,	75					cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						TGGCCGCCTGGATGTTAGTTA	0.502													51	87	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060551	46060551	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060551A>G	uc003gxb.2	-	6	866	c.714T>C	c.(712-714)TTT>TTC	p.F238F		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	238	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		CTACAAATGCAAACTGATATA	0.348													18	53	---	---	---	---	PASS
PDCL2	132954	broad.mit.edu	37	4	56448400	56448400	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56448400G>T	uc003hbb.2	-	2	114	c.11C>A	c.(10-12)CCC>CAC	p.P4H		NM_152401	NP_689614	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	4											0	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			ATCTTCATTGGGATCCTACAC	0.299													15	55	---	---	---	---	PASS
PDCL2	132954	broad.mit.edu	37	4	56448401	56448401	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56448401G>T	uc003hbb.2	-	2	113	c.10C>A	c.(10-12)CCC>ACC	p.P4T		NM_152401	NP_689614	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	4											0	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			TCTTCATTGGGATCCTACACA	0.299													15	55	---	---	---	---	PASS
REST	5978	broad.mit.edu	37	4	57786007	57786007	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57786007A>T	uc003hch.2	+	3	1300	c.953A>T	c.(952-954)CAT>CTT	p.H318L	REST_uc003hci.2_Missense_Mutation_p.H318L|REST_uc010ihf.2_5'UTR	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	318	C2H2-type 5.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					CAGAAGACTCATCTAACTAGA	0.323													3	96	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66356236	66356236	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66356236G>T	uc003hcy.2	-	5	1454	c.1261C>A	c.(1261-1263)CTG>ATG	p.L421M	EPHA5_uc003hcx.2_Missense_Mutation_p.L352M|EPHA5_uc003hcz.2_Missense_Mutation_p.L421M|EPHA5_uc011cah.1_Missense_Mutation_p.L421M|EPHA5_uc011cai.1_Missense_Mutation_p.L421M|EPHA5_uc003hda.2_Missense_Mutation_p.L421M	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	421	Fibronectin type-III 1.|Extracellular (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						GTGTTTTTCAGGCCGCTTTGC	0.507										TSP Lung(17;0.13)			53	54	---	---	---	---	PASS
EPHA5	2044	broad.mit.edu	37	4	66356237	66356237	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66356237G>T	uc003hcy.2	-	5	1453	c.1260C>A	c.(1258-1260)GGC>GGA	p.G420G	EPHA5_uc003hcx.2_Silent_p.G351G|EPHA5_uc003hcz.2_Silent_p.G420G|EPHA5_uc011cah.1_Silent_p.G420G|EPHA5_uc011cai.1_Silent_p.G420G|EPHA5_uc003hda.2_Silent_p.G420G	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	420	Fibronectin type-III 1.|Extracellular (Potential).				cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						TGTTTTTCAGGCCGCTTTGCC	0.502										TSP Lung(17;0.13)			53	53	---	---	---	---	PASS
UGT2B15	7366	broad.mit.edu	37	4	69535760	69535760	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69535760A>C	uc011cal.1	-	1	615	c.577T>G	c.(577-579)TCC>GCC	p.S193A		NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor	193					steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						GGTACATAGGAAGGAGGGAAC	0.358													4	402	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85771053	85771053	+	Splice_Site	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85771053A>G	uc003hpd.2	-	5	712	c.304_splice	c.e5+1	p.E102_splice	WDFY3_uc003hpf.2_Splice_Site_p.E102_splice	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTGTAAAAATACCTGTGGATT	0.363													5	111	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114278132	114278132	+	Silent	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114278132T>A	uc003ibe.3	+	38	8458	c.8358T>A	c.(8356-8358)GCT>GCA	p.A2786A	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Silent_p.A88A|ANK2_uc011cgb.1_Silent_p.A2801A	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2753					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCAGCTCAGCTGCTCCTGTCT	0.463													42	23	---	---	---	---	PASS
POU4F2	5458	broad.mit.edu	37	4	147561769	147561769	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147561769C>T	uc003ikv.2	+	2	1287	c.1039C>T	c.(1039-1041)CGC>TGC	p.R347C		NM_004575	NP_004566	Q12837	PO4F2_HUMAN	Brn3b POU domain transcription factor	347	Homeobox.				estrogen receptor signaling pathway|MAPKKK cascade|negative regulation of transcription from RNA polymerase II promoter	nuclear speck	RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription			breast(1)	1	all_hematologic(180;0.151)					GGAGAAGAAGCGCAAGCGCAC	0.622													7	161	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155510606	155510606	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155510606A>T	uc003iod.1	-	2	221	c.163T>A	c.(163-165)TGC>AGC	p.C55S	FGA_uc003ioe.1_Missense_Mutation_p.C55S|FGA_uc003iof.1_Missense_Mutation_p.C55S	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	55					platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCATCAGAGCAGAAGGGCCAG	0.542													53	64	---	---	---	---	PASS
VEGFC	7424	broad.mit.edu	37	4	177649017	177649017	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177649017C>A	uc003ius.1	-	3	897	c.467G>T	c.(466-468)TGT>TTT	p.C156F		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	156					angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		GACGGACACACATGGAGGTTT	0.517													39	50	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183675813	183675813	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183675813G>T	uc003ivd.1	+	21	4330	c.4293G>T	c.(4291-4293)CAG>CAT	p.Q1431H	ODZ3_uc003ive.1_Missense_Mutation_p.Q844H	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1431	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		GGATAAGGCAGGTCACAACAG	0.468													5	37	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1409227	1409227	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1409227A>T	uc003jck.2	-	11	1533	c.1412T>A	c.(1411-1413)GTC>GAC	p.V471D		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	471					cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	GAGCGTGAAGACGTAGATGCC	0.572													3	38	---	---	---	---	PASS
C5orf49	134121	broad.mit.edu	37	5	7832066	7832066	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7832066T>A	uc003jea.3	-	3	471	c.341A>T	c.(340-342)AAC>ATC	p.N114I		NM_001089584	NP_001083053	A4QMS7	CE049_HUMAN	hypothetical protein LOC134121	114											0						AAAGTCCCGGTTTAGGGGCTC	0.547													11	327	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31511217	31511217	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31511217C>A	uc003jhg.2	-	8	1716	c.1357G>T	c.(1357-1359)GGG>TGG	p.G453W	RNASEN_uc003jhh.2_Missense_Mutation_p.G416W|RNASEN_uc003jhi.2_Missense_Mutation_p.G416W|RNASEN_uc010iui.1_Missense_Mutation_p.G376W	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	453					gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						TGCCTGCTCCCCAACTCCTCC	0.448													59	69	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32000253	32000253	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000253G>T	uc003jhl.2	+	5	1518	c.1130G>T	c.(1129-1131)AGG>ATG	p.R377M	PDZD2_uc003jhm.2_Missense_Mutation_p.R377M|PDZD2_uc011cnx.1_Missense_Mutation_p.R203M	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	377	PDZ 2.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AGGGATGGCAGGCTGTCCTTA	0.547													21	48	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32059445	32059445	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32059445G>C	uc003jhl.2	+	13	2689	c.2301G>C	c.(2299-2301)AAG>AAC	p.K767N	PDZD2_uc003jhm.2_Missense_Mutation_p.K767N|PDZD2_uc011cnx.1_Missense_Mutation_p.K593N	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	767	PDZ 4.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CAGTGGCCAAGATGGAGAGCA	0.448													6	82	---	---	---	---	PASS
RANBP3L	202151	broad.mit.edu	37	5	36249793	36249793	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36249793G>A	uc003jkh.2	-	14	1854	c.1361C>T	c.(1360-1362)TCT>TTT	p.S454F	RANBP3L_uc011cow.1_Missense_Mutation_p.S479F	NM_145000	NP_659437	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like isoform 2	454					intracellular transport					ovary(1)	1	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			AGTCCAACTAGAAGGATCTGT	0.284													4	108	---	---	---	---	PASS
RPL37	6167	broad.mit.edu	37	5	40834286	40834286	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40834286A>G	uc003jme.1	-	3	321	c.221T>C	c.(220-222)TTC>TCC	p.F74S	SNORD72_uc003jmf.1_5'Flank	NM_000997	NP_000988	P61927	RL37_HUMAN	ribosomal protein L37	74					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	metal ion binding|protein binding|rRNA binding|structural constituent of ribosome				0		Breast(839;0.238)				ACTGTACCTGAATCTGCGGTA	0.408													5	114	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41199881	41199881	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41199881C>G	uc003jmk.2	-	4	644	c.434G>C	c.(433-435)CGC>CCC	p.R145P	C6_uc003jml.1_Missense_Mutation_p.R145P	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	145	LDL-receptor class A.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				ACTGTCACAGCGAAATTTATT	0.413													34	105	---	---	---	---	PASS
EMB	133418	broad.mit.edu	37	5	49699253	49699253	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49699253G>C	uc003jom.2	-	6	885	c.636C>G	c.(634-636)ATC>ATG	p.I212M	EMB_uc010ivq.2_Missense_Mutation_p.I6M|EMB_uc003jol.2_Missense_Mutation_p.I143M|EMB_uc011cpy.1_Missense_Mutation_p.I162M|EMB_uc010ivr.2_Missense_Mutation_p.I158M	NM_198449	NP_940851	Q6PCB8	EMB_HUMAN	embigin precursor	212	Extracellular (Potential).|Ig-like V-type 2.					integral to membrane					0	Lung SC(58;0.218)	Lung NSC(810;0.0795)				ATGTTCCATTGATCACATATT	0.363													3	76	---	---	---	---	PASS
IPO11	51194	broad.mit.edu	37	5	61778973	61778973	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61778973A>G	uc003jtc.2	+	10	1064	c.874A>G	c.(874-876)ATT>GTT	p.I292V	IPO11_uc011cqr.1_Missense_Mutation_p.I332V|IPO11_uc003jtb.1_Missense_Mutation_p.I292V	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	292						cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		TACTCCTCTAATTCAGAGATC	0.299													8	75	---	---	---	---	PASS
IPO11	51194	broad.mit.edu	37	5	61802105	61802105	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61802105T>G	uc003jtc.2	+	19	1893	c.1703T>G	c.(1702-1704)CTG>CGG	p.L568R	IPO11_uc011cqr.1_Missense_Mutation_p.L608R|IPO11_uc003jtd.1_RNA	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	568	HEAT 7.					cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		TTTCAGTTACTGCAGCAAGTT	0.328													12	66	---	---	---	---	PASS
F2RL1	2150	broad.mit.edu	37	5	76129526	76129526	+	Missense_Mutation	SNP	G	A	A	rs149001132		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76129526G>A	uc003keo.2	+	2	1269	c.1094G>A	c.(1093-1095)CGC>CAC	p.R365H		NM_005242	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	365	Cytoplasmic (Potential).				blood coagulation|elevation of cytosolic calcium ion concentration|positive regulation of leukocyte chemotaxis|positive regulation of positive chemotaxis|regulation of blood coagulation	Golgi apparatus|integral to plasma membrane	receptor binding|thrombin receptor activity			central_nervous_system(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		CGAAGTGTCCGCACTGTAAAG	0.448													13	234	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82817981	82817981	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82817981C>T	uc003kii.3	+	7	4212	c.3856C>T	c.(3856-3858)CCT>TCT	p.P1286S	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.P1286S|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	1286	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TTCAAGTCCTCCTGCTACACA	0.473													4	87	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101834440	101834440	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101834440C>T	uc003knn.2	-	1	281	c.109G>A	c.(109-111)GGA>AGA	p.G37R	SLCO6A1_uc003kno.2_Missense_Mutation_p.G37R|SLCO6A1_uc003knp.2_Missense_Mutation_p.G37R|SLCO6A1_uc003knq.2_Missense_Mutation_p.G37R	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	37	Cytoplasmic (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TTCGGGGTTCCCTTGGCCCTC	0.602													112	164	---	---	---	---	PASS
CEP120	153241	broad.mit.edu	37	5	122708355	122708355	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122708355T>G	uc003ktk.2	-	18	2552	c.2470A>C	c.(2470-2472)ACC>CCC	p.T824P	CEP120_uc011cwq.1_Missense_Mutation_p.T633P	NM_153223	NP_694955	Q8N960	CE120_HUMAN	coiled-coil domain containing 100	824	Potential.					centrosome				ovary(1)	1						TTTTCCAAGGTGAGAAGATTT	0.299													32	54	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128844873	128844873	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128844873C>T	uc003kvb.1	+	3	833	c.833C>T	c.(832-834)TCC>TTC	p.S278F	ADAMTS19_uc003kvc.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	278					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CAGAAAAGGTCCATGGAGGAA	0.398													9	63	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140257180	140257180	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140257180C>A	uc003lic.2	+	1	2250	c.2123C>A	c.(2122-2124)TCC>TAC	p.S708Y	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.S708Y	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	708	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGCGGTGTCCAGCCTGCTG	0.667													18	23	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140553393	140553393	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553393G>A	uc003lit.2	+	1	1151	c.977G>A	c.(976-978)GGG>GAG	p.G326E		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	326	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACGGCGGCGGGCTTTCTGGA	0.433													31	35	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140723680	140723680	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140723680G>C	uc003ljm.1	+	1	80	c.80G>C	c.(79-81)GGA>GCA	p.G27A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.G27A	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	27					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGAAACAGGATCCGGTCAG	0.582											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	82	94	---	---	---	---	PASS
PCDHGA11	56105	broad.mit.edu	37	5	140802625	140802625	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140802625A>T	uc003lkq.1	+	1	2089	c.1831A>T	c.(1831-1833)AAG>TAG	p.K611*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Nonsense_Mutation_p.K611*|PCDHGA11_uc003lkp.1_Nonsense_Mutation_p.K611*	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	611	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGCCTGCTTAAGGCCAGCGA	0.662													35	42	---	---	---	---	PASS
CCNJL	79616	broad.mit.edu	37	5	159680516	159680516	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159680516C>T	uc003lyb.1	-	7	1429	c.1177G>A	c.(1177-1179)GTG>ATG	p.V393M	CCNJL_uc011dee.1_Missense_Mutation_p.V345M|CCNJL_uc003lyc.1_RNA	NM_024565	NP_078841	Q8IV13	CCNJL_HUMAN	cyclin J-like	393						nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGACGGGCACGGGACACATA	0.622													7	90	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169081483	169081483	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169081483G>T	uc003maf.2	+	2	200	c.120G>T	c.(118-120)ACG>ACT	p.T40T	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	40	SH3.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACAGGAGACGTGTGGAGGTG	0.582													39	39	---	---	---	---	PASS
C6orf195	154386	broad.mit.edu	37	6	2623807	2623807	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2623807C>A	uc003mtw.2	-	3	1235	c.250G>T	c.(250-252)GCC>TCC	p.A84S		NM_152554	NP_689767	Q96MT4	CF195_HUMAN	hypothetical protein LOC154386	84											0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				ATGCTCCAGGCCTGACAGCAA	0.597													43	40	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7583049	7583049	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7583049C>T	uc003mxp.1	+	24	5833	c.5554C>T	c.(5554-5556)CGC>TGC	p.R1852C	DSP_uc003mxq.1_Missense_Mutation_p.R1253C	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1852	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGTGAAACAGCGCCTGGAGTG	0.478													11	118	---	---	---	---	PASS
SLC17A3	10786	broad.mit.edu	37	6	25851025	25851025	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25851025A>T	uc003nfi.3	-	6	669	c.559T>A	c.(559-561)TCA>ACA	p.S187T	SLC17A3_uc003nfk.3_Missense_Mutation_p.S265T|SLC17A3_uc011djz.1_Missense_Mutation_p.S265T|SLC17A3_uc011dka.1_Missense_Mutation_p.S187T	NM_006632	NP_006623	O00476	NPT4_HUMAN	solute carrier family 17 (sodium phosphate),	187					glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0						TCTTTTTCTGAGGTGCTTATC	0.413													49	56	---	---	---	---	PASS
HIST1H2BN	8341	broad.mit.edu	37	6	27806769	27806769	+	Silent	SNP	C	T	T	rs144906486	byFrequency	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27806769C>T	uc003njv.2	+	1	330	c.330C>T	c.(328-330)CAC>CAT	p.H110H	HIST1H2AK_uc003njs.2_5'Flank|HIST1H2BN_uc003njt.1_RNA|HIST1H2BN_uc003nju.1_Silent_p.H110H	NM_003520	NP_003511	Q99877	H2B1N_HUMAN	histone cluster 1, H2bn	110					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TGGCCAAGCACGCGGTGTCGG	0.662													57	40	---	---	---	---	PASS
GNL1	2794	broad.mit.edu	37	6	30514615	30514615	+	Splice_Site	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30514615T>A	uc003nqh.2	-	11	2470	c.1442_splice	c.e11-1	p.A481_splice	GNL1_uc011dmi.1_Splice_Site_p.A278_splice|GNL1_uc011dmj.1_Splice_Site_p.A479_splice|GNL1_uc011dmk.1_Splice_Site_p.A136_splice	NM_005275	NP_005266	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1						response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity			ovary(3)	3						CTGCCCAGGCTGGAGGAAGAA	0.517													43	38	---	---	---	---	PASS
STK19	8859	broad.mit.edu	37	6	31948524	31948524	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31948524G>A	uc003nyv.2	+	7	1135	c.1007G>A	c.(1006-1008)CGG>CAG	p.R336Q	STK19_uc003nyt.2_Missense_Mutation_p.R289Q|STK19_uc011dox.1_Missense_Mutation_p.R293Q|STK19_uc003nyw.2_Missense_Mutation_p.R332Q|STK19_uc010jtn.1_RNA|C4A_uc011doy.1_5'Flank|C4A_uc011doz.1_5'Flank|C4A_uc011dpa.1_5'Flank	NM_032454	NP_115830	P49842	STK19_HUMAN	serine/threonine kinase 19 isoform 2	336						nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			skin(4)	4						GTCGTGGTGCGGCTTGGCCTC	0.617													4	64	---	---	---	---	PASS
C6orf129	154467	broad.mit.edu	37	6	37452873	37452873	+	Intron	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37452873T>C	uc003ont.2	-							NM_138493	NP_612502	Q9P0B6	CF129_HUMAN	hypothetical protein LOC154467							integral to membrane					0						GCAGGAGCATTACCTGGCCTC	0.637													23	21	---	---	---	---	PASS
CRISP2	7180	broad.mit.edu	37	6	49668381	49668381	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49668381C>A	uc003ozq.2	-	5	439	c.183G>T	c.(181-183)ATG>ATT	p.M61I	CRISP2_uc003ozl.2_Missense_Mutation_p.M61I|CRISP2_uc003ozn.2_Missense_Mutation_p.M61I|CRISP2_uc003ozr.2_Missense_Mutation_p.M61I|CRISP2_uc003ozo.2_Missense_Mutation_p.M61I|CRISP2_uc003ozm.2_Missense_Mutation_p.M61I|CRISP2_uc003ozp.2_Missense_Mutation_p.M61I	NM_001142408	NP_001135880	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2 precursor	61						extracellular space				skin(1)	1	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TGCCTCTTACCATCTTTAGCA	0.458													8	58	---	---	---	---	PASS
BMP5	653	broad.mit.edu	37	6	55625317	55625317	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55625317C>T	uc003pcq.2	-	5	1754	c.1042G>A	c.(1042-1044)GAG>AAG	p.E348K	BMP5_uc011dxf.1_Missense_Mutation_p.E348K	NM_021073	NP_066551	P22003	BMP5_HUMAN	bone morphogenetic protein 5 preproprotein	348					cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TGTTTTTGCTCACTTGTGTTA	0.363													31	43	---	---	---	---	PASS
MTO1	25821	broad.mit.edu	37	6	74183082	74183082	+	Intron	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74183082A>G	uc003pgy.3	+						MTO1_uc010kav.2_Intron|MTO1_uc003pgz.3_Intron|MTO1_uc003pha.3_Intron|MTO1_uc003phb.3_Intron	NM_133645	NP_598400	Q9Y2Z2	MTO1_HUMAN	mitochondrial translation optimization 1 homolog						tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6						TTTTCTTGTTATTTAGTGGAT	0.244													9	35	---	---	---	---	PASS
C6orf167	253714	broad.mit.edu	37	6	97679345	97679345	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97679345T>C	uc003ppb.2	-	13	1752	c.1486A>G	c.(1486-1488)ATG>GTG	p.M496V	C6orf167_uc011eaf.1_Missense_Mutation_p.M456V|C6orf167_uc010kcn.1_Missense_Mutation_p.M270V	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	496					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TTGCTCTTCATTGCTTTTTTA	0.368													26	34	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102483400	102483400	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102483400G>T	uc003pqp.3	+	14	2519	c.2270G>T	c.(2269-2271)GGC>GTC	p.G757V	GRIK2_uc003pqo.3_Missense_Mutation_p.G757V|GRIK2_uc010kcw.2_Missense_Mutation_p.G757V	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	757	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	CAGATTGGCGGCCTTATAGAC	0.458													76	159	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110551303	110551303	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110551303G>T	uc003pua.2	+	15	1733	c.1709G>T	c.(1708-1710)GGT>GTT	p.G570V		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	570	WD 7.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ATAACATGTGGTTGGGATGGT	0.338													36	51	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112430732	112430732	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112430732G>A	uc003pvu.2	-	39	5689	c.5380C>T	c.(5380-5382)CGC>TGC	p.R1794C	LAMA4_uc003pvv.2_Missense_Mutation_p.R1787C|LAMA4_uc003pvt.2_Missense_Mutation_p.R1787C	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1794	Laminin G-like 5.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding	p.R1787C(1)		ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ACAAAGTGGCGTATGCAGCCT	0.502													36	68	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117709004	117709004	+	Silent	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117709004T>A	uc003pxp.1	-	13	2152	c.1953A>T	c.(1951-1953)GCA>GCT	p.A651A	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	651	Fibronectin type-III 3.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TTGGAGAACTTGCTCTCACAG	0.483			T	GOPC|ROS1	glioblastoma|NSCLC								90	140	---	---	---	---	PASS
RSPO3	84870	broad.mit.edu	37	6	127476525	127476525	+	Silent	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127476525A>T	uc003qar.2	+	4	866	c.576A>T	c.(574-576)CCA>CCT	p.P192P	RSPO3_uc003qas.1_Silent_p.P192P	NM_032784	NP_116173	Q9BXY4	RSPO3_HUMAN	R-spondin 3 precursor	192	TSP type-1.					extracellular region	heparin binding				0				GBM - Glioblastoma multiforme(226;0.0555)		TGTGTCCCCCAACAAATGAGA	0.428													15	47	---	---	---	---	PASS
TAAR6	319100	broad.mit.edu	37	6	132891742	132891742	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132891742G>A	uc011eck.1	+	1	282	c.282G>A	c.(280-282)GTG>GTA	p.V94V		NM_175067	NP_778237	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	94	Extracellular (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(1)	3	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		TCAGGACGGTGGAGAGCTGCT	0.502													37	108	---	---	---	---	PASS
AHI1	54806	broad.mit.edu	37	6	135611618	135611618	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135611618T>C	uc003qgi.2	-	28	3915	c.3531A>G	c.(3529-3531)ATA>ATG	p.I1177M	AHI1_uc003qgf.2_RNA|AHI1_uc003qgg.2_Intron|AHI1_uc003qgh.2_Missense_Mutation_p.I1177M|AHI1_uc003qgj.2_Missense_Mutation_p.I1177M	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a	1177						adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		GTGTATCCATTATGTGTCCTT	0.234													161	234	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152629688	152629688	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152629688A>G	uc010kiw.2	-	91	17884	c.17282T>C	c.(17281-17283)ATT>ACT	p.I5761T	SYNE1_uc010kiv.2_Missense_Mutation_p.I285T|SYNE1_uc003qos.3_Missense_Mutation_p.I285T|SYNE1_uc003qot.3_Missense_Mutation_p.I5690T|SYNE1_uc003qou.3_Missense_Mutation_p.I5761T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5761	Cytoplasmic (Potential).|Spectrin 19.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTATCCTCAATCTCTCTGTG	0.428										HNSCC(10;0.0054)			5	131	---	---	---	---	PASS
CNKSR3	154043	broad.mit.edu	37	6	154727502	154727502	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154727502G>T	uc003qpy.2	-	13	2159	c.1654C>A	c.(1654-1656)CTG>ATG	p.L552M		NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	552					negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TGAGTCAACAGTTTGAGGCGC	0.562													3	32	---	---	---	---	PASS
SERAC1	84947	broad.mit.edu	37	6	158538849	158538849	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158538849C>T	uc003qrc.2	-	13	1455	c.1313G>A	c.(1312-1314)TGG>TAG	p.W438*	SERAC1_uc003qrb.2_Nonsense_Mutation_p.W166*	NM_032861	NP_116250	Q96JX3	SRAC1_HUMAN	serine active site containing 1	438					GPI anchor metabolic process|intracellular protein transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	binding|hydrolase activity, acting on ester bonds				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;1.37e-18)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)		TTTTGCTAACCATGTCTAAGT	0.413													6	79	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166572067	166572067	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166572067G>T	uc003quu.1	-	9	1537	c.1044C>A	c.(1042-1044)CCC>CCA	p.P348P	T_uc003qut.1_Silent_p.P349P|T_uc003quv.1_Silent_p.P290P	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	348					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		ACCACAGGCTGGGGTACTGAC	0.652									Chordoma_Familial_Clustering_of				5	8	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166572068	166572068	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166572068G>A	uc003quu.1	-	9	1536	c.1043C>T	c.(1042-1044)CCC>CTC	p.P348L	T_uc003qut.1_Missense_Mutation_p.P349L|T_uc003quv.1_Missense_Mutation_p.P290L	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	348					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		CCACAGGCTGGGGTACTGACT	0.652									Chordoma_Familial_Clustering_of				4	9	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1526289	1526289	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1526289T>A	uc003skn.2	-	22	3049	c.2948A>T	c.(2947-2949)CAG>CTG	p.Q983L	INTS1_uc003skp.1_Missense_Mutation_p.Q330L	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	983					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GGAGGCCACCTGGGAGGAGCC	0.597													3	6	---	---	---	---	PASS
TMEM184A	202915	broad.mit.edu	37	7	1587401	1587401	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1587401G>C	uc003skv.3	-	8	1306	c.989C>G	c.(988-990)GCA>GGA	p.A330G	TMEM184A_uc003skt.3_Missense_Mutation_p.A309G|TMEM184A_uc003skw.3_Missense_Mutation_p.A135G	NM_001097620	NP_001091089	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	330						integral to membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		CTTCTTCTCTGCGTACACCTG	0.642													3	23	---	---	---	---	PASS
GGCT	79017	broad.mit.edu	37	7	30538534	30538534	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30538534C>G	uc003tba.2	-	3	435	c.308G>C	c.(307-309)GGA>GCA	p.G103A	GGCT_uc003tbb.2_Intron|GGCT_uc003tbc.2_RNA|GGCT_uc003taz.2_Missense_Mutation_p.G42A	NM_024051	NP_076956	O75223	GGCT_HUMAN	gamma-glutamyl cyclotransferase	103					release of cytochrome c from mitochondria	cytosol	acyltransferase activity|gamma-glutamylcyclotransferase activity|protein homodimerization activity				0						AACATACATTCCACTTTTAAC	0.378													58	64	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38433815	38433815	+	Splice_Site	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38433815C>G	uc003tgu.2	-	18	1468	c.1399_splice	c.e18-1	p.I467_splice	AMPH_uc003tgv.2_Splice_Site_p.I425_splice|AMPH_uc003tgt.2_Splice_Site_p.I352_splice|AMPH_uc003tgw.1_Splice_Site_p.I490_splice|AMPH_uc010kxl.1_Splice_Site	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						CAGGTATGATCTGCAGGGCAG	0.577													37	40	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507486	44507486	+	Intron	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507486C>T	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						GCCATCTCCTCCTCGGCATCA	0.398													4	71	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507617	44507617	+	Intron	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507617C>T	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						CCCAGAGGCACTGACAACAGG	0.468													5	281	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507678	44507678	+	Intron	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507678G>A	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						TTGGTTATGGGAGCAACAAAA	0.478													6	306	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507739	44507739	+	Intron	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507739A>G	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						GGTCCACAACATCAAGGAGCT	0.493													6	171	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45632493	45632493	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45632493G>A	uc003tne.3	+	2	793	c.775G>A	c.(775-777)GAG>AAG	p.E259K	ADCY1_uc003tnd.2_Missense_Mutation_p.E34K	NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	259	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCTGGAGGATGAGAACGAGAA	0.592													24	37	---	---	---	---	PASS
ADCY1	107	broad.mit.edu	37	7	45725678	45725678	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45725678C>G	uc003tne.3	+	13	2209	c.2191C>G	c.(2191-2193)CTG>GTG	p.L731V		NM_021116	NP_066939	Q08828	ADCY1_HUMAN	adenylate cyclase 1	731	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACACCATGCCCTGCTCTGCTG	0.627													7	39	---	---	---	---	PASS
POM121L12	285877	broad.mit.edu	37	7	53103760	53103760	+	Silent	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53103760G>C	uc003tpz.2	+	1	412	c.396G>C	c.(394-396)CGG>CGC	p.R132R		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	132											0						ACCCAGGACGGACCTGGAGCC	0.602													6	55	---	---	---	---	PASS
ELN	2006	broad.mit.edu	37	7	73474266	73474266	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73474266G>A	uc003tzw.2	+	23	1574	c.1483G>A	c.(1483-1485)GTC>ATC	p.V495I	RFC2_uc011kfa.1_Intron|ELN_uc003tzn.2_Missense_Mutation_p.V489I|ELN_uc003tzz.2_Missense_Mutation_p.V408I|ELN_uc003tzo.2_Missense_Mutation_p.V456I|ELN_uc003tzp.2_Missense_Mutation_p.V400I|ELN_uc003tzq.2_Missense_Mutation_p.V353I|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Missense_Mutation_p.V470I|ELN_uc003tzt.2_Missense_Mutation_p.V494I|ELN_uc003tzu.2_Missense_Mutation_p.V475I|ELN_uc003tzv.2_Missense_Mutation_p.V460I|ELN_uc003tzx.2_Missense_Mutation_p.V479I|ELN_uc011kff.1_Missense_Mutation_p.V489I|ELN_uc003tzy.2_Missense_Mutation_p.V465I	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor	518	Ala-rich.				blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	GGCTCCTGGTGTCGGTGTGGC	0.572			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						25	245	---	---	---	---	PASS
SEMA3A	10371	broad.mit.edu	37	7	83610772	83610772	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83610772G>T	uc003uhz.2	-	14	1832	c.1517C>A	c.(1516-1518)ACG>AAG	p.T506K		NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor	506	Sema.				axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						AACCCCAGCCGTTGAACCAAT	0.438													6	32	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	86991136	86991136	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86991136C>T	uc003uit.2	+	6	760	c.515C>T	c.(514-516)ACT>ATT	p.T172I	CROT_uc003uiu.2_Missense_Mutation_p.T200I	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	172					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	CCAGGAATTACTAGAGACTCC	0.348													15	189	---	---	---	---	PASS
DLX5	1749	broad.mit.edu	37	7	96650095	96650095	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96650095C>A	uc003uon.2	-	3	1031	c.823G>T	c.(823-825)GGC>TGC	p.G275C		NM_005221	NP_005212	P56178	DLX5_HUMAN	distal-less homeobox 5	275					cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					TGTAAGGAGCCCGGCGGCGGC	0.572													18	55	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100693916	100693916	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100693916G>T	uc003uxp.1	+	7	12927	c.12874G>T	c.(12874-12876)GAC>TAC	p.D4292Y	MUC17_uc010lho.1_Intron	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4292	Extracellular (Potential).|SEA.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TATTTGCTCAGGTGAACTCTG	0.458													9	31	---	---	---	---	PASS
TMEM168	64418	broad.mit.edu	37	7	112413056	112413056	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112413056C>G	uc003vgn.2	-	4	1718	c.1326G>C	c.(1324-1326)TTG>TTC	p.L442F	TMEM168_uc010lju.2_Missense_Mutation_p.L442F|TMEM168_uc011kmr.1_Missense_Mutation_p.L58F	NM_022484	NP_071929	Q9H0V1	TM168_HUMAN	transmembrane protein 168	442						integral to membrane|transport vesicle				ovary(1)|central_nervous_system(1)	2						CAGTAGACCTCAAATTTAACT	0.393													4	84	---	---	---	---	PASS
FOXP2	93986	broad.mit.edu	37	7	114299649	114299649	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114299649G>A	uc003vhb.2	+	13	1942	c.1568G>A	c.(1567-1569)AGG>AAG	p.R523K	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.R548K|FOXP2_uc003vha.2_Missense_Mutation_p.R431K|FOXP2_uc011kmu.1_Missense_Mutation_p.R540K|FOXP2_uc011kmv.1_Missense_Mutation_p.R522K|FOXP2_uc010ljz.1_Missense_Mutation_p.R338K|FOXP2_uc003vhe.1_Missense_Mutation_p.R93K	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	523	Fork-head.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						TCATCTGACAGGCAGTTAACA	0.388													30	102	---	---	---	---	PASS
OPN1SW	611	broad.mit.edu	37	7	128415785	128415785	+	Silent	SNP	C	T	T	rs150585695	byFrequency	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128415785C>T	uc003vnt.3	-	1	60	c.60G>A	c.(58-60)CCG>CCA	p.P20P		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	20	Extracellular (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						GCCCATCCCACGGCCCCACTG	0.517													6	129	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141758051	141758051	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141758051C>T	uc003vwy.2	+	31	3796	c.3742C>T	c.(3742-3744)CTG>TTG	p.L1248L		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1248	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGGGTTCCAGCTGTGTCGCTA	0.478													19	372	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142180928	142180928	+	Intron	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142180928C>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011krz.1_Missense_Mutation_p.C8F					SubName: Full=V_segment translation product; Flags: Fragment;																		CAAGGCTGCACAGCACAGGAG	0.572													41	42	---	---	---	---	PASS
FAM115A	9747	broad.mit.edu	37	7	143573132	143573132	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143573132C>T	uc003wdo.1	-	2	703	c.570G>A	c.(568-570)ACG>ACA	p.T190T	FAM115A_uc011ktu.1_Intron|FAM115A_uc003wdp.1_Silent_p.T190T	NM_014719	NP_055534	Q9Y4C2	F115A_HUMAN	hypothetical protein LOC9747	190											0	Melanoma(164;0.0903)					TAAAGAAACTCGTGTCCCCTT	0.517													9	48	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151874635	151874635	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151874635G>A	uc003wla.2	-	38	8122	c.7903C>T	c.(7903-7905)CAA>TAA	p.Q2635*	MLL3_uc003wkz.2_Nonsense_Mutation_p.Q1696*|MLL3_uc003wky.2_Nonsense_Mutation_p.Q144*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2635					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GAATGACCTTGCTCTTGTTGA	0.498			N		medulloblastoma								62	108	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154672636	154672636	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154672636T>A	uc003wlk.2	+	21	2246	c.2117T>A	c.(2116-2118)GTG>GAG	p.V706E	DPP6_uc003wli.2_Missense_Mutation_p.V642E|DPP6_uc003wlm.2_Missense_Mutation_p.V644E|DPP6_uc011kvq.1_Missense_Mutation_p.V599E	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	706	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGGACGCGCGTGGCCGTGTTT	0.552													10	79	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10464570	10464570	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10464570T>A	uc003wtc.2	-	4	7267	c.7038A>T	c.(7036-7038)GAA>GAT	p.E2346D		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2346					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		AAGTAGAACTTTCTGGGTACA	0.547													36	127	---	---	---	---	PASS
EXTL3	2137	broad.mit.edu	37	8	28608235	28608235	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28608235C>T	uc003xgz.1	+	7	3205	c.2612C>T	c.(2611-2613)TCC>TTC	p.S871F		NM_001440	NP_001431	O43909	EXTL3_HUMAN	exostoses-like 3	871	Lumenal (Potential).					integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding|protein binding			skin(2)	2		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		CATGATGACTCCCACTTCCAC	0.567													39	106	---	---	---	---	PASS
DUSP4	1846	broad.mit.edu	37	8	29207707	29207707	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29207707C>T	uc003xhm.2	-	1	479	c.89G>A	c.(88-90)GGC>GAC	p.G30D	DUSP4_uc003xhl.2_5'Flank	NM_001394	NP_001385	Q13115	DUS4_HUMAN	dual specificity phosphatase 4 isoform 1	30					endoderm formation|inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/threonine phosphatase activity			lung(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		GCTGCCGCTGCCGCCCGCGCC	0.682													5	4	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30701206	30701206	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30701206T>G	uc003xil.2	-	1	5328	c.5328A>C	c.(5326-5328)GAA>GAC	p.E1776D		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1776										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		ATGAATTCTTTTCCCTTTTTG	0.328													24	26	---	---	---	---	PASS
GPR124	25960	broad.mit.edu	37	8	37699818	37699818	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37699818T>A	uc003xkj.2	+	19	4325	c.3962T>A	c.(3961-3963)GTA>GAA	p.V1321E	GPR124_uc010lvy.2_Missense_Mutation_p.V1104E	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	1321	Cytoplasmic (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GGCGCGGAGGTAGCCAGCGGC	0.677													2	3	---	---	---	---	PASS
CHRNB3	1142	broad.mit.edu	37	8	42587227	42587227	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42587227G>A	uc003xpi.1	+	5	905	c.777G>A	c.(775-777)TCG>TCA	p.S259S		NM_000749	NP_000740	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta	259					synaptic transmission, cholinergic	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)	1	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)			ATTTACCTTCGGATGAAGGAG	0.433													4	111	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43157238	43157238	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43157238C>G	uc003xpz.1	+	5	861	c.818C>G	c.(817-819)TCT>TGT	p.S273C	POTEA_uc003xqa.1_Intron	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	273										ovary(1)	1						TATGCAGTTTCTAGTCATCAT	0.299													7	115	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53569508	53569508	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53569508C>T	uc003xre.3	-	15	3439	c.2881G>A	c.(2881-2883)GAC>AAC	p.D961N	RB1CC1_uc003xrf.3_Missense_Mutation_p.D961N	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	961	Potential.				autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTTTTTAAGTCTTCTAACACT	0.353													4	133	---	---	---	---	PASS
PLAG1	5324	broad.mit.edu	37	8	57078946	57078946	+	Silent	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57078946A>T	uc003xsq.3	-	3	1810	c.1359T>A	c.(1357-1359)GTT>GTA	p.V453V	PLAG1_uc003xsr.3_Silent_p.V453V|PLAG1_uc010lyi.2_Silent_p.V453V|PLAG1_uc010lyj.2_Silent_p.V371V	NM_001114635	NP_001108107	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1 isoform b	453	Activates transcription; Inhibition of nuclear import due to lack of NLS and KPNA2 interaction.|Massively activates transcription.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding		CTNNB1/PLAG1(60)|FGFR1_ENST00000447712/PLAG1(28)|CHCHD7/PLAG1(12)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|COL1A2/PLAG1(3)|TCEA1_ENST00000521604/PLAG1(3)	salivary_gland(113)|soft_tissue(13)|lung(1)|central_nervous_system(1)|breast(1)	129		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			GGAGCTGGGAAACAGAAGAAT	0.463			T	TCEA1|LIFR|CTNNB1|CHCHD7	salivary adenoma								16	131	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70541814	70541814	+	Missense_Mutation	SNP	G	T	T	rs140600931		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70541814G>T	uc010lza.1	+	19	2901	c.2184G>T	c.(2182-2184)AAG>AAT	p.K728N	SULF1_uc003xyd.2_Missense_Mutation_p.K728N|SULF1_uc003xye.2_Missense_Mutation_p.K728N|SULF1_uc003xyf.2_Missense_Mutation_p.K728N|SULF1_uc003xyg.2_Missense_Mutation_p.K728N|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_Translation_Start_Site	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	728				K -> R (in Ref. 4; BAC11258).	apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AGGAGAGGAAGGAGAAGAGAC	0.527													29	79	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72951117	72951117	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72951117C>T	uc003xza.2	-	19	2453	c.2278G>A	c.(2278-2280)GAA>AAA	p.E760K	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	760	Extracellular (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TCTAGTATTTCTGAATGATCA	0.303													18	62	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89209517	89209517	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89209517C>A	uc003yeb.3	-	2	433	c.151G>T	c.(151-153)GGC>TGC	p.G51C	MMP16_uc003yec.2_Missense_Mutation_p.G51C	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	51					collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						GGAAGGTAGCCGTACTTTTGT	0.393													16	43	---	---	---	---	PASS
MTERFD1	51001	broad.mit.edu	37	8	97269295	97269295	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97269295C>A	uc003yhs.1	-	3	460	c.382G>T	c.(382-384)GAA>TAA	p.E128*	MTERFD1_uc003yhr.1_Nonsense_Mutation_p.E7*|MTERFD1_uc010mbd.1_Nonsense_Mutation_p.E128*	NM_015942	NP_057026	Q96E29	MTER1_HUMAN	MTERF domain containing 1 precursor	128					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	transcription regulatory region DNA binding			ovary(1)	1	Breast(36;5.16e-05)					ATAGCCTCTTCCTCTGAAATT	0.408													31	46	---	---	---	---	PASS
LAPTM4B	55353	broad.mit.edu	37	8	98787974	98787974	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98787974C>T	uc003yia.2	+	1	166	c.10C>T	c.(10-12)CGG>TGG	p.R4W	LAPTM4B_uc010mbg.2_Missense_Mutation_p.R4W	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4	57					transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			GATGACGTCACGGACTCGGGT	0.697													6	25	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110592214	110592214	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110592214C>T	uc003ynj.3	-	5	711	c.548G>A	c.(547-549)CGG>CAG	p.R183Q	SYBU_uc003yni.3_Missense_Mutation_p.R180Q|SYBU_uc003ynk.3_Missense_Mutation_p.R64Q|SYBU_uc010mco.2_Missense_Mutation_p.R182Q|SYBU_uc003ynl.3_Missense_Mutation_p.R182Q|SYBU_uc010mcp.2_Missense_Mutation_p.R183Q|SYBU_uc010mcq.2_Missense_Mutation_p.R183Q|SYBU_uc003yno.3_Missense_Mutation_p.R64Q|SYBU_uc010mcr.2_Missense_Mutation_p.R183Q|SYBU_uc003ynm.3_Missense_Mutation_p.R182Q|SYBU_uc003ynn.3_Missense_Mutation_p.R182Q|SYBU_uc010mcs.2_Missense_Mutation_p.R64Q|SYBU_uc010mct.2_Missense_Mutation_p.R183Q|SYBU_uc010mcu.2_Missense_Mutation_p.R182Q|SYBU_uc003ynp.3_Missense_Mutation_p.R115Q|SYBU_uc010mcv.2_Missense_Mutation_p.R183Q|SYBU_uc003ynh.3_5'UTR|SYBU_uc011lhw.1_Missense_Mutation_p.R53Q	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	183	Sufficient for interaction with KIF5B.|Ser-rich.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						TCCATTACTCCGCCCATGAGG	0.507													11	294	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113395805	113395805	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113395805T>A	uc003ynu.2	-	37	6181	c.6022A>T	c.(6022-6024)AGC>TGC	p.S2008C	CSMD3_uc003yns.2_Missense_Mutation_p.S1210C|CSMD3_uc003ynt.2_Missense_Mutation_p.S1968C|CSMD3_uc011lhx.1_Missense_Mutation_p.S1904C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2008	Extracellular (Potential).|CUB 11.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCTGAATAGCTTCCAAGTCTT	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			29	52	---	---	---	---	PASS
NOV	4856	broad.mit.edu	37	8	120429198	120429198	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120429198G>C	uc003yoq.2	+	2	520	c.299G>C	c.(298-300)GGC>GCC	p.G100A		NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor	100	IGFBP N-terminal.				regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AACCAGACTGGCATCTGCACG	0.587											OREG0018940	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	29	---	---	---	---	PASS
TAF2	6873	broad.mit.edu	37	8	120756528	120756528	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120756528C>A	uc003you.2	-	24	3484	c.3214G>T	c.(3214-3216)GGG>TGG	p.G1072W		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	1072					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CTAATCTTACCTGGAGTTGAC	0.378													26	117	---	---	---	---	PASS
TAF2	6873	broad.mit.edu	37	8	120801883	120801883	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120801883G>A	uc003you.2	-	12	1787	c.1517C>T	c.(1516-1518)TCC>TTC	p.S506F		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	506					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATTTGAAATGGATTTCAAAAA	0.403													6	125	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131136311	131136311	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131136311T>C	uc003yta.1	-	17	1583	c.1555A>G	c.(1555-1557)ATG>GTG	p.M519V	ASAP1_uc003ysz.1_Missense_Mutation_p.M330V|ASAP1_uc011liw.1_Missense_Mutation_p.M512V	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	519	Arf-GAP.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						TTTGCTTCCATAATATCATTA	0.328													37	69	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73233933	73233933	+	Silent	SNP	C	G	G	rs139079542	byFrequency	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73233933C>G	uc004aid.2	-	16	2416	c.2172G>C	c.(2170-2172)ACG>ACC	p.T724T	TRPM3_uc004ahu.2_Silent_p.T554T|TRPM3_uc004ahv.2_Silent_p.T526T|TRPM3_uc004ahw.2_Silent_p.T596T|TRPM3_uc004ahx.2_Silent_p.T583T|TRPM3_uc004ahy.2_Silent_p.T586T|TRPM3_uc004ahz.2_Silent_p.T573T|TRPM3_uc004aia.2_Silent_p.T571T|TRPM3_uc004aib.2_Silent_p.T561T|TRPM3_uc004aic.2_Silent_p.T724T	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	749	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						TCAGCTCATACGTCAGCAGTT	0.577													3	82	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104317101	104317101	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104317101G>A	uc004bbn.2	+	15	2235	c.2145G>A	c.(2143-2145)CAG>CAA	p.Q715Q		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	715	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		AATACCTACAGAAGAAGCTAG	0.403													16	40	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128064643	128064643	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128064643G>T	uc010mwx.2	+	5	893	c.567G>T	c.(565-567)CTG>CTT	p.L189L	GAPVD1_uc004bpo.2_Silent_p.L189L|GAPVD1_uc011lzs.1_Silent_p.L189L|GAPVD1_uc004bpp.2_Silent_p.L189L|GAPVD1_uc004bpq.2_Silent_p.L189L|GAPVD1_uc004bpr.2_Silent_p.L189L|GAPVD1_uc004bps.2_Silent_p.L189L|GAPVD1_uc010mwy.1_Silent_p.L48L	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	189	Ras-GAP.				endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CTGAAGGACTGTTTTCTGCCA	0.388													3	85	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16870833	16870833	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16870833A>T	uc001ioo.2	-	66	10787	c.10735T>A	c.(10735-10737)TCT>ACT	p.S3579T		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	3579	CUB 27.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAGGATGGAGAGCTGGCGTTG	0.433											OREG0020047	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	91	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17271981	17271981	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17271981A>G	uc001iou.2	+	2	973	c.560A>G	c.(559-561)GAG>GGG	p.E187G	uc001iot.1_RNA|VIM_uc001iov.1_Missense_Mutation_p.E187G|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.E187G|VIM_uc001ioy.1_Missense_Mutation_p.E187G|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.E187G|VIM_uc001ipc.1_Missense_Mutation_p.E187G	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	187	Rod.|Coil 1B.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton	p.E187*(1)		large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						CGCCTCCGGGAGAAGTAAGGC	0.701													7	14	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18254536	18254536	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18254536G>T	uc001ipo.2	+	4	941	c.668G>T	c.(667-669)GGA>GTA	p.G223V	SLC39A12_uc001ipn.2_Missense_Mutation_p.G223V|SLC39A12_uc001ipp.2_Missense_Mutation_p.G223V|SLC39A12_uc010qck.1_Missense_Mutation_p.G89V	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	223	Helical; (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						GTTTGTCTGGGACAAGGAAAC	0.438													17	59	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21185952	21185952	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21185952A>T	uc001iqi.2	-	2	485	c.88T>A	c.(88-90)TAT>AAT	p.Y30N	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	30	Nebulin 1.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						ACAGGCTTATAGAAGACCTAT	0.353													5	141	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26432395	26432395	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26432395G>C	uc001isn.2	+	21	2641	c.2281G>C	c.(2281-2283)GAT>CAT	p.D761H	MYO3A_uc009xko.1_Missense_Mutation_p.D761H|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	761	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						CCTAAATGAAGATGTGGATGC	0.308													12	20	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37422867	37422867	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37422867G>A	uc001iza.1	+	5	572	c.473G>A	c.(472-474)TGT>TAT	p.C158Y		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	214	ANK 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						CTTGCTGTATGTCATGGATCA	0.373													28	209	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37454039	37454039	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37454039G>A	uc001iza.1	+	18	1951	c.1852G>A	c.(1852-1854)GAA>AAA	p.E618K		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	674						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ACTCCCATCAGAATCCAAACA	0.284													22	66	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50835781	50835781	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50835781C>A	uc001jhz.2	+	7	1214	c.1061C>A	c.(1060-1062)ACG>AAG	p.T354K	CHAT_uc001jhv.1_Missense_Mutation_p.T236K|CHAT_uc001jhx.1_Missense_Mutation_p.T236K|CHAT_uc001jhy.1_Missense_Mutation_p.T236K|CHAT_uc001jia.2_Missense_Mutation_p.T236K|CHAT_uc010qgs.1_Missense_Mutation_p.T236K	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	354					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GGCCTGCTGACGTCTGACGGG	0.592													30	40	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72289727	72289727	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72289727G>T	uc001jrd.3	+	4	652	c.371G>T	c.(370-372)CGG>CTG	p.R124L		NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	124										ovary(2)|central_nervous_system(1)	3						CCCAACTTCCGGCAGGTGCAG	0.637													3	56	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73406254	73406254	+	Silent	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73406254T>C	uc001jrx.3	+	13	1706	c.1329T>C	c.(1327-1329)TAT>TAC	p.Y443Y	CDH23_uc001jrw.3_Silent_p.Y443Y|CDH23_uc001jry.2_Silent_p.Y59Y|CDH23_uc001jrz.2_Silent_p.Y59Y	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	443	Cadherin 4.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ATGTGGGCTATGCCAAGGTGA	0.557													84	119	---	---	---	---	PASS
C10orf58	84293	broad.mit.edu	37	10	82187220	82187220	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82187220G>A	uc001kcc.3	+	5	704	c.544G>A	c.(544-546)GGG>AGG	p.G182R	C10orf58_uc001kcd.3_Missense_Mutation_p.G171R|C10orf58_uc001kce.3_Missense_Mutation_p.G182R|C10orf58_uc001kcf.3_Missense_Mutation_p.G182R	NM_032333	NP_115709	Q9BRX8	CJ058_HUMAN	hypothetical protein LOC84293 precursor	182						extracellular region					0			Colorectal(32;0.229)			CTTCATCCTTGGGGGAGTTTT	0.502													34	42	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85956412	85956412	+	Intron	SNP	G	T	T	rs79239487	by1000genomes	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85956412G>T	uc001kcv.2	+						CDHR1_uc001kcw.2_Intron	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor						homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						GAGAGGTATGGGGAGGTGTGG	0.557													4	116	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95093544	95093544	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95093544C>G	uc001kin.2	-	42	4813	c.4690G>C	c.(4690-4692)GAG>CAG	p.E1564Q	MYOF_uc001kio.2_Missense_Mutation_p.E1551Q|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1564	Cytoplasmic (Potential).|C2 5.				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						GGCTGGAGCTCTAAGCCTCGA	0.522													8	46	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95791902	95791902	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95791902A>G	uc001kjk.2	+	2	1733	c.1099A>G	c.(1099-1101)AAG>GAG	p.K367E	PLCE1_uc010qnx.1_Missense_Mutation_p.K367E	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	367					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				CATAGATCAGAAGAGAAATGG	0.483													32	35	---	---	---	---	PASS
PDCD4	27250	broad.mit.edu	37	10	112653929	112653929	+	Silent	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112653929T>C	uc001kzh.2	+	9	1314	c.1071T>C	c.(1069-1071)CCT>CCC	p.P357P	PDCD4_uc001kzg.2_Silent_p.P346P|PDCD4_uc010qre.1_Silent_p.P343P	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1	357	MI 2.				apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TGGAAGTACCTCATTTTCACC	0.333													4	115	---	---	---	---	PASS
LHPP	64077	broad.mit.edu	37	10	126172723	126172723	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126172723G>A	uc001lhs.1	+	2	161	c.141G>A	c.(139-141)CGG>CGA	p.R47R	LHPP_uc001lht.1_Silent_p.R47R|LHPP_uc009yai.1_Silent_p.R47R	NM_022126	NP_071409	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic	47					protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		AGCGTTCCCGGCTGAAGGTGA	0.617													3	36	---	---	---	---	PASS
H19	283120	broad.mit.edu	37	11	2016897	2016897	+	3'UTR	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2016897G>T	uc001lvc.1	-	5					H19_uc001luz.1_RNA|H19_uc001lva.3_RNA|H19_uc001lvd.2_RNA|H19_uc001lve.2_RNA|H19_uc001lvb.1_RNA					SubName: Full=cDNA FLJ32212 fis, clone PLACE6003399, weakly similar to SPIDROIN 1;												0						GTGGCTGGTGGTCAACCGTCC	0.612									Beckwith-Wiedemann_syndrome				7	23	---	---	---	---	PASS
OR51B4	79339	broad.mit.edu	37	11	5322984	5322984	+	Missense_Mutation	SNP	C	T	T	rs115914853	by1000genomes	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5322984C>T	uc010qza.1	-	1	193	c.193G>A	c.(193-195)GCA>ACA	p.A65T	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033179	NP_149419	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCGTGTCTGCCAGCATAGCC	0.517													37	86	---	---	---	---	PASS
OR51B6	390058	broad.mit.edu	37	11	5373029	5373029	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5373029C>G	uc010qzb.1	+	1	292	c.292C>G	c.(292-294)CAG>GAG	p.Q98E	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004750	NP_001004750	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B,	98	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGCTTCTCTCAGGCCTATTT	0.493													3	122	---	---	---	---	PASS
OR10A4	283297	broad.mit.edu	37	11	6898336	6898336	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6898336G>A	uc010rat.1	+	1	458	c.458G>A	c.(457-459)GGG>GAG	p.G153E		NM_207186	NP_997069	Q9H209	O10A4_HUMAN	olfactory receptor, family 10, subfamily A,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGGTTCTCAGGGTTTTCAGTG	0.532													32	52	---	---	---	---	PASS
TPH1	7166	broad.mit.edu	37	11	18051058	18051058	+	Splice_Site	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18051058C>T	uc001mnp.2	-	4	496	c.470_splice	c.e4+1	p.H157_splice	TPH1_uc009yhe.2_Splice_Site	NM_004179	NP_004170	P17752	TPH1_HUMAN	tryptophan hydroxylase 1						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity				0					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	AATATACTTACTGTTTATAGT	0.284													33	92	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20668426	20668426	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20668426G>T	uc001mqd.2	+	14	2289	c.2016G>T	c.(2014-2016)CAG>CAT	p.Q672H	SLC6A5_uc009yic.2_Missense_Mutation_p.Q437H	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	672					synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	TTGGATTCCAGCCTAACATCT	0.438													32	60	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26692804	26692804	+	Intron	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26692804G>A	uc001mra.2	-						SLC5A12_uc001mrb.2_Intron	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						TTTTCCTGAGGGAAATACAAA	0.413													34	111	---	---	---	---	PASS
FIBIN	387758	broad.mit.edu	37	11	27016328	27016328	+	Silent	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27016328C>A	uc001mrd.2	+	1	701	c.255C>A	c.(253-255)ACC>ACA	p.T85T		NM_203371	NP_976249	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog precursor	85						extracellular region|Golgi apparatus					0						AGGAGTTCACCGTGCTGGGCC	0.652													6	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30946900	30946900	+	RNA	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30946900C>T	uc001mss.1	-	1		c.56G>A			uc009yjk.1_Missense_Mutation_p.G433R					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		ATTTCCTTCCCCTTTTCATTG	0.353													46	159	---	---	---	---	PASS
API5	8539	broad.mit.edu	37	11	43343602	43343602	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43343602A>C	uc010rfh.1	+	5	632	c.459A>C	c.(457-459)AAA>AAC	p.K153N	API5_uc010rfg.1_Missense_Mutation_p.K142N|API5_uc001mxf.2_Missense_Mutation_p.K153N|API5_uc010rfi.1_Missense_Mutation_p.K99N|API5_uc001mxg.2_Missense_Mutation_p.K27N	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a	153					anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						GAGCAATTAAATTCCTTTCTA	0.383													8	165	---	---	---	---	PASS
PSMC3	5702	broad.mit.edu	37	11	47444133	47444133	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47444133G>A	uc001nfh.2	-	8	1070	c.876C>T	c.(874-876)GGC>GGT	p.G292G	PSMC3_uc009ylr.1_Silent_p.G250G	NM_002804	NP_002795	P17980	PRS6A_HUMAN	proteasome 26S ATPase subunit 3	292					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|nucleoside-triphosphatase activity|protein binding|transcription coactivator activity|transcription corepressor activity			ovary(4)	4				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		ACCGCTTGGTGCCGATGGCAT	0.552													76	149	---	---	---	---	PASS
PTPRJ	5795	broad.mit.edu	37	11	48166407	48166407	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48166407A>G	uc001ngp.3	+	13	3111	c.2756A>G	c.(2755-2757)AAT>AGT	p.N919S		NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	919	Extracellular (Potential).			YNGKLEPLGSYR -> LQWEAGTSGLLP (in Ref. 2; BAA07035).	contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						GGTTATTACAATGGGAAGCTG	0.458													74	120	---	---	---	---	PASS
OR5AS1	219447	broad.mit.edu	37	11	55798238	55798238	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55798238T>A	uc010riw.1	+	1	344	c.344T>A	c.(343-345)CTG>CAG	p.L115Q		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					TGCCTTATCCTGGCAGCAATG	0.473													28	47	---	---	---	---	PASS
PGA5	5222	broad.mit.edu	37	11	61018735	61018735	+	Silent	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61018735C>G	uc001nqz.2	+	9	1179	c.1149C>G	c.(1147-1149)GGC>GGG	p.G383G		NM_014224	NP_055039	P00790	PEPA_HUMAN	pepsinogen 5, group I precursor	383					digestion|proteolysis	extracellular region	aspartic-type endopeptidase activity			skin(1)	1						ACCAGGTCGGCCTGGCCCCTG	0.542													58	198	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62288817	62288817	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288817C>A	uc001ntl.2	-	5	13372	c.13072G>T	c.(13072-13074)GAT>TAT	p.D4358Y	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4358					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ATACTGACATCAGGGGCATCA	0.493													5	205	---	---	---	---	PASS
ARAP1	116985	broad.mit.edu	37	11	72412727	72412727	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72412727C>A	uc001osu.2	-	16	2458	c.2269G>T	c.(2269-2271)GGC>TGC	p.G757C	ARAP1_uc001osv.2_Missense_Mutation_p.G757C|ARAP1_uc001osr.2_Missense_Mutation_p.G517C|ARAP1_uc001oss.2_Missense_Mutation_p.G512C|ARAP1_uc009yth.2_Missense_Mutation_p.G451C|ARAP1_uc010rre.1_Missense_Mutation_p.G512C|ARAP1_uc001osw.1_Missense_Mutation_p.G45C	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	757	PH 3.				actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						AGCAGCTTGCCGGCAGAGGCA	0.637													68	104	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85431949	85431949	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85431949T>C	uc010rth.1	-	8	1789	c.1513A>G	c.(1513-1515)AGG>GGG	p.R505G	SYTL2_uc010rtg.1_Missense_Mutation_p.R506G|SYTL2_uc010rti.1_Missense_Mutation_p.R505G|SYTL2_uc010rtj.1_Missense_Mutation_p.R457G|SYTL2_uc010rte.1_5'Flank|SYTL2_uc001pax.2_5'Flank|SYTL2_uc001paz.2_5'Flank|SYTL2_uc001pba.2_5'Flank|SYTL2_uc001pay.2_5'Flank|SYTL2_uc001paw.2_5'Flank|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.R827G|SYTL2_uc001pbb.2_Missense_Mutation_p.R827G|SYTL2_uc001pbc.2_Missense_Mutation_p.R827G|SYTL2_uc010rtf.1_Missense_Mutation_p.R363G	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	505					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GGCATTTTCCTAGCGGCACTC	0.378													30	63	---	---	---	---	PASS
CCDC83	220047	broad.mit.edu	37	11	85584264	85584264	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85584264A>T	uc001pbh.1	+	3	618	c.106A>T	c.(106-108)AAG>TAG	p.K36*	CCDC83_uc001pbg.1_Nonsense_Mutation_p.K36*|CCDC83_uc001pbi.1_RNA|CCDC83_uc001pbj.1_5'UTR	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83	36										skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ATGTCAAATAAAGGAAGATGC	0.264													8	49	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88300351	88300351	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88300351G>A	uc001pcq.2	-	7	2700	c.2500C>T	c.(2500-2502)CGC>TGC	p.R834C	GRM5_uc009yvm.2_Missense_Mutation_p.R834C	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	834	Cytoplasmic (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	AAGGCGCTGCGCACGTTTCTC	0.572													5	120	---	---	---	---	PASS
MED17	9440	broad.mit.edu	37	11	93523815	93523815	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93523815G>A	uc001pem.3	+	3	768	c.493G>A	c.(493-495)GAA>AAA	p.E165K		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	165					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GAAGGGGGCAGAAAGACTGAC	0.398													46	129	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101833133	101833133	+	Missense_Mutation	SNP	G	C	C	rs149377851		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101833133G>C	uc001pgm.2	+	6	1637	c.1367G>C	c.(1366-1368)TGT>TCT	p.C456S	KIAA1377_uc001pgn.2_Missense_Mutation_p.C412S|KIAA1377_uc010run.1_Missense_Mutation_p.C257S|KIAA1377_uc009yxa.1_Missense_Mutation_p.C257S	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	456							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		CCTACTTCATGTGTACCAGTG	0.378													8	97	---	---	---	---	PASS
KIAA1826	84437	broad.mit.edu	37	11	105880331	105880331	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880331C>T	uc001piy.2	-	3	1142	c.969G>A	c.(967-969)CAG>CAA	p.Q323Q	KIAA1826_uc001piz.2_Silent_p.Q323Q	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	323	Potential.					nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)		CCTTTTCAATCTGCAGCTTCT	0.408													7	183	---	---	---	---	PASS
DDX6	1656	broad.mit.edu	37	11	118638961	118638961	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118638961G>A	uc001pub.2	-	5	830	c.469C>T	c.(469-471)CGG>TGG	p.R157W	DDX6_uc001puc.2_Missense_Mutation_p.R157W	NM_004397	NP_004388	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6	157	Helicase ATP-binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity			ovary(1)	1	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		AGGTCTAGCCGTTCAAGTAAG	0.413			T	IGH@	B-NHL								16	30	---	---	---	---	PASS
OR8G2	26492	broad.mit.edu	37	11	124096262	124096262	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124096262G>T	uc010saf.1	+	1	865	c.865G>T	c.(865-867)GTG>TTG	p.V289L		NM_001007249	NP_001007250	Q15614	OR8G2_HUMAN	olfactory receptor, family 8, subfamily G,	289						integral to membrane	olfactory receptor activity				0		Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.91e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		AGTGTCCTCTGTGTTTTATAC	0.458													6	70	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252781	124252781	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252781C>A	uc010sai.1	-	1	459	c.459G>T	c.(457-459)TTG>TTT	p.L153F		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TGGCTCCAGCCAATCCCATTA	0.493													8	9	---	---	---	---	PASS
B3GAT1	27087	broad.mit.edu	37	11	134254093	134254093	+	Intron	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134254093G>T	uc001qhq.2	-						B3GAT1_uc001qhr.2_Intron|B3GAT1_uc010scv.1_Intron	NM_018644	NP_061114	Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1						carbohydrate metabolic process	Golgi membrane|integral to membrane	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity|metal ion binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		CTGCGGAGTCGGGAGACCGGC	0.716													8	27	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2721173	2721173	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2721173A>G	uc009zdu.1	+	30	4195	c.3882A>G	c.(3880-3882)AAA>AAG	p.K1294K	CACNA1C_uc009zdv.1_Silent_p.K1271K|CACNA1C_uc001qkb.2_Silent_p.K1274K|CACNA1C_uc001qkc.2_Silent_p.K1274K|CACNA1C_uc001qke.2_Silent_p.K1274K|CACNA1C_uc001qkf.2_Silent_p.K1274K|CACNA1C_uc001qjz.2_Silent_p.K1274K|CACNA1C_uc001qkd.2_Silent_p.K1274K|CACNA1C_uc001qkg.2_Silent_p.K1274K|CACNA1C_uc009zdw.1_Silent_p.K1274K|CACNA1C_uc001qkh.2_Silent_p.K1274K|CACNA1C_uc001qkl.2_Silent_p.K1294K|CACNA1C_uc001qkn.2_Silent_p.K1274K|CACNA1C_uc001qko.2_Silent_p.K1294K|CACNA1C_uc001qkp.2_Silent_p.K1274K|CACNA1C_uc001qkr.2_Silent_p.K1274K|CACNA1C_uc001qku.2_Silent_p.K1274K|CACNA1C_uc001qkq.2_Silent_p.K1274K|CACNA1C_uc001qks.2_Silent_p.K1274K|CACNA1C_uc001qkt.2_Silent_p.K1274K|CACNA1C_uc001qka.1_Silent_p.K809K|CACNA1C_uc001qki.1_Silent_p.K1010K|CACNA1C_uc001qkj.1_Silent_p.K1010K|CACNA1C_uc001qkk.1_Silent_p.K1010K|CACNA1C_uc001qkm.1_Silent_p.K1010K	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1294	Cytoplasmic (Potential).|IV.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	TTGCCTTCAAACCCAAGGTAG	0.537													11	39	---	---	---	---	PASS
CLEC4C	170482	broad.mit.edu	37	12	7894112	7894112	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7894112A>G	uc001qtg.1	-	3	314	c.140T>C	c.(139-141)ATG>ACG	p.M47T	CLEC4C_uc001qth.1_Missense_Mutation_p.M47T|CLEC4C_uc001qti.1_Missense_Mutation_p.M16T	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	47	Extracellular (Potential).				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		TTTGCTATACATAAAATTGTG	0.378													5	105	---	---	---	---	PASS
PRR4	11272	broad.mit.edu	37	12	11000994	11000994	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11000994T>C	uc001qyz.3	-	2	116	c.77A>G	c.(76-78)GAA>GGA	p.E26G	PRR4_uc009zhp.2_Missense_Mutation_p.E39G|PRH1_uc001qzb.3_RNA|PRR4_uc001qza.3_RNA|PRR4_uc009zhq.1_RNA	NM_007244	NP_009175	Q16378	PROL4_HUMAN	proline rich 4 (lacrimal) isoform 2	26					visual perception	extracellular space					0						AGTAAAGTCTTCATAGTTCAC	0.383													8	72	---	---	---	---	PASS
LRP6	4040	broad.mit.edu	37	12	12303938	12303938	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12303938A>G	uc001rah.3	-	13	2968	c.2826T>C	c.(2824-2826)AGT>AGC	p.S942S	BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Silent_p.S942S	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein	942	Extracellular (Potential).|Beta-propeller 4.				cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				GGTTGATGGCACTCTTTTGAC	0.438													5	82	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30805224	30805224	+	Splice_Site	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30805224C>T	uc001rjd.2	-	19	2245	c.2075_splice	c.e19-1	p.D692_splice	IPO8_uc001rje.1_Splice_Site_p.D181_splice|IPO8_uc010sjt.1_Splice_Site_p.D487_splice	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8						intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GGCATCATGTCTGAAAAAAAA	0.323													5	78	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32996237	32996237	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32996237G>T	uc001rlj.3	-	6	1504	c.1389C>A	c.(1387-1389)GTC>GTA	p.V463V	PKP2_uc001rlk.3_Intron|PKP2_uc010skj.1_Intron	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	463	ARM 3.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TTCTTAAATTGACTGTATGGT	0.274													5	95	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40707775	40707775	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40707775T>C	uc001rmg.3	+	32	4659	c.4538T>C	c.(4537-4539)ATC>ACC	p.I1513T	LRRK2_uc009zjw.2_Missense_Mutation_p.I351T|LRRK2_uc001rmi.2_Missense_Mutation_p.I346T	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1513					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATTTCATAGATCCGAGATCAG	0.343													4	35	---	---	---	---	PASS
YAF2	10138	broad.mit.edu	37	12	42554536	42554536	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42554536T>A	uc001rmv.2	-	4	466	c.398A>T	c.(397-399)AAA>ATA	p.K133I	YAF2_uc001rmw.2_Missense_Mutation_p.K157I|YAF2_uc010sko.1_Missense_Mutation_p.K124I|YAF2_uc010skp.1_Missense_Mutation_p.K91I	NM_005748	NP_005739	Q8IY57	YAF2_HUMAN	YY1 associated factor 2	133					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|zinc ion binding				0	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		TGACTTTGTTTTCTCCTTAAA	0.438													30	34	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46233248	46233248	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46233248C>T	uc001ros.1	+	11	1467	c.1467C>T	c.(1465-1467)GTC>GTT	p.V489V	ARID2_uc001ror.2_Silent_p.V489V|ARID2_uc009zkg.1_5'UTR|ARID2_uc009zkh.1_Silent_p.V116V|ARID2_uc001rot.1_Silent_p.V135V	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	489					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TAGAGCAAGTCCAAACCCAGA	0.403													4	225	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51138612	51138612	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51138612A>T	uc001rwv.2	+	38	4877	c.4721A>T	c.(4720-4722)TAT>TTT	p.Y1574F	DIP2B_uc009zlt.2_Missense_Mutation_p.Y1004F	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	1574						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						TACGTGGCTTATAACATGTAA	0.507													15	67	---	---	---	---	PASS
SLC11A2	4891	broad.mit.edu	37	12	51402304	51402304	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51402304G>A	uc001rxe.3	-	3	235	c.138C>T	c.(136-138)TAC>TAT	p.Y46Y	SLC11A2_uc001rxd.3_5'UTR|SLC11A2_uc001rxc.3_Silent_p.Y46Y|SLC11A2_uc001rxf.2_RNA|SLC11A2_uc010smx.1_Silent_p.Y42Y|SLC11A2_uc001rxh.1_Silent_p.Y46Y|SLC11A2_uc001rxj.1_Silent_p.Y46Y|SLC11A2_uc001rxi.2_Silent_p.Y46Y|SLC11A2_uc001rxk.1_Silent_p.Y75Y|SLC11A2_uc010smy.1_Silent_p.Y9Y	NM_000617	NP_000608	P49281	NRAM2_HUMAN	solute carrier family 11 (proton-coupled	46	Cytoplasmic (Potential).				activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1						AAGTGGCGAAGTACTCCTCTG	0.488													13	170	---	---	---	---	PASS
HOXC4	3221	broad.mit.edu	37	12	54447770	54447770	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54447770G>C	uc001seu.2	+	3	744	c.64G>C	c.(64-66)GAA>CAA	p.E22Q	HOXC4_uc001sex.2_Missense_Mutation_p.E22Q	NM_014620	NP_055435	P09017	HXC4_HUMAN	homeobox C4	22						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TCCATGCGAAGAATATTCGCA	0.448													120	132	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70983913	70983913	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70983913C>T	uc001swb.3	-	6	1257	c.1227G>A	c.(1225-1227)CGG>CGA	p.R409R	PTPRB_uc010sto.1_Silent_p.R409R|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Silent_p.R627R|PTPRB_uc001swa.3_Silent_p.R627R|PTPRB_uc001swd.3_Silent_p.R626R|PTPRB_uc009zrr.1_Silent_p.R506R	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	409	Fibronectin type-III 5.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AGAGTAGGATCCGATACTGCT	0.512											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	49	133	---	---	---	---	PASS
PTPRR	5801	broad.mit.edu	37	12	71139710	71139710	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71139710G>T	uc001swi.1	-	6	1311	c.895C>A	c.(895-897)CTG>ATG	p.L299M	PTPRR_uc001swh.1_Missense_Mutation_p.L54M|PTPRR_uc009zrs.2_Missense_Mutation_p.L148M|PTPRR_uc010stq.1_Missense_Mutation_p.L187M|PTPRR_uc010str.1_Missense_Mutation_p.L148M	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	299	Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		ACAACATTCAGTACCTTTGGG	0.537													35	81	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72355476	72355476	+	Intron	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72355476A>C	uc009zrw.1	+						TPH2_uc001swy.2_Intron	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2						aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	GTTGATATTTAATTTCATGAT	0.383													5	84	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85626479	85626479	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85626479A>G	uc001tac.2	+	26	5072	c.4961A>G	c.(4960-4962)CAC>CGC	p.H1654R		NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1654										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TGCAGCAATCACTTTTTGCCT	0.338													42	51	---	---	---	---	PASS
CCDC41	51134	broad.mit.edu	37	12	94706779	94706779	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94706779A>C	uc001tdd.2	-	15	2308	c.1722T>G	c.(1720-1722)CAT>CAG	p.H574Q	CCDC41_uc001tde.2_Missense_Mutation_p.H574Q|CCDC41_uc009zsw.1_RNA	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	566	Potential.										0						ATTTGTTTTCATGAAGAGATT	0.269													11	32	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114836499	114836499	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114836499G>T	uc001tvo.2	-	5	884	c.389C>A	c.(388-390)GCC>GAC	p.A130D	TBX5_uc001tvp.2_Missense_Mutation_p.A130D|TBX5_uc001tvq.2_Missense_Mutation_p.A80D|TBX5_uc010syv.1_Missense_Mutation_p.A130D	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	130	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GCCAGGCATGGCGGGCTCAGC	0.612													8	9	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116424272	116424272	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116424272C>T	uc001tvw.2	-	19	4192	c.4137G>A	c.(4135-4137)CCG>CCA	p.P1379P		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1379					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GGATGGGCAACGGCTCAGGAG	0.473													14	83	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19748040	19748040	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19748040G>A	uc009zzj.2	-	5	1365	c.1316C>T	c.(1315-1317)TCC>TTC	p.S439F		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	439					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GGCTTCCACGGAATCCACGCC	0.592													8	140	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29608097	29608097	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29608097C>G	uc001usl.3	+	2	2369	c.2311C>G	c.(2311-2313)CGG>GGG	p.R771G		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	761	Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						AACTTTCTATCGGTCAGCCAT	0.453													3	44	---	---	---	---	PASS
CCNA1	8900	broad.mit.edu	37	13	37014302	37014302	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37014302G>T	uc001uvr.3	+	6	1430	c.1080G>T	c.(1078-1080)AGG>AGT	p.R360S	CCNA1_uc010teo.1_Missense_Mutation_p.R316S|CCNA1_uc010abq.2_Missense_Mutation_p.R316S|CCNA1_uc010abp.2_Missense_Mutation_p.R316S|CCNA1_uc001uvs.3_Missense_Mutation_p.R359S|CCNA1_uc010abr.2_RNA	NM_003914	NP_003905	P78396	CCNA1_HUMAN	cyclin A1 isoform a	360					cell division|G2/M transition of mitotic cell cycle|male meiosis I|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|spermatogenesis	cytosol|microtubule cytoskeleton|nucleoplasm	protein kinase binding			lung(2)|skin(2)|ovary(1)	5		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		TGTGCGTCAGGACTGAGAACC	0.468													46	57	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38138709	38138709	+	Intron	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38138709T>C	uc001uwo.3	-						POSTN_uc010tet.1_Intron|POSTN_uc001uwp.3_Intron|POSTN_uc001uwr.2_Intron|POSTN_uc001uwq.2_Intron|POSTN_uc010teu.1_Intron|POSTN_uc010tev.1_Intron|POSTN_uc010tew.1_Intron	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1						cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TAAAATTAAATTGTTGTAGTT	0.343													27	40	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77629779	77629779	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77629779T>C	uc001vkf.2	-	81	13538	c.13447A>G	c.(13447-13449)ACA>GCA	p.T4483A	MYCBP2_uc010aev.2_Missense_Mutation_p.T3887A|MYCBP2_uc001vke.2_Missense_Mutation_p.T1100A	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	4483					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CCAGGAGTTGTGATAGCTTCA	0.363													27	58	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22521153	22521153	+	Intron	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22521153C>A	uc001wbw.2	+						uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_RNA					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTAGGCAGGACCCTGGGAAAG	0.463													4	65	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23869498	23869498	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23869498C>A	uc001wjv.2	-	14	1615	c.1548G>T	c.(1546-1548)ATG>ATT	p.M516I	MYH6_uc010akp.1_Missense_Mutation_p.M516I	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	516	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CCTGCAGGTCCATGCCAAAGT	0.557													30	55	---	---	---	---	PASS
RIPK3	11035	broad.mit.edu	37	14	24805493	24805493	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24805493G>A	uc001wpb.2	-	10	1655	c.1445C>T	c.(1444-1446)TCG>TTG	p.S482L	ADCY4_uc001wov.2_5'Flank|ADCY4_uc001wow.2_5'Flank|ADCY4_uc010toh.1_5'Flank|ADCY4_uc001wox.2_5'Flank|ADCY4_uc001woy.2_5'Flank|ADCY4_uc001woz.3_5'Flank|RIPK3_uc001wpa.2_Missense_Mutation_p.S282L|RIPK3_uc010alq.2_RNA|RIPK3_uc010toi.1_Missense_Mutation_p.S261L	NM_006871	NP_006862	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	482					apoptosis|induction of apoptosis by extracellular signals	cytoplasm	ATP binding|protein binding|transcription coactivator activity			central_nervous_system(2)|ovary(1)|lung(1)	4				GBM - Glioblastoma multiforme(265;0.0181)		CCCCTTGCCCGAAGGTGCCAA	0.542													47	93	---	---	---	---	PASS
HEATR5A	25938	broad.mit.edu	37	14	31858046	31858046	+	Intron	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31858046C>G	uc001wrf.3	-						HEATR5A_uc010ami.2_5'Flank|HEATR5A_uc001wrg.1_5'Flank|HEATR5A_uc010tpk.1_Intron	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A								binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		ATTTGTGATTCCAACCTGAGT	0.428													18	57	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33016177	33016177	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33016177A>C	uc001wrq.2	+	4	2488	c.2318A>C	c.(2317-2319)AAC>ACC	p.N773T	AKAP6_uc010aml.2_Missense_Mutation_p.N770T	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	773	Spectrin 1.				protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CACCAAGACAACTATGAAGCC	0.383													43	93	---	---	---	---	PASS
PSMA6	5687	broad.mit.edu	37	14	35778212	35778212	+	Intron	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35778212T>G	uc001wtd.2	+						KIAA0391_uc001wta.2_Intron|PSMA6_uc010tpt.1_Intron|PSMA6_uc010tpu.1_Intron	NM_002791	NP_002782	P60900	PSA6_HUMAN	proteasome alpha 6 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nuclear matrix|polysome|proteasome core complex, alpha-subunit complex|sarcomere	NF-kappaB binding|purine ribonucleoside triphosphate binding|RNA binding|threonine-type endopeptidase activity				0	Breast(36;0.0519)|Hepatocellular(127;0.158)		Lung(238;3.81e-05)|LUAD - Lung adenocarcinoma(48;5.59e-05)|Epithelial(34;0.00342)|all cancers(34;0.00973)	GBM - Glioblastoma multiforme(112;0.0234)		GTAATTAATCTGTAGATATAC	0.294													5	181	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47324237	47324237	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47324237G>T	uc001wwj.3	-	15	2862	c.2666C>A	c.(2665-2667)ACT>AAT	p.T889N	MDGA2_uc001wwh.3_Missense_Mutation_p.T91N|MDGA2_uc001wwi.3_Missense_Mutation_p.T660N	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	889	MAM.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						CTGAAATGAAGTAATTGGGTA	0.323													5	110	---	---	---	---	PASS
STYX	6815	broad.mit.edu	37	14	53217453	53217453	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53217453A>T	uc010tqy.1	+	5	259	c.197A>T	c.(196-198)AAT>ATT	p.N66I	STYX_uc001xaa.2_Missense_Mutation_p.N66I	NM_001130701	NP_001124173	Q8WUJ0	STYX_HUMAN	serine/threonine/tyrosine interacting protein	66					protein dephosphorylation|spermatogenesis	cytoplasm	protein tyrosine/serine/threonine phosphatase activity				0	Breast(41;0.176)					ATACGACAAAATATTGAAGCA	0.299													7	198	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63483556	63483556	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63483556T>A	uc001xfx.2	-	2	241	c.190A>T	c.(190-192)ACT>TCT	p.T64S	KCNH5_uc001xfy.2_Missense_Mutation_p.T64S|KCNH5_uc001xfz.1_Missense_Mutation_p.T6S|KCNH5_uc001xga.2_Missense_Mutation_p.T6S	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	64	Cytoplasmic (Potential).|PAS.				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TACCTGCAAGTGCTGCTTTTC	0.378													20	91	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64488573	64488573	+	Splice_Site	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64488573A>C	uc001xgm.2	+	37	5583	c.5353_splice	c.e37-2	p.E1785_splice	SYNE2_uc001xgl.2_Splice_Site_p.E1785_splice	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTATGCATTTAGGAGATACAA	0.318													18	66	---	---	---	---	PASS
C14orf179	112752	broad.mit.edu	37	14	76452154	76452154	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76452154G>C	uc010asm.1	+	1	59	c.25G>C	c.(25-27)GAG>CAG	p.E9Q	C14orf179_uc001xsf.2_RNA|C14orf179_uc010asl.1_Missense_Mutation_p.E9Q|C14orf179_uc001xsg.2_Missense_Mutation_p.E9Q|C14orf179_uc010tve.1_RNA|C14orf179_uc001xse.2_Missense_Mutation_p.E9Q	NM_001102564	NP_001096034	Q96FT9	IFT43_HUMAN	hypothetical protein LOC112752 isoform 2	9					cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)		CGACTTGGACGAGGAGCTTCG	0.672													16	50	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	80319975	80319975	+	Intron	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80319975G>T	uc001xun.2	+						NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TTCATCTCCTGTGTAGTTCAC	0.453													47	129	---	---	---	---	PASS
TDP1	55775	broad.mit.edu	37	14	90459730	90459730	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90459730G>T	uc001xxy.2	+	14	1743	c.1444G>T	c.(1444-1446)GCT>TCT	p.A482S	TDP1_uc010atm.2_RNA|TDP1_uc001xxz.2_Missense_Mutation_p.A482S|TDP1_uc010atn.2_Missense_Mutation_p.A482S|TDP1_uc001xya.2_Missense_Mutation_p.A243S|TDP1_uc001xyb.2_RNA|TDP1_uc010ato.2_Missense_Mutation_p.A482S|TDP1_uc001xyd.1_Missense_Mutation_p.A97S	NM_018319	NP_060789	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	482					cell death|double-strand break repair|single strand break repair	cytoplasm|nucleus	3'-tyrosyl-DNA phosphodiesterase activity|double-stranded DNA binding|exonuclease activity|protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		CAAATGGTCAGCTGAGACTTC	0.373								Repair_of_DNA-protein_crosslinks					12	42	---	---	---	---	PASS
TRAF3	7187	broad.mit.edu	37	14	103371655	103371655	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103371655A>G	uc001ymc.1	+	12	1594	c.1241A>G	c.(1240-1242)TAC>TGC	p.Y414C	TRAF3_uc001yme.1_Missense_Mutation_p.Y389C|TRAF3_uc001ymd.1_Missense_Mutation_p.Y414C|TRAF3_uc010txy.1_Missense_Mutation_p.Y331C	NM_145725	NP_663777	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3 isoform 1	414					apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		ACCGCCAGCTACAATGGAGTG	0.597													25	66	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106725354	106725354	+	RNA	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106725354C>A	uc010tyt.1	-	588		c.18193G>T								Parts of antibodies, mostly variable regions.												0						TAGCTGAGACCCACTCCAGCC	0.572													57	368	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107283095	107283095	+	5'Flank	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107283095A>G	uc010tyt.1	-						uc001ytb.1_Silent_p.G16G					Parts of antibodies, mostly variable regions.												0						GGGAGTAGGTACCTGTGGAGA	0.592													40	125	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24924477	24924477	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24924477C>T	uc001ywo.2	+	1	3937	c.3463C>T	c.(3463-3465)CTT>TTT	p.L1155F		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	1155					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CTGTTTCCAACTTCCGTAAGA	0.428													5	86	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25966982	25966982	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25966982G>A	uc010ayu.2	-	7	1291	c.1185C>T	c.(1183-1185)GAC>GAT	p.D395D		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	395	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ACAACTGCATGTCCTGGTTAA	0.423													10	132	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27193318	27193318	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27193318G>T	uc001zbd.1	+	12	1666	c.1327G>T	c.(1327-1329)GTT>TTT	p.V443F	GABRA5_uc001zbe.1_RNA	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	443	Helical; (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TTTCAACTTAGTTTACTGGGC	0.443													9	19	---	---	---	---	PASS
FSIP1	161835	broad.mit.edu	37	15	40030346	40030346	+	Silent	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40030346C>A	uc001zki.2	-	8	1055	c.837G>T	c.(835-837)CTG>CTT	p.L279L		NM_152597	NP_689810	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	279										ovary(2)|skin(1)	3		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		AAAGCTCAACCAGCCTTTTCT	0.378													35	86	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43363118	43363118	+	Silent	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43363118T>A	uc001zqq.2	-	5	600	c.534A>T	c.(532-534)TCA>TCT	p.S178S	UBR1_uc010udk.1_Silent_p.S178S	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	178					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ACGGACAGCGTGAATTCTATA	0.323													24	62	---	---	---	---	PASS
SLC30A4	7782	broad.mit.edu	37	15	45779781	45779781	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45779781A>G	uc001zvj.2	-	6	1256	c.944T>C	c.(943-945)CTT>CCT	p.L315P		NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),	315	Helical; (Potential).				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		AAAAGCCACAAGTAATGAAAA	0.308													3	163	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48561893	48561893	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48561893G>T	uc001zwn.3	+	19	2550	c.2334G>T	c.(2332-2334)GTG>GTT	p.V778V	SLC12A1_uc010uew.1_Silent_p.V584V|SLC12A1_uc010bem.2_Silent_p.V778V|SLC12A1_uc001zwq.3_Silent_p.V549V|SLC12A1_uc001zwr.3_Silent_p.V505V	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	778					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	ACACTCTGGTGATTGGATATA	0.418													5	30	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55964742	55964742	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55964742T>A	uc002adg.2	-	11	1990	c.1942A>T	c.(1942-1944)ATT>TTT	p.I648F	PRTG_uc002adh.2_Missense_Mutation_p.I150F	NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	648	Fibronectin type-III 3.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		TAGCCCTGAATAGCAGCTGTG	0.488													23	83	---	---	---	---	PASS
TRIP4	9325	broad.mit.edu	37	15	64689799	64689799	+	Intron	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64689799C>T	uc002anm.2	+							NM_016213	NP_057297	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ligand-dependent nuclear receptor binding|transcription coactivator activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3						TGTCTTTGTACGATAGGCACA	0.383													16	50	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64915056	64915056	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64915056C>G	uc002ann.2	+	2	778	c.778C>G	c.(778-780)CTG>GTG	p.L260V		NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	260						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ACCAGCAGTGCTGCCAATACA	0.473													68	129	---	---	---	---	PASS
IL16	3603	broad.mit.edu	37	15	81598257	81598257	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81598257A>G	uc002bgh.3	+	17	3805	c.3429A>G	c.(3427-3429)AGA>AGG	p.R1143R	IL16_uc010blq.1_Silent_p.R1097R|IL16_uc002bge.3_RNA|IL16_uc010unp.1_Silent_p.R1185R|IL16_uc002bgg.2_Silent_p.R1143R|IL16_uc002bgi.1_Silent_p.R533R|IL16_uc002bgj.2_Silent_p.R637R|IL16_uc002bgk.2_Silent_p.R442R|IL16_uc002bgl.1_Silent_p.R442R|IL16_uc010unq.1_Silent_p.R442R	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	1143	PDZ 3.|Interaction with PPP1R12A, PPP1R12B and PPP1R12C.				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						AGGTTCACAGAGTGTTTCCAA	0.507													7	144	---	---	---	---	PASS
EFTUD1	79631	broad.mit.edu	37	15	82512533	82512533	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82512533G>A	uc002bgt.1	-	13	1499	c.1330C>T	c.(1330-1332)CGT>TGT	p.R444C	EFTUD1_uc002bgu.1_Missense_Mutation_p.R393C	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain	444					mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						TGTCTTGCACGCTCACGTCTC	0.498													6	392	---	---	---	---	PASS
SYNM	23336	broad.mit.edu	37	15	99673095	99673095	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99673095G>T	uc002bup.2	+	6	4650	c.4530G>T	c.(4528-4530)GGG>GGT	p.G1510G	SYNM_uc002buo.2_Silent_p.G1198G|SYNM_uc002buq.2_RNA	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	1510	Tail.|Interaction with DMD and UTRN.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						CCTCTGCTGGGGAAGGAGACC	0.562													22	76	---	---	---	---	PASS
ADAMTS17	170691	broad.mit.edu	37	15	100871105	100871105	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100871105T>C	uc002bvv.1	-	3	684	c.605A>G	c.(604-606)AAG>AGG	p.K202R	ADAMTS17_uc002bvx.1_5'UTR	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	202	Cysteine switch (By similarity).				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		TGTTAGAACCTTGCAGAGCTG	0.567													46	121	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101562654	101562654	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101562654A>C	uc002bwr.2	+	15	2238	c.1919A>C	c.(1918-1920)AAG>ACG	p.K640T	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	640	Roc.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAGCTGATGAAGATGATCATC	0.592													38	103	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	9012908	9012908	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9012908A>C	uc002czl.2	-	6	899	c.700T>G	c.(700-702)TTC>GTC	p.F234V	USP7_uc010uyk.1_Missense_Mutation_p.F135V|USP7_uc010uyj.1_Missense_Mutation_p.F135V|USP7_uc002czk.2_Missense_Mutation_p.F218V|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	234					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TGATTCGTGAAAAATAACGTC	0.463													13	231	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20451694	20451694	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20451694C>G	uc002dhe.2	+	14	1832	c.1685C>G	c.(1684-1686)ACG>AGG	p.T562R		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	562					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						CTGCCAAAGACGGTTTCTGGA	0.448													22	55	---	---	---	---	PASS
ADCY7	113	broad.mit.edu	37	16	50339494	50339494	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50339494C>T	uc002egd.1	+	12	1944	c.1676C>T	c.(1675-1677)ACG>ATG	p.T559M	ADCY7_uc002egc.1_Missense_Mutation_p.T559M	NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	559	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)	CTCAGCTCCACGAGGTGAGGT	0.607													6	186	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77369733	77369733	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77369733G>T	uc002ffc.3	-	12	2198	c.1779C>A	c.(1777-1779)TCC>TCA	p.S593S	ADAMTS18_uc010chc.1_Silent_p.S181S|ADAMTS18_uc002ffe.1_Silent_p.S289S	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	593	TSP type-1 1.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TCGACCAGGCGGACCACTGGC	0.572													80	200	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77397773	77397773	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77397773G>T	uc002ffc.3	-	6	1401	c.982C>A	c.(982-984)CTA>ATA	p.L328I	ADAMTS18_uc010chc.1_5'UTR|ADAMTS18_uc002ffe.1_Missense_Mutation_p.L24I|ADAMTS18_uc010vni.1_RNA	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	328	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TCTTTAAATAGGCCAGAAACC	0.383													25	67	---	---	---	---	PASS
MAF	4094	broad.mit.edu	37	16	79628410	79628410	+	3'UTR	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79628410C>T	uc002ffn.2	-	1					MAF_uc002ffm.2_Missense_Mutation_p.A387T	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene						transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		CAAAATGTGGCGTATCCCACT	0.378			T	IGH@	MM								5	9	---	---	---	---	PASS
MTHFSD	64779	broad.mit.edu	37	16	86565980	86565980	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86565980C>T	uc002fjn.2	-	8	840	c.789G>A	c.(787-789)CCG>CCA	p.P263P	MTHFSD_uc010voo.1_Silent_p.P243P|MTHFSD_uc002fjo.2_Silent_p.P100P|MTHFSD_uc002fjm.2_Silent_p.P262P|MTHFSD_uc010vop.1_Silent_p.P100P|MTHFSD_uc010voq.1_Silent_p.P262P|MTHFSD_uc010vor.1_Silent_p.P263P	NM_001159377	NP_001152849	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain	263					folic acid-containing compound biosynthetic process		5-formyltetrahydrofolate cyclo-ligase activity|ATP binding|RNA binding				0						AGCCTGGTTCCGGAAGGTGCT	0.637													3	9	---	---	---	---	PASS
TRAPPC2L	51693	broad.mit.edu	37	16	88925020	88925020	+	Intron	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88925020C>A	uc002fmc.2	+						GALNS_uc002fly.3_5'Flank|GALNS_uc010cid.2_5'Flank|GALNS_uc002flz.3_5'Flank|GALNS_uc002fma.2_5'Flank|TRAPPC2L_uc010cie.2_Intron|TRAPPC2L_uc002fmd.3_Intron|TRAPPC2L_uc002fme.3_Intron|TRAPPC2L_uc002fmf.2_5'Flank|uc002fmg.2_5'Flank	NM_016209	NP_057293	Q9UL33	TPC2L_HUMAN	trafficking protein particle complex 2-like						ER to Golgi vesicle-mediated transport	endoplasmic reticulum|Golgi apparatus|perinuclear region of cytoplasm					0				BRCA - Breast invasive adenocarcinoma(80;0.0477)		GTCATCCTTTCTTGCAGAATT	0.557											OREG0024050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	270	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5074150	5074150	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5074150C>A	uc002gau.1	+	36	6124	c.3894C>A	c.(3892-3894)AGC>AGA	p.S1298R	USP6_uc002gav.1_Missense_Mutation_p.S1298R|USP6_uc010ckz.1_Missense_Mutation_p.S981R	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	1298					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						AAGAAGACAGCACTGATGACC	0.418			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								4	115	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12656437	12656437	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12656437A>G	uc002gnn.2	+	10	2131	c.1832A>G	c.(1831-1833)AAT>AGT	p.N611S	MYOCD_uc002gno.2_Missense_Mutation_p.N611S|MYOCD_uc002gnp.1_Missense_Mutation_p.N515S|MYOCD_uc002gnq.2_Missense_Mutation_p.N330S	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	611					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CCTCTTGGAAATGCTCATTGT	0.512													10	194	---	---	---	---	PASS
SLC13A2	9058	broad.mit.edu	37	17	26817738	26817738	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26817738C>A	uc002hbh.2	+	4	455	c.388C>A	c.(388-390)CTG>ATG	p.L130M	SLC13A2_uc010wal.1_Missense_Mutation_p.L87M|SLC13A2_uc010wam.1_Missense_Mutation_p.L86M|SLC13A2_uc010wan.1_Missense_Mutation_p.L179M|SLC13A2_uc010wao.1_Missense_Mutation_p.L87M|SLC13A2_uc002hbi.2_Missense_Mutation_p.L59M	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	130	Helical; (Potential).					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	GGGCTTCATGCTGGTCACGGC	0.592													55	33	---	---	---	---	PASS
KRT222	125113	broad.mit.edu	37	17	38812817	38812817	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38812817A>T	uc002hvc.2	-	6	790	c.725T>A	c.(724-726)TTG>TAG	p.L242*	KRT222_uc010wfk.1_RNA|KRT222_uc002hvb.2_Nonsense_Mutation_p.L202*	NM_152349	NP_689562	Q8N1A0	KT222_HUMAN	truncated type I keratin KA21	242						intermediate filament	structural molecule activity			central_nervous_system(1)|skin(1)	2						CTTTTTCCTCAATCGAGGGTT	0.343													67	52	---	---	---	---	PASS
NSF	4905	broad.mit.edu	37	17	44782198	44782198	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44782198C>T	uc002iku.2	+	13	1552	c.1448C>T	c.(1447-1449)TCT>TTT	p.S483F	NSF_uc010wke.1_Missense_Mutation_p.S389F|NSF_uc010wkf.1_Missense_Mutation_p.S389F|NSF_uc010wkg.1_Missense_Mutation_p.S478F	NM_006178	NP_006169	P46459	NSF_HUMAN	vesicle-fusing ATPase	483					protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		TTCCTTGCTTCTTTGGAGAAT	0.383													9	73	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48753334	48753334	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48753334G>C	uc002isl.2	+	22	3030	c.2950G>C	c.(2950-2952)GCT>CCT	p.A984P	ABCC3_uc002isn.2_5'Flank	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	984	ABC transmembrane type-1 2.|Helical; Name=12; (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	TCAAAGTGCGGCTGCCATTGG	0.567													22	21	---	---	---	---	PASS
UTP18	51096	broad.mit.edu	37	17	49337958	49337958	+	Silent	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49337958C>A	uc002its.2	+	1	62	c.13C>A	c.(13-15)CGG>AGG	p.R5R	MBTD1_uc002itr.3_5'Flank|MBTD1_uc002itq.3_5'Flank	NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component	5					rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			GCCGCCGGAGCGGAGGAGACG	0.701													15	11	---	---	---	---	PASS
RNF43	54894	broad.mit.edu	37	17	56435317	56435317	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56435317G>A	uc002iwf.2	-	8	3776	c.1820C>T	c.(1819-1821)TCG>TTG	p.S607L	RNF43_uc010wnv.1_Missense_Mutation_p.S566L|RNF43_uc002iwh.3_Missense_Mutation_p.S607L|RNF43_uc002iwg.3_Missense_Mutation_p.S607L|RNF43_uc010dcw.2_Missense_Mutation_p.S480L	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	607	Pro-rich.|Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAGCCGCCCCGAAGGGGCTGC	0.647													13	151	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71391524	71391524	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71391524G>A	uc010dfm.2	-	25	3362	c.3362C>T	c.(3361-3363)CCG>CTG	p.P1121L	SDK2_uc002jjt.3_Missense_Mutation_p.P280L|SDK2_uc010dfn.2_Missense_Mutation_p.P800L	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	1121	Extracellular (Potential).|Fibronectin type-III 6.				cell adhesion	integral to membrane				ovary(2)	2						TTCCATCTCCGGGAGAGGCTG	0.632													13	57	---	---	---	---	PASS
UNC13D	201294	broad.mit.edu	37	17	73827393	73827393	+	Silent	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73827393C>T	uc002jpp.2	-	26	2864	c.2484G>A	c.(2482-2484)GTG>GTA	p.V828V	UNC13D_uc010wsk.1_Silent_p.V828V|UNC13D_uc002jpq.1_3'UTR	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	828	MHD2.				positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTCCACCAGCACTGTGAGTG	0.652									Familial_Hemophagocytic_Lymphohistiocytosis				10	39	---	---	---	---	PASS
MYO5B	4645	broad.mit.edu	37	18	47527731	47527731	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47527731T>C	uc002leb.2	-	5	794	c.506A>G	c.(505-507)AAG>AGG	p.K169R	MYO5B_uc002lec.1_Missense_Mutation_p.K168R	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	169	Myosin head-like.|ATP (Potential).				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		TGATACCGTCTTCCCGGCTCC	0.522													3	165	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50589827	50589827	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50589827G>T	uc002lfe.1	+	6	1725	c.1138G>T	c.(1138-1140)GTG>TTG	p.V380L	DCC_uc010xdr.1_Missense_Mutation_p.V228L|DCC_uc010dpf.1_Missense_Mutation_p.V35L	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	380	Extracellular (Potential).|Ig-like C2-type 4.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TTTTCAGATAGTGGTAATTAT	0.313													51	63	---	---	---	---	PASS
CDH19	28513	broad.mit.edu	37	18	64235678	64235678	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64235678G>T	uc002lkc.1	-	3	603	c.465C>A	c.(463-465)GCC>GCA	p.A155A	CDH19_uc010dql.1_RNA|CDH19_uc010xey.1_Silent_p.A155A|CDH19_uc002lkd.2_Silent_p.A155A	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein	155	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				CTGGTACAATGGCCTCATAAG	0.363													19	107	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65179558	65179558	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65179558C>A	uc002lke.1	-	2	3542	c.2318G>T	c.(2317-2319)AGG>ATG	p.R773M		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	763						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				GAAAATAATCCTATCATGTCT	0.383													10	100	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74620433	74620433	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74620433G>A	uc002lmi.2	+	14	2647	c.2449G>A	c.(2449-2451)GAG>AAG	p.E817K	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	817					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		AGCGAACCCCGAGGCCATGCT	0.627													5	60	---	---	---	---	PASS
FUT5	2527	broad.mit.edu	37	19	5867525	5867525	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5867525G>T	uc002mdo.3	-	2	300	c.212C>A	c.(211-213)CCT>CAT	p.P71H	FUT5_uc010duo.2_Missense_Mutation_p.P71H	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	71	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						GGGGTGGGCAGGGGTCGCCAT	0.667													10	75	---	---	---	---	PASS
CLEC4M	10332	broad.mit.edu	37	19	7831639	7831639	+	Silent	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7831639C>G	uc002mih.2	+	6	931	c.813C>G	c.(811-813)ACC>ACG	p.T271T	CLEC4M_uc010xjv.1_3'UTR|CLEC4M_uc002mhy.2_3'UTR|CLEC4M_uc010xjw.1_Silent_p.T227T|CLEC4M_uc010dvt.2_Silent_p.T248T|CLEC4M_uc010dvs.2_Silent_p.T270T|CLEC4M_uc010xjx.1_Silent_p.T243T|CLEC4M_uc002mhz.2_Silent_p.T202T|CLEC4M_uc002mic.2_Silent_p.T266T|CLEC4M_uc002mia.2_Silent_p.T158T	NM_001144910	NP_001138382	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M isoform	294	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to plasma membrane	ICAM-3 receptor activity|mannose binding|metal ion binding|peptide antigen binding|virion binding			pancreas(1)	1						ACTCCGTCACCGCCTGCCAGG	0.592													34	84	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8995703	8995703	+	Intron	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8995703G>A	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CCCAGGAGCTGAGGAGAAGCC	0.493													11	15	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9003659	9003659	+	Silent	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9003659G>T	uc002mkp.2	-	49	40185	c.39981C>A	c.(39979-39981)CTC>CTA	p.L13327L	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.L144L|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13329	Extracellular (Potential).|SEA 9.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGGTAAAATTGAGGGTGAATG	0.473													55	110	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602310	10602310	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602310C>A	uc002moq.1	-	3	1424	c.1268G>T	c.(1267-1269)GGC>GTC	p.G423V	KEAP1_uc002mop.1_Missense_Mutation_p.G141V|KEAP1_uc002mor.1_Missense_Mutation_p.G423V	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	423	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			ATAGATGTGGCCATCGATGAC	0.667													5	4	---	---	---	---	PASS
MIR181D	574457	broad.mit.edu	37	19	13985806	13985806	+	RNA	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13985806G>T	hsa-mir-181d|MI0003139	+			c.118G>T			NANOS3_uc002mxj.3_5'Flank																	0						GGCCAGACACGGCTTAAGGGG	0.587													19	30	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15807756	15807756	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15807756A>C	uc002nbl.2	+	13	1497	c.1436A>C	c.(1435-1437)AAA>ACA	p.K479T		NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					GCGGAGATGAAAGTGGTCCTG	0.627													26	30	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16038015	16038015	+	Intron	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16038015G>A	uc002nbu.2	-						CYP4F11_uc010eab.1_Intron|CYP4F11_uc002nbt.2_Intron	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide						inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GAGTTCAAGGGACTCACGTGC	0.308													6	63	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31038928	31038928	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31038928A>C	uc002nsu.1	+	4	2540	c.2402A>C	c.(2401-2403)CAC>CCC	p.H801P	ZNF536_uc010edd.1_Missense_Mutation_p.H801P	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	801	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					TTAGAGCGACACCATCGGGAG	0.517													53	67	---	---	---	---	PASS
WTIP	126374	broad.mit.edu	37	19	34981323	34981323	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34981323A>T	uc002nvm.2	+	2	710	c.710A>T	c.(709-711)CAG>CTG	p.Q237L		NM_001080436	NP_001073905			Wilms tumor 1 interacting protein												0	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GGAGCCCAGCAGGCGTGCCAG	0.592													11	106	---	---	---	---	PASS
FFAR2	2867	broad.mit.edu	37	19	35940862	35940862	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35940862C>A	uc002nzg.2	+	2	326	c.246C>A	c.(244-246)TGC>TGA	p.C82*	FFAR2_uc010eea.2_Nonsense_Mutation_p.C82*	NM_005306	NP_005297	O15552	FFAR2_HUMAN	free fatty acid receptor 2	82	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			AGGTCGTCTGCGCCCTCACGA	0.627													4	33	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41077929	41077929	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41077929T>G	uc002ony.2	+	34	7410	c.7324T>G	c.(7324-7326)TGG>GGG	p.W2442G	SPTBN4_uc002onz.2_Missense_Mutation_p.W2442G|SPTBN4_uc010egx.2_Missense_Mutation_p.W1185G	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	2442	PH.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTCCAGGTCGTGGGTGAGCCT	0.567													10	640	---	---	---	---	PASS
ZNF235	9310	broad.mit.edu	37	19	44792290	44792290	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44792290C>T	uc002oza.3	-	5	1401	c.1298G>A	c.(1297-1299)TGT>TAT	p.C433Y	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.C429Y|ZNF235_uc010xwx.1_Missense_Mutation_p.C347Y	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog	433	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)				ACAATCCCCACATTTATATGG	0.418													4	98	---	---	---	---	PASS
SULT2A1	6822	broad.mit.edu	37	19	48389461	48389461	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48389461G>C	uc002phr.2	-	1	194	c.54C>G	c.(52-54)TTC>TTG	p.F18L		NM_003167	NP_003158	Q06520	ST2A1_HUMAN	bile-salt sulfotransferase 2A1	18					3'-phosphoadenosine 5'-phosphosulfate metabolic process|bile acid catabolic process|cellular lipid metabolic process|digestion|sulfation|xenobiotic metabolic process	cytosol	bile-salt sulfotransferase activity			ovary(1)|pancreas(1)	2		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)		TTTCGGATCTGAAACCCATAG	0.428													75	87	---	---	---	---	PASS
CCDC114	93233	broad.mit.edu	37	19	48800667	48800667	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48800667C>T	uc002pir.2	-	14	2262	c.1579G>A	c.(1579-1581)GGC>AGC	p.G527S	CCDC114_uc002piq.2_Missense_Mutation_p.G336S|CCDC114_uc002pio.2_3'UTR	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	527										ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GTACTGGAGCCGGCCCTCTGG	0.697													3	69	---	---	---	---	PASS
FPR3	2359	broad.mit.edu	37	19	52327500	52327500	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52327500A>G	uc002pxt.1	+	2	683	c.499A>G	c.(499-501)ATA>GTA	p.I167V		NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2	167	Extracellular (Potential).				cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6						CTGGACTACAATAAGTACTAC	0.458													53	121	---	---	---	---	PASS
ZNF578	147660	broad.mit.edu	37	19	53007938	53007938	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53007938G>C	uc002pzp.3	+	5	338	c.94G>C	c.(94-96)GAA>CAA	p.E32Q		NM_001099694	NP_001093164	Q96N58	ZN578_HUMAN	zinc finger protein 578	Error:Variant_position_missing_in_Q96N58_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TGTGGCTATAGAATTCTCATT	0.448													17	142	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55085379	55085379	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55085379G>C	uc002qgg.3	+	1	123	c.34G>C	c.(34-36)GGG>CGG	p.G12R	LILRA2_uc010ern.2_Missense_Mutation_p.G12R|LILRA2_uc002qgf.2_Missense_Mutation_p.G12R|LILRA2_uc010yfe.1_Missense_Mutation_p.G12R|LILRA2_uc010yff.1_Missense_Mutation_p.G12R|LILRA2_uc010ero.2_Missense_Mutation_p.G12R|LILRA2_uc010yfg.1_Missense_Mutation_p.G12R	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	12					defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		GATCTGTCTCGGTGAGATTTG	0.602													69	80	---	---	---	---	PASS
NCR1	9437	broad.mit.edu	37	19	55418050	55418050	+	Silent	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55418050A>G	uc002qib.2	+	3	278	c.240A>G	c.(238-240)AAA>AAG	p.K80K	NCR1_uc002qic.2_Silent_p.K80K|NCR1_uc002qie.2_Silent_p.K80K|NCR1_uc002qid.2_Intron|NCR1_uc002qif.2_Intron|NCR1_uc010esj.2_Intron	NM_004829	NP_004820	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	80	Ig-like 1.|Extracellular (Potential).				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0449)		GGATTAACAAAGTCAAATTCT	0.522													6	88	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55435244	55435244	+	Intron	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55435244G>A	uc002qih.3	-						NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Intron|NLRP7_uc010esk.2_Intron|NLRP7_uc010esl.2_Intron	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CTTCAACCTGGAGGGATCAGA	0.413													28	44	---	---	---	---	PASS
NSFL1C	55968	broad.mit.edu	37	20	1435635	1435635	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1435635G>C	uc002wfc.2	-	4	1369	c.421C>G	c.(421-423)CCT>GCT	p.P141A	NSFL1C_uc002wfd.2_Missense_Mutation_p.P30A|NSFL1C_uc002wfe.2_Missense_Mutation_p.P141A|NSFL1C_uc002wff.2_RNA|NSFL1C_uc010gag.2_5'Flank	NM_016143	NP_057227	Q9UNZ2	NSF1C_HUMAN	p47 protein isoform a	141						chromosome|Golgi stack|nucleus	lipid binding|protein binding				0						GTCTCTCCAGGGCTCTTGGTC	0.532													89	295	---	---	---	---	PASS
MAVS	57506	broad.mit.edu	37	20	3844897	3844897	+	Intron	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3844897C>T	uc002wjw.3	+						MAVS_uc002wjx.3_Intron|MAVS_uc002wjy.3_Intron	NM_020746	NP_065797	Q7Z434	MAVS_HUMAN	virus-induced signaling adapter						activation of innate immune response|cellular response to exogenous dsRNA|defense response to bacterium|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of chemokine (C-C motif) ligand 5 production|positive regulation of defense response to virus by host|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interleukin-8 production|positive regulation of IP-10 production|positive regulation of protein import into nucleus, translocation|positive regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|response to virus	integral to membrane|mitochondrial outer membrane	CARD domain binding|protein kinase binding|signal transducer activity				0						GTTTTTCCACCGGCAGGTGCG	0.602													6	261	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8703075	8703075	+	Intron	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8703075A>G	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						TGAGGTGGGTACTTAGGGCTT	0.443													7	130	---	---	---	---	PASS
C20orf3	57136	broad.mit.edu	37	20	24954272	24954272	+	Intron	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24954272C>A	uc002wty.2	-						C20orf3_uc002wtz.2_Intron|C20orf3_uc010zsw.1_Intron	NM_020531	NP_065392	Q9HDC9	APMAP_HUMAN	chromosome 20 open reading frame 3						biosynthetic process	cell surface|integral to membrane	arylesterase activity|strictosidine synthase activity			ovary(1)	1						GGGATTATCACCAACTTACTG	0.468													12	111	---	---	---	---	PASS
ACSS1	84532	broad.mit.edu	37	20	24988512	24988512	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24988512G>C	uc002wub.2	-	14	2834	c.1956C>G	c.(1954-1956)ATC>ATG	p.I652M	ACSS1_uc002wuc.2_Missense_Mutation_p.I650M|ACSS1_uc010gdc.2_Missense_Mutation_p.I447M|ACSS1_uc002wud.1_RNA|ACSS1_uc002wua.2_Missense_Mutation_p.I569M	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	652					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCTCACTAGTGATGATCTTCC	0.557													16	141	---	---	---	---	PASS
RBL1	5933	broad.mit.edu	37	20	35724343	35724343	+	5'UTR	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35724343C>T	uc002xgi.2	-	1					RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_5'UTR|RBL1_uc010gfv.1_RNA	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				CCTTCAGGCCCCGCGGGCTGC	0.706													8	12	---	---	---	---	PASS
KIAA1755	85449	broad.mit.edu	37	20	36870243	36870243	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36870243G>T	uc002xhy.1	-	3	562	c.290C>A	c.(289-291)CCT>CAT	p.P97H	KIAA1755_uc002xhz.1_Missense_Mutation_p.P97H	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	97										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				CAATAAGAGAGGGTTGAGGGG	0.562													17	207	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40080585	40080585	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40080585C>T	uc002xka.1	-	22	3582	c.3404G>A	c.(3403-3405)CGT>CAT	p.R1135H		NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1135					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CAGGAGGGCACGGCAAATCAT	0.517													4	186	---	---	---	---	PASS
MYBL2	4605	broad.mit.edu	37	20	42302324	42302324	+	Intron	SNP	A	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42302324A>G	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron|MYBL2_uc002xla.1_Intron	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AAAAGAAGAAAAAGTAAGAGC	0.328													17	18	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61537362	61537362	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61537362T>C	uc002ydr.1	-	6	1729	c.1465A>G	c.(1465-1467)AGT>GGT	p.S489G	DIDO1_uc002yds.1_Missense_Mutation_p.S489G|DIDO1_uc002ydt.1_Missense_Mutation_p.S489G|DIDO1_uc002ydu.1_Missense_Mutation_p.S489G|DIDO1_uc002ydv.1_Missense_Mutation_p.S489G|DIDO1_uc002ydw.1_Missense_Mutation_p.S489G|DIDO1_uc002ydx.1_Missense_Mutation_p.S489G|DIDO1_uc011aao.1_Missense_Mutation_p.S489G	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	489					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					AGTGCTTCACTCCGCGCAGGG	0.517													50	184	---	---	---	---	PASS
PTK6	5753	broad.mit.edu	37	20	62165629	62165629	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62165629C>G	uc002yfg.2	-	3	432	c.392G>C	c.(391-393)CGG>CCG	p.R131P	PTK6_uc011aay.1_Missense_Mutation_p.R30P|PTK6_uc011aaz.1_5'Flank|PTK6_uc011aba.1_3'UTR	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6	131	SH2.					cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity	p.R131L(1)		stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)			CCCGGCACGCCGCCAGATCTT	0.692													4	26	---	---	---	---	PASS
SLC2A4RG	56731	broad.mit.edu	37	20	62374220	62374220	+	Intron	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62374220C>T	uc002ygq.2	+						SLC2A4RG_uc002ygr.2_Intron|SLC2A4RG_uc011abj.1_Intron|SLC2A4RG_uc002ygs.2_Intron|SLC2A4RG_uc002ygt.2_Intron	NM_020062	NP_064446	Q9NR83	S2A4R_HUMAN	SLC2A4 regulator							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					TGTCCTGTGACCCCCCGCACA	0.677													8	17	---	---	---	---	PASS
HLCS	3141	broad.mit.edu	37	21	38311131	38311131	+	Splice_Site	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38311131C>T	uc010gnb.2	-	3	1253	c.52_splice	c.e3+1	p.S18_splice	HLCS_uc002yvs.2_Splice_Site_p.S18_splice|HLCS_uc010gnc.1_Splice_Site_p.S165_splice	NM_000411	NP_000402	P50747	BPL1_HUMAN	holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	AAGTTACTTACACACAATCTT	0.264													39	55	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24573465	24573465	+	Intron	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24573465C>G	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron|CABIN1_uc010gul.1_Intron	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GTACCTTTGTCTTCCAGAGGG	0.617													104	124	---	---	---	---	PASS
GGT5	2687	broad.mit.edu	37	22	24620982	24620982	+	Silent	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24620982G>A	uc002zzo.3	-	11	2013	c.1596C>T	c.(1594-1596)TAC>TAT	p.Y532Y	GGT5_uc002zzp.3_Silent_p.Y533Y|GGT5_uc002zzr.3_Silent_p.Y500Y|GGT5_uc002zzq.3_Silent_p.Y500Y|GGT5_uc011ajm.1_Silent_p.Y456Y	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b	532	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						AGTTGGGCTCGTACTCCACAC	0.607													4	29	---	---	---	---	PASS
GGT5	2687	broad.mit.edu	37	22	24621612	24621612	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24621612G>A	uc002zzo.3	-	9	1655	c.1238C>T	c.(1237-1239)GCG>GTG	p.A413V	GGT5_uc002zzp.3_Missense_Mutation_p.A413V|GGT5_uc002zzr.3_Missense_Mutation_p.A381V|GGT5_uc002zzq.3_Missense_Mutation_p.A381V|GGT5_uc011ajm.1_Missense_Mutation_p.A336V	NM_004121	NP_004112	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform b	413	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)|skin(1)	3						ATACACCATCGCTCCAAAGCT	0.627													4	44	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25145726	25145726	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25145726T>A	uc003abd.1	-	10	1567	c.1150A>T	c.(1150-1152)AAA>TAA	p.K384*	PIWIL3_uc011ajx.1_Nonsense_Mutation_p.K275*|PIWIL3_uc011ajy.1_Nonsense_Mutation_p.K275*|PIWIL3_uc010gut.1_Nonsense_Mutation_p.K384*	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	384	PAZ.				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						AGGCCCTTTTTCCATCTGCCC	0.468													10	68	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26164833	26164833	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26164833A>T	uc003abz.1	+	4	1200	c.950A>T	c.(949-951)AAG>ATG	p.K317M	MYO18B_uc003aca.1_Missense_Mutation_p.K198M|MYO18B_uc010guy.1_Missense_Mutation_p.K198M|MYO18B_uc010guz.1_Missense_Mutation_p.K198M|MYO18B_uc011aka.1_Translation_Start_Site|MYO18B_uc011akb.1_5'Flank	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	317						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CCTGGGAGAAAGTGGGGAGGT	0.532													5	39	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32229905	32229905	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32229905G>T	uc003als.2	+	25	2251	c.2109G>T	c.(2107-2109)ATG>ATT	p.M703I	DEPDC5_uc011als.1_Missense_Mutation_p.M625I|DEPDC5_uc011alu.1_Missense_Mutation_p.M703I|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.M703I|DEPDC5_uc003alu.2_Missense_Mutation_p.M143I|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Missense_Mutation_p.M24I|DEPDC5_uc003alw.2_Missense_Mutation_p.M1I|DEPDC5_uc011alx.1_5'UTR|DEPDC5_uc011alt.1_Missense_Mutation_p.M597I	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	703					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						CCATAGGTATGAATCCTAGGA	0.448													125	293	---	---	---	---	PASS
BPIL2	254240	broad.mit.edu	37	22	32831696	32831696	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32831696C>T	uc003amn.2	-	8	919	c.919G>A	c.(919-921)GAA>AAA	p.E307K	BPIL2_uc010gwo.2_Missense_Mutation_p.E121K|BPIL2_uc011amb.1_Missense_Mutation_p.E31K	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	307						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						CTCACCTCTTCGGTGGAGAGA	0.418													6	74	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3238837	3238837	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3238837G>T	uc004crg.3	-	5	5046	c.4889C>A	c.(4888-4890)TCC>TAC	p.S1630Y		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	1630						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				AAAGTATCTGGAAGCGCTTTG	0.473													127	62	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31198492	31198492	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31198492T>C	uc004dda.1	-	69	10325	c.10081A>G	c.(10081-10083)ACT>GCT	p.T3361A	DMD_uc004dcq.1_Missense_Mutation_p.T632A|DMD_uc004dcr.1_Missense_Mutation_p.T901A|DMD_uc004dcs.1_Missense_Mutation_p.T901A|DMD_uc004dct.1_Missense_Mutation_p.T901A|DMD_uc004dcu.1_Missense_Mutation_p.T901A|DMD_uc004dcv.1_Missense_Mutation_p.T901A|DMD_uc004dcw.2_Missense_Mutation_p.T2017A|DMD_uc004dcx.2_Missense_Mutation_p.T2020A|DMD_uc004dcz.2_Missense_Mutation_p.T3238A|DMD_uc004dcy.1_Missense_Mutation_p.T3357A|DMD_uc004ddb.1_Missense_Mutation_p.T3353A|DMD_uc004dcm.1_Missense_Mutation_p.T293A|DMD_uc004dcn.1_Missense_Mutation_p.T293A|DMD_uc004dco.1_Missense_Mutation_p.T293A|DMD_uc004dcp.1_Missense_Mutation_p.T293A|DMD_uc011mkb.1_Missense_Mutation_p.T293A|DMD_uc010ngm.2_Missense_Mutation_p.T293A	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3361	Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CTTACCGGAGTGCAATATTCC	0.408													3	71	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65423283	65423283	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65423283C>A	uc011moz.1	+	13	2224	c.2164C>A	c.(2164-2166)CCT>ACT	p.P722T	HEPH_uc004dwn.2_Missense_Mutation_p.P722T|HEPH_uc004dwo.2_Missense_Mutation_p.P452T|HEPH_uc010nkr.2_Missense_Mutation_p.P530T|HEPH_uc011mpa.1_Missense_Mutation_p.P722T|HEPH_uc010nks.2_Missense_Mutation_p.P11T	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	719	Extracellular (Potential).				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CTCCCAGTGTCCTGGCCACCA	0.522													24	20	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70598702	70598702	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70598702G>A	uc004dzu.3	+	8	1229	c.1178G>A	c.(1177-1179)GGC>GAC	p.G393D	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.G414D	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	393	Protein kinase 1.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				GAAAACAATGGCACTGATCTT	0.438													68	42	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433991	72433991	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433991A>T	uc004ebi.2	-	1	694	c.338T>A	c.(337-339)TTA>TAA	p.L113*	NAP1L2_uc011mqj.1_5'UTR	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	113					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					TTTAAGGGCTAACACACGGTA	0.403													52	25	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73072079	73072079	+	RNA	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73072079G>A	uc004ebm.1	-	1		c.510C>T				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						CCGATACCCCGATGGGCTAAG	0.478													5	17	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75004382	75004382	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75004382C>G	uc004ecj.1	-	1	690	c.505G>C	c.(505-507)GCG>CCG	p.A169P		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	169	MAGE 1.									ovary(1)|skin(1)	2						AGGGACTCCGCTATCCTATCG	0.522													3	20	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83724452	83724452	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83724452G>C	uc004eek.1	-	3	388	c.279C>G	c.(277-279)AGC>AGG	p.S93R	HDX_uc011mqv.1_Missense_Mutation_p.S93R|HDX_uc004eel.1_Missense_Mutation_p.S35R	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	93						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						AAGACTGCTGGCTTGAGGGTC	0.428													6	66	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101095855	101095855	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101095855T>A	uc011mrk.1	-	9	853	c.493A>T	c.(493-495)AAC>TAC	p.N165Y	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	165	LRR 1.				mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						TTGCACAAGTTCAAAGACAAC	0.478													40	26	---	---	---	---	PASS
GPRASP2	114928	broad.mit.edu	37	X	101970974	101970974	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101970974G>C	uc004ejk.2	+	4	2511	c.1177G>C	c.(1177-1179)GCA>CCA	p.A393P	GPRASP2_uc004ejl.2_Missense_Mutation_p.A393P|GPRASP2_uc004ejm.2_Missense_Mutation_p.A393P|GPRASP2_uc011mrp.1_5'Flank	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	393						cytoplasm	protein binding			ovary(1)	1						CTGGTTCTGGGCAGAAAAAGA	0.527													6	84	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122532572	122532572	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122532572G>A	uc004etq.3	+	8	1291	c.998G>A	c.(997-999)CGG>CAG	p.R333Q	GRIA3_uc004etr.3_Missense_Mutation_p.R333Q|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.R317Q	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	333	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	GATGTGTCCCGGAGAGGAAGT	0.483													7	39	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	124097425	124097425	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124097425G>A	uc004euj.2	-	1	242	c.178C>T	c.(178-180)CAG>TAG	p.Q60*	ODZ1_uc011muj.1_Nonsense_Mutation_p.Q60*|ODZ1_uc010nqy.2_Nonsense_Mutation_p.Q60*	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	60	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TTTCTACTCTGGCTATTGTAA	0.373													117	77	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132160305	132160305	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132160305G>C	uc010nrm.1	-	6	2414	c.1944C>G	c.(1942-1944)TTC>TTG	p.F648L	USP26_uc011mvf.1_Missense_Mutation_p.F648L	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	648					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					CTTTTTCAATGAATGCTCGAT	0.433													11	82	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135429362	135429362	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135429362C>A	uc004ezu.1	+	6	3788	c.3497C>A	c.(3496-3498)TCT>TAT	p.S1166Y	GPR112_uc010nsb.1_Missense_Mutation_p.S961Y|GPR112_uc010nsc.1_Missense_Mutation_p.S933Y	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1166	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TCAACTACGTCTACACCAGAA	0.478													119	45	---	---	---	---	PASS
CXorf66	347487	broad.mit.edu	37	X	139047576	139047576	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139047576G>C	uc004fbb.2	-	1	102	c.80C>G	c.(79-81)TCT>TGT	p.S27C		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	27	Extracellular (Potential).					integral to membrane					0						ACCTGTAGTAGAAGATCCATT	0.328													18	124	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	140985623	140985623	+	IGR	SNP	T	C	C			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140985623T>C								MAGEC3 (6 upstream) : MAGEC1 (6057 downstream)																							GAGTGATGTCTGAAGCAGATT	0.537													4	44	---	---	---	---	PASS
GDI1	2664	broad.mit.edu	37	X	153669525	153669525	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153669525G>A	uc004fli.3	+	7	1144	c.802G>A	c.(802-804)GTG>ATG	p.V268M	GDI1_uc011mzo.1_3'UTR|GDI1_uc004flj.2_5'Flank|FAM50A_uc004fll.3_5'Flank	NM_001493	NP_001484	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	268					protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTGGTGGGCGTGAAGTCTGA	0.557													11	68	---	---	---	---	PASS
SPOCD1	90853	broad.mit.edu	37	1	32258806	32258807	+	Intron	DEL	AG	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32258806_32258807delAG	uc001bts.1	-						SPOCD1_uc001btr.1_5'Flank|SPOCD1_uc001btt.2_Intron|SPOCD1_uc001btu.2_Intron|SPOCD1_uc001btv.2_Intron	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1						transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		catgagtGAAAGAGAGAGAGAG	0.376													4	2	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242226	67242227	+	Intron	DEL	AT	-	-	rs72385752		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242226_67242227delAT	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						CATATTCTACATATAtgtgtgt	0.248													3	3	---	---	---	---	
IL23R	149233	broad.mit.edu	37	1	67672567	67672568	+	Intron	INS	-	T	T	rs79547341		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67672567_67672568insT	uc001ddo.2	+						IL23R_uc009waz.2_Intron|IL23R_uc001ddp.2_Intron|IL23R_uc010opi.1_Intron|IL23R_uc010opj.1_Intron|IL23R_uc010opk.1_Intron|IL23R_uc010opl.1_Intron|IL23R_uc010opm.1_Intron|IL23R_uc001ddq.2_Intron|IL23R_uc010opn.1_Intron|IL23R_uc001ddr.2_Intron|IL23R_uc010opo.1_Intron|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Intron|IL23R_uc010opr.1_Intron|IL23R_uc010ops.1_Intron|IL23R_uc010opt.1_Intron|IL23R_uc010opu.1_Intron|IL23R_uc010opv.1_Intron|IL23R_uc010opw.1_Intron|IL23R_uc010opx.1_Intron|IL23R_uc010opy.1_Intron|IL23R_uc010opz.1_Intron|IL23R_uc010oqa.1_Intron|IL23R_uc010oqb.1_Intron|IL23R_uc010oqc.1_Intron|IL23R_uc010oqd.1_Intron|IL23R_uc010oqe.1_Intron|IL23R_uc010oqf.1_Intron|IL23R_uc010oqg.1_Intron|IL23R_uc010oqh.1_Intron|IL23R_uc001dds.2_5'Flank|IL23R_uc001ddt.2_5'Flank	NM_144701	NP_653302	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor precursor						inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0						ACAGCCAGGTCttttttttttt	0.351													4	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145024585	145024590	+	Intron	DEL	ACACAT	-	-	rs72171398		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024585_145024590delACACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		acacacacacacacatacacacacac	0.267			T	PDGFRB	MPD								4	2	---	---	---	---	
PSME4	23198	broad.mit.edu	37	2	54127161	54127161	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54127161delA	uc002rxp.2	-						PSME4_uc010yop.1_Intron|PSME4_uc010yoq.1_Intron|PSME4_uc010fbu.1_Intron|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GAATCTTGTTAAAAAGAAAAA	0.204													76	37	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89879349	89879350	+	IGR	INS	-	CAACGCGAGTGCAGG	CAACGCGAGTGCAGG			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89879349_89879350insCAACGCGAGTGCAGG								FLJ40330 (773224 upstream) : None (None downstream)																							tggaatggaatggaatggaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232451623	232451623	+	IGR	DEL	A	-	-	rs78129699		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232451623delA								NMUR1 (56441 upstream) : C2orf57 (5989 downstream)																							actctatctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40418595	40418595	+	IGR	DEL	G	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40418595delG								EIF1B (64682 upstream) : ENTPD3 (10078 downstream)																							agggaggggaggggagggagg	0.000													5	5	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179119234	179119236	+	Intron	DEL	AAT	-	-	rs74384746		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119234_179119236delAAT	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCAGttaaaaaataataataatt	0.271													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	27956273	27956274	+	IGR	INS	-	CA	CA	rs73260108		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27956273_27956274insCA								STIM2 (930465 upstream) : None (None downstream)																							GCGCGCGCGcgcacacacacac	0.099													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76010133	76010136	+	IGR	DEL	AGGG	-	-	rs9991977		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76010133_76010136delAGGG								PARM1 (34810 upstream) : RCHY1 (394219 downstream)																							gaaggaaggaagggaggaaggaag	0.225													4	2	---	---	---	---	
SLC9A3	6550	broad.mit.edu	37	5	474946	474946	+	Intron	DEL	G	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:474946delG	uc003jbe.2	-						SLC9A3_uc011clx.1_Intron|LOC25845_uc003jbd.2_5'Flank|LOC25845_uc010itb.1_5'Flank	NM_004174	NP_004165	P48764	SL9A3_HUMAN	solute carrier family 9 (sodium/hydrogen							cell surface|integral to membrane	sodium:hydrogen antiporter activity				0			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			gagacctggagggagaggAGC	0.348													4	2	---	---	---	---	
BTF3	689	broad.mit.edu	37	5	72800092	72800093	+	Intron	INS	-	TTT	TTT	rs34051700		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72800092_72800093insTTT	uc003kcr.1	+						BTF3_uc003kcq.1_Intron|BTF3_uc003kcs.1_Intron|BTF3_uc003kct.1_Intron	NM_001037637	NP_001032726	P20290	BTF3_HUMAN	basic transcription factor 3 isoform A						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding				0		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		TTCATCTGttcttttttttttt	0.267													5	3	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131322650	131322651	+	Intron	DEL	AC	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131322650_131322651delAC	uc010jdo.1	-						ACSL6_uc003kvv.1_Intron|ACSL6_uc003kvx.1_Intron|ACSL6_uc003kvy.1_Intron|ACSL6_uc003kwb.2_Intron|ACSL6_uc003kvz.1_Intron|ACSL6_uc003kwa.1_Intron|ACSL6_uc010jdn.1_Intron|ACSL6_uc010jdp.1_5'Flank	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			acatacacatacacacacacac	0.163													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32521843	32521844	+	Intron	DEL	CT	-	-	rs67101368		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32521843_32521844delCT	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AGAAGGCTACCTCCTGTAAGAA	0.356													1	5	---	---	---	---	
COL12A1	1303	broad.mit.edu	37	6	75855327	75855327	+	Intron	DEL	C	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75855327delC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CTGATGTTTTCTTTTTTtttt	0.144													4	2	---	---	---	---	
MAP3K4	4216	broad.mit.edu	37	6	161455286	161455287	+	Intron	INS	-	ATA	ATA			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161455286_161455287insATA	uc003qtn.2	+						MAP3K4_uc010kkc.1_Intron|MAP3K4_uc003qto.2_Intron|MAP3K4_uc011efz.1_Intron|MAP3K4_uc011ega.1_Intron	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4						activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CACTGTCTTTCATAGGCAAGAG	0.337													80	42	---	---	---	---	
C7orf28A	51622	broad.mit.edu	37	7	5965102	5965102	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5965102delA	uc003spf.2	+							NM_015622	NP_056437	P86791	CCZ1_HUMAN	hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)		tgtctcaaacaaaaaaaaaaa	0.129													4	2	---	---	---	---	
SEMA3D	223117	broad.mit.edu	37	7	84657700	84657700	+	Intron	DEL	C	-	-	rs73713927		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84657700delC	uc003uic.2	-						SEMA3D_uc010led.2_Intron|SEMA3D_uc003uib.2_Intron	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						ACAGTTTAGACAAAAAAAAAA	0.393													4	2	---	---	---	---	
CREB3L2	64764	broad.mit.edu	37	7	137654540	137654540	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137654540delA	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vty.3_Intron	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						acacacacacaacatacacat	0.000			T	FUS	fibromyxoid sarcoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739522	155739525	+	IGR	DEL	TTCC	-	-	rs5888641		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739522_155739525delTTCC								SHH (134555 upstream) : C7orf4 (593660 downstream)																							ccttccttctttccttccttcctt	0.000													4	3	---	---	---	---	
TNKS	8658	broad.mit.edu	37	8	9620574	9620577	+	Intron	DEL	TTTT	-	-	rs66959741		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9620574_9620577delTTTT	uc003wss.2	+						TNKS_uc011kww.1_Intron	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TTATTATGAAtttttttttttttt	0.275													4	2	---	---	---	---	
GPR124	25960	broad.mit.edu	37	8	37699191	37699192	+	Frame_Shift_Ins	INS	-	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37699191_37699192insG	uc003xkj.2	+	19	3698_3699	c.3335_3336insG	c.(3334-3336)GAGfs	p.E1112fs	GPR124_uc010lvy.2_Frame_Shift_Ins_p.E895fs	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	1112	Cytoplasmic (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GTGTTCGGGGAGGGCCCCCCCT	0.559													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	63023167	63023167	+	IGR	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63023167delA								ASPH (395968 upstream) : NKAIN3 (138334 downstream)																							ATACGCTTATATGGAAGCCAA	0.448													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	40479757	40479758	+	IGR	INS	-	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40479757_40479758insA								FAM74A1 (572517 upstream) : FAM75A3 (220533 downstream)																							ACATTAAATTGAAAAAAAAAAA	0.411													9	4	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94984623	94984623	+	Intron	DEL	A	-	-	rs71511611		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94984623delA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	actcagtctcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
ERP44	23071	broad.mit.edu	37	9	102822307	102822308	+	Intron	INS	-	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102822307_102822308insT	uc004bam.2	-						ERP44_uc010msy.2_Intron|ERP44_uc010msz.2_Intron	NM_015051	NP_055866	Q9BS26	ERP44_HUMAN	thioredoxin domain containing 4 (endoplasmic						cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0						ATTTTATTGGGTTTTTTTTTTG	0.287													4	2	---	---	---	---	
NR6A1	2649	broad.mit.edu	37	9	127288844	127288844	+	Intron	DEL	A	-	-	rs111378093		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127288844delA	uc004bor.1	-						NR6A1_uc004boq.1_Intron|NR6A1_uc010mwq.1_Intron	NM_033334	NP_201591	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1						cell proliferation|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	transcription factor complex	protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						CAGTTTGAAGAAAAAAAAAAA	0.418													6	5	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136798989	136798989	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136798989delA	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		ggatgggtggatggatggatg	0.000													4	2	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136799051	136799054	+	Intron	DEL	ATGG	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136799051_136799054delATGG	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		tgatgggtgaatggatggatggat	0.000													4	2	---	---	---	---	
CUBN	8029	broad.mit.edu	37	10	16932684	16932684	+	Intron	DEL	T	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16932684delT	uc001ioo.2	-						CUBN_uc009xjq.1_Intron|CUBN_uc009xjr.1_Intron	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTGAGAATAATTTTTTTAAAG	0.328													4	2	---	---	---	---	
NEBL	10529	broad.mit.edu	37	10	21097279	21097279	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21097279delA	uc001iqi.2	-						NEBL_uc001iqj.2_Intron|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TTTTTTCTTTAAAAAAAAAAA	0.299													3	3	---	---	---	---	
RAG2	5897	broad.mit.edu	37	11	36615826	36615827	+	Intron	INS	-	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36615826_36615827insT	uc001mwv.3	-						C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2						chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				TGTGAATAGCATTTTTTTAAGT	0.376									Familial_Hemophagocytic_Lymphohistiocytosis				13	6	---	---	---	---	
PUS3	83480	broad.mit.edu	37	11	125764947	125764947	+	Intron	DEL	T	-	-	rs144232833		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125764947delT	uc001qcy.2	-						HYLS1_uc009zbv.2_Intron|HYLS1_uc001qcx.3_Intron	NM_031307	NP_112597	Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3							nucleus	RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		ATGCTAtttcttttttttttt	0.184													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126223118	126223118	+	Intron	DEL	G	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126223118delG	uc001qdq.1	-						uc001qdr.1_Intron|ST3GAL4_uc001qds.2_5'Flank|ST3GAL4_uc001qdt.2_5'Flank|ST3GAL4_uc009zcc.2_5'Flank|ST3GAL4_uc009zcd.2_5'Flank|ST3GAL4_uc001qdu.2_5'Flank|ST3GAL4_uc001qdv.2_5'Flank					Homo sapiens cDNA FLJ39051 fis, clone NT2RP7011452.																		ggaaagacaagaaaaagagag	0.000													5	3	---	---	---	---	
NTF3	4908	broad.mit.edu	37	12	5596047	5596054	+	Intron	DEL	GTGTGTGT	-	-	rs111941703		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5596047_5596054delGTGTGTGT	uc001qnk.3	+							NM_001102654	NP_001096124	P20783	NTF3_HUMAN	neurotrophin 3 isoform 1 preproprotein						signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						TAGTTACGTGgtgtgtgtgtgtgtgtgt	0.288													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13004774	13004774	+	IGR	DEL	G	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13004774delG								DDX47 (21865 upstream) : RPL13AP20 (23637 downstream)																							taggaattatgggagctacaa	0.050													6	7	---	---	---	---	
MLL2	8085	broad.mit.edu	37	12	49436428	49436428	+	Frame_Shift_Del	DEL	C	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49436428delC	uc001rta.3	-	27	5783	c.5783delG	c.(5782-5784)GGTfs	p.G1928fs		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1928					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AGGGAGTCCACCTACAAGACG	0.552			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			55	54	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	81655693	81655693	+	Intron	DEL	T	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81655693delT	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010suf.1_Intron|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						TTTTTTTGTCTTTTTTTTTTT	0.403													4	2	---	---	---	---	
PLBD2	196463	broad.mit.edu	37	12	113824846	113824846	+	Frame_Shift_Del	DEL	G	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113824846delG	uc001tve.2	+	10	1426	c.1391delG	c.(1390-1392)CGGfs	p.R464fs	PLBD2_uc001tvf.2_Frame_Shift_Del_p.R432fs	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2 isoform 1	464					lipid catabolic process	lysosomal lumen	hydrolase activity				0						ATCTTCCGGCGGAACCAGTCA	0.602													136	62	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33752131	33752132	+	Intron	INS	-	A	A			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33752131_33752132insA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		ggaaaggaaggaaggaaggaag	0.059													4	2	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105356242	105356243	+	Intron	INS	-	ATGG	ATGG			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105356242_105356243insATGG	uc010axb.2	+						INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Intron|KIAA0284_uc001yps.2_Intron|KIAA0284_uc001ypt.2_Intron	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1							cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		tggatggacaaatggatggatg	0.213													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28900331	28900331	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28900331delA	uc010uan.1	+						uc010azc.2_Intron|uc010uao.1_5'Flank					Homo sapiens cDNA FLJ55955 complete cds, highly similar to HECT domain and RCC1-like domain-containing protein 2.																		actctgtctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78202278	78202278	+	IGR	DEL	C	-	-	rs71145877		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78202278delC								LINGO1 (213803 upstream) : LOC645752 (4281 downstream)																							TTGACAGTGGCTCCCCCAGCC	0.577													2	5	---	---	---	---	
STARD5	80765	broad.mit.edu	37	15	81611436	81611436	+	Intron	DEL	A	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81611436delA	uc002bgm.2	-						STARD5_uc002bgn.2_Intron	NM_181900	NP_871629	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer protein 5						C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1						CTTCCGCAGGAAAAAAAAAAA	0.488													3	3	---	---	---	---	
EIF4A1	1973	broad.mit.edu	37	17	7475941	7475941	+	5'UTR	DEL	T	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7475941delT	uc002gho.1	+	9					EIF4A1_uc002ghr.1_5'UTR|EIF4A1_uc002ghq.1_5'UTR|EIF4A1_uc002ghp.1_5'Flank|SNORA48_uc002ghs.1_5'Flank	NM_001416	NP_001407	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A						nuclear-transcribed mRNA poly(A) tail shortening	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA cap binding|translation initiation factor activity			ovary(1)	1						AGGCGGGCCCTCCAGCCAATG	0.637													4	2	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7578500	7578501	+	Frame_Shift_Ins	INS	-	T	T			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578500_7578501insT	uc002gim.2	-	5	623_624	c.429_430insA	c.(427-432)GTGCAGfs	p.V143fs	TP53_uc002gig.1_Frame_Shift_Ins_p.V143fs|TP53_uc002gih.2_Frame_Shift_Ins_p.V143fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Ins_p.V11fs|TP53_uc010cng.1_Frame_Shift_Ins_p.V11fs|TP53_uc002gii.1_Frame_Shift_Ins_p.V11fs|TP53_uc010cnh.1_Frame_Shift_Ins_p.V143fs|TP53_uc010cni.1_Frame_Shift_Ins_p.V143fs|TP53_uc002gij.2_Frame_Shift_Ins_p.V143fs|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Frame_Shift_Ins_p.V50fs|TP53_uc002gio.2_Frame_Shift_Ins_p.V11fs|TP53_uc010vug.1_Frame_Shift_Ins_p.V104fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	143_144	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q -> P (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Q144*(29)|p.V143M(16)|p.V143A(14)|p.0?(7)|p.V143L(4)|p.V143E(4)|p.Q144fs*26(3)|p.Q144K(2)|p.V143V(2)|p.V143fs*27(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.V143fs*29(1)|p.Q144del(1)|p.Q144fs*32(1)|p.A138_V143delAKTCPV(1)|p.V143G(1)|p.P142_Q144delPVQ(1)|p.Q144fs*4(1)|p.V143_S149del(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACCCACAGCTGCACAGGGCAGG	0.594		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			28	39	---	---	---	---	
MYH8	4626	broad.mit.edu	37	17	10296178	10296178	+	Frame_Shift_Del	DEL	C	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10296178delC	uc002gmm.2	-	37	5528	c.5433delG	c.(5431-5433)GGGfs	p.G1811fs	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1811	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TCTGCTTCTTCCCACCCTTCA	0.567									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				85	77	---	---	---	---	
ERAL1	26284	broad.mit.edu	37	17	27183733	27183733	+	Intron	DEL	T	-	-			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27183733delT	uc002hcy.1	+						ERAL1_uc002hcx.1_3'UTR|ERAL1_uc002hcz.1_Intron|ERAL1_uc002hda.1_5'Flank|ERAL1_uc002hdb.1_5'Flank	NM_005702	NP_005693	O75616	ERAL1_HUMAN	Era-like 1						ribosomal small subunit assembly	mitochondrial inner membrane|mitochondrial matrix	GTP binding|ribosomal small subunit binding|rRNA binding			skin(1)	1	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			tttctttttcttttttttttt	0.199													8	6	---	---	---	---	
USP32	84669	broad.mit.edu	37	17	58332410	58332410	+	Intron	DEL	T	-	-	rs35284371		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58332410delT	uc002iyo.1	-						USP32_uc002iyn.1_Intron|USP32_uc010wov.1_Intron	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32						protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AATGTAGTTCttttttttttt	0.353													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20620088	20620089	+	IGR	INS	-	A	A	rs12968516		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20620088_20620089insA								RBBP8 (13643 upstream) : CABLES1 (94439 downstream)																							ggaagggagggaggaaggaagg	0.079													4	2	---	---	---	---	
POLRMT	5442	broad.mit.edu	37	19	623080	623081	+	Intron	INS	-	T	T	rs142978491	by1000genomes	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:623080_623081insT	uc002lpf.1	-							NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase						transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGAGACCTCATGGCCCTCAAG	0.688													2	4	---	---	---	---	
PTPRS	5802	broad.mit.edu	37	19	5278194	5278195	+	Intron	INS	-	A	A	rs111490914		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5278194_5278195insA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron|PTPRS_uc002mbz.1_Intron	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		TAGAAACTGCCAAAAAAAAAAA	0.332													4	2	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49963971	49963972	+	Intron	INS	-	T	T	rs35639941		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49963971_49963972insT	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		acacccggccattttttttttt	0.005													4	2	---	---	---	---	
NOP56	10528	broad.mit.edu	37	20	2633326	2633331	+	Intron	DEL	GGGCGC	-	-	rs28970277	byFrequency	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2633326_2633331delGGGCGC	uc002wgh.2	+						NOP56_uc010zpy.1_Intron|MIR1292_hsa-mir-1292|MI0006433_5'Flank|NOP56_uc002wgi.2_5'Flank|SNORD110_uc002wgj.2_5'Flank|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						AGTGGTTGCGGGGCGCGGGCGACGCG	0.573													7	5	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45220862	45220863	+	Intron	INS	-	CATA	CATA	rs142792823	by1000genomes	TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45220862_45220863insCATA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	aaaactaaatgcatacatacat	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													8	4	---	---	---	---	
MN1	4330	broad.mit.edu	37	22	28146770	28146770	+	3'UTR	DEL	A	-	-	rs28501997		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28146770delA	uc003adj.2	-	2					MN1_uc010gvg.2_RNA	NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						CAACCTAGAGAAAAAAAAAAA	0.289			T	ETV6	AML|meningioma								3	3	---	---	---	---	
CYTH4	27128	broad.mit.edu	37	22	37707901	37707902	+	Intron	DEL	AG	-	-	rs3842718		TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37707901_37707902delAG	uc003arf.2	+						CYTH4_uc011amw.1_Intron|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517	Q9UIA0	CYH4_HUMAN	cytohesin 4						regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						AGCCTGCCACAGAGAGAGTGCT	0.599													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	969922	969923	+	IGR	INS	-	G	G			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:969922_969923insG								SHOX (349777 upstream) : CRLF2 (344964 downstream)																							TTACGCACGGCGGTCATCTTTT	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13637342	13637343	+	IGR	INS	-	GGT	GGT			TCGA-39-5036-01A-01D-1441-08	TCGA-39-5036-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13637342_13637343insGGT								None (None upstream) : None (None downstream)																							CCGTGGCGGCGTGGGGGCAAAA	0.604													4	2	---	---	---	---	
