Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC2A7	155184	broad.mit.edu	37	1	9083027	9083027	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9083027G>A	uc009vmo.1	-	3	261	c.261C>T	c.(259-261)GGC>GGT	p.G87G		NM_207420	NP_997303	Q6PXP3	GTR7_HUMAN	intestinal facilitative glucose transporter 7	87	Helical; (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CCAACAGGCCGCCCAGAGGAA	0.517													35	260	---	---	---	---	PASS
FBXO2	26232	broad.mit.edu	37	1	11710680	11710680	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11710680C>A	uc001asj.2	-	2	576	c.234G>T	c.(232-234)TGG>TGT	p.W78C	FBXO2_uc009vna.2_Missense_Mutation_p.W78C|FBXO2_uc009vnb.1_RNA	NM_012168	NP_036300	Q9UK22	FBX2_HUMAN	F-box only protein 2	78	F-box.				glycoprotein catabolic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|endoplasmic reticulum|membrane|microsome|SCF ubiquitin ligase complex	sugar binding|ubiquitin-protein ligase activity				0	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CCAGCTCCTTCCAGCGCAGGC	0.746													3	9	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27057875	27057875	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27057875A>T	uc001bmv.1	+	3	1956	c.1583A>T	c.(1582-1584)CAG>CTG	p.Q528L	ARID1A_uc001bmt.1_Missense_Mutation_p.Q528L|ARID1A_uc001bmu.1_Missense_Mutation_p.Q528L|ARID1A_uc001bmw.1_Missense_Mutation_p.Q145L	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	528					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCTCCACATCAGCAGTCCCCG	0.622			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								27	189	---	---	---	---	PASS
LCK	3932	broad.mit.edu	37	1	32742069	32742069	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32742069C>G	uc001bux.2	+	8	901	c.763C>G	c.(763-765)CAG>GAG	p.Q255E	LCK_uc001buy.2_Missense_Mutation_p.Q255E|LCK_uc001buz.2_Missense_Mutation_p.Q255E|LCK_uc010ohc.1_Missense_Mutation_p.Q299E|LCK_uc001bva.2_Intron	NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase	255	Protein kinase.|ATP (By similarity).				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	GGGGGCTGGACAGTTCGGGGA	0.677			T	TRB@	T-ALL								7	29	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39927568	39927568	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39927568C>T	uc010oiu.1	+	58	16997	c.16866C>T	c.(16864-16866)ACC>ACT	p.T5622T	MACF1_uc010ois.1_Silent_p.T5120T|MACF1_uc001cde.1_5'UTR|MACF1_uc001cdf.1_5'UTR	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	7078	EF-hand 2.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCCCCACCACCAAGTTAGAGA	0.383													34	284	---	---	---	---	PASS
PLK3	1263	broad.mit.edu	37	1	45271199	45271199	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45271199G>T	uc001cmn.2	+	15	1890	c.1790G>T	c.(1789-1791)GGC>GTC	p.G597V	PLK3_uc001cmo.2_RNA|BTBD19_uc010old.1_5'Flank|BTBD19_uc010ole.1_5'Flank	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	597	POLO box 2.					membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					ATTCTCAGTGGCTGGGAGCCC	0.602													71	348	---	---	---	---	PASS
TAL1	6886	broad.mit.edu	37	1	47689738	47689738	+	Missense_Mutation	SNP	A	G	G	rs147015002		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47689738A>G	uc001cqx.2	-	3	1056	c.479T>C	c.(478-480)ATG>ACG	p.M160T	TAL1_uc009vyq.2_5'UTR|TAL1_uc001cqy.2_Missense_Mutation_p.M160T|TAL1_uc001cra.1_RNA|TAL1_uc001cqz.1_RNA	NM_003189	NP_003180	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	160					basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1						GGTGGTGAACATAGGGAAGGC	0.567			T	TRD@|SIL	lymphoblastic leukemia/biphasic								21	169	---	---	---	---	PASS
ORC1L	4998	broad.mit.edu	37	1	52867041	52867041	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52867041G>T	uc001ctt.2	-	3	435	c.216C>A	c.(214-216)TTC>TTA	p.F72L	ORC1L_uc010oni.1_Missense_Mutation_p.F72L|ORC1L_uc001ctu.2_Missense_Mutation_p.F72L|ORC1L_uc009vzd.2_Intron	NM_004153	NP_004144	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	72	BAH.				cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding				0						CACCATCTTCGAACAACTCAA	0.428													22	247	---	---	---	---	PASS
FUBP1	8880	broad.mit.edu	37	1	78432396	78432396	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78432396C>A	uc001dii.2	-	7	544	c.455G>T	c.(454-456)GGA>GTA	p.G152V	FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_Missense_Mutation_p.G173V	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein	152	KH 1.				transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						TTCAGGTGTTCCAGTTAACAT	0.338													23	99	---	---	---	---	PASS
FUBP1	8880	broad.mit.edu	37	1	78432397	78432397	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78432397C>A	uc001dii.2	-	7	543	c.454G>T	c.(454-456)GGA>TGA	p.G152*	FUBP1_uc001dih.3_RNA|FUBP1_uc010orm.1_Nonsense_Mutation_p.G173*	NM_003902	NP_003893	Q96AE4	FUBP1_HUMAN	far upstream element-binding protein	152	KH 1.				transcription from RNA polymerase II promoter	nucleus	protein binding|RNA binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			central_nervous_system(2)|lung(1)	3						TCAGGTGTTCCAGTTAACATA	0.338													23	99	---	---	---	---	PASS
AGL	178	broad.mit.edu	37	1	100357256	100357256	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100357256A>G	uc001dsi.1	+	23	3444	c.3044A>G	c.(3043-3045)TAT>TGT	p.Y1015C	AGL_uc001dsj.1_Missense_Mutation_p.Y1015C|AGL_uc001dsk.1_Missense_Mutation_p.Y1015C|AGL_uc001dsl.1_Missense_Mutation_p.Y1015C|AGL_uc001dsm.1_Missense_Mutation_p.Y999C|AGL_uc001dsn.1_Missense_Mutation_p.Y998C	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	1015	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ATTGGTGCATATACCACTCTT	0.393													31	221	---	---	---	---	PASS
PTPN22	26191	broad.mit.edu	37	1	114397560	114397560	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114397560C>T	uc001eds.2	-	8	782	c.652G>A	c.(652-654)GAT>AAT	p.D218N	uc001edv.1_5'Flank|PTPN22_uc009wgq.2_Missense_Mutation_p.D218N|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Missense_Mutation_p.D218N|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Missense_Mutation_p.D218N	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type	218	Tyrosine-protein phosphatase.				negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACACTGTCATCCTCTTGGTAA	0.413													37	158	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120050217	120050217	+	Missense_Mutation	SNP	G	A	A	rs141328314		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120050217G>A	uc001ehv.1	+	2	263	c.118G>A	c.(118-120)GGA>AGA	p.G40R	HSD3B1_uc001ehw.2_Missense_Mutation_p.G42R	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	40					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	CAAGGCCTTCGGACCAGAATT	0.507													27	118	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120050218	120050218	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120050218G>T	uc001ehv.1	+	2	264	c.119G>T	c.(118-120)GGA>GTA	p.G40V	HSD3B1_uc001ehw.2_Missense_Mutation_p.G42V	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	40					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	AAGGCCTTCGGACCAGAATTG	0.502													27	119	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155171258	155171258	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155171258G>C	uc001fix.2	-	11	1302	c.1279C>G	c.(1279-1281)CAC>GAC	p.H427D	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Missense_Mutation_p.H418D|THBS3_uc001fiz.2_Missense_Mutation_p.H427D|THBS3_uc001fiy.2_5'UTR|THBS3_uc010pfu.1_Missense_Mutation_p.H307D|THBS3_uc010pfv.1_RNA|THBS3_uc001fja.2_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	427	EGF-like 4.				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCATGGATGTGGCAGGGGCTG	0.622													17	115	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156907135	156907135	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156907135C>A	uc001fqo.2	-	38	5266	c.4226G>T	c.(4225-4227)CGC>CTC	p.R1409L	ARHGEF11_uc010phu.1_Missense_Mutation_p.R825L|ARHGEF11_uc001fqn.2_Missense_Mutation_p.R1449L|MIR765_hsa-mir-765|MI0005116_5'Flank	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1409					actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCGGCTGGGGCGTCTTGGATC	0.622													6	64	---	---	---	---	PASS
CRP	1401	broad.mit.edu	37	1	159683523	159683523	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159683523T>A	uc001ftw.2	-	2	571	c.467A>T	c.(466-468)GAG>GTG	p.E156V	CRP_uc001ftx.1_Intron|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	156	Pentaxin.	Calcium 1.|Calcium 2.			acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	GGAATCCTGCTCCTGCCCCAA	0.532													53	401	---	---	---	---	PASS
CRP	1401	broad.mit.edu	37	1	159683524	159683524	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159683524C>A	uc001ftw.2	-	2	570	c.466G>T	c.(466-468)GAG>TAG	p.E156*	CRP_uc001ftx.1_Intron|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	156	Pentaxin.	Calcium 1.|Calcium 2.			acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	GAATCCTGCTCCTGCCCCAAG	0.532													53	407	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160128811	160128811	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160128811G>A	uc001fve.3	+	5	1024	c.545G>A	c.(544-546)GGA>GAA	p.G182E	ATP1A4_uc001fvf.3_RNA	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	182	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTAATTCGAGGAGGAGAGAAG	0.468													7	78	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067601	190067601	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067601G>T	uc001gse.1	-	8	2080	c.1848C>A	c.(1846-1848)AAC>AAA	p.N616K	FAM5C_uc010pot.1_Missense_Mutation_p.N514K	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	616						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TCTTCCATTTGTTCCCCAGAG	0.448													36	429	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201844012	201844012	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201844012G>T	uc001gwz.2	+	22	2936	c.2886G>T	c.(2884-2886)GAG>GAT	p.E962D		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	962					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						aggaggaggaggaTGGTTTAG	0.318													4	137	---	---	---	---	PASS
PIGR	5284	broad.mit.edu	37	1	207103673	207103673	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207103673T>C	uc001hez.2	-	11	2469	c.2285A>G	c.(2284-2286)CAG>CGG	p.Q762R	PIGR_uc009xbz.2_Missense_Mutation_p.Q762R	NM_002644	NP_002635	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor precursor	762	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3						CTAGGCTTCCTGGGGGCCGTC	0.637													7	29	---	---	---	---	PASS
HHIPL2	79802	broad.mit.edu	37	1	222715355	222715355	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222715355T>A	uc001hnh.1	-	3	1175	c.1117A>T	c.(1117-1119)AAA>TAA	p.K373*		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	373					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		CCAGCTTACTTGTTCTGAGCA	0.527													20	98	---	---	---	---	PASS
ZNF512	84450	broad.mit.edu	37	2	27824216	27824216	+	Intron	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27824216C>A	uc002rla.2	+						ZNF512_uc010ylv.1_Intron|ZNF512_uc010ylw.1_Intron|ZNF512_uc002rlb.2_Intron|ZNF512_uc010ylx.1_Intron|ZNF512_uc002rlc.2_Intron|ZNF512_uc010yly.1_Intron|ZNF512_uc010ylz.1_Intron	NM_032434	NP_115810	Q96ME7	ZN512_HUMAN	zinc finger protein 512						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					AGTATTTTTCCTTCTAGGAAA	0.393													18	143	---	---	---	---	PASS
CLIP4	79745	broad.mit.edu	37	2	29379276	29379276	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29379276G>T	uc002rmv.2	+	10	1461	c.1222G>T	c.(1222-1224)GGT>TGT	p.G408C	CLIP4_uc002rmu.2_Missense_Mutation_p.G408C|CLIP4_uc010ezm.1_Missense_Mutation_p.G408C|CLIP4_uc002rmw.2_RNA|CLIP4_uc010ymn.1_Missense_Mutation_p.G390C	NM_024692	NP_078968	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family,	408										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					ATTGCCTCCTGGTGAAGAACT	0.313													13	89	---	---	---	---	PASS
EPCAM	4072	broad.mit.edu	37	2	47612313	47612313	+	Silent	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47612313C>G	uc002rvx.2	+	8	1225	c.867C>G	c.(865-867)TCC>TCG	p.S289S	EPCAM_uc002rvw.2_Silent_p.S317S	NM_002354	NP_002345	P16422	EPCAM_HUMAN	epithelial cell adhesion molecule precursor	289	Cytoplasmic (Potential).				positive regulation of cell proliferation	apical plasma membrane|basolateral plasma membrane|integral to membrane|lateral plasma membrane|tight junction	protein binding			skin(1)	1						AGGTTATTTCCAGAAAGAAGA	0.338									Lynch_syndrome				51	309	---	---	---	---	PASS
GFPT1	2673	broad.mit.edu	37	2	69569383	69569383	+	Splice_Site	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69569383T>A	uc002sfh.2	-	12	1231	c.1052_splice	c.e12-1	p.V351_splice		NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1						CCAAATTCACTGAAATAAAAG	0.398													25	200	---	---	---	---	PASS
ZNF2	7549	broad.mit.edu	37	2	95847693	95847693	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95847693G>A	uc002suf.2	+	6	1579	c.1117G>A	c.(1117-1119)GAA>AAA	p.E373K	ZNF2_uc002sug.2_Missense_Mutation_p.E331K|ZNF2_uc010yue.1_Missense_Mutation_p.E336K|ZNF2_uc010fhs.2_Missense_Mutation_p.E294K	NM_021088	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2 isoform a	373	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		TGAATGCAGCGAATGCGGGAA	0.527													15	119	---	---	---	---	PASS
SLC20A1	6574	broad.mit.edu	37	2	113404520	113404520	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113404520G>T	uc002tib.2	+	2	561	c.115G>T	c.(115-117)GTG>TTG	p.V39L	uc010fkq.1_5'Flank	NM_005415	NP_005406	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate	39	Helical; (Potential).				phosphate metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to plasma membrane	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity			ovary(2)	2						GGCATTCTCCGTGGGAGCCAA	0.493													14	120	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125530467	125530467	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125530467G>T	uc002tno.2	+	17	2986	c.2622G>T	c.(2620-2622)TGG>TGT	p.W874C	CNTNAP5_uc010flu.2_Missense_Mutation_p.W875C	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	874	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ACAACCAATGGCACTATGTCC	0.547													29	170	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141773378	141773378	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141773378T>G	uc002tvj.1	-	13	3049	c.2077A>C	c.(2077-2079)AAG>CAG	p.K693Q	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	693	Extracellular (Potential).|LDL-receptor class B 7.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CACAGCATCTTTGAAGTCACA	0.418										TSP Lung(27;0.18)			28	121	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	159992709	159992709	+	Silent	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159992709C>G	uc002uag.2	+	5	538	c.264C>G	c.(262-264)CCC>CCG	p.P88P	TANC1_uc010fol.1_Silent_p.P88P|TANC1_uc010zcm.1_Silent_p.P88P|TANC1_uc010fom.1_Silent_p.P88P|TANC1_uc002uah.1_5'UTR	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	88						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						CTACAGGTCCCGTCAGGAAGC	0.483													33	200	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162830816	162830816	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162830816G>A	uc002ubx.3	+	24	3401	c.3217G>A	c.(3217-3219)GGG>AGG	p.G1073R	SLC4A10_uc002uby.3_Missense_Mutation_p.G1043R|SLC4A10_uc010zcs.1_Missense_Mutation_p.G1054R	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	1073	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						CCCATTGGAAGGGCACTATAG	0.333													4	30	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168104476	168104476	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168104476A>G	uc002udx.2	+	8	6592	c.6574A>G	c.(6574-6576)ACA>GCA	p.T2192A	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T2017A|XIRP2_uc010fpq.2_Missense_Mutation_p.T1970A|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2017					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AAAGCAAGAAACAAAATATTC	0.408													22	100	---	---	---	---	PASS
HAT1	8520	broad.mit.edu	37	2	172844237	172844237	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172844237C>G	uc002uhi.2	+	10	1129	c.1053C>G	c.(1051-1053)TAC>TAG	p.Y351*	HAT1_uc010fqi.2_Nonsense_Mutation_p.Y186*|HAT1_uc002uhj.2_Nonsense_Mutation_p.Y266*	NM_003642	NP_003633	O14929	HAT1_HUMAN	histone acetyltransferase 1	351					chromatin silencing at telomere|DNA packaging	cytoplasm|nuclear matrix|nucleoplasm	histone acetyltransferase activity|protein binding			large_intestine(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.216)			ACAGAAGCTACAGACTGGATA	0.348													27	141	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179431690	179431690	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179431690G>T	uc010zfg.1	-	275	71689	c.71465C>A	c.(71464-71466)CCA>CAA	p.P23822Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P17517Q|TTN_uc010zfi.1_Missense_Mutation_p.P17450Q|TTN_uc010zfj.1_Missense_Mutation_p.P17325Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24749							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGCTTTTTGGTGGTCCAGG	0.413													33	181	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590253	179590253	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590253T>A	uc010zfg.1	-	68	17170	c.16946A>T	c.(16945-16947)GAA>GTA	p.E5649V	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E2310V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6576							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTAATCACTTCTTCCTTCTC	0.433													10	94	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179621110	179621110	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179621110G>A	uc010zfh.1	-	44	10804	c.10580C>T	c.(10579-10581)GCA>GTA	p.A3527V	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc002unb.2_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTATCTTTGCACCTTCGTG	0.408													14	98	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197208380	197208380	+	Splice_Site	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197208380C>A	uc002utm.1	-	3	583	c.400_splice	c.e3+1	p.P134_splice	HECW2_uc002utl.1_Splice_Site	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						TAGTTACTTACGTTCCATGAA	0.363													16	295	---	---	---	---	PASS
BMPR2	659	broad.mit.edu	37	2	203332238	203332238	+	Intron	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203332238A>G	uc002uzf.3	+						BMPR2_uc010ftr.2_Intron|BMPR2_uc002uze.2_Intron	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II						anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						ATATTGATTTATAGGATGTTG	0.343													12	100	---	---	---	---	PASS
INO80D	54891	broad.mit.edu	37	2	206870222	206870222	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206870222C>A	uc002vaz.3	-	11	2359	c.1954G>T	c.(1954-1956)GCT>TCT	p.A652S		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	652					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						AGCTCCTCAGCCTCTTCGGTA	0.507													8	83	---	---	---	---	PASS
MRPL44	65080	broad.mit.edu	37	2	224824686	224824686	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224824686C>T	uc002vnr.3	+	2	684	c.615C>T	c.(613-615)AGC>AGT	p.S205S		NM_022915	NP_075066	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44 precursor	205	RNase III.				RNA processing	mitochondrion|ribosome	double-stranded RNA binding|protein binding|ribonuclease III activity			central_nervous_system(1)	1		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGTTACAGAGCAGTGGACCTG	0.438													17	126	---	---	---	---	PASS
C3orf20	84077	broad.mit.edu	37	3	14744711	14744711	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14744711G>T	uc003byy.2	+	6	1224	c.820G>T	c.(820-822)GAG>TAG	p.E274*	C3orf20_uc003byz.2_Nonsense_Mutation_p.E152*|C3orf20_uc003bza.2_Nonsense_Mutation_p.E152*|C3orf20_uc003byx.1_Nonsense_Mutation_p.E274*	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	274						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						CAACAGCCTGGAGTTCAGCGA	0.587													35	225	---	---	---	---	PASS
NKIRAS1	28512	broad.mit.edu	37	3	23934649	23934649	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23934649C>G	uc003ccj.2	-	5	918	c.516G>C	c.(514-516)CAG>CAC	p.Q172H	NKIRAS1_uc003cck.2_Missense_Mutation_p.Q172H|NKIRAS1_uc003ccl.2_Missense_Mutation_p.Q172H|NKIRAS1_uc003ccm.2_Missense_Mutation_p.Q172H	NM_020345	NP_065078	Q9NYS0	KBRS1_HUMAN	kappa B-ras 1	172					I-kappaB kinase/NF-kappaB cascade|small GTPase mediated signal transduction	cytoplasm	GTP binding|GTPase activity				0						TTGATTTGCTCTGGGGTTGAG	0.378													27	141	---	---	---	---	PASS
TREX1	11277	broad.mit.edu	37	3	48508848	48508848	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48508848G>T	uc003ctj.2	+	2	2216	c.959G>T	c.(958-960)GGA>GTA	p.G320V	TREX1_uc010hjy.2_Missense_Mutation_p.G265V|TREX1_uc003ctk.2_Missense_Mutation_p.G126V|TREX1_uc010hjz.2_Missense_Mutation_p.G265V|TREX1_uc010hka.2_Missense_Mutation_p.G320V	NM_033629	NP_338599	Q9NSU2	TREX1_HUMAN	three prime repair exonuclease 1 isoform b	320				G -> R (in Ref. 1; CAB50866).	cell death|DNA recombination|DNA replication|mismatch repair	nuclear envelope	3'-5'-exodeoxyribonuclease activity|exodeoxyribonuclease III activity|metal ion binding|MutLalpha complex binding|MutSalpha complex binding|protein homodimerization activity|single-stranded DNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CCCAGCCTTGGAGAGAGCAGG	0.602								Direct_reversal_of_damage|Editing_and_processing_nucleases					4	113	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115394998	115394998	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115394998G>C	uc003ebq.2	+	2	555	c.169G>C	c.(169-171)GAT>CAT	p.D57H	GAP43_uc003ebr.2_Missense_Mutation_p.D93H	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	57	IQ.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		AGAGAAGAAGGATGATGTCCA	0.488													5	110	---	---	---	---	PASS
FSTL1	11167	broad.mit.edu	37	3	120122198	120122198	+	Silent	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120122198T>A	uc003eds.2	-	8	760	c.585A>T	c.(583-585)GGA>GGT	p.G195G	FSTL1_uc011bjh.1_Silent_p.G160G	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor	195	EF-hand 2.				BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		CAACACAGAGTCCCCTGAAAC	0.468													16	65	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121410365	121410365	+	Missense_Mutation	SNP	T	C	C	rs116186804	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121410365T>C	uc003eei.3	-	14	7957	c.7831A>G	c.(7831-7833)ATA>GTA	p.I2611V	GOLGB1_uc010hrc.2_Missense_Mutation_p.I2616V|GOLGB1_uc003eej.3_Missense_Mutation_p.I2577V	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2611	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		AGCTGGGATATAGATACTTTC	0.393													33	195	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129370615	129370615	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129370615C>T	uc003emz.3	-	7	2172	c.1671G>A	c.(1669-1671)ACG>ACA	p.T557T	TMCC1_uc003emy.3_Silent_p.T233T|TMCC1_uc011blc.1_Silent_p.T378T|TMCC1_uc010htg.2_Silent_p.T443T	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	557	Potential.					integral to membrane				skin(1)	1						TGGAGATGCGCGTCTGGCATG	0.587													5	108	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140285066	140285066	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140285066G>T	uc003etn.2	+	17	3029	c.2839G>T	c.(2839-2841)GAG>TAG	p.E947*		NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	947	Cytoplasmic (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						AGCCCAGCTGGAGTGGGATGA	0.602										HNSCC(16;0.037)			6	15	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142269086	142269086	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142269086T>C	uc003eux.3	-	14	2986	c.2864A>G	c.(2863-2865)CAG>CGG	p.Q955R		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	955					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GTCAGCATTCTGGCATGGAGT	0.398								Other_conserved_DNA_damage_response_genes					25	150	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142272128	142272128	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142272128C>G	uc003eux.3	-	13	2868	c.2746G>C	c.(2746-2748)GCA>CCA	p.A916P		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	916					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						CTTTTAGCTGCAACCAGAGCT	0.408								Other_conserved_DNA_damage_response_genes					8	88	---	---	---	---	PASS
CPB1	1360	broad.mit.edu	37	3	148563352	148563352	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148563352C>G	uc003ewl.2	+	9	943	c.920C>G	c.(919-921)TCC>TGC	p.S307C		NM_001871	NP_001862	P15086	CBPB1_HUMAN	pancreatic carboxypeptidase B1 preproprotein	307					proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CACTCGTACTCCCAAATGATG	0.443													22	140	---	---	---	---	PASS
MAN2B2	23324	broad.mit.edu	37	4	6588845	6588845	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6588845C>G	uc003gjf.1	+	4	550	c.514C>G	c.(514-516)CTC>GTC	p.L172V	MAN2B2_uc003gje.1_Missense_Mutation_p.L172V|MAN2B2_uc011bwf.1_Missense_Mutation_p.L172V	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	172					mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						CAATGCCCACCTCGGCTCCCG	0.662													4	79	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62679551	62679551	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62679551C>T	uc010ihh.2	+	6	1393	c.1220C>T	c.(1219-1221)TCA>TTA	p.S407L	LPHN3_uc003hcq.3_Missense_Mutation_p.S407L|LPHN3_uc003hcs.1_Missense_Mutation_p.S236L	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	407	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						ggacaagtttcatacatttct	0.119													11	62	---	---	---	---	PASS
TECRL	253017	broad.mit.edu	37	4	65274916	65274916	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65274916C>A	uc003hcv.2	-	1	263	c.154G>T	c.(154-156)GTC>TTC	p.V52F	TECRL_uc003hcw.2_Missense_Mutation_p.V52F	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	52					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						GAATGTTTGACTGCTGGAGTT	0.358													18	75	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72412222	72412222	+	Silent	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72412222A>G	uc003hfy.2	+	19	2715	c.2598A>G	c.(2596-2598)GAA>GAG	p.E866E	SLC4A4_uc010iic.2_Silent_p.E866E|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Silent_p.E866E|SLC4A4_uc003hgc.3_Silent_p.E822E|SLC4A4_uc010iid.2_Silent_p.E70E	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	866	Extracellular (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CACCTGGAGAACAACCAAAGT	0.483													12	63	---	---	---	---	PASS
PPM1K	152926	broad.mit.edu	37	4	89186283	89186283	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89186283T>A	uc003hrm.3	-	6	1247	c.857A>T	c.(856-858)CAT>CTT	p.H286L		NM_152542	NP_689755	Q8N3J5	PPM1K_HUMAN	protein phosphatase 1K (PP2C domain containing)	286	PP2C-like.				protein dephosphorylation	mitochondrial matrix|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000192)		ATCAGCATGATGTAACTGCAA	0.413													31	208	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104082506	104082506	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104082506G>T	uc003hxb.1	-	19	2041	c.1951C>A	c.(1951-1953)CTG>ATG	p.L651M	CENPE_uc003hxc.1_Missense_Mutation_p.L626M	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	651	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTCTCCTTCAGCTCCAGATTT	0.333													20	136	---	---	---	---	PASS
CTSO	1519	broad.mit.edu	37	4	156863508	156863508	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156863508C>T	uc003ipg.2	-	3	394	c.345G>A	c.(343-345)AGG>AGA	p.R115R		NM_001334	NP_001325	P43234	CATO_HUMAN	cathepsin O preproprotein	115					proteolysis	lysosome	cysteine-type endopeptidase activity				0	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		CCTGCTTGTCCCTCCAGTCAA	0.423													14	123	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177081166	177081166	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177081166G>T	uc003iuj.2	+	20	2775	c.2619G>T	c.(2617-2619)CAG>CAT	p.Q873H	WDR17_uc003iuk.2_Missense_Mutation_p.Q849H|WDR17_uc003ium.3_Missense_Mutation_p.Q849H|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.Q92H	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	873										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AATTAATCCAGGAAGATAAGG	0.338													10	98	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5242297	5242297	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5242297C>T	uc003jdl.2	+	17	2793	c.2655C>T	c.(2653-2655)TGC>TGT	p.C885C	ADAMTS16_uc003jdk.1_Silent_p.C885C	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	885	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CCGTGTCCTGCGGAGGGGGTA	0.612													11	106	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7802424	7802424	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7802424G>A	uc003jdz.1	+	21	2789	c.2722G>A	c.(2722-2724)GAG>AAG	p.E908K	ADCY2_uc011cmo.1_Missense_Mutation_p.E728K|ADCY2_uc010itm.1_Missense_Mutation_p.E104K	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	908	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CGTGAACAAGGAGGGCTTGGA	0.498													21	81	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11732318	11732318	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11732318A>T	uc003jfa.1	-	2	249	c.104T>A	c.(103-105)TTA>TAA	p.L35*	CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	35					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GGAGGTGTTTAAGCCGGGGCT	0.507													19	176	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13870923	13870923	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13870923T>C	uc003jfd.2	-	24	3829	c.3787A>G	c.(3787-3789)ATA>GTA	p.I1263V		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1263	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCCTCCCTTATTTCTTTCAGC	0.338									Kartagener_syndrome				21	134	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21842274	21842274	+	Silent	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21842274G>C	uc010iuc.2	-	5	1268	c.810C>G	c.(808-810)CCC>CCG	p.P270P	CDH12_uc011cno.1_Silent_p.P230P|CDH12_uc003jgk.2_Silent_p.P270P	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	270	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						ACATACTTTTGGGGAATCGAG	0.408										HNSCC(59;0.17)			48	213	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	31983589	31983589	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31983589G>A	uc003jhl.2	+	3	1193	c.805G>A	c.(805-807)GGC>AGC	p.G269S	PDZD2_uc003jhm.2_Missense_Mutation_p.G269S|PDZD2_uc011cnx.1_Missense_Mutation_p.G95S	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	269					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GCTAGAAAATGGCCCAGATTC	0.557													27	189	---	---	---	---	PASS
SLC1A3	6507	broad.mit.edu	37	5	36608603	36608603	+	Silent	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36608603A>G	uc003jkj.3	+	2	554	c.78A>G	c.(76-78)ACA>ACG	p.T26T	SLC1A3_uc011cox.1_5'UTR|SLC1A3_uc010iuy.2_Silent_p.T26T	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	26	Cytoplasmic (Potential).				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	GTAAACGCACACTTTTGGCCA	0.458													60	271	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37169315	37169315	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37169315G>C	uc011cpa.1	-	34	7042	c.6811C>G	c.(6811-6813)CTG>GTG	p.L2271V	C5orf42_uc011coy.1_Missense_Mutation_p.L771V|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.L1346V|C5orf42_uc003jkr.1_Missense_Mutation_p.L304V	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2271										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTCTGTGGCAGAGCAGGTTGG	0.478													26	158	---	---	---	---	PASS
LIFR	3977	broad.mit.edu	37	5	38482681	38482681	+	Intron	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38482681A>G	uc010ive.1	-						LIFR_uc003jli.2_Intron	NM_001127671	NP_001121143	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor						positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)					ATAAGAAAATAAAAGATTACC	0.269			T	PLAG1	salivary adenoma								28	157	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40981570	40981570	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40981570C>T	uc003jmh.2	+	18	2541	c.2427C>T	c.(2425-2427)AAC>AAT	p.N809N		NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	809	Complement control factor I module 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TGGAAGTGAACGGCAAGGAGC	0.542													8	35	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63256546	63256546	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63256546T>C	uc011cqt.1	-	1	1001	c.1001A>G	c.(1000-1002)AAG>AGG	p.K334R		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	334	Cytoplasmic (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	CAGGGCCATCTTGCGCTTCGC	0.597													27	144	---	---	---	---	PASS
CCDC125	202243	broad.mit.edu	37	5	68590723	68590723	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68590723G>A	uc003jvv.1	-	8	864	c.821C>T	c.(820-822)GCG>GTG	p.A274V	CCDC125_uc003jvx.1_Missense_Mutation_p.A273V|CCDC125_uc003jvy.1_RNA|CCDC125_uc003jvw.2_Missense_Mutation_p.A149V	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	274						cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCCGAGGACCGCAAGCTTTAA	0.488													5	196	---	---	---	---	PASS
ERAP1	51752	broad.mit.edu	37	5	96126064	96126064	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96126064G>A	uc003kmm.2	-	10	1806	c.1459C>T	c.(1459-1461)CCT>TCT	p.P487S	ERAP1_uc003kml.2_Missense_Mutation_p.P487S|ERAP1_uc010jbm.1_Missense_Mutation_p.P299S|ERAP1_uc003kmn.2_Missense_Mutation_p.P487S	NM_001040458	NP_001035548	Q9NZ08	ERAP1_HUMAN	type 1 tumor necrosis factor receptor shedding	487	Lumenal (Potential).				angiogenesis|antigen processing and presentation of endogenous peptide antigen via MHC class I|fat cell differentiation|membrane protein ectodomain proteolysis|regulation of blood pressure|regulation of innate immune response|response to bacterium	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|integral to membrane	aminopeptidase activity|interleukin-1, Type II receptor binding|interleukin-6 receptor binding|metalloexopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		CCATCTGTAGGGCAAATCTAA	0.363													23	51	---	---	---	---	PASS
RAPGEF6	51735	broad.mit.edu	37	5	130799800	130799800	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130799800A>G	uc003kvn.1	-	18	2620	c.2414T>C	c.(2413-2415)GTC>GCC	p.V805A	RAPGEF6_uc003kvp.1_Missense_Mutation_p.V855A|RAPGEF6_uc003kvo.1_Missense_Mutation_p.V810A|RAPGEF6_uc010jdi.1_Missense_Mutation_p.V805A|RAPGEF6_uc010jdj.1_Missense_Mutation_p.V805A|RAPGEF6_uc003kvq.2_Missense_Mutation_p.V522A|RAPGEF6_uc003kvr.2_Missense_Mutation_p.V805A|RAPGEF6_uc011cxe.1_RNA|RAPGEF6_uc010jdk.2_Missense_Mutation_p.V805A	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide	805	Ras-associating.				Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CTGTTTTATGACACCCTCAGG	0.383													3	114	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140792990	140792990	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140792990C>T	uc003lkl.1	+	1	248	c.248C>T	c.(247-249)CCG>CTG	p.P83L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.P83L	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	83	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCTGAACCCGCGCAGCGGC	0.627													23	127	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51656023	51656023	+	Intron	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51656023C>A	uc003pah.1	-						PKHD1_uc010jzn.1_Intron|PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					AATCCTTGTGCCTTTACTCAC	0.483													24	135	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	56006603	56006603	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56006603G>A	uc003pcs.2	-	12	1754	c.1522C>T	c.(1522-1524)CCA>TCA	p.P508S	COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.P508S|COL21A1_uc003pcu.1_Missense_Mutation_p.P505S	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	508	Collagen-like 1.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TCTCGCCCTGGTTCTCCTTTG	0.348													14	96	---	---	---	---	PASS
SNX14	57231	broad.mit.edu	37	6	86259601	86259601	+	Intron	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86259601T>C	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TTTTTTACTATAGAGATTAAA	0.284													20	100	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100841640	100841640	+	Silent	SNP	G	A	A	rs139715467	byFrequency	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100841640G>A	uc003pqj.3	-	10	1500	c.1293C>T	c.(1291-1293)GAC>GAT	p.D431D	SIM1_uc010kcu.2_Silent_p.D431D	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	431	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CGCACGATGCGTCGTGCTGGG	0.612													13	86	---	---	---	---	PASS
C6orf170	221322	broad.mit.edu	37	6	121482134	121482134	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121482134C>A	uc003pyo.1	-	23	2707	c.2639G>T	c.(2638-2640)GGG>GTG	p.G880V	C6orf170_uc003pyq.1_RNA|C6orf170_uc010kej.1_5'UTR|C6orf170_uc003pyp.1_Missense_Mutation_p.G440V	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	880					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		TTCCAATGGCCCACCAACAAG	0.388													18	88	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128411045	128411045	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128411045G>A	uc003qbk.2	-	8	1622	c.1255C>T	c.(1255-1257)CGT>TGT	p.R419C	PTPRK_uc003qbj.2_Missense_Mutation_p.R419C|PTPRK_uc010kfc.2_Missense_Mutation_p.R419C|PTPRK_uc011ebu.1_Missense_Mutation_p.R419C|PTPRK_uc003qbl.1_Missense_Mutation_p.R289C|PTPRK_uc011ebv.1_Missense_Mutation_p.R419C	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	419	Extracellular (Potential).|Fibronectin type-III 2.				cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GTGTGGCAACGCGTAATGTTG	0.463													14	99	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160453653	160453653	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160453653G>C	uc003qta.2	+	8	1101	c.953G>C	c.(952-954)TGC>TCC	p.C318S		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	318	2.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		GAGTATGCCTGCCACAGAGAT	0.478													24	79	---	---	---	---	PASS
CHST12	55501	broad.mit.edu	37	7	2472891	2472891	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2472891A>G	uc003smc.2	+	2	752	c.617A>G	c.(616-618)CAC>CGC	p.H206R	CHST12_uc003smd.2_Missense_Mutation_p.H206R	NM_018641	NP_061111	Q9NRB3	CHSTC_HUMAN	carbohydrate sulfotransferase 12	206	Lumenal (Potential).				dermatan sulfate biosynthetic process	integral to Golgi membrane	3'-phosphoadenosine 5'-phosphosulfate binding|chondroitin 4-sulfotransferase activity|protein binding			kidney(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		CCGCGCGAGCACGTGCACAAC	0.652													6	34	---	---	---	---	PASS
RBAK	57786	broad.mit.edu	37	7	5103321	5103321	+	Intron	SNP	T	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5103321T>G	uc010kss.1	+						LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Intron	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		ATTTTTCCTTTTTAGAAGCCT	0.408													4	27	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11468628	11468628	+	Silent	SNP	A	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11468628A>C	uc003ssf.3	-	14	3441	c.3189T>G	c.(3187-3189)CGT>CGG	p.R1063R		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1063	TSP type-1 11.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ATGGTTTTTCACGCAGCCATT	0.488										HNSCC(18;0.044)			54	360	---	---	---	---	PASS
TMEM195	392636	broad.mit.edu	37	7	15458232	15458232	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15458232G>A	uc003stb.1	-	5	730	c.560C>T	c.(559-561)GCT>GTT	p.A187V		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	187					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						AAGATGAACAGCATATACTGA	0.313													11	84	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31864552	31864552	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31864552C>A	uc003tcm.1	-	13	1804	c.1335G>T	c.(1333-1335)ATG>ATT	p.M445I	PDE1C_uc003tcn.1_Missense_Mutation_p.M445I|PDE1C_uc003tco.1_Missense_Mutation_p.M505I|PDE1C_uc003tcr.2_Missense_Mutation_p.M445I|PDE1C_uc003tcs.2_Missense_Mutation_p.M445I	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	445	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TCTTCTCGGTCATGTCCGTAA	0.493													22	183	---	---	---	---	PASS
ASL	435	broad.mit.edu	37	7	65557066	65557066	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65557066G>T	uc003tuo.2	+	15	1247	c.1136G>T	c.(1135-1137)CGC>CTC	p.R379L	ASL_uc003tup.2_Missense_Mutation_p.R379L|ASL_uc003tur.2_Missense_Mutation_p.R353L|ASL_uc003tuq.2_Missense_Mutation_p.R359L	NM_000048	NP_000039	P04424	ARLY_HUMAN	argininosuccinate lyase isoform 1	379					arginine biosynthetic process via ornithine|arginine catabolic process|urea cycle	cytosol	argininosuccinate lyase activity			breast(2)	2					L-Arginine(DB00125)	TACCTGGTCCGCAAAGGGGTA	0.597													44	169	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413896	72413896	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413896A>G	uc003twk.2	+	11	3364	c.3364A>G	c.(3364-3366)ACC>GCC	p.T1122A	POM121_uc003twj.2_Missense_Mutation_p.T857A|POM121_uc010lam.1_Missense_Mutation_p.T857A	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	1122	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				AGGCTCCAGCACCACCACCGG	0.637													4	13	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82435074	82435074	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82435074C>A	uc003uhx.2	-	21	15152	c.14863G>T	c.(14863-14865)GGG>TGG	p.G4955W		NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4869					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						ACGCTATACCCACTGCCAAAG	0.527													5	24	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91630612	91630612	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91630612G>C	uc003ulg.2	+	8	1606	c.1381G>C	c.(1381-1383)GAG>CAG	p.E461Q	AKAP9_uc003ule.2_Missense_Mutation_p.E473Q|AKAP9_uc003ulf.2_Missense_Mutation_p.E461Q|AKAP9_uc003uli.2_Missense_Mutation_p.E86Q	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	473	Glu-rich.|Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GGCACAGATGGAGGAAATGAA	0.378			T	BRAF	papillary thyroid								36	159	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94039566	94039566	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94039566C>A	uc003ung.1	+	20	1519	c.1048C>A	c.(1048-1050)CCA>ACA	p.P350T	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	350					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGAGCCTGGTCCAGCTGGCTC	0.418										HNSCC(75;0.22)			12	85	---	---	---	---	PASS
AASS	10157	broad.mit.edu	37	7	121741498	121741498	+	Intron	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121741498T>C	uc003vka.2	-						AASS_uc011knu.1_Intron|AASS_uc011knv.1_Intron|AASS_uc003vkb.2_Intron|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor						protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	ACTGCCTAAATGTATATGACA	0.294													28	130	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122774500	122774500	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122774500G>T	uc003vkm.2	-	8	921	c.896C>A	c.(895-897)TCC>TAC	p.S299Y	SLC13A1_uc010lks.2_Missense_Mutation_p.S175Y	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	299	Helical; (Potential).					integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	CCAGATCCAGGATAAGAGTAG	0.413													8	76	---	---	---	---	PASS
OPN1SW	611	broad.mit.edu	37	7	128413743	128413743	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128413743C>T	uc003vnt.3	-	4	887	c.887G>A	c.(886-888)TGC>TAC	p.C296Y		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	296	Helical; Name=7; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						ATTGTAGATGCAAGCACTCTT	0.473													8	63	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700698	136700698	+	Silent	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700698C>A	uc003vtf.1	+	4	1709	c.1086C>A	c.(1084-1086)GCC>GCA	p.A362A	CHRM2_uc003vtg.1_Silent_p.A362A|CHRM2_uc003vtj.1_Silent_p.A362A|CHRM2_uc003vtk.1_Silent_p.A362A|CHRM2_uc003vtl.1_Silent_p.A362A|CHRM2_uc003vtm.1_Silent_p.A362A|CHRM2_uc003vti.1_Silent_p.A362A|CHRM2_uc003vto.1_Silent_p.A362A|CHRM2_uc003vtn.1_Silent_p.A362A|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	362	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	ATATTGTAGCCCGCAAGATTG	0.473													10	99	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137266584	137266584	+	Intron	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137266584C>T	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						GGAAATGGGACGTTGTCCTCA	0.348													11	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142099914	142099914	+	Intron	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142099914C>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vyz.1_Missense_Mutation_p.V9L					SubName: Full=V_segment translation product; Flags: Fragment;																		CCCAGGACCACCCAGCAGAGG	0.458													23	150	---	---	---	---	PASS
KEL	3792	broad.mit.edu	37	7	142640001	142640001	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142640001C>A	uc003wcb.2	-	17	2112	c.1902G>T	c.(1900-1902)GAG>GAT	p.E634D		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	634	Extracellular (Potential).	Zinc; catalytic (By similarity).			proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					CTGCAGCATTCTCTAAGAATG	0.517													34	201	---	---	---	---	PASS
LGI3	203190	broad.mit.edu	37	8	22005927	22005927	+	Silent	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22005927G>T	uc003xav.2	-	8	1682	c.1393C>A	c.(1393-1395)CGG>AGG	p.R465R	LGI3_uc010ltu.2_Silent_p.R441R	NM_139278	NP_644807	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	465	EAR 6.				exocytosis	cell junction|extracellular region|synaptic vesicle|synaptosome				ovary(1)	1				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		AGCGAGCCCCGGGAGGGCAGG	0.667													3	16	---	---	---	---	PASS
SORBS3	10174	broad.mit.edu	37	8	22432219	22432219	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22432219G>T	uc003xbv.2	+	21	2334	c.1994G>T	c.(1993-1995)GGA>GTA	p.G665V	SORBS3_uc003xbw.3_Missense_Mutation_p.G323V	NM_005775	NP_005766	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3 isoform 1	665	SH3 3.|Binds to SOS.				muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		ACGTTCCCTGGAAATTACGTT	0.602											OREG0018613	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	133	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53126751	53126751	+	Intron	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53126751T>A	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron|ST18_uc003xrb.2_Intron|ST18_uc010lyb.2_Intron	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TAGAACCTGCTTGCTAACTCA	0.483													19	87	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59515778	59515778	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59515778A>G	uc003xtt.2	-	13	1250	c.1036T>C	c.(1036-1038)TCA>CCA	p.S346P	NSMAF_uc011lee.1_Missense_Mutation_p.S377P|NSMAF_uc003xtu.2_Missense_Mutation_p.S346P	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	346	BEACH.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				CCTAGTTCTGAGCTGGAATAA	0.433													32	237	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69021782	69021782	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69021782G>A	uc003xxv.1	+	25	3097	c.3070G>A	c.(3070-3072)GAC>AAC	p.D1024N	PREX2_uc011lez.1_Missense_Mutation_p.D959N	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1024					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						AGAAACCCAAGACATCTATCA	0.458													25	178	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77764061	77764061	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764061G>A	uc003yav.2	+	10	5156	c.4769G>A	c.(4768-4770)GGG>GAG	p.G1590E	ZFHX4_uc003yau.1_Missense_Mutation_p.G1635E|ZFHX4_uc003yaw.1_Missense_Mutation_p.G1590E	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1590						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTGGCTGGTGGGCACAGCATT	0.502										HNSCC(33;0.089)			10	85	---	---	---	---	PASS
DCAF13	25879	broad.mit.edu	37	8	104427175	104427175	+	5'UTR	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104427175G>A	uc003yln.2	+	1					SLC25A32_uc003yll.2_5'UTR|SLC25A32_uc011lhr.1_5'UTR|DCAF13_uc003ylm.1_5'UTR|DCAF13_uc003ylo.2_5'UTR	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing						rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1						TAGGCTCGGGGCCCGTCGACA	0.721													4	9	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113253983	113253983	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113253983T>A	uc003ynu.2	-	66	10593	c.10434A>T	c.(10432-10434)AGA>AGT	p.R3478S	CSMD3_uc003yns.2_Missense_Mutation_p.R2680S|CSMD3_uc003ynt.2_Missense_Mutation_p.R3438S|CSMD3_uc011lhx.1_Missense_Mutation_p.R3309S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3478	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCAGTGCAGGTCTAGGATCTT	0.299										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			34	262	---	---	---	---	PASS
MTSS1	9788	broad.mit.edu	37	8	125575193	125575193	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125575193C>A	uc003yrk.2	-	10	1399	c.865G>T	c.(865-867)GGC>TGC	p.G289C	NDUFB9_uc011lim.1_Intron|MTSS1_uc011lin.1_Missense_Mutation_p.G23C|MTSS1_uc011lio.1_Missense_Mutation_p.G179C|MTSS1_uc003yri.2_Missense_Mutation_p.G89C|MTSS1_uc003yrj.2_Missense_Mutation_p.G289C|MTSS1_uc003yrl.2_Missense_Mutation_p.G293C	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	289	Ser-rich.				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GAGTGGGAGCCGCTGGACCGG	0.627													3	14	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143603331	143603331	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143603331G>A	uc003ywm.2	+	20	3213	c.3030G>A	c.(3028-3030)GTG>GTA	p.V1010V		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1010	Helical; Name=3; (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CACAGGTGGTGTGCACGCTGG	0.692													4	5	---	---	---	---	PASS
ZC3H3	23144	broad.mit.edu	37	8	144621338	144621338	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144621338C>T	uc003yyd.2	-	2	228	c.199G>A	c.(199-201)GGG>AGG	p.G67R		NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	67					mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CACGAAGGCCCATGGTGGGAA	0.667													20	150	---	---	---	---	PASS
GLDC	2731	broad.mit.edu	37	9	6553420	6553420	+	Missense_Mutation	SNP	G	A	A	rs121964977		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6553420G>A	uc003zkc.2	-	20	2598	c.2405C>T	c.(2404-2406)GCG>GTG	p.A802V		NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	802					glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	CCATGGGGCCGCACTGACGGT	0.547													25	84	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14775880	14775880	+	Silent	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14775880A>G	uc003zlm.2	-	25	5354	c.4764T>C	c.(4762-4764)ACT>ACC	p.T1588T	FREM1_uc010mic.2_Intron|FREM1_uc003zlk.2_5'Flank|FREM1_uc003zll.2_Silent_p.T124T	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1588	CSPG 11.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TAAAGCAGTCAGTCTGGGAGT	0.498													19	99	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971082	21971082	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971082G>A	uc003zpk.2	-	2	488	c.276C>T	c.(274-276)GAC>GAT	p.D92D	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.H148Y	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	92	ANK 3.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(13)|p.D92fs*54(2)|p.H83fs*2(2)|p.E61_L94del(1)|p.R137fs*48(1)|p.A68fs*3(1)|p.T93fs*26(1)|p.D92N(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCACCAGCGTGTCCAGGAAGC	0.746		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			8	8	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37746626	37746626	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37746626C>G	uc004aag.1	+	16	4641	c.4597C>G	c.(4597-4599)CAG>GAG	p.Q1533E	FRMPD1_uc004aah.1_Missense_Mutation_p.Q1533E	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1533						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		CACCTACCATCAGTTTATAGA	0.617													38	135	---	---	---	---	PASS
ZNF658	26149	broad.mit.edu	37	9	40772779	40772779	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40772779C>T	uc004abs.2	-	5	2648	c.2496G>A	c.(2494-2496)GGG>GGA	p.G832G	ZNF658_uc010mmm.1_Intron|ZNF658_uc010mmn.1_Silent_p.G832G	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	832	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGAAAGTTTTCCCACATTGGT	0.408													40	172	---	---	---	---	PASS
AGTPBP1	23287	broad.mit.edu	37	9	88272541	88272541	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88272541C>T	uc011ltd.1	-	9	751	c.718G>A	c.(718-720)GCT>ACT	p.A240T	AGTPBP1_uc011ltc.1_Missense_Mutation_p.A138T|AGTPBP1_uc010mqc.2_Missense_Mutation_p.A240T|AGTPBP1_uc011lte.1_Missense_Mutation_p.A292T	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	240					C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						CTGTCTACAGCTCTCCTGGCA	0.343													3	91	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	119097135	119097135	+	Intron	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119097135G>T	uc004bjn.2	+						PAPPA_uc011lxp.1_Intron|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TGTCTCCCCTGACAGGCCTCC	0.622													18	44	---	---	---	---	PASS
PKN3	29941	broad.mit.edu	37	9	131476641	131476641	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131476641C>T	uc004bvw.2	+	11	1871	c.1478C>T	c.(1477-1479)CCC>CTC	p.P493L	PKN3_uc010myh.2_Missense_Mutation_p.P493L|PKN3_uc011mbk.1_Missense_Mutation_p.P43L	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	493	Pro-rich.				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						CCTGCCACTCCCAGGTGAGGA	0.622													16	58	---	---	---	---	PASS
DBH	1621	broad.mit.edu	37	9	136517356	136517356	+	Intron	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136517356T>C	uc004cel.2	+							NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta hydroxylase precursor						hormone biosynthetic process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)	CCCTCGGCTCTGCCTGCCCCA	0.662													13	92	---	---	---	---	PASS
ASAH2	56624	broad.mit.edu	37	10	52008284	52008284	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52008284G>T	uc001jjd.2	-	1	87	c.87C>A	c.(85-87)AGC>AGA	p.S29R	ASAH2_uc009xos.2_Missense_Mutation_p.S29R	NM_019893	NP_063946	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase 2 isoform a	29	Helical; Signal-anchor for type II membrane protein; (Potential).				apoptosis|ceramide metabolic process|signal transduction	integral to membrane|mitochondrion|plasma membrane	ceramidase activity				0						TAAACAAGAGGCTGAGAAGGG	0.443													29	93	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	53564377	53564377	+	Silent	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53564377C>A	uc001jjm.2	+	4	774	c.580C>A	c.(580-582)CGA>AGA	p.R194R	PRKG1_uc001jjn.2_Silent_p.R209R|PRKG1_uc001jjo.2_Silent_p.R209R	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	194	cGMP 1.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GGCCATTGATCGACAATGTTT	0.343													9	74	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67680256	67680256	+	Silent	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67680256C>A	uc009xpn.1	-	18	2643	c.2520G>T	c.(2518-2520)GGG>GGT	p.G840G	CTNNA3_uc001jmw.2_Silent_p.G840G	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	840					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						GGTGCCGGGGCCCAGCAGGAC	0.468													32	194	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70332267	70332267	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70332267G>T	uc001jok.3	+	2	677	c.172G>T	c.(172-174)GTT>TTT	p.V58F		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	58					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						AGAAAGAGATGTTAAGAAAAA	0.423													7	130	---	---	---	---	PASS
SFTPA2	729238	broad.mit.edu	37	10	81318630	81318630	+	Intron	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81318630C>T	uc001kal.3	-						SFTPA2_uc001kan.3_Intron	NM_006926	NP_008857	Q8IWL1	SFPA2_HUMAN	RecName: Full=Pulmonary surfactant-associated protein A2;          Short=SP-A2;          Short=SP-A;          Short=PSP-A;          Short=PSPA; AltName: Full=Alveolar proteinosis protein; AltName: Full=35 kDa pulmonary surfactant-associated protein; Flags: Precursor;						cell junction assembly|respiratory gaseous exchange	collagen|extracellular space	sugar binding				0	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CCACCTGCCCCGCCCTGCTCA	0.632									Pulmonary_Fibrosis_Idiopathic				21	151	---	---	---	---	PASS
GPR26	2849	broad.mit.edu	37	10	125426542	125426542	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125426542G>A	uc001lhh.2	+	1	672	c.619G>A	c.(619-621)GAC>AAC	p.D207N		NM_153442	NP_703143	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	207	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CAAGCGCATCGACGTGATCAC	0.642													3	16	---	---	---	---	PASS
TALDO1	6888	broad.mit.edu	37	11	755975	755975	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:755975C>A	uc001lqz.2	+	2	244	c.194C>A	c.(193-195)GCG>GAG	p.A65E	TALDO1_uc010qwl.1_Missense_Mutation_p.A65E|TALDO1_uc001lra.2_Missense_Mutation_p.A65E	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	65					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		GTGGAGGAGGCGATTGCCTAT	0.632													3	57	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1268600	1268600	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1268600C>G	uc009ycr.1	+	50	12200	c.12074C>G	c.(12073-12075)GCA>GGA	p.A4025G	MUC5B_uc001ltb.2_Missense_Mutation_p.A3500G	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3497	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACCCCAGCAGCAACCACCAGT	0.662													20	69	---	---	---	---	PASS
OR52N5	390075	broad.mit.edu	37	11	5799147	5799147	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5799147A>T	uc010qzn.1	-	1	718	c.718T>A	c.(718-720)TCA>ACA	p.S240T	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N,	240	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		CGAGCATCTGATGAAGAGAGG	0.453													10	92	---	---	---	---	PASS
OR52N5	390075	broad.mit.edu	37	11	5799598	5799598	+	Silent	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5799598A>G	uc010qzn.1	-	1	267	c.267T>C	c.(265-267)AAT>AAC	p.N89N	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001922	NP_001001922	Q8NH56	O52N5_HUMAN	olfactory receptor, family 52, subfamily N,	89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		TGCAGAGTGCATTGGGTAGAG	0.448													13	132	---	---	---	---	PASS
OR56B4	196335	broad.mit.edu	37	11	6129241	6129241	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6129241G>T	uc010qzx.1	+	1	233	c.233G>T	c.(232-234)GGC>GTC	p.G78V		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	78	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGGACATTGGCCTGGCCACC	0.502													7	75	---	---	---	---	PASS
NRIP3	56675	broad.mit.edu	37	11	9005642	9005642	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9005642G>T	uc001mhg.2	-	5	706	c.592C>A	c.(592-594)CTA>ATA	p.L198I	NRIP3_uc010rbu.1_3'UTR	NM_020645	NP_065696	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	198					proteolysis		aspartic-type endopeptidase activity				0				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		AGAGTCTGTAGACCAAGGGAC	0.393													19	203	---	---	---	---	PASS
GALNTL4	374378	broad.mit.edu	37	11	11354266	11354266	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11354266T>C	uc001mjo.2	-	8	1812	c.1391A>G	c.(1390-1392)TAC>TGC	p.Y464C		NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	464	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		GATGTCGGAGTACATCCTCAT	0.527													4	82	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18745750	18745750	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18745750C>T	uc009yht.2	-	2	224	c.34G>A	c.(34-36)GAG>AAG	p.E12K	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	12										ovary(4)|large_intestine(2)|kidney(1)	7						GACACGTGCTCCTGCAGCATC	0.592													13	214	---	---	---	---	PASS
ALX4	60529	broad.mit.edu	37	11	44286713	44286713	+	Silent	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44286713G>T	uc001myb.2	-	4	1031	c.927C>A	c.(925-927)CTC>CTA	p.L309L		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	309					hair follicle development						0						CGTTGTTGCCGAGCCAGGACG	0.692													3	11	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55322397	55322397	+	Silent	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322397C>A	uc010rig.1	+	1	615	c.615C>A	c.(613-615)GGC>GGA	p.G205G		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	151	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GGACAGGGGGCCTCTTGCATT	0.468										HNSCC(20;0.049)			19	162	---	---	---	---	PASS
OR5M8	219484	broad.mit.edu	37	11	56258430	56258430	+	Silent	SNP	C	A	A	rs141674595		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56258430C>A	uc001nix.1	-	1	417	c.417G>T	c.(415-417)GTG>GTT	p.V139V		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	139	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					GGAAGGAGCACACACTCTTGG	0.527													21	83	---	---	---	---	PASS
OR10Q1	219960	broad.mit.edu	37	11	57995755	57995755	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57995755C>A	uc010rkd.1	-	1	593	c.593G>T	c.(592-594)CGC>CTC	p.R198L		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	198	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				CTGGTGCACGCGGATGTCAGC	0.597													9	48	---	---	---	---	PASS
PATL1	219988	broad.mit.edu	37	11	59420456	59420456	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59420456C>T	uc001noe.3	-	10	1300	c.1157G>A	c.(1156-1158)GGA>GAA	p.G386E	PATL1_uc009yms.1_Missense_Mutation_p.G356E|PATL1_uc010rkw.1_Missense_Mutation_p.G91E	NM_152716	NP_689929	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog	386	Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly|deadenylation-dependent decapping of nuclear-transcribed mRNA	cytoplasmic mRNA processing body	protein binding|RNA binding			ovary(1)	1						CCGGTGACTTCCTCTATCTCC	0.438													44	214	---	---	---	---	PASS
VWCE	220001	broad.mit.edu	37	11	61050268	61050268	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61050268G>A	uc001nra.2	-	6	930	c.651C>T	c.(649-651)TCC>TCT	p.S217S	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	217	EGF-like 3; calcium-binding (Potential).					extracellular region	calcium ion binding			ovary(1)	1						TACCTACACAGGAGTGCCGGT	0.552													29	274	---	---	---	---	PASS
PRKRIR	5612	broad.mit.edu	37	11	76063785	76063785	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76063785C>A	uc001oxh.1	-	5	409	c.409G>T	c.(409-411)GCT>TCT	p.A137S	PRKRIR_uc010rrz.1_5'UTR	NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double	137					negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						GGGTTCTGAGCATTGCTATTG	0.368													6	45	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117258018	117258018	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117258018G>T	uc001prc.2	+	15	1971	c.1824G>T	c.(1822-1824)AGG>AGT	p.R608S	CEP164_uc001prb.2_Missense_Mutation_p.R611S|CEP164_uc010rxk.1_Missense_Mutation_p.R582S|CEP164_uc001prf.2_RNA|CEP164_uc009yzp.1_RNA|CEP164_uc001prg.1_Missense_Mutation_p.R41S	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	608	Glu-rich.				cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		AAGACCAGAGGCACCTGCTGG	0.587													32	146	---	---	---	---	PASS
C11orf63	79864	broad.mit.edu	37	11	122756635	122756635	+	Silent	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122756635A>T	uc001pym.2	+	2	375	c.78A>T	c.(76-78)ACA>ACT	p.T26T	C11orf63_uc001pyl.1_Silent_p.T26T	NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	26										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		TCCAGTCCACACACCCACCTT	0.383													10	157	---	---	---	---	PASS
ITFG2	55846	broad.mit.edu	37	12	2933085	2933085	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2933085A>T	uc001qlb.1	+	11	1280	c.1216A>T	c.(1216-1218)AGC>TGC	p.S406C	ITFG2_uc010seb.1_Missense_Mutation_p.S229C|ITFG2_uc010sec.1_RNA	NM_018463	NP_060933	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	406											0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GGAGTACCACAGCCTGCTGCA	0.597													18	98	---	---	---	---	PASS
NECAP1	25977	broad.mit.edu	37	12	8245544	8245544	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8245544C>T	uc001qtx.2	+	6	647	c.569C>T	c.(568-570)CCG>CTG	p.P190L	NECAP1_uc001qty.2_Missense_Mutation_p.P48L	NM_015509	NP_056324	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	190					endocytosis|protein transport	clathrin coated vesicle membrane|plasma membrane				ovary(1)	1				Kidney(36;0.0915)		CTCCCACCCCCGCCAGGAGGC	0.512													16	176	---	---	---	---	PASS
CLEC1A	51267	broad.mit.edu	37	12	10241723	10241723	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10241723A>G	uc001qxb.2	-	2	298	c.214T>C	c.(214-216)TTT>CTT	p.F72L	CLEC1A_uc009zhf.2_5'UTR|CLEC1A_uc001qxc.2_5'UTR|CLEC1A_uc001qxd.2_Intron|CLEC1A_uc010sgx.1_Intron	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1	72	Helical; Signal-anchor for type II membrane protein; (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						GCAGACTTACACAAAAGCCCC	0.512													11	47	---	---	---	---	PASS
WBP11	51729	broad.mit.edu	37	12	14947514	14947514	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14947514G>A	uc001rci.2	-	7	839	c.678C>T	c.(676-678)CCC>CCT	p.P226P		NM_016312	NP_057396	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	226					mRNA processing|RNA splicing|rRNA processing	cytoplasm	single-stranded DNA binding|WW domain binding			ovary(1)|lung(1)	2						GCCTACGAGGGGGAAGATCTA	0.488													67	403	---	---	---	---	PASS
RASSF8	11228	broad.mit.edu	37	12	26218104	26218104	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26218104G>A	uc001rgx.2	+	3	998	c.777G>A	c.(775-777)AAG>AAA	p.K259K	RASSF8_uc001rgy.2_Silent_p.K259K|RASSF8_uc001rgz.2_Silent_p.K259K|RASSF8_uc009zjd.1_Silent_p.K259K|RASSF8_uc009zje.1_Silent_p.K259K	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	259	Glu-rich.				signal transduction						0	Colorectal(261;0.0847)					ACAAATTAAAGGACTATTTGG	0.373													10	199	---	---	---	---	PASS
ARNTL2	56938	broad.mit.edu	37	12	27553684	27553684	+	Silent	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27553684A>G	uc001rht.1	+	10	1155	c.1137A>G	c.(1135-1137)GGA>GGG	p.G379G	ARNTL2_uc001rhw.2_Silent_p.G342G|ARNTL2_uc010sjp.1_Silent_p.G342G|ARNTL2_uc001rhu.1_Silent_p.G365G|ARNTL2_uc009zji.1_Silent_p.G345G|ARNTL2_uc001rhv.1_Silent_p.G331G|uc001rhx.2_Intron	NM_020183	NP_064568	Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear	379	PAS 2.				circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)					CAGTGAATGGAAAATTTGTCT	0.348													25	147	---	---	---	---	PASS
FAM113B	91523	broad.mit.edu	37	12	47629351	47629351	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47629351G>T	uc001rpn.2	+	4	1236	c.505G>T	c.(505-507)GGC>TGC	p.G169C	FAM113B_uc010slj.1_Missense_Mutation_p.G49C|FAM113B_uc001rpq.2_Missense_Mutation_p.G169C	NM_138371	NP_612380	Q96HM7	F113B_HUMAN	hypothetical protein LOC91523	169							hydrolase activity			skin(3)|ovary(2)	5	Renal(347;0.138)|Lung SC(27;0.192)					CATGCCTGTGGGCGAGGAAGT	0.612													7	86	---	---	---	---	PASS
SMUG1	23583	broad.mit.edu	37	12	54576119	54576119	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54576119C>G	uc001sff.1	-	4	703	c.574G>C	c.(574-576)GGG>CGG	p.G192R	SMUG1_uc001sfa.1_RNA|SMUG1_uc001sfe.1_3'UTR|SMUG1_uc001sfg.1_Missense_Mutation_p.G192R|SMUG1_uc009znf.1_Missense_Mutation_p.G192R|SMUG1_uc001sfb.3_Intron|SMUG1_uc001sfc.3_Intron|SMUG1_uc001sfd.3_Intron	NM_014311	NP_055126	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional	192					depyrimidination	nucleolus|nucleoplasm	DNA binding|protein binding|single-strand selective uracil DNA N-glycosylase activity				0						TCACAGATCCCAAGAAGCTGT	0.632								BER_DNA_glycosylases					10	130	---	---	---	---	PASS
MMP19	4327	broad.mit.edu	37	12	56234994	56234994	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56234994G>T	uc001sib.2	-	3	321	c.200C>A	c.(199-201)CCA>CAA	p.P67Q	MMP19_uc001sia.2_5'Flank|MMP19_uc001sid.2_Intron|MMP19_uc010spw.1_Missense_Mutation_p.P67Q	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	67					angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						ACCTGAGACTGGAAGTTCAGA	0.512													8	82	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57957931	57957931	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57957931G>T	uc001sor.1	+	4	540	c.332G>T	c.(331-333)CGA>CTA	p.R111L	KIF5A_uc010srr.1_Intron	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	111	Kinesin-motor.				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						ATCATTCCTCGAATTGCCCGA	0.527													9	123	---	---	---	---	PASS
FRS2	10818	broad.mit.edu	37	12	69968278	69968278	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69968278C>G	uc001suy.2	+	10	1580	c.1070C>G	c.(1069-1071)CCT>CGT	p.P357R	FRS2_uc001suz.2_Missense_Mutation_p.P357R|FRS2_uc009zrj.2_Missense_Mutation_p.P357R|FRS2_uc009zrk.2_Missense_Mutation_p.P357R	NM_006654	NP_006645	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	357					activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TCTTTGCCTCCTGTTTGGGAA	0.418													19	154	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70963667	70963667	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70963667C>T	uc001swb.3	-	12	2798	c.2768G>A	c.(2767-2769)AGC>AAC	p.S923N	PTPRB_uc010sto.1_Missense_Mutation_p.S923N|PTPRB_uc010stp.1_Missense_Mutation_p.S833N|PTPRB_uc001swc.3_Missense_Mutation_p.S1141N|PTPRB_uc001swa.3_Missense_Mutation_p.S1053N|PTPRB_uc001swd.3_Missense_Mutation_p.S1140N|PTPRB_uc009zrr.1_Missense_Mutation_p.S1020N	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	923	Fibronectin type-III 11.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CACCGTCAGGCTATCTGTTGC	0.428													11	49	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80672819	80672819	+	IGR	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80672819G>T								PPP1R12A (343584 upstream) : PTPRQ (165307 downstream)																							GTTTGTCGACGAGGAATGTTC	0.358													14	312	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88508920	88508920	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88508920C>A	uc001tar.2	-	19	2208	c.1864G>T	c.(1864-1866)GAT>TAT	p.D622Y	CEP290_uc001tat.2_Missense_Mutation_p.D415Y|CEP290_uc009zsl.1_RNA	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	622	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						CTTTCTAAATCTCTTTCTTTT	0.249													5	33	---	---	---	---	PASS
RPH3A	22895	broad.mit.edu	37	12	113312915	113312915	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113312915G>T	uc010syl.1	+	11	1185	c.823G>T	c.(823-825)GCC>TCC	p.A275S	RPH3A_uc001ttz.2_Missense_Mutation_p.A275S|RPH3A_uc001tty.2_Missense_Mutation_p.A271S|RPH3A_uc009zwe.1_Missense_Mutation_p.A271S|RPH3A_uc010sym.1_Missense_Mutation_p.A226S|RPH3A_uc001tua.2_Missense_Mutation_p.A35S	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1	275	Pro-rich.				intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CTCAGTCCAGGCCTCCAGACC	0.602													3	8	---	---	---	---	PASS
OGFOD2	79676	broad.mit.edu	37	12	123463863	123463863	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123463863C>T	uc001uea.1	+	7	1044	c.1023C>T	c.(1021-1023)CCC>CCT	p.P341P	OGFOD2_uc001uds.1_Silent_p.P177P|OGFOD2_uc001udt.1_Silent_p.P177P|OGFOD2_uc001udu.1_Silent_p.P177P|OGFOD2_uc001udv.1_Silent_p.P177P|OGFOD2_uc009zxs.1_Silent_p.P177P|OGFOD2_uc001udw.1_Silent_p.P177P|OGFOD2_uc001udx.1_Silent_p.P177P|OGFOD2_uc001udy.1_Silent_p.P177P|OGFOD2_uc001udz.1_Silent_p.P281P|OGFOD2_uc001ueb.1_Silent_p.P177P|ARL6IP4_uc001uec.2_5'Flank|ARL6IP4_uc001ued.2_5'Flank|ARL6IP4_uc001uee.2_5'Flank|ARL6IP4_uc001uef.2_5'Flank|ARL6IP4_uc001ueg.2_5'Flank|ARL6IP4_uc009zxt.2_5'Flank|ARL6IP4_uc001ueh.2_5'Flank|ARL6IP4_uc001uei.2_5'Flank	NM_024623	NP_078899	Q6N063	OGFD2_HUMAN	2-oxoglutarate and iron-dependent oxygenase	341							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			pancreas(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.11e-05)|Epithelial(86;0.000127)|BRCA - Breast invasive adenocarcinoma(302;0.107)	Vitamin C(DB00126)	GAGAGGAGCCCGCCACGGTGG	0.647													4	57	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124840069	124840069	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124840069G>A	uc010tba.1	-	24	3431	c.3314C>T	c.(3313-3315)CCG>CTG	p.P1105L	NCOR2_uc010tay.1_Missense_Mutation_p.P1104L|NCOR2_uc010taz.1_Missense_Mutation_p.P1088L|NCOR2_uc010tbb.1_Missense_Mutation_p.P1097L|NCOR2_uc010tbc.1_Missense_Mutation_p.P1087L|NCOR2_uc001ugj.1_Missense_Mutation_p.P1105L	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	1105					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GGGTGGGCGCGGCAGGACGGG	0.657													6	35	---	---	---	---	PASS
TRPC4	7223	broad.mit.edu	37	13	38357198	38357198	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38357198G>T	uc001uws.2	-	2	508	c.273C>A	c.(271-273)AGC>AGA	p.S91R	TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.S91R|TRPC4_uc010tey.1_Missense_Mutation_p.S91R|TRPC4_uc010abw.2_Missense_Mutation_p.S91R|TRPC4_uc010abx.2_Missense_Mutation_p.S91R|TRPC4_uc010aby.2_Missense_Mutation_p.S91R	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	91	ANK 2.|Cytoplasmic (Potential).|Multimerization domain (By similarity).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		AGACATTAAAGCTTAAGAGTA	0.219													31	126	---	---	---	---	PASS
SPRY2	10253	broad.mit.edu	37	13	80910886	80910886	+	3'UTR	SNP	A	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80910886A>C	uc001vli.2	-	2					SPRY2_uc001vlj.2_3'UTR	NM_005842	NP_005833	O43597	SPY2_HUMAN	sprouty 2						epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of ERK1 and ERK2 cascade|positive regulation of gene expression|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein kinase B signaling cascade	cytosol|microtubule|ruffle membrane	protein serine/threonine kinase activator activity			ovary(1)|lung(1)	2	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		ATTCCTGATTAATGATGCTAT	0.368													13	37	---	---	---	---	PASS
GPC6	10082	broad.mit.edu	37	13	94197638	94197638	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94197638C>T	uc001vlt.2	+	2	915	c.283C>T	c.(283-285)CGC>TGC	p.R95C	GPC6_uc010tig.1_Missense_Mutation_p.R95C|GPC6_uc001vlu.1_Missense_Mutation_p.R25C	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	95						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				CCATTTTGTGCGCACCACTTT	0.398													43	178	---	---	---	---	PASS
ATP11A	23250	broad.mit.edu	37	13	113460563	113460563	+	Missense_Mutation	SNP	G	A	A	rs150693839		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113460563G>A	uc001vsi.3	+	4	377	c.289G>A	c.(289-291)GGA>AGA	p.G97R	ATP11A_uc001vsj.3_Missense_Mutation_p.G97R|ATP11A_uc001vsm.1_5'UTR	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	97	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				AGTGACAAGCGGACTTCCACT	0.398													64	161	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22592197	22592197	+	Intron	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22592197C>A	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Missense_Mutation_p.H94Q|uc010ajj.1_Missense_Mutation_p.H94Q|uc001wde.1_Missense_Mutation_p.H68Q|uc010aji.1_Missense_Mutation_p.H94Q					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TCCTGCCCCACGCTACGCTGA	0.488													3	65	---	---	---	---	PASS
DHRS4L2	317749	broad.mit.edu	37	14	24470661	24470661	+	Silent	SNP	G	C	C	rs144732095		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24470661G>C	uc001wli.3	+	6	730	c.600G>C	c.(598-600)CTG>CTC	p.L200L	DHRS4_uc001wlc.3_Intron|DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_Intron|DHRS4L2_uc001wlh.3_Intron|DHRS4L2_uc010tnt.1_Silent_p.L123L|DHRS4L2_uc010alb.2_Silent_p.L74L	NM_198083	NP_932349	D5KJA1	D5KJA1_HUMAN	dehydrogenase/reductase (SDR family) member 4	138							binding|oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)		CCATAGAGCTGGCCCCAAGGA	0.502													18	287	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24877097	24877097	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24877097G>T	uc001wpf.3	+	3	539	c.221G>T	c.(220-222)AGC>ATC	p.S74I		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	74					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						GGCCTGTGCAGCCCAGAGCTG	0.617													30	129	---	---	---	---	PASS
SSTR1	6751	broad.mit.edu	37	14	38679133	38679133	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38679133G>T	uc001wul.1	+	3	1156	c.539G>T	c.(538-540)GGC>GTC	p.G180V	SSTR1_uc010amu.1_Intron	NM_001049	NP_001040	P30872	SSR1_HUMAN	somatostatin receptor 1	180	Helical; Name=4; (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity			central_nervous_system(3)|ovary(1)|lung(1)	5	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)	GTAAACCTGGGCGTGTGGGTG	0.647													28	74	---	---	---	---	PASS
GPHN	10243	broad.mit.edu	37	14	67555743	67555743	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67555743C>T	uc001xiy.2	+	11	2210	c.1089C>T	c.(1087-1089)GAC>GAT	p.D363D	GPHN_uc001xix.2_Silent_p.D396D|GPHN_uc010tss.1_Silent_p.D409D|GPHN_uc010tst.1_Silent_p.D332D|GPHN_uc010tsu.1_Silent_p.D286D	NM_001024218	NP_001019389	Q9NQX3	GEPH_HUMAN	gephyrin isoform 2	363	MPT adenylyltransferase.				Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ATGCAAAAGACAATTTACCCC	0.388			T	MLL	AL								20	64	---	---	---	---	PASS
RPS6KA5	9252	broad.mit.edu	37	14	91369242	91369242	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91369242T>G	uc001xys.2	-	9	1244	c.1029A>C	c.(1027-1029)TTA>TTC	p.L343F	RPS6KA5_uc010twi.1_Missense_Mutation_p.L264F|RPS6KA5_uc001xyt.2_Missense_Mutation_p.L343F|RPS6KA5_uc010att.1_RNA	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5	343	AGC-kinase C-terminal.				axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		TACTCACATCTAATTCATCTC	0.418													33	120	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92480787	92480787	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92480787T>C	uc001xzy.2	-	7	1746	c.958A>G	c.(958-960)AAA>GAA	p.K320E	TRIP11_uc010auf.1_Missense_Mutation_p.K85E	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	320	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		Gataattttttatttatatct	0.279			T	PDGFRB	AML								5	90	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106993807	106993807	+	RNA	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106993807C>A	uc010tyt.1	-	187		c.8640G>T								Parts of antibodies, mostly variable regions.												0						CCTCCCCTCACTGTGTCTCTC	0.572													59	153	---	---	---	---	PASS
OR4N4	283694	broad.mit.edu	37	15	22383115	22383115	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22383115C>T	uc001yuc.1	+	7	1624	c.643C>T	c.(643-645)CTG>TTG	p.L215L	LOC727924_uc001yub.1_Intron|OR4N4_uc010tzv.1_Silent_p.L215L	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCTGGGGCTTCTGGCTTCCTA	0.517													14	119	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42158429	42158429	+	Splice_Site	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42158429T>A	uc001zos.2	-	38	6859	c.6526_splice	c.e38-1	p.K2176_splice		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CTCTCCCTTCTGGAGGGAGAG	0.647													6	18	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54799355	54799355	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54799355C>G	uc002ack.2	+	21	5342	c.5342C>G	c.(5341-5343)TCA>TGA	p.S1781*		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1781					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GCAATTGTATCAAGTGATTTC	0.323													3	26	---	---	---	---	PASS
BNC1	646	broad.mit.edu	37	15	83935686	83935686	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83935686C>A	uc002bjt.1	-	3	425	c.337G>T	c.(337-339)GAC>TAC	p.D113Y	BNC1_uc010uos.1_Missense_Mutation_p.D101Y	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	113					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AAGAGCCGGTCCAGTAGGATT	0.502													18	129	---	---	---	---	PASS
LONP2	83752	broad.mit.edu	37	16	48295410	48295410	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48295410A>T	uc002efi.1	+	5	888	c.799A>T	c.(799-801)AAT>TAT	p.N267Y	LONP2_uc010vgm.1_RNA|LONP2_uc002efj.1_Missense_Mutation_p.N223Y	NM_031490	NP_113678	Q86WA8	LONP2_HUMAN	peroxisomal LON protease-like	267					misfolded or incompletely synthesized protein catabolic process|protein targeting to peroxisome|signal peptide processing	nucleoid|peroxisomal matrix	ATP binding|ATP-dependent peptidase activity|enzyme binding|sequence-specific DNA binding|serine-type endopeptidase activity				0						AGATGAAGATAATGATGACAT	0.338													37	217	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65016007	65016007	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65016007G>A	uc002eoi.2	-	8	1631	c.1197C>T	c.(1195-1197)GGC>GGT	p.G399G	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Silent_p.G399G|CDH11_uc010vin.1_Silent_p.G273G|CDH11_uc002eok.1_RNA	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	399	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CAACCACGGTGCCAGCAGCTG	0.493			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			28	192	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77355045	77355045	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77355045C>A	uc002ffc.3	-	15	2637	c.2218G>T	c.(2218-2220)GTT>TTT	p.V740F	ADAMTS18_uc010chc.1_Missense_Mutation_p.V328F|ADAMTS18_uc002ffe.1_Missense_Mutation_p.V436F	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	740	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						CCTTTGCAAACGCCACAAGCA	0.383													23	182	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77375655	77375655	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77375655C>G	uc002ffc.3	-	11	2075	c.1656G>C	c.(1654-1656)AGG>AGC	p.R552S	ADAMTS18_uc010chc.1_Missense_Mutation_p.R140S|ADAMTS18_uc002ffe.1_Missense_Mutation_p.R248S	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	552	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TGGTCTCACACCTGTGGCCTA	0.398													8	73	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11648345	11648345	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11648345G>T	uc002gne.2	+	31	6411	c.6343G>T	c.(6343-6345)GTT>TTT	p.V2115F	DNAH9_uc010coo.2_Missense_Mutation_p.V1409F	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2115	AAA 2 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CGAAGCTTTGGTTAGGAAGGC	0.517													15	81	---	---	---	---	PASS
TRIM16L	147166	broad.mit.edu	37	17	18634465	18634465	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18634465G>A	uc002gug.1	+	8	971	c.284G>A	c.(283-285)CGC>CAC	p.R95H	TRIM16L_uc010vyf.1_Missense_Mutation_p.R149H|TRIM16L_uc002guh.1_Missense_Mutation_p.R95H|TRIM16L_uc010cqg.1_Missense_Mutation_p.R197H|TRIM16L_uc002gui.1_Missense_Mutation_p.R95H|TRIM16L_uc010vyg.1_Missense_Mutation_p.R95H|TRIM16L_uc010vyh.1_Intron	NM_001037330	NP_001032407	Q309B1	TR16L_HUMAN	tripartite motif-containing 16-like	95						cytoplasm					0						TCGGGCATCCGCAAAGTTATC	0.443													4	125	---	---	---	---	PASS
JUP	3728	broad.mit.edu	37	17	39767095	39767095	+	Intron	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39767095G>C	uc010wfs.1	-						KRT16_uc002hxg.3_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GCTGTGCTGGGTCCTTCATAC	0.592													21	99	---	---	---	---	PASS
HOXB7	3217	broad.mit.edu	37	17	46685369	46685369	+	Silent	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46685369C>A	uc002inv.2	-	2	592	c.489G>T	c.(487-489)ACG>ACT	p.T163T		NM_004502	NP_004493	P09629	HXB7_HUMAN	homeobox B7	163	Homeobox.					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCCGCCGCCGCGTCAGGTAGC	0.557													15	149	---	---	---	---	PASS
HOXB7	3217	broad.mit.edu	37	17	46685422	46685422	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46685422G>A	uc002inv.2	-	2	539	c.436C>T	c.(436-438)CGC>TGC	p.R146C		NM_004502	NP_004493	P09629	HXB7_HUMAN	homeobox B7	146	Homeobox.					nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTCTGGTAGCGGGTGTAGGTC	0.507													9	109	---	---	---	---	PASS
CSH1	1442	broad.mit.edu	37	17	61972734	61972734	+	Intron	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61972734C>T	uc002jcs.1	-						CSH2_uc002jck.2_Intron|CSH1_uc002jcp.1_Intron|CSH1_uc002jcq.1_Intron|CSH1_uc002jcr.1_3'UTR|CSH1_uc002jct.1_Intron|CSH1_uc002jcu.1_Silent_p.L185L|CSH1_uc002jcv.1_Intron|CSH1_uc002jcw.2_Intron|CSH1_uc002jcy.2_3'UTR	NM_001317	NP_001308	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 1 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding			skin(1)	1						TCTCTTGGGTCAGCGCCTTAC	0.547									Russell-Silver_syndrome				17	193	---	---	---	---	PASS
GH1	2688	broad.mit.edu	37	17	61995185	61995185	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61995185C>T	uc002jdj.2	-	4	453	c.391G>A	c.(391-393)GCC>ACC	p.A131T	GH1_uc002jdi.2_Missense_Mutation_p.A116T|GH1_uc002jdk.2_Missense_Mutation_p.A91T|GH1_uc002jdl.2_Intron|GH1_uc002jdm.2_Intron|GH1_uc002jdn.2_Intron	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1	131					glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						CTGTCAGAGGCGCCGTACACC	0.612													21	106	---	---	---	---	PASS
SLC39A11	201266	broad.mit.edu	37	17	71027694	71027694	+	Splice_Site	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71027694C>A	uc002jjb.2	-	4	421	c.306_splice	c.e4+1	p.L102_splice	SLC39A11_uc002jja.2_Splice_Site_p.L102_splice|SLC39A11_uc002jjc.1_Splice_Site_p.L102_splice	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						GTGGTACTCACCAAGTGAGGC	0.493													6	74	---	---	---	---	PASS
ASPSCR1	79058	broad.mit.edu	37	17	79974718	79974718	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79974718C>T	uc002kcx.2	+	14	1545	c.1448C>T	c.(1447-1449)CCA>CTA	p.P483L	ASPSCR1_uc002kcw.1_Missense_Mutation_p.P483L|ASPSCR1_uc002kcy.2_Missense_Mutation_p.P577L|ASPSCR1_uc002kcz.2_Missense_Mutation_p.P377L|ASPSCR1_uc002kda.2_Missense_Mutation_p.P431L	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,	483							protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GCCATCTCCCCATCTGCGGCC	0.662			T	TFE3	alveolar soft part sarcoma								4	38	---	---	---	---	PASS
ATP8B1	5205	broad.mit.edu	37	18	55355660	55355660	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55355660C>A	uc002lgw.2	-	12	1300	c.1300G>T	c.(1300-1302)GCA>TCA	p.A434S	uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1	434	Cytoplasmic (Potential).				ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				CTAGCTTTTGCGGGTGTGTCC	0.443									Byler_disease				40	187	---	---	---	---	PASS
EMR1	2015	broad.mit.edu	37	19	6897289	6897289	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6897289G>T	uc002mfw.2	+	4	406	c.368G>T	c.(367-369)GGA>GTA	p.G123V	EMR1_uc010dvc.2_Missense_Mutation_p.G123V|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Missense_Mutation_p.G123V	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	123	Extracellular (Potential).|EGF-like 2; calcium-binding (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					TGGGTCCCAGGAAAGCCGGGC	0.498													25	81	---	---	---	---	PASS
LRRC8E	80131	broad.mit.edu	37	19	7965541	7965541	+	Nonsense_Mutation	SNP	G	T	T	rs149479952		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7965541G>T	uc002mir.2	+	3	2235	c.2134G>T	c.(2134-2136)GAG>TAG	p.E712*		NM_025061	NP_079337	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member	712	LRR 9.					integral to membrane				lung(1)|pancreas(1)	2						CAATGCCCTGGAGGCCCTGCC	0.647													4	121	---	---	---	---	PASS
HNRNPM	4670	broad.mit.edu	37	19	8550883	8550883	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8550883G>A	uc010dwe.2	+	14	1651	c.1571G>A	c.(1570-1572)CGC>CAC	p.R524H	HNRNPM_uc010xke.1_Missense_Mutation_p.R470H|HNRNPM_uc010dwd.2_Missense_Mutation_p.R485H|HNRNPM_uc002mka.2_Missense_Mutation_p.R389H|HNRNPM_uc002mkb.1_5'Flank	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	524	17.|27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						GCCATCGAGCGCATGGGCCTG	0.697													4	95	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9063188	9063188	+	Silent	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9063188T>A	uc002mkp.2	-	3	24462	c.24258A>T	c.(24256-24258)CCA>CCT	p.P8086P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8088	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TAATAACCATTGGAGATGTGA	0.473													20	93	---	---	---	---	PASS
DDA1	79016	broad.mit.edu	37	19	17426741	17426741	+	Splice_Site	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17426741A>T	uc002ngd.2	+	4	264	c.137_splice	c.e4-2	p.I46_splice	DDA1_uc002nge.2_Splice_Site	NM_024050	NP_076955	Q9BW61	DDA1_HUMAN	DET1 and DDB1 associated 1											ovary(1)	1						TTTCCTCCTTAGTCATCGTGA	0.527													109	474	---	---	---	---	PASS
KIAA1683	80726	broad.mit.edu	37	19	18377695	18377695	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18377695T>C	uc002nin.2	-	3	871	c.655A>G	c.(655-657)ACC>GCC	p.T219A	KIAA1683_uc010ebn.2_Missense_Mutation_p.T219A|KIAA1683_uc010xqe.1_Missense_Mutation_p.T173A	NM_025249	NP_079525	Q9H0B3	K1683_HUMAN	KIAA1683 isoform b	219						mitochondrion				ovary(2)	2						GGCTCTGGGGTACCCTGAGCT	0.627													22	48	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155926	22155926	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155926T>C	uc002nqp.2	-	5	1759	c.1610A>G	c.(1609-1611)TAC>TGC	p.Y537C	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTACATTTGTAGGGCTTCTC	0.398													24	115	---	---	---	---	PASS
GRAMD1A	57655	broad.mit.edu	37	19	35505200	35505200	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35505200C>T	uc010xse.1	+	10	1115	c.978C>T	c.(976-978)GAC>GAT	p.D326D	GRAMD1A_uc002nxi.1_Silent_p.D413D|GRAMD1A_uc002nxk.2_Silent_p.D319D|GRAMD1A_uc002nxl.2_Silent_p.D92D|GRAMD1A_uc010xsf.1_Silent_p.D331D|GRAMD1A_uc002nxm.1_RNA|GRAMD1A_uc002nxn.1_5'Flank	NM_020895	NP_065946	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A isoform 1	326						integral to membrane					0	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CCCAGCCTGACGGGCCCACCA	0.632													8	192	---	---	---	---	PASS
AKT2	208	broad.mit.edu	37	19	40761067	40761067	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40761067C>T	uc002onf.2	-	4	547	c.285G>A	c.(283-285)GAG>GAA	p.E95E	AKT2_uc010egs.2_Silent_p.E95E|AKT2_uc010egt.2_Silent_p.E33E|AKT2_uc010xvj.1_Silent_p.E33E|AKT2_uc010egu.1_Silent_p.E33E|AKT2_uc010xvk.1_Silent_p.E95E	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase	95	PH.				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			AGACTGACCTCTCGTCTGGAG	0.567			A		ovarian|pancreatic 								9	141	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46357737	46357737	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46357737C>T	uc002pdn.2	-	2	262	c.17G>A	c.(16-18)GGA>GAA	p.G6E	SYMPK_uc002pdo.1_Missense_Mutation_p.G6E|SYMPK_uc002pdp.1_Missense_Mutation_p.G6E|SYMPK_uc002pdq.1_Missense_Mutation_p.G6E	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	6	Interaction with HSF1.				cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GACGCTGTCTCCACTGCCGCT	0.617													6	66	---	---	---	---	PASS
CEACAM18	729767	broad.mit.edu	37	19	51981926	51981926	+	Silent	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51981926G>T	uc002pwv.1	+	2	213	c.213G>T	c.(211-213)CTG>CTT	p.L71L		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	71						integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GATGGAGCCTGTGGAGGAGGG	0.627													5	55	---	---	---	---	PASS
LILRB3	11025	broad.mit.edu	37	19	54724576	54724576	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54724576C>T	uc002qef.1	-	6	1191	c.1080G>A	c.(1078-1080)GGG>GGA	p.G360G	LILRB3_uc002qee.1_Silent_p.G360G|LILRB3_uc002qeh.1_Silent_p.G360G|LILRB3_uc002qeg.1_RNA|LILRB3_uc002qei.1_Silent_p.G360G|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Silent_p.G360G|LILRB3_uc002qej.1_RNA|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Silent_p.G360G|LILRB3_uc002qep.1_Silent_p.G360G|LILRB3_uc002qeq.1_Silent_p.G360G|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Silent_p.G360G|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855	O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor,	360	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GATGGGCTGCCCCTTCTTTGG	0.582													13	52	---	---	---	---	PASS
KIR2DL3	3804	broad.mit.edu	37	19	55263135	55263135	+	Silent	SNP	C	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55263135C>G	uc002qgv.2	+	6	768	c.750C>G	c.(748-750)ACC>ACG	p.T250T	KIR2DL3_uc002qgx.2_Silent_p.T250T|KIR2DL3_uc002qgy.2_Silent_p.T152T|KIR2DL3_uc010erw.1_Silent_p.T250T|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two	250	Helical; (Potential).				immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		TGATTGGGACCTCAGTGGtca	0.378													6	204	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56544154	56544154	+	Intron	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56544154C>A	uc002qmj.2	+						NLRP5_uc002qmi.2_Intron	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5							mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TGATGTAAGGCTGCCCGCCCC	0.597													46	158	---	---	---	---	PASS
ZNF211	10520	broad.mit.edu	37	19	58152510	58152510	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58152510C>T	uc002qpq.2	+	3	836	c.656C>T	c.(655-657)GCG>GTG	p.A219V	ZNF211_uc010yhb.1_Missense_Mutation_p.A223V|ZNF211_uc002qpp.2_Missense_Mutation_p.A232V|ZNF211_uc002qpr.2_Missense_Mutation_p.A283V|ZNF211_uc002qps.2_Missense_Mutation_p.A284V|ZNF211_uc002qpt.2_Missense_Mutation_p.A231V|ZNF211_uc010yhc.1_Missense_Mutation_p.A231V|ZNF211_uc010yhd.1_Missense_Mutation_p.A158V|ZNF211_uc010yhe.1_Missense_Mutation_p.A210V	NM_198855	NP_942152	Q13398	ZN211_HUMAN	zinc finger protein 211 isoform 2	219						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AACAAGTGTGCGGTGGCCTTT	0.473													22	101	---	---	---	---	PASS
PROKR2	128674	broad.mit.edu	37	20	5294767	5294767	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5294767C>A	uc010zqw.1	-	1	249	c.249G>T	c.(247-249)AAG>AAT	p.K83N	PROKR2_uc010zqx.1_Missense_Mutation_p.K83N|PROKR2_uc010zqy.1_Missense_Mutation_p.K83N|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	83	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GGTTGCGCAACTTCTTATAGC	0.547										HNSCC(71;0.22)			25	89	---	---	---	---	PASS
CST9L	128821	broad.mit.edu	37	20	23546727	23546727	+	Intron	SNP	A	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23546727A>G	uc002wtk.3	-							NM_080610	NP_542177	Q9H4G1	CST9L_HUMAN	cystatin 9-like precursor							extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GACTCCACCTATTGCACACAG	0.458													20	167	---	---	---	---	PASS
TM9SF4	9777	broad.mit.edu	37	20	30747829	30747829	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30747829G>T	uc002wxj.2	+	16	1839	c.1604G>T	c.(1603-1605)GGC>GTC	p.G535V	TM9SF4_uc010zts.1_Missense_Mutation_p.G442V|TM9SF4_uc002wxk.2_Missense_Mutation_p.G518V|TM9SF4_uc010gdz.2_Missense_Mutation_p.G414V	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	535						integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TACCTCTTTGGCTTCCTGTTC	0.532													23	78	---	---	---	---	PASS
TP53TG5	27296	broad.mit.edu	37	20	44004180	44004180	+	Silent	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44004180G>A	uc002xny.2	-	4	348	c.267C>T	c.(265-267)GCC>GCT	p.A89A	SYS1_uc002xnw.1_3'UTR|SYS1-DBNDD2_uc002xnx.2_Intron	NM_014477	NP_055292	Q9Y2B4	T53G5_HUMAN	TP53-target gene 5 protein	89					intracellular signal transduction|negative regulation of cell growth	cytoplasm|nucleus				central_nervous_system(1)	1						TTTTATTGCAGGCACTGTTTT	0.522													22	206	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50769440	50769440	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50769440C>T	uc002xwl.2	-	6	1640	c.1291G>A	c.(1291-1293)GAT>AAT	p.D431N	ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Missense_Mutation_p.D429N|ZFP64_uc002xwn.2_Missense_Mutation_p.D377N	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	431	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						AAGGAGGCATCGCATATATCG	0.562													7	61	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19770581	19770581	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19770581T>A	uc002ykw.2	-	2	242	c.211A>T	c.(211-213)AAT>TAT	p.N71Y		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	71	Extracellular (Potential).|SEA.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AAATTAGGATTATATGTAACT	0.358													25	94	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18028975	18028975	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18028975C>A	uc010gqw.1	+	16	4058	c.3932C>A	c.(3931-3933)TCA>TAA	p.S1311*	CECR2_uc010gqv.1_Nonsense_Mutation_p.S1169*|CECR2_uc002zml.2_Nonsense_Mutation_p.S1170*|CECR2_uc002zmo.2_RNA	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	1353					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		GGATTTGGTTCATCTGCATTT	0.572													57	122	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18028976	18028976	+	Silent	SNP	A	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18028976A>T	uc010gqw.1	+	16	4059	c.3933A>T	c.(3931-3933)TCA>TCT	p.S1311S	CECR2_uc010gqv.1_Silent_p.S1169S|CECR2_uc002zml.2_Silent_p.S1170S|CECR2_uc002zmo.2_RNA	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	1353					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		GATTTGGTTCATCTGCATTTC	0.572													57	121	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22385737	22385737	+	RNA	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22385737C>T	uc011aim.1	+	2		c.217C>T			uc002zvu.2_Intron					Parts of antibodies, mostly variable regions.												0						TGATGGCAGCCACAGCAAGGG	0.602													21	68	---	---	---	---	PASS
SH3BP1	23616	broad.mit.edu	37	22	38043285	38043285	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38043285T>C	uc003ati.2	+	12	1159	c.1048T>C	c.(1048-1050)TCC>CCC	p.S350P	SH3BP1_uc003atg.1_RNA|SH3BP1_uc011anl.1_Missense_Mutation_p.S350P|SH3BP1_uc003ath.1_Missense_Mutation_p.S350P|SH3BP1_uc003atj.1_Missense_Mutation_p.S286P|SH3BP1_uc003atk.1_Missense_Mutation_p.S264P|uc003atl.1_Intron	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	350	Rho-GAP.				signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					TGCCCTCAAGTCCTATCTGCG	0.622													17	235	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40814895	40814895	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40814895G>A	uc003ayv.1	-	9	1754	c.1547C>T	c.(1546-1548)GCG>GTG	p.A516V	MKL1_uc003ayw.1_Missense_Mutation_p.A516V|MKL1_uc010gye.1_Missense_Mutation_p.A516V|MKL1_uc010gyf.1_Missense_Mutation_p.A466V	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	516	Potential.				positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CTCTAGCTCCGCCCGCCCCCC	0.682			T	RBM15	acute megakaryocytic leukemia								26	39	---	---	---	---	PASS
MKL1	57591	broad.mit.edu	37	22	40816853	40816853	+	Silent	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40816853T>C	uc003ayv.1	-	7	1086	c.879A>G	c.(877-879)CCA>CCG	p.P293P	MKL1_uc003ayw.1_Silent_p.P293P|MKL1_uc010gye.1_Silent_p.P293P|MKL1_uc010gyf.1_Silent_p.P243P	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	293					positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GTGCCTACTTTGGCGGGGCAG	0.637			T	RBM15	acute megakaryocytic leukemia								14	32	---	---	---	---	PASS
SHOX	6473	broad.mit.edu	37	X	591828	591828	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:591828T>A	uc004cph.1	+	2	887	c.196T>A	c.(196-198)TGC>AGC	p.C66S	SHOX_uc004cpi.2_Missense_Mutation_p.C66S	NM_000451	NP_000442	O15266	SHOX_HUMAN	short stature homeobox isoform SHOXa	66					skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGGCGGCCACTGCCCGGTGCA	0.592													7	97	---	---	---	---	PASS
SHOX	6473	broad.mit.edu	37	X	601573	601573	+	Silent	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:601573G>T	uc004cph.1	+	4	1195	c.504G>T	c.(502-504)CGG>CGT	p.R168R	SHOX_uc004cpi.2_Silent_p.R168R	NM_000451	NP_000442	O15266	SHOX_HUMAN	short stature homeobox isoform SHOXa	168	Homeobox.		R -> W (in LMD).		skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCCAGAACCGGAGAGCCAAGT	0.592													18	151	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31893457	31893457	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31893457T>C	uc004dda.1	-	48	7190	c.6946A>G	c.(6946-6948)ATT>GTT	p.I2316V	DMD_uc004dcr.1_5'UTR|DMD_uc004dcs.1_5'UTR|DMD_uc004dct.1_5'UTR|DMD_uc004dcu.1_5'UTR|DMD_uc004dcv.1_5'UTR|DMD_uc004dcw.2_Missense_Mutation_p.I972V|DMD_uc004dcx.2_Missense_Mutation_p.I975V|DMD_uc004dcz.2_Missense_Mutation_p.I2193V|DMD_uc004dcy.1_Missense_Mutation_p.I2312V|DMD_uc004ddb.1_Missense_Mutation_p.I2308V|DMD_uc010ngn.1_RNA	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2316	Spectrin 16.		Missing (in DMD).		muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGAGCTTCAATTTCTCCTTGT	0.343													12	20	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132161178	132161178	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132161178C>T	uc010nrm.1	-	6	1541	c.1071G>A	c.(1069-1071)AAG>AAA	p.K357K	USP26_uc011mvf.1_Silent_p.K357K	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	357					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					GTAACATCTCCTTGATTTCTA	0.383													32	74	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135441478	135441478	+	Silent	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135441478C>T	uc004ezu.1	+	11	7299	c.7008C>T	c.(7006-7008)GCC>GCT	p.A2336A	GPR112_uc010nsb.1_Silent_p.A2131A|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2336	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TCATAAAAGCCAGCTCTTCCT	0.373													38	161	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152826170	152826170	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152826170C>T	uc004fht.1	+	17	3002	c.2876C>T	c.(2875-2877)GCG>GTG	p.A959V	ATP2B3_uc004fhs.1_Missense_Mutation_p.A959V|ATP2B3_uc010nuf.1_5'UTR|ATP2B3_uc004fhu.1_5'Flank	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	959	Extracellular (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGAGGAATGCGCCCCTGCAC	0.562													13	38	---	---	---	---	PASS
ATP2B3	492	broad.mit.edu	37	X	152826171	152826171	+	Silent	SNP	G	C	C			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152826171G>C	uc004fht.1	+	17	3003	c.2877G>C	c.(2875-2877)GCG>GCC	p.A959A	ATP2B3_uc004fhs.1_Silent_p.A959A|ATP2B3_uc010nuf.1_5'UTR|ATP2B3_uc004fhu.1_5'Flank	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	959	Extracellular (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGAGGAATGCGCCCCTGCACT	0.562													13	37	---	---	---	---	PASS
VAMP7	6845	broad.mit.edu	37	X	155149501	155149501	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155149501G>T	uc004fnr.2	+	6	632	c.458G>T	c.(457-459)AGA>ATA	p.R153I	VAMP7_uc004fnt.2_Missense_Mutation_p.R112I|VAMP7_uc011naa.1_Missense_Mutation_p.R114I|VAMP7_uc011nab.1_Missense_Mutation_p.R52I|VAMP7_uc004fns.2_Intron|VAMP7_uc011nac.1_Missense_Mutation_p.R86I	NM_005638	NP_005629	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7 isoform 1	153	v-SNARE coiled-coil homology.|Cytoplasmic (Potential).				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGAGGAGAAAGATTGGAATTA	0.303													21	161	---	---	---	---	PASS
FAM131C	348487	broad.mit.edu	37	1	16386305	16386306	+	Intron	INS	-	C	C	rs143272992		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16386305_16386306insC	uc001axz.3	-						FAM131C_uc010obz.1_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487												0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGTGATCTGGGCCCCCAAGGAC	0.599													6	3	---	---	---	---	
FMO3	2328	broad.mit.edu	37	1	171083037	171083038	+	Intron	INS	-	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171083037_171083038insA	uc001ghi.2	+						FMO3_uc001ghh.2_Intron|FMO3_uc010pmb.1_Intron|FMO3_uc010pmc.1_Intron	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3						xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CTATGCCTCAGAAAAAAAAAAT	0.342													4	2	---	---	---	---	
NR5A2	2494	broad.mit.edu	37	1	200143065	200143066	+	Intron	DEL	TT	-	-	rs72238192		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200143065_200143066delTT	uc001gvb.2	+						NR5A2_uc001gvc.2_Intron|NR5A2_uc009wzh.2_Intron|NR5A2_uc010pph.1_Intron	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2						embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					GAAATGTTGCtttttttttttt	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	201235502	201235505	+	IGR	DEL	TTCC	-	-	rs71904187		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201235502_201235505delTTCC								IGFN1 (37429 upstream) : PKP1 (17075 downstream)																							cctcacttctttccttccttcctt	0.000													4	2	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233424551	233424552	+	Intron	DEL	TT	-	-	rs10558976		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233424551_233424552delTT	uc001hvl.2	-							NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				AAAGATGCCCtttttttttttt	0.356													4	2	---	---	---	---	
GCC2	9648	broad.mit.edu	37	2	109085655	109085658	+	Intron	DEL	AAAG	-	-	rs71980528		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109085655_109085658delAAAG	uc002tec.2	+						GCC2_uc002ted.2_Intron	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2						Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						taatataaaCAAAGAAACCGAGAT	0.245													2	5	---	---	---	---	
C2orf77	129881	broad.mit.edu	37	2	170512899	170512901	+	Intron	DEL	GAG	-	-	rs13412021		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170512899_170512901delGAG	uc002ufe.2	-							NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881												0						agaggaggaagaggaggaggagg	0.000													4	2	---	---	---	---	
WDR75	84128	broad.mit.edu	37	2	190320338	190320338	+	Intron	DEL	T	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190320338delT	uc002uql.1	+						WDR75_uc002uqm.1_Intron|WDR75_uc002uqn.1_Intron|WDR75_uc002uqo.1_5'Flank	NM_032168	NP_115544	Q8IWA0	WDR75_HUMAN	WD repeat domain 75							nucleolus				ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			ATGGTATAGATTTTTTTAGGA	0.299													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	202919066	202919081	+	IGR	DEL	AGAAGGAAGGAAGGAG	-	-	rs7575134	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202919066_202919081delAGAAGGAAGGAAGGAG								FZD7 (15906 upstream) : SUMO1 (151822 downstream)																							aaaggaagaaagaaggaaggaaggagagaaggaagg	0.130													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32647937	32647938	+	IGR	INS	-	A	A	rs34405029		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32647937_32647938insA								DYNC1LI1 (35587 upstream) : CNOT10 (78760 downstream)																							aggaaggaaggaggaaggaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32677112	32677112	+	IGR	DEL	A	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32677112delA								DYNC1LI1 (64762 upstream) : CNOT10 (49586 downstream)																							AGGACGCGAGAAAAAAAAAAG	0.289													3	3	---	---	---	---	
OR5K2	402135	broad.mit.edu	37	3	98216382	98216383	+	5'Flank	INS	-	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98216382_98216383insA	uc011bgx.1	+							NM_001004737	NP_001004737	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						CGCAGTGAATTGGGCATGCACC	0.386													7	4	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176771834	176771837	+	Intron	DEL	GTGT	-	-	rs138539758		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176771834_176771837delGTGT	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron|TBL1XR1_uc003fiy.2_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			GACGAAGGTCgtgtgtgtgtgtgt	0.255													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25497611	25497612	+	IGR	INS	-	CTTT	CTTT	rs144415784	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25497611_25497612insCTTT								ANAPC4 (77492 upstream) : SLC34A2 (159823 downstream)																							ttccttccttccttccttcctt	0.040													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49101467	49101467	+	IGR	DEL	C	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49101467delC								CWH43 (37374 upstream) : None (None downstream)																							ccattccattccattcctttc	0.000													4	2	---	---	---	---	
IGJ	3512	broad.mit.edu	37	4	71521932	71521932	+	3'UTR	DEL	A	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71521932delA	uc003hfn.3	-	4					IGJ_uc010ihz.2_3'UTR	NM_144646	NP_653247	P01591	IGJ_HUMAN	immunoglobulin J chain						immune response	extracellular region	antigen binding				0			Lung(101;0.235)			TACATCACCCAAAAAAAAAAA	0.308													5	3	---	---	---	---	
MTTP	4547	broad.mit.edu	37	4	100542573	100542573	+	Intron	DEL	A	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100542573delA	uc003hvc.3	+						MTTP_uc011cej.1_Intron	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large						lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	CTGGGATACCAAAAAAAAATC	0.299													7	4	---	---	---	---	
LRBA	987	broad.mit.edu	37	4	151642666	151642666	+	Intron	DEL	T	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151642666delT	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					AAGAACTGGGTTTTTTTTTTT	0.284													6	3	---	---	---	---	
CCDC111	201973	broad.mit.edu	37	4	185613052	185613052	+	Intron	DEL	T	-	-	rs10567357		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185613052delT	uc003iwk.2	+						CCDC111_uc003iwj.2_Intron|CCDC111_uc003iwl.2_Intron|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_Intron	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111						DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		aatacaaaccttttttttttt	0.025													3	3	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGGGACACACGGGGCGGGGACT	0.668													10	6	---	---	---	---	
ADAMTS16	170690	broad.mit.edu	37	5	5232302	5232302	+	Intron	DEL	A	-	-	rs10713189		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5232302delA	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TTGGGTAAGGAAAAAAAAAAC	0.363													6	3	---	---	---	---	
MIER3	166968	broad.mit.edu	37	5	56224818	56224819	+	Intron	INS	-	CTCACACACACA	CTCACACACACA	rs146870702		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56224818_56224819insCTCACACACACA	uc003jrd.1	-						MIER3_uc003jqz.1_Intron|MIER3_uc003jra.1_Intron|MIER3_uc003jrb.1_Intron|MIER3_uc003jrc.1_Intron	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		actctctctctcacacacacac	0.233													5	4	---	---	---	---	
PDE8B	8622	broad.mit.edu	37	5	76521700	76521712	+	Intron	DEL	CACACACCCCACG	-	-	rs139710458	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76521700_76521712delCACACACCCCACG	uc003kfa.2	+						PDE8B_uc003kfb.2_Intron|PDE8B_uc003kfc.2_Intron|PDE8B_uc003kfd.2_Intron|PDE8B_uc003kfe.2_Intron	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		cacacacacacacacaccccacgcacacaTCTC	0.286													4	3	---	---	---	---	
NUDT12	83594	broad.mit.edu	37	5	102886822	102886823	+	Intron	INS	-	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102886822_102886823insT	uc003koi.2	-						NUDT12_uc011cvb.1_Intron	NM_031438	NP_113626	Q9BQG2	NUD12_HUMAN	nudix-type motif 12							nucleus|peroxisome	metal ion binding|NAD+ diphosphatase activity				0		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		TACATGCAAAGttttttttttt	0.139													4	2	---	---	---	---	
DMXL1	1657	broad.mit.edu	37	5	118463045	118463046	+	Intron	DEL	TT	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118463045_118463046delTT	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron|DMXL1_uc003ksc.1_Intron	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCCTTTATCCtttttttttttt	0.317													6	3	---	---	---	---	
C6orf218	221718	broad.mit.edu	37	6	10430699	10430701	+	Intron	DEL	TTT	-	-	rs139837855		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430699_10430701delTTT	uc003myz.2	-							NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				CTCTGACTAGttttttttttttt	0.202													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15710434	15710437	+	IGR	DEL	CTTT	-	-	rs12191708		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15710434_15710437delCTTT								DTNBP1 (47163 upstream) : MYLIP (418880 downstream)																							tccttccttcctttcttcctttct	0.088													5	3	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21805229	21805246	+	Intron	DEL	CACACACACACACACACA	-	-	rs71837859	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21805229_21805246delCACACACACACACACACA	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CAGCCTGCGTcacacacacacacacacacacacacaca	0.385									Kartagener_syndrome				10	5	---	---	---	---	
RAPGEF5	9771	broad.mit.edu	37	7	22194363	22194364	+	Intron	INS	-	T	T	rs150777301	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22194363_22194364insT	uc003svg.2	-						RAPGEF5_uc011jyl.1_Intron	NM_012294	NP_036426	Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5						nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1						ACAGAGTTAGATTTTTTATATA	0.386													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56357562	56357563	+	IGR	INS	-	AAA	AAA			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56357562_56357563insAAA								PSPH (173472 upstream) : DKFZp434L192 (206353 downstream)																							gactccatctcaaaaaaaaaaa	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	68046478	68046481	+	IGR	DEL	GAAG	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68046478_68046481delGAAG								None (None upstream) : None (None downstream)																							agggagggaagaaggaaggaagga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100608467	100608468	+	Intron	INS	-	T	T	rs139602002	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100608467_100608468insT	uc003uxl.1	+						uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_5'Flank					SubName: Full=Intestinal mucin; Flags: Fragment;																		AGGGAGAGACCTTTGCGGGAGG	0.624													6	3	---	---	---	---	
ASZ1	136991	broad.mit.edu	37	7	117020837	117020838	+	Intron	INS	-	AAAAAC	AAAAAC	rs147516910	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117020837_117020838insAAAAAC	uc003vjb.2	-						ASZ1_uc011kno.1_Intron|ASZ1_uc011knp.1_Intron	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper						cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GACAATCTGAAAAAAACAAAAA	0.282													5	3	---	---	---	---	
GDAP1	54332	broad.mit.edu	37	8	75275006	75275007	+	Intron	INS	-	CT	CT	rs140955331	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75275006_75275007insCT	uc003yah.2	+						GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Intron	NM_018972	NP_061845	Q8TB36	GDAP1_HUMAN	ganglioside-induced differentiation-associated							cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CTTCAACTTAGCTCTCTCTCTC	0.411													4	3	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14803313	14803314	+	Intron	INS	-	TCCCCTCCCC	TCCCCTCCCC	rs141611687	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14803313_14803314insTCCCCTCCCC	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		tctttttcttttcccctcccct	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68417570	68417571	+	IGR	INS	-	AA	AA	rs111263548		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68417570_68417571insAA								FAM27B (623381 upstream) : MIR1299 (584668 downstream)																							AGGATAGGAATAAAACATCAGT	0.243													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	133833997	133833999	+	IGR	DEL	CAG	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133833997_133833999delCAG								FIBCD1 (19542 upstream) : LAMC3 (50505 downstream)																							ccatcaccaccagcaccaccacc	0.000													4	2	---	---	---	---	
CACNA1B	774	broad.mit.edu	37	9	141015240	141015241	+	Frame_Shift_Ins	INS	-	T	T			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141015240_141015241insT	uc004cog.2	+	45	6541_6542	c.6396_6397insT	c.(6394-6399)CGCTTTfs	p.R2132fs	CACNA1B_uc004coi.2_Frame_Shift_Ins_p.R1344fs	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	2132_2133	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CCTGCGACCGCTTTGGGGGCCG	0.708													4	2	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51623014	51623015	+	Intron	INS	-	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51623014_51623015insA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|uc010qhh.1_5'Flank|uc001jiu.2_Intron|uc010qhg.1_Intron|uc009xop.2_5'Flank	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		TGCCAGCAAGGAAAAAAAAAAC	0.455													6	3	---	---	---	---	
JAKMIP3	282973	broad.mit.edu	37	10	133961636	133961637	+	Intron	INS	-	TGAACA	TGAACA	rs141683861	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133961636_133961637insTGAACA	uc001lkx.3	+						JAKMIP3_uc009yba.1_Intron	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		ACACAAAGCCCtgaacatgaac	0.495													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	384186	384186	+	IGR	DEL	T	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:384186delT								B4GALNT4 (2070 upstream) : PKP3 (10031 downstream)																							cgtgactgcgtttctaagcag	0.199													4	2	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26584943	26584952	+	Intron	DEL	TGTGTGTGTG	-	-	rs61877025		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26584943_26584952delTGTGTGTGTG	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Intron|MUC15_uc001mqx.2_Intron|MUC15_uc001mqy.2_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTTCTCTCTCtgtgtgtgtgtgtgtgtgtg	0.229													4	3	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76891308	76891309	+	Intron	INS	-	CTGCCAAATTATTTGG	CTGCCAAATTATTTGG	rs140333333	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76891308_76891309insCTGCCAAATTATTTGG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						ACTTGTCCTATCAAAGTCATGC	0.554													4	2	---	---	---	---	
PCF11	51585	broad.mit.edu	37	11	82875029	82875029	+	Intron	DEL	A	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82875029delA	uc001ozx.3	+						PCF11_uc010rsu.1_Intron	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11						mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						GTTCAATTTGAAAAAAAAAAA	0.254													4	2	---	---	---	---	
EED	8726	broad.mit.edu	37	11	85975481	85975482	+	Intron	INS	-	TATT	TATT	rs138959322	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85975481_85975482insTATT	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788	O75530	EED_HUMAN	embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				AGTAAAGACtatatttatttat	0.312													5	4	---	---	---	---	
NCAM1	4684	broad.mit.edu	37	11	112832392	112832392	+	Intron	DEL	T	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112832392delT	uc009yyq.1	+						NCAM1_uc001pno.2_Intron|uc001pnn.2_Intron	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TGCAGGTACATTTTTTTTTTT	0.413													7	4	---	---	---	---	
POTEG	404785	broad.mit.edu	37	14	19554007	19554008	+	Intron	INS	-	G	G			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19554007_19554008insG	uc001vuz.1	+						POTEG_uc001vva.1_Intron|POTEG_uc010ahc.1_Intron	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											ovary(1)	1						CTGGCGGGGGAGGAGGGGAGCC	0.594													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22118556	22118559	+	IGR	DEL	AATA	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22118556_22118559delAATA								CXADRP2 (101678 upstream) : LOC727924 (159473 downstream)																							TTGTAATAAGAATATATAGCTCAA	0.324													13	10	---	---	---	---	
AGBL1	123624	broad.mit.edu	37	15	86923462	86923463	+	Intron	INS	-	CCTG	CCTG	rs113927338		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86923462_86923463insCCTG	uc002blz.1	+							NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						tcattccctcccctgcctgcct	0.144													4	2	---	---	---	---	
NR2F2	7026	broad.mit.edu	37	15	96881005	96881005	+	3'UTR	DEL	A	-	-	rs34678417		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96881005delA	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TGTGAATTTCAAAAAAAAAAA	0.289													3	6	---	---	---	---	
N4BP1	9683	broad.mit.edu	37	16	48579938	48579939	+	Intron	INS	-	A	A			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48579938_48579939insA	uc002efp.2	-							NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				gaccttgtctcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1387740	1387754	+	Intron	DEL	GGGCCTGGGTGCTGA	-	-	rs71886519		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1387740_1387754delGGGCCTGGGTGCTGA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGGGTGCGGGGGGCCTGGGTGCTGAGGGCCTGGGT	0.698													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25289230	25289233	+	IGR	DEL	TCTA	-	-	rs138697975		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25289230_25289233delTCTA								None (None upstream) : WSB1 (331873 downstream)																							GTTTGTTACCTCTATCTATTGACT	0.343													6	3	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26684394	26684395	+	Splice_Site	INS	-	G	G	rs113730440		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26684394_26684395insG	uc002haz.2	-	2	210	c.78_splice	c.e2+1	p.W26_splice	POLDIP2_uc010wag.1_RNA|TMEM199_uc002hba.2_5'Flank|SARM1_uc010wah.1_5'Flank	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AGAGCGGCTTTGCCACCGGGCC	0.762													4	3	---	---	---	---	
RPL23	9349	broad.mit.edu	37	17	37006922	37006923	+	Intron	DEL	TT	-	-	rs34258429		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37006922_37006923delTT	uc002hqx.1	-						RPL23_uc002hqw.1_Intron|RPL23_uc002hqy.1_3'UTR	NM_000978	NP_000969	P62829	RL23_HUMAN	ribosomal protein L23						endocrine pancreas development|ribosomal protein import into nucleus|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						catgcccagatttttttttttt	0.129													2	4	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39914431	39914431	+	Intron	DEL	T	-	-	rs150430167		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39914431delT	uc002hxq.2	-						JUP_uc010wfs.1_Intron|JUP_uc002hxr.2_Intron|JUP_uc002hxs.2_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		ttgttttttgttttttttttc	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78439862	78439863	+	5'Flank	DEL	GT	-	-	rs71926424		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78439862_78439863delGT	uc002jyo.1	-											Homo sapiens cDNA FLJ33500 fis, clone BRAMY2004352.																		CGCCAACCCAgtgtgtgtgtgt	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393851	77393853	+	IGR	DEL	GTG	-	-	rs147421523	by1000genomes	TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393851_77393853delGTG								NFATC1 (104529 upstream) : CTDP1 (45948 downstream)																							gatgatggcagtggtggtggtgg	0.000													4	2	---	---	---	---	
ZNF77	58492	broad.mit.edu	37	19	2938977	2938977	+	Intron	DEL	G	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2938977delG	uc002lws.3	-							NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		aaaaaaaaaagaaaaCCAAGG	0.274													4	2	---	---	---	---	
FCAR	2204	broad.mit.edu	37	19	55392991	55392991	+	Intron	DEL	G	-	-			TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55392991delG	uc002qhr.1	+						FCAR_uc002qhq.2_Intron|FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Intron|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Intron|FCAR_uc002qhw.1_Intron|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Intron|FCAR_uc002qhz.1_Intron|FCAR_uc002qia.1_Intron	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		cacagggagaggagactgagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46109797	46109798	+	IGR	INS	-	TC	TC	rs36146547		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46109797_46109798insTC								ZMYND8 (124323 upstream) : NCOA3 (20859 downstream)																							ctttctttctttttctttcttt	0.000													5	3	---	---	---	---	
EDN3	1908	broad.mit.edu	37	20	57899654	57899654	+	Intron	DEL	C	-	-	rs111992101		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57899654delC	uc002yap.2	+						EDN3_uc002yaq.2_3'UTR|EDN3_uc002yar.2_3'UTR|EDN3_uc002yas.2_3'UTR	NM_000114	NP_000105	P14138	EDN3_HUMAN	endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)					CTTAACAATACCCCCCCCCCA	0.507													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151841	20151842	+	IGR	INS	-	CAC	CAC	rs10627070		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151841_20151842insCAC								ZDHHC8 (16312 upstream) : LOC150197 (42013 downstream)																							accaccaccatcaccaccacca	0.025													4	2	---	---	---	---	
CELSR1	9620	broad.mit.edu	37	22	46877139	46877140	+	Intron	INS	-	A	A	rs112875441		TCGA-39-5039-01A-01D-1441-08	TCGA-39-5039-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46877139_46877140insA	uc003bhw.1	-							NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		gaccatgtctcaaaaaaaaaaa	0.163													6	6	---	---	---	---	
