Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
IL22RA1	58985	broad.mit.edu	37	1	24465095	24465095	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24465095C>T	uc001biq.1	-	2	192	c.153G>A	c.(151-153)ACG>ACA	p.T51T	IL22RA1_uc010oeg.1_5'Flank|IL22RA1_uc009vrb.1_5'UTR|IL22RA1_uc010oeh.1_Silent_p.T51T	NM_021258	NP_067081	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1 precursor	51	Extracellular (Potential).|Fibronectin type-III 1.					integral to membrane	interferon receptor activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		TGCTGTAGACCGTGTCTGGGG	0.567																0.225352	39.06468	43.982842	16	55	KEEP	---	---	---	---	17	11	27	36	-1	capture	Silent	SNP	24465095	24465095	IL22RA1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7596	251
PTAFR	5724	broad.mit.edu	37	1	28477494	28477494	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28477494G>A	uc001bpl.2	-	2	166	c.39C>T	c.(37-39)TTC>TTT	p.F13F	PTAFR_uc001bpm.3_Silent_p.F13F|PTAFR_uc009vte.2_Silent_p.F13F	NM_000952	NP_000943	P25105	PTAFR_HUMAN	platelet-activating factor receptor	13	Extracellular (Potential).				chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		GAGTGTATCGGAACTCAGAGT	0.527																0.036585	-12.55089	6.547051	3	79	KEEP	---	---	---	---	1	2	49	52	-1	capture	Silent	SNP	28477494	28477494	PTAFR	1	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	12618	251
GLIS1	148979	broad.mit.edu	37	1	53995480	53995480	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53995480C>T	uc001cvr.1	-	4	1508	c.941G>A	c.(940-942)CGC>CAC	p.R314H		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	314	C2H2-type 4.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						TAGGTGGGTGCGCTGGTGCTT	0.657																0.361345	115.260771	117.286633	43	76	KEEP	---	---	---	---	27	31	40	59	-1	capture	Missense_Mutation	SNP	53995480	53995480	GLIS1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6381	251
ADAM30	11085	broad.mit.edu	37	1	120437661	120437661	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120437661C>A	uc001eij.2	-	1	1453	c.1299G>T	c.(1297-1299)TTG>TTT	p.L433F		NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein	433	Disintegrin.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		CACCTGGTTGCAACTTACAAT	0.453																0.328947	276.886055	284.776985	100	204	KEEP	---	---	---	---	43	64	101	119	0.598130841121	capture	Missense_Mutation	SNP	120437661	120437661	ADAM30	1	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	248	251
SEMA4A	64218	broad.mit.edu	37	1	156126258	156126258	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156126258G>C	uc001fnl.2	+	3	297	c.193G>C	c.(193-195)GAC>CAC	p.D65H	SEMA4A_uc009wrq.2_Missense_Mutation_p.D65H|SEMA4A_uc001fnm.2_Missense_Mutation_p.D65H|SEMA4A_uc001fnn.2_5'UTR|SEMA4A_uc001fno.2_Missense_Mutation_p.D65H	NM_022367	NP_071762	Q9H3S1	SEM4A_HUMAN	semaphorin B precursor	65	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)					CCAGGATTTTGACACTCTGCT	0.542																0.364407	152.403404	154.30773	43	75	KEEP	---	---	---	---	24	23	34	52	-1	capture	Missense_Mutation	SNP	156126258	156126258	SEMA4A	1	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	13924	251
ILDR2	387597	broad.mit.edu	37	1	166888604	166888604	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:166888604G>A	uc001gdx.1	-	10	1964	c.1908C>T	c.(1906-1908)TCC>TCT	p.S636S		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	636	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						AGACCACAAGGGACATCCTGG	0.438																0.048387	-6.305224	7.024074	3	59	KEEP	---	---	---	---	1	2	36	37	-1	capture	Silent	SNP	166888604	166888604	ILDR2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	7633	251
PTPRC	5788	broad.mit.edu	37	1	198676014	198676014	+	Silent	SNP	G	A	A	rs137909392	byFrequency	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:198676014G>A	uc001gur.1	+	9	1011	c.831G>A	c.(829-831)GCG>GCA	p.A277A	PTPRC_uc001gus.1_Silent_p.A229A|PTPRC_uc001gut.1_Silent_p.A116A|PTPRC_uc009wzf.1_Silent_p.A165A|PTPRC_uc010ppg.1_Silent_p.A213A	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	277	Extracellular (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						GTAAAAATGCGTCTGTTTCCA	0.289					815											0.441176	225.201382	225.713985	75	95	KEEP	---	---	---	---	33	60	46	65	-1	capture	Silent	SNP	198676014	198676014	PTPRC	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	12692	251
LYST	1130	broad.mit.edu	37	1	235938388	235938388	+	Splice_Site	SNP	T	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235938388T>A	uc001hxj.2	-	18	5636	c.5461_splice	c.e18-1	p.V1821_splice	LYST_uc009xgb.1_Splice_Site|LYST_uc010pxs.1_Splice_Site	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator						defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTCAACAACCTAAAAAAAAAA	0.313												Chediak-Higashi_syndrome				0.045455	-11.334934	8.049435	4	84	KEEP	---	---	---	---	4	3	42	68	-1	capture	Splice_Site	SNP	235938388	235938388	LYST	1	T	A	A	A	1	0	0	0	0	0	0	1	0	689	53	5	4	9043	251
OR13G1	441933	broad.mit.edu	37	1	247835982	247835982	+	Missense_Mutation	SNP	A	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247835982A>C	uc001idi.1	-	1	362	c.362T>G	c.(361-363)GTG>GGG	p.V121G		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ACAAATGGCCACATAGCGGTC	0.478																0.393258	124.316987	125.201098	35	54	KEEP	---	---	---	---	20	19	30	28	-1	capture	Missense_Mutation	SNP	247835982	247835982	OR13G1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	10846	251
PHRF1	57661	broad.mit.edu	37	11	607162	607162	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:607162C>A	uc001lqe.2	+	14	1837	c.1706C>A	c.(1705-1707)CCG>CAG	p.P569Q	PHRF1_uc010qwc.1_Missense_Mutation_p.P568Q|PHRF1_uc010qwd.1_Missense_Mutation_p.P567Q|PHRF1_uc010qwe.1_Missense_Mutation_p.P565Q|PHRF1_uc009ybz.1_Missense_Mutation_p.P359Q|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	569							RNA polymerase binding|zinc ion binding				0						TCCGGGAGCCCGGCCCAAGGC	0.662																0.051724	-5.216298	7.106317	3	55	KEEP	---	---	---	---	4	0	38	22	-1	capture	Missense_Mutation	SNP	607162	607162	PHRF1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	11764	251
SLC3A2	6520	broad.mit.edu	37	11	62623803	62623803	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62623803G>T	uc001nwd.2	+	1	286	c.62G>T	c.(61-63)GGC>GTC	p.G21V	SLC3A2_uc001nwb.2_Missense_Mutation_p.G21V|SLC3A2_uc001nwc.2_Missense_Mutation_p.G21V|SLC3A2_uc001nwe.2_Missense_Mutation_p.G21V|SLC3A2_uc001nwf.2_Missense_Mutation_p.G21V|SNHG1_uc001nvp.2_5'Flank|SNHG1_uc001nvo.2_5'Flank|SNHG1_uc001nvq.2_5'Flank|SNHG1_uc001nvs.2_5'Flank|SNHG1_uc001nvr.2_5'Flank|SNHG1_uc001nvt.2_5'Flank|SNHG1_uc001nvu.2_5'Flank|SNORD31_uc009yoj.1_5'Flank|SNORD30_uc001nvw.1_5'Flank|SNORD29_uc001nvx.2_5'Flank|SNORD28_uc001nvy.1_5'Flank|SNORD27_uc001nvz.2_5'Flank|SNORD26_uc009yok.1_5'Flank|SNORD25_uc001nwa.3_5'Flank	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	21					blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						CAGTTGCCTGGCTCACATTCG	0.647																0.066225	-21.02877	8.690639	10	141	KEEP	---	---	---	---	4	6	81	95	0.4	capture	Missense_Mutation	SNP	62623803	62623803	SLC3A2	11	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	14519	251
P2RY2	5029	broad.mit.edu	37	11	72945627	72945627	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72945627C>T	uc001otj.2	+	3	756	c.423C>T	c.(421-423)TCC>TCT	p.S141S	P2RY2_uc001otk.2_Silent_p.S141S|P2RY2_uc001otl.2_Silent_p.S141S	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2	141	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	CTCTGCGCTCCCTGCGCTGGG	0.662																0.371429	110.895631	112.421328	39	66	KEEP	---	---	---	---	21	23	43	33	-1	capture	Silent	SNP	72945627	72945627	P2RY2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	11256	251
SNX19	399979	broad.mit.edu	37	11	130781567	130781567	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130781567G>T	uc001qgk.3	-	2	2322	c.1774C>A	c.(1774-1776)CGT>AGT	p.R592S	SNX19_uc010sce.1_5'UTR|SNX19_uc010scf.1_Missense_Mutation_p.R35S|SNX19_uc010scg.1_5'UTR|SNX19_uc001qgl.3_Missense_Mutation_p.R592S|SNX19_uc009zcx.1_RNA	NM_014758	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	592	PX.				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|lung(2)	4	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TCCTCCAGACGGGTCTGCAGA	0.557					728											0.028302	-18.857745	7.105846	3	103	KEEP	---	---	---	---	1	2	60	53	0.333333333333	capture	Missense_Mutation	SNP	130781567	130781567	SNX19	11	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	14782	251
WNT5B	81029	broad.mit.edu	37	12	1749108	1749108	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:1749108T>C	uc009zdq.2	+	4	829	c.587T>C	c.(586-588)CTC>CCC	p.L196P	WNT5B_uc001qjj.2_Missense_Mutation_p.L196P|WNT5B_uc001qjk.2_Missense_Mutation_p.L196P|WNT5B_uc001qjl.2_Missense_Mutation_p.L196P	NM_032642	NP_116031	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family,	196					angiogenesis|anterior/posterior pattern formation|cell migration involved in gastrulation|cellular response to retinoic acid|chondrocyte differentiation|convergent extension involved in axis elongation|convergent extension involved in gastrulation|dorsal/ventral axis specification|endocrine pancreas development|fat cell differentiation|lens fiber cell development|negative regulation of canonical Wnt receptor signaling pathway|neuron differentiation|positive regulation of cell migration|positive regulation of fat cell differentiation|respiratory system development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			GGCCGGGTGCTCATGAACCTG	0.632																0.065217	-0.112143	8.9161	3	43	KEEP	---	---	---	---	0	3	29	17	-1	capture	Missense_Mutation	SNP	1749108	1749108	WNT5B	12	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17273	251
OR8S1	341568	broad.mit.edu	37	12	48921845	48921845	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48921845G>A	uc010slu.1	+	2	1039	c.1039G>A	c.(1039-1041)GCA>ACA	p.A347T		NM_001005203	NP_001005203	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S,	347	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AGGGGCCTGCGCATGCTCCGC	0.662																0.545455	51.145298	51.203946	18	15	KEEP	---	---	---	---	8	10	9	8	-1	capture	Missense_Mutation	SNP	48921845	48921845	OR8S1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11150	251
SCYL2	55681	broad.mit.edu	37	12	100717360	100717360	+	Missense_Mutation	SNP	A	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:100717360A>C	uc001thn.2	+	11	1503	c.1453A>C	c.(1453-1455)AAA>CAA	p.K485Q	SCYL2_uc009ztw.1_Missense_Mutation_p.K312Q|SCYL2_uc001thm.1_Missense_Mutation_p.K485Q	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein	485					endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						CCCATCCATGAAAAACGCTTT	0.318					647											0.31068	113.6668	116.952103	32	71	KEEP	---	---	---	---	16	20	37	53	-1	capture	Missense_Mutation	SNP	100717360	100717360	SCYL2	12	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	13841	251
ANO4	121601	broad.mit.edu	37	12	101520784	101520784	+	Missense_Mutation	SNP	G	A	A	rs143188971	byFrequency	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101520784G>A	uc010svm.1	+	27	3376	c.2804G>A	c.(2803-2805)CGT>CAT	p.R935H	ANO4_uc001thw.2_Missense_Mutation_p.R900H|ANO4_uc001thx.2_Missense_Mutation_p.R935H|ANO4_uc001thy.2_Missense_Mutation_p.R455H	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	935	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GAACTGGAACGTCTCCAGAAG	0.483													HNSCC(74;0.22)			0.350877	56.913069	58.017557	20	37	KEEP	---	---	---	---	8	14	14	26	-1	capture	Missense_Mutation	SNP	101520784	101520784	ANO4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	693	251
RYR3	6263	broad.mit.edu	37	15	33916210	33916210	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33916210G>A	uc001zhi.2	+	20	2630	c.2560G>A	c.(2560-2562)GTA>ATA	p.V854I	RYR3_uc010bar.2_Missense_Mutation_p.V854I	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	854	4 X approximate repeats.|1.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCCATGCCCCGTAGACACCAG	0.433																0.403614	389.872728	392.572491	134	198	KEEP	---	---	---	---	86	80	115	147	-1	capture	Missense_Mutation	SNP	33916210	33916210	RYR3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13662	251
ACAN	176	broad.mit.edu	37	15	89389067	89389067	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89389067C>T	uc010upo.1	+	7	1757	c.1383C>T	c.(1381-1383)CTC>CTT	p.L461L	ACAN_uc002bmx.2_Silent_p.L461L|ACAN_uc010upp.1_Silent_p.L461L|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	461					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTGAGGACCTCGTCGTGCAGG	0.532																0.6	9.825924	9.869647	3	2	KEEP	---	---	---	---	2	2	1	1	-1	capture	Silent	SNP	89389067	89389067	ACAN	15	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	117	251
MVP	9961	broad.mit.edu	37	16	29858658	29858658	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29858658A>G	uc002dui.2	+	14	2490	c.2406A>G	c.(2404-2406)ATA>ATG	p.I802M	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc002duj.2_Missense_Mutation_p.I802M|MVP_uc010vea.1_Missense_Mutation_p.I396M	NM_005115	NP_005106	Q14764	MVP_HUMAN	major vault protein	802					mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						CAGAGGCCATAGGCCCCAGCA	0.582																0.038961	-9.042951	8.627265	3	74	KEEP	---	---	---	---	1	2	39	40	-1	capture	Missense_Mutation	SNP	29858658	29858658	MVP	16	A	G	G	G	1	0	0	0	0	1	0	0	0	189	15	3	3	9906	251
ATP6V0D1	9114	broad.mit.edu	37	16	67477041	67477041	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67477041G>A	uc002ete.1	-	4	622	c.522C>T	c.(520-522)GAC>GAT	p.D174D	ATP6V0D1_uc010vjo.1_Silent_p.D215D|ATP6V0D1_uc010vjn.1_Silent_p.D97D	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	174					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		TGTTCATCTCGTCAAGGTCCT	0.567																0.39485	257.132435	259.391995	92	141	KEEP	---	---	---	---	49	57	89	74	-1	capture	Silent	SNP	67477041	67477041	ATP6V0D1	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1164	251
HYDIN	54768	broad.mit.edu	37	16	70908762	70908762	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:70908762C>T	uc002ezr.2	-	63	10743	c.10615G>A	c.(10615-10617)GCG>ACG	p.A3539T		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3540										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TAGATATACGCGGTGGTGGGC	0.507																0.38806	78.534239	79.270032	26	41	KEEP	---	---	---	---	19	18	33	28	-1	capture	Missense_Mutation	SNP	70908762	70908762	HYDIN	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7392	251
RABEP1	9135	broad.mit.edu	37	17	5235422	5235422	+	Silent	SNP	T	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5235422T>G	uc002gbm.3	+	3	566	c.342T>G	c.(340-342)GTT>GTG	p.V114V	RABEP1_uc010clc.1_Silent_p.V114V|RABEP1_uc010cld.1_Silent_p.V71V|RABEP1_uc010vsw.1_Silent_p.V71V|RABEP1_uc002gbl.3_Silent_p.V114V|RABEP1_uc002gbj.2_Silent_p.V114V|RABEP1_uc002gbk.2_Silent_p.V114V	NM_004703	NP_004694	Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	114	Potential.				apoptosis|cellular membrane fusion|endocytosis|protein transport	centrosome|early endosome|endocytic vesicle|recycling endosome	growth factor activity|GTPase activator activity|protein homodimerization activity			large_intestine(1)|ovary(1)	2						GAGAAGAAGTTGCTTCACTTC	0.378					903											0.02521	-23.380677	6.353906	3	116	KEEP	---	---	---	---	1	2	66	75	-1	capture	Silent	SNP	5235422	5235422	RABEP1	17	T	G	G	G	1	0	0	0	0	0	0	0	1	808	63	4	4	12856	251
MYH4	4622	broad.mit.edu	37	17	10358985	10358985	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10358985C>A	uc002gmn.2	-	19	2231	c.2120G>T	c.(2119-2121)CGC>CTC	p.R707L	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	707	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CCTGCAGATGCGGATGCCTTC	0.468																0.026549	-20.876095	7.120906	3	110	KEEP	---	---	---	---	2	1	63	75	0.333333333333	capture	Missense_Mutation	SNP	10358985	10358985	MYH4	17	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	9947	251
MYH1	4619	broad.mit.edu	37	17	10408543	10408543	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10408543C>T	uc002gmo.2	-	21	2466	c.2372G>A	c.(2371-2373)CGA>CAA	p.R791Q	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	791	IQ.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GGCCTGGGTTCGGGTAATCAG	0.458					585											0.407407	217.684105	219.112324	77	112	KEEP	---	---	---	---	36	49	61	72	-1	capture	Missense_Mutation	SNP	10408543	10408543	MYH1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9939	251
USP22	23326	broad.mit.edu	37	17	20931977	20931977	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:20931977C>T	uc002gym.3	-	2	386	c.182G>A	c.(181-183)TGT>TAT	p.C61Y	USP22_uc002gyn.3_Missense_Mutation_p.C49Y|USP22_uc002gyl.3_5'UTR	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	61	UBP-type.				cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						ATGGCAGATACAGGACTTGGC	0.517																0.425532	53.986521	54.215017	20	27	KEEP	---	---	---	---	8	12	12	19	-1	capture	Missense_Mutation	SNP	20931977	20931977	USP22	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16936	251
C17orf70	80233	broad.mit.edu	37	17	79517665	79517665	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79517665T>C	uc002kaq.2	-	3	910	c.855A>G	c.(853-855)ATA>ATG	p.I285M	C17orf70_uc002kao.1_5'Flank|C17orf70_uc010wuq.1_RNA|C17orf70_uc002kap.2_Missense_Mutation_p.I134M	NM_001109760	NP_001103230	Q0VG06	FP100_HUMAN	Fanconi anemia core complex 100 kDa subunit	285					DNA repair	cytoplasm|intermediate filament cytoskeleton|nucleoplasm	DNA binding			ovary(1)|skin(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			TCAAGGCCCCTATGAAGATGA	0.577																0.022388	-26.28358	7.795879	3	131	KEEP	---	---	---	---	0	3	72	91	-1	capture	Missense_Mutation	SNP	79517665	79517665	C17orf70	17	T	C	C	C	1	0	0	0	0	1	0	0	0	680	53	3	3	1862	251
LAMA1	284217	broad.mit.edu	37	18	7034562	7034562	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7034562C>T	uc002knm.2	-	14	2061	c.1967G>A	c.(1966-1968)CGT>CAT	p.R656H	LAMA1_uc010wzj.1_Missense_Mutation_p.R132H	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	656	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAGCTGGTCACGATCAATCTG	0.423					1597											0.414508	234.465792	235.696961	80	113	KEEP	---	---	---	---	38	46	59	70	-1	capture	Missense_Mutation	SNP	7034562	7034562	LAMA1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8525	251
SERPINB7	8710	broad.mit.edu	37	18	61465969	61465969	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61465969A>G	uc002ljl.2	+	6	682	c.586A>G	c.(586-588)AAA>GAA	p.K196E	SERPINB7_uc002ljm.2_Missense_Mutation_p.K196E|SERPINB7_uc010xet.1_Missense_Mutation_p.K179E|SERPINB7_uc010dqg.2_Missense_Mutation_p.K196E	NM_001040147	NP_001035237	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade	196					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)				TTGCCATTTCAAATCTCCCAA	0.403																0.421875	354.272698	355.632074	108	148	KEEP	---	---	---	---	53	75	72	98	-1	capture	Missense_Mutation	SNP	61465969	61465969	SERPINB7	18	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	13999	251
PALM	5064	broad.mit.edu	37	19	746493	746493	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:746493C>T	uc002lpm.1	+	9	1037	c.843C>T	c.(841-843)GGC>GGT	p.G281G	PALM_uc002lpn.1_Silent_p.G237G|PALM_uc010xfu.1_Silent_p.G146G	NM_002579	NP_002570	O75781	PALM_HUMAN	paralemmin isoform 1	281					cellular component movement|negative regulation of adenylate cyclase activity|negative regulation of dopamine receptor signaling pathway|positive regulation of filopodium assembly|regulation of cell shape	cytoplasmic membrane-bounded vesicle|filopodium membrane|integral to plasma membrane					0		all_epithelial(18;2.19e-21)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)|Lung(535;0.201)		CACAGCCAGGCGAGGCCACGT	0.726																0.2	6.985821	8.663686	4	16	KEEP	---	---	---	---	2	2	9	12	-1	capture	Silent	SNP	746493	746493	PALM	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11312	251
CD97	976	broad.mit.edu	37	19	14513618	14513618	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14513618G>A	uc002myl.2	+	12	1516	c.1393G>A	c.(1393-1395)GCC>ACC	p.A465T	CD97_uc002mym.2_Missense_Mutation_p.A416T|CD97_uc002myn.2_Missense_Mutation_p.A372T	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor	465	Extracellular (Potential).				cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						CATCCTTTTCGCCTTCTCCCA	0.527																0.339223	259.909013	266.378539	96	187	KEEP	---	---	---	---	48	65	109	116	-1	capture	Missense_Mutation	SNP	14513618	14513618	CD97	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3020	251
FAM32A	26017	broad.mit.edu	37	19	16301334	16301334	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16301334A>G	uc002ndt.2	+	3	239	c.220A>G	c.(220-222)ATG>GTG	p.M74V		NM_014077	NP_054796	Q9Y421	FA32A_HUMAN	hypothetical protein LOC26017	74	Lys-rich.					nucleolus					0						TCTCCAGCAAATGGAAAGGAT	0.562																0.347826	57.087615	58.027183	16	30	KEEP	---	---	---	---	11	5	19	14	-1	capture	Missense_Mutation	SNP	16301334	16301334	FAM32A	19	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	5501	251
CD22	933	broad.mit.edu	37	19	35832290	35832290	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35832290G>A	uc010edt.2	+	8	1629	c.1552G>A	c.(1552-1554)GAG>AAG	p.E518K	CD22_uc010xst.1_Missense_Mutation_p.E346K|CD22_uc010edu.2_Missense_Mutation_p.E430K|CD22_uc010edv.2_Missense_Mutation_p.E518K|CD22_uc002nzb.3_Missense_Mutation_p.E341K|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	518	Extracellular (Potential).|Ig-like C2-type 5.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	GCCCCTTTCCGAGATTCACTC	0.572	Ovarian(42;1009 1133 23674 26041)															0.363636	146.964082	149.302155	52	91	KEEP	---	---	---	---	27	25	52	50	-1	capture	Missense_Mutation	SNP	35832290	35832290	CD22	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2956	251
HKR1	284459	broad.mit.edu	37	19	37853831	37853831	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37853831G>A	uc002ogb.2	+	6	1403	c.1134G>A	c.(1132-1134)GCG>GCA	p.A378A	HKR1_uc002ofx.2_Silent_p.A94A|HKR1_uc002ofy.2_Silent_p.A94A|HKR1_uc002oga.2_Silent_p.A360A|HKR1_uc010xto.1_Silent_p.A360A|HKR1_uc002ogc.2_Silent_p.A359A|HKR1_uc010xtp.1_Silent_p.A317A|HKR1_uc002ogd.2_Silent_p.A317A	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1	378	C2H2-type 3.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACCAGAGGGCGCACACTGGGG	0.532																0.024631	-43.603464	7.328338	5	198	KEEP	---	---	---	---	2	4	120	94	-1	capture	Silent	SNP	37853831	37853831	HKR1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7119	251
ACPT	93650	broad.mit.edu	37	19	51295361	51295361	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51295361G>A	uc002pta.1	+	5	482	c.482G>A	c.(481-483)CGA>CAA	p.R161Q		NM_033068	NP_149059	Q9BZG2	PPAT_HUMAN	testicular acid phosphatase precursor	161	Extracellular (Potential).					integral to membrane	acid phosphatase activity				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		AGCTGTCCCCGATACCACGAG	0.468																0.222222	13.836451	15.752607	6	21	KEEP	---	---	---	---	3	4	15	10	-1	capture	Missense_Mutation	SNP	51295361	51295361	ACPT	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	168	251
BIRC8	112401	broad.mit.edu	37	19	53794413	53794413	+	Translation_Start_Site	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53794413G>A	uc002qbk.2	-	1	463	c.-785C>T	c.(-787--783)GACGG>GATGG			NM_033341	NP_203127	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat-containing 8						apoptosis		zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(134;0.00304)		CTTGTCCACCGTCTCGCGCCA	0.527																0.35	19.430704	19.822364	7	13	KEEP	---	---	---	---	3	4	8	5	-1	capture	Translation_Start_Site	SNP	53794413	53794413	BIRC8	19	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	1428	251
LILRB2	10288	broad.mit.edu	37	19	54784355	54784355	+	Translation_Start_Site	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54784355G>A	uc002qfb.2	-	2	263	c.-3C>T	c.(-5--1)GACGC>GATGC		LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Translation_Start_Site|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Translation_Start_Site|LILRB2_uc010yet.1_Translation_Start_Site|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGTCATGGCGTCTCCTCCCA	0.592																0.219355	148.881879	171.345044	68	242	KEEP	---	---	---	---	49	37	154	144	-1	capture	Translation_Start_Site	SNP	54784355	54784355	LILRB2	19	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	8711	251
HSPBP1	23640	broad.mit.edu	37	19	55776732	55776732	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55776732C>T	uc002qjx.2	-	6	1167	c.1057G>A	c.(1057-1059)GTG>ATG	p.V353M	HSPBP1_uc002qjy.2_Missense_Mutation_p.V307M|HSPBP1_uc002qkb.2_Missense_Mutation_p.C303Y|HSPBP1_uc002qka.2_Missense_Mutation_p.V307M|HSPBP1_uc002qkd.2_Missense_Mutation_p.V307M|HSPBP1_uc002qkc.2_Missense_Mutation_p.V307M|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein	310					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CACTCGCGCACACCCTGCGGA	0.612																0.293103	162.584663	171.490527	68	164	KEEP	---	---	---	---	46	50	114	110	-1	capture	Missense_Mutation	SNP	55776732	55776732	HSPBP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	7351	251
HSPBP1	23640	broad.mit.edu	37	19	55777302	55777302	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55777302C>T	uc002qjx.2	-	5	1093	c.983G>A	c.(982-984)CGG>CAG	p.R328Q	HSPBP1_uc002qjy.2_Missense_Mutation_p.R282Q|HSPBP1_uc002qkb.2_Missense_Mutation_p.R282Q|HSPBP1_uc002qka.2_Missense_Mutation_p.R282Q|HSPBP1_uc002qkd.2_Missense_Mutation_p.R282Q|HSPBP1_uc002qkc.2_Missense_Mutation_p.R282Q|uc002qke.2_5'Flank	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein	285	ARM 4.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GTGCTCTGTCCGCACCAGGGC	0.687																0.313725	41.119997	42.675069	16	35	KEEP	---	---	---	---	6	12	18	26	-1	capture	Missense_Mutation	SNP	55777302	55777302	HSPBP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7351	251
ZSCAN1	284312	broad.mit.edu	37	19	58564905	58564905	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58564905C>T	uc002qrc.1	+	6	960	c.713C>T	c.(712-714)CCC>CTC	p.P238L		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	238					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		ATCTCGAGCCCCAAGGGTCCA	0.617																0.024194	-24.387609	6.703925	3	121	KEEP	---	---	---	---	3	0	73	63	-1	capture	Missense_Mutation	SNP	58564905	58564905	ZSCAN1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	18102	251
ITSN2	50618	broad.mit.edu	37	2	24435600	24435600	+	Silent	SNP	C	T	T	rs146758206	byFrequency	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:24435600C>T	uc002rfe.2	-	33	4266	c.4008G>A	c.(4006-4008)CCG>CCA	p.P1336P	ITSN2_uc002rff.2_Silent_p.P1309P	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	1336	DH.				endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTTACACCGCGGGTCAGATG	0.542																0.33945	207.003626	211.961531	74	144	KEEP	---	---	---	---	37	48	66	90	-1	capture	Silent	SNP	24435600	24435600	ITSN2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7850	251
ST6GAL2	84620	broad.mit.edu	37	2	107450522	107450522	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107450522G>A	uc002tdq.2	-	3	1143	c.1024C>T	c.(1024-1026)CGC>TGC	p.R342C	ST6GAL2_uc002tdr.2_Missense_Mutation_p.R342C|ST6GAL2_uc002tds.3_Missense_Mutation_p.R342C	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	342	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						TTAATGATGCGTATGGTGGTT	0.393																0.020492	-54.542324	8.311611	5	239	KEEP	---	---	---	---	0	6	136	169	-1	capture	Missense_Mutation	SNP	107450522	107450522	ST6GAL2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15112	251
GALNT13	114805	broad.mit.edu	37	2	155099239	155099239	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:155099239C>T	uc002tyr.3	+	6	1074	c.507C>T	c.(505-507)TAC>TAT	p.Y169Y	GALNT13_uc002tyt.3_Silent_p.Y169Y|GALNT13_uc010foc.1_Translation_Start_Site	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	169	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TAGAGAATTACGTGAAAAATT	0.353																0.294872	63.091809	66.029899	23	55	KEEP	---	---	---	---	14	13	37	30	-1	capture	Silent	SNP	155099239	155099239	GALNT13	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6151	251
XIRP2	129446	broad.mit.edu	37	2	168105145	168105145	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:168105145A>G	uc002udx.2	+	8	7261	c.7243A>G	c.(7243-7245)AAA>GAA	p.K2415E	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.K2240E|XIRP2_uc010fpq.2_Missense_Mutation_p.K2193E|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2240					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CATAACAGGAAAAACCGGTGT	0.438																0.438503	302.34321	302.956042	82	105	KEEP	---	---	---	---	47	43	65	52	-1	capture	Missense_Mutation	SNP	168105145	168105145	XIRP2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	17311	251
TTN	7273	broad.mit.edu	37	2	179398164	179398164	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179398164G>A	uc010zfg.1	-	307	95698	c.95474C>T	c.(95473-95475)ACA>ATA	p.T31825I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T25520I|TTN_uc010zfi.1_Missense_Mutation_p.T25453I|TTN_uc010zfj.1_Missense_Mutation_p.T25328I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32752							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCATTTTAATGTTGGTGGGGG	0.463					8722											0.326087	73.511057	75.983533	30	62	KEEP	---	---	---	---	14	18	28	41	-1	capture	Missense_Mutation	SNP	179398164	179398164	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16617	251
MYBL2	4605	broad.mit.edu	37	20	42331498	42331498	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42331498G>A	uc002xlb.1	+	8	1535	c.1320G>A	c.(1318-1320)ACG>ACA	p.T440T	MYBL2_uc010zwj.1_Silent_p.T416T|MYBL2_uc002xla.1_Silent_p.T440T	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	440						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			ACAGCCTCACGCCCAAGAGCA	0.542					380											0.307692	171.229735	178.082943	64	144	KEEP	---	---	---	---	26	40	89	87	-1	capture	Silent	SNP	42331498	42331498	MYBL2	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9920	251
CCT8L2	150160	broad.mit.edu	37	22	17072504	17072504	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17072504C>T	uc002zlp.1	-	1	1197	c.937G>A	c.(937-939)GTG>ATG	p.V313M		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	313					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TGAATCACCACGATGCCATAC	0.557																0.384824	397.253821	401.547226	142	227	KEEP	---	---	---	---	83	79	148	127	-1	capture	Missense_Mutation	SNP	17072504	17072504	CCT8L2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2932	251
CHEK2	11200	broad.mit.edu	37	22	29083951	29083951	+	Silent	SNP	G	A	A	rs142890589	by1000genomes	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29083951G>A	uc003adu.1	-	15	1638	c.1566C>T	c.(1564-1566)CCC>CCT	p.P522P	CHEK2_uc003ads.1_Silent_p.P301P|CHEK2_uc010gvh.1_Silent_p.P431P|CHEK2_uc010gvi.1_Silent_p.P371P|CHEK2_uc010gvj.1_RNA|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.P565P|CHEK2_uc003adv.1_Silent_p.P493P|CHEK2_uc003adw.1_Silent_p.P522P|CHEK2_uc003adx.1_Silent_p.P301P|CHEK2_uc003ady.1_Silent_p.P511P|CHEK2_uc003adz.1_Silent_p.P326P	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	522					cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCCTTCACGGGGCCGCTTTC	0.453					268	F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				0.042857	-9.23498	6.457059	3	67	KEEP	---	---	---	---	0	3	33	38	-1	capture	Silent	SNP	29083951	29083951	CHEK2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	3301	251
CHEK2	11200	broad.mit.edu	37	22	29083962	29083962	+	Missense_Mutation	SNP	G	C	C	rs138839489	by1000genomes	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29083962G>C	uc003adu.1	-	15	1627	c.1555C>G	c.(1555-1557)CGA>GGA	p.R519G	CHEK2_uc003ads.1_Missense_Mutation_p.R298G|CHEK2_uc010gvh.1_Missense_Mutation_p.R428G|CHEK2_uc010gvi.1_Missense_Mutation_p.R368G|CHEK2_uc010gvj.1_RNA|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.R562G|CHEK2_uc003adv.1_Missense_Mutation_p.R490G|CHEK2_uc003adw.1_Missense_Mutation_p.R519G|CHEK2_uc003adx.1_Missense_Mutation_p.R298G|CHEK2_uc003ady.1_Missense_Mutation_p.R508G|CHEK2_uc003adz.1_Missense_Mutation_p.R323G	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	519					cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						GGCCGCTTTCGACTAGTAGAA	0.463					268	F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				0.044776	-6.823966	8.013063	3	64	KEEP	---	---	---	---	0	3	33	33	-1	capture	Missense_Mutation	SNP	29083962	29083962	CHEK2	22	G	C	C	C	1	0	0	0	0	1	0	0	0	480	37	4	4	3301	251
FBLN2	2199	broad.mit.edu	37	3	13659763	13659763	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13659763C>T	uc011avb.1	+	6	2042	c.1917C>T	c.(1915-1917)GAC>GAT	p.D639D	FBLN2_uc011auz.1_Silent_p.D665D|FBLN2_uc011ava.1_Silent_p.D639D|FBLN2_uc011avc.1_Silent_p.D639D	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	639	EGF-like 1; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CACTGCAGGACGATGGCCGCA	0.612																0.444444	85.995062	86.163813	28	35	KEEP	---	---	---	---	13	18	10	30	-1	capture	Silent	SNP	13659763	13659763	FBLN2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5645	251
SCN10A	6336	broad.mit.edu	37	3	38812783	38812783	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38812783C>T	uc003ciq.2	-	4	586	c.586G>A	c.(586-588)GTC>ATC	p.V196I		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	196	I.|Helical; Name=S3 of repeat I; (Potential).				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	AGGGTAATGACGCTAAAATCC	0.353																0.372294	243.603368	246.907212	86	145	KEEP	---	---	---	---	32	69	84	79	-1	capture	Missense_Mutation	SNP	38812783	38812783	SCN10A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13805	251
GPX1	2876	broad.mit.edu	37	3	49395545	49395545	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49395545T>G	uc011bcl.1	-	2	247	c.167A>C	c.(166-168)TAC>TCC	p.Y56S	GPX1_uc011bcm.1_Missense_Mutation_p.Y56S	NM_000581	NP_000572	P07203	GPX1_HUMAN	glutathione peroxidase 1 isoform 1	56					anti-apoptosis|cell redox homeostasis|glutathione metabolic process|heart contraction|hydrogen peroxide catabolic process|negative regulation of caspase activity|purine base metabolic process|purine nucleotide catabolic process|regulation of gene expression, epigenetic|regulation of mammary gland epithelial cell proliferation|regulation of proteasomal protein catabolic process|release of cytochrome c from mitochondria|response to selenium ion|UV protection	cytosol|mitochondrion	endopeptidase inhibitor activity|glutathione peroxidase activity|SH3 domain binding			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Glutathione(DB00143)	CATCTGGGTGTAGTCCCGGAC	0.657																0.25	21.815338	23.403324	7	21	KEEP	---	---	---	---	4	3	14	11	-1	capture	Missense_Mutation	SNP	49395545	49395545	GPX1	3	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	6672	251
KIAA1407	57577	broad.mit.edu	37	3	113684122	113684122	+	Silent	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:113684122C>T	uc003eax.2	-	17	2838	c.2691G>A	c.(2689-2691)CAG>CAA	p.Q897Q		NM_020817	NP_065868	Q8NCU4	K1407_HUMAN	hypothetical protein LOC57577	897										ovary(2)	2						TACGAAGTTGCTGTCGCCTTT	0.408																0.351562	268.666533	273.644942	90	166	KEEP	---	---	---	---	47	53	101	110	-1	capture	Silent	SNP	113684122	113684122	KIAA1407	3	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	8151	251
RAB43	339122	broad.mit.edu	37	3	128813923	128813923	+	Silent	SNP	G	A	A	rs145101068		TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:128813923G>A	uc003eln.1	-	2	581	c.294C>T	c.(292-294)TAC>TAT	p.Y98Y	RAB43_uc003elo.1_Missense_Mutation_p.T314M|RAB43_uc010hsy.1_Silent_p.Y98Y	NM_198490	NP_940892	Q86YS6	RAB43_HUMAN	RAB43 protein	98					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						TGGTGATGTCGTAGGCAAGGA	0.572																0.028302	-18.565958	7.405625	3	103	KEEP	---	---	---	---	1	2	67	75	-1	capture	Silent	SNP	128813923	128813923	RAB43	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12840	251
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	G	G	rs121913279		TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178952085A>G	uc003fjk.2	+	21	3297	c.3140A>G	c.(3139-3141)CAT>CGT	p.H1047R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1047	PI3K/PI4K.		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATGATGCACATCATGGTGGC	0.378	Colon(199;1504 1750 3362 26421 31210 32040)	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57	p.H1047R(LS180-Tumor)|p.H1047R(UACC893-Tumor)|p.H1047R(HSC2-Tumor)|p.H1047R(BT20-Tumor)|p.H1047R(SKOV3-Tumor)|p.H1047L(GP2D-Tumor)|p.H1047R(T47D-Tumor)|p.H1047R(SNU840-Tumor)|p.H1047R(CAL148-Tumor)|p.H1047R(HCT116-Tumor)|p.H1047R(SNUC5-Tumor)|p.H1047R(MCAS-Tumor)|p.H1047R(SNU1076-Tumor)|p.H1047R(HCC1954-Tumor)|p.H1047L(OAW42-Tumor)|p.H1047L(EFM19-Tumor)|p.H1047R(RKO-Tumor)|p.H1047R(CAL29-Tumor)|p.H1047R(CAL33-Tumor)|p.H1047R(MDAMB453-Tumor)|p.H1047R(NCIH1048-Tumor)|p.H1047R(SNU407-Tumor)	621	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			0.427746	238.528294	239.314784	74	99	KEEP	---	---	---	---	34	51	41	69	-1	capture	Missense_Mutation	SNP	178952085	178952085	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	11816	251
SPON2	10417	broad.mit.edu	37	4	1161329	1161329	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1161329G>A	uc003gcn.3	-	5	954	c.927C>T	c.(925-927)CCC>CCT	p.P309P	SPON2_uc003gco.3_Silent_p.P309P|SPON2_uc010ibr.2_Silent_p.P309P|SPON2_uc003gcm.1_3'UTR	NM_012445	NP_036577	Q9BUD6	SPON2_HUMAN	spondin 2, extracellular matrix protein	309	TSP type-1.				axon guidance|cell adhesion|innate immune response	proteinaceous extracellular matrix	metal ion binding			central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.00805)	UCEC - Uterine corpus endometrioid carcinoma (64;0.139)|Colorectal(103;0.19)		CGTTGTTGGCGGGCTGGACCC	0.682														OREG0016030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.026316	-21.575316	6.709646	3	111	KEEP	---	---	---	---	0	3	77	99	-1	capture	Silent	SNP	1161329	1161329	SPON2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14975	251
C4orf44	345222	broad.mit.edu	37	4	3251162	3251162	+	Silent	SNP	C	T	T	rs143238822		TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3251162C>T	uc003ggs.2	+	1	396	c.213C>T	c.(211-213)AAC>AAT	p.N71N	C4orf44_uc003ggt.2_Silent_p.N71N	NM_001042690	NP_001036155	Q6ZTZ1	CD044_HUMAN	hypothetical protein LOC345222 isoform a	71											0						CCAAGCGCAACGCCAAGGTGT	0.612																0.37931	31.517069	31.888001	11	18	KEEP	---	---	---	---	9	2	8	11	-1	capture	Silent	SNP	3251162	3251162	C4orf44	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2250	251
HS3ST1	9957	broad.mit.edu	37	4	11401289	11401289	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:11401289T>C	uc003gmq.2	-	2	664	c.341A>G	c.(340-342)CAG>CGG	p.Q114R		NM_005114	NP_005105	O14792	HS3S1_HUMAN	heparan sulfate D-glucosaminyl	114						Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			skin(1)	1						CACTGTGAGCTGGTGTGGCCA	0.617																0.387435	234.979735	237.107977	74	117	KEEP	---	---	---	---	37	45	67	72	-1	capture	Missense_Mutation	SNP	11401289	11401289	HS3ST1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	7288	251
GRSF1	2926	broad.mit.edu	37	4	71691907	71691907	+	Silent	SNP	C	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71691907C>A	uc010iia.1	-	7	1274	c.1191G>T	c.(1189-1191)ACG>ACT	p.T397T	GRSF1_uc011caz.1_Silent_p.T279T|GRSF1_uc003hfs.2_Silent_p.T235T	NM_002092	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1 isoform 1	397					mRNA polyadenylation		mRNA binding|nucleotide binding				0		all_hematologic(202;0.21)	Lung(101;0.235)			GCAGAGAAGACGTAGTTCCAA	0.423																0.061224	-3.413509	6.434861	3	46	KEEP	---	---	---	---	3	0	25	24	-1	capture	Silent	SNP	71691907	71691907	GRSF1	4	C	A	A	A	1	0	0	0	0	0	0	0	1	236	19	4	4	6742	251
TET2	54790	broad.mit.edu	37	4	106155901	106155901	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:106155901T>G	uc003hxk.2	+	3	1188	c.802T>G	c.(802-804)TCG>GCG	p.S268A	TET2_uc011cez.1_Missense_Mutation_p.S289A|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.S268A|TET2_uc003hxi.1_Missense_Mutation_p.S268A	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	268					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CACTCACCCATCGCATACCTC	0.498					111	Mis N|F		MDS								0.35443	96.103271	97.567243	28	51	KEEP	---	---	---	---	15	16	31	20	-1	capture	Missense_Mutation	SNP	106155901	106155901	TET2	4	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	15655	251
ACSL1	2180	broad.mit.edu	37	4	185681554	185681554	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:185681554C>G	uc003iww.2	-	18	2033	c.1739G>C	c.(1738-1740)AGT>ACT	p.S580T	ACSL1_uc011ckm.1_Missense_Mutation_p.S409T|ACSL1_uc003iwt.1_Missense_Mutation_p.S580T|ACSL1_uc003iwu.1_Missense_Mutation_p.S580T|ACSL1_uc011ckn.1_Missense_Mutation_p.S546T|ACSL1_uc003iws.1_Missense_Mutation_p.S140T	NM_001995	NP_001986	P33121	ACSL1_HUMAN	acyl-CoA synthetase long-chain family member 1	580	Cytoplasmic (Potential).				digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AACAGGCTCACTTCGCATGTA	0.443																0.420079	1165.057623	1169.270374	318	439	KEEP	---	---	---	---	160	193	229	252	-1	capture	Missense_Mutation	SNP	185681554	185681554	ACSL1	4	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	177	251
RNASEN	29102	broad.mit.edu	37	5	31508865	31508865	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:31508865C>T	uc003jhg.2	-	9	1809	c.1450G>A	c.(1450-1452)GAG>AAG	p.E484K	RNASEN_uc003jhh.2_Missense_Mutation_p.E447K|RNASEN_uc003jhi.2_Missense_Mutation_p.E447K|RNASEN_uc010iui.1_Missense_Mutation_p.E407K	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	484					gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						GACTCACACTCGGATTCACTG	0.378																0.396226	61.664334	62.163609	21	32	KEEP	---	---	---	---	12	10	19	18	-1	capture	Missense_Mutation	SNP	31508865	31508865	RNASEN	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13309	251
SLC30A5	64924	broad.mit.edu	37	5	68411085	68411085	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:68411085C>G	uc003jvh.2	+	8	835	c.634C>G	c.(634-636)CTG>GTG	p.L212V	SLC30A5_uc003jvj.2_5'Flank|SLC30A5_uc003jvk.2_5'Flank|SLC30A5_uc003jvi.2_Missense_Mutation_p.L41V	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),	212	Helical; (Potential).				cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		ATTGCTAGTACTGGCTTTGTG	0.373																0.101562	18.374144	38.643256	13	115	KEEP	---	---	---	---	6	8	69	70	-1	capture	Missense_Mutation	SNP	68411085	68411085	SLC30A5	5	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	14450	251
PCDHA3	56145	broad.mit.edu	37	5	140180868	140180868	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140180868G>A	uc003lhf.2	+	1	86	c.86G>A	c.(85-87)GGC>GAC	p.G29D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.G29D	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	29					homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGGAGCGGCCAGCTCCAC	0.637																0.031008	-24.585352	6.48065	4	125	KEEP	---	---	---	---	2	2	61	83	-1	capture	Missense_Mutation	SNP	140180868	140180868	PCDHA3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	11428	251
PCDHGA2	56113	broad.mit.edu	37	5	140720212	140720212	+	Silent	SNP	C	T	T	rs150000282	byFrequency	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140720212C>T	uc003ljk.1	+	1	1859	c.1674C>T	c.(1672-1674)AAC>AAT	p.N558N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Silent_p.N558N	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	558	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACGACAACGCGCCCGAGA	0.622																0.456338	481.108281	481.697116	162	193	KEEP	---	---	---	---	86	103	106	117	-1	capture	Silent	SNP	140720212	140720212	PCDHGA2	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11457	251
TRIM26	7726	broad.mit.edu	37	6	30153775	30153775	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30153775C>A	uc003npr.2	-	9	1707	c.1498G>T	c.(1498-1500)GTG>TTG	p.V500L	TRIM26_uc003nps.2_Missense_Mutation_p.V500L|TRIM26_uc010jry.2_Missense_Mutation_p.V230L|TRIM26_uc003npt.2_Missense_Mutation_p.V500L	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	500	B30.2/SPRY.						DNA binding|zinc ion binding			ovary(2)|lung(1)	3						GTGAAAGTCACGGTGCCCCCT	0.627																0.061224	-1.912756	7.931508	3	46	KEEP	---	---	---	---	2	1	22	25	0.333333333333	capture	Missense_Mutation	SNP	30153775	30153775	TRIM26	6	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	16383	251
HLA-DPA1	3113	broad.mit.edu	37	6	33036842	33036842	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33036842G>A	uc003ocs.1	-	3	613	c.582C>T	c.(580-582)TGC>TGT	p.C194C	HLA-DPA1_uc010juk.2_Silent_p.C194C|HLA-DPA1_uc003oct.1_Silent_p.C194C	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	194	Alpha-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						GCTCCACCCTGCAGTCATAGA	0.537																0.367542	409.895329	416.37422	154	265	KEEP	---	---	---	---	70	93	130	160	-1	capture	Silent	SNP	33036842	33036842	HLA-DPA1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	7127	251
FAM83B	222584	broad.mit.edu	37	6	54805390	54805390	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:54805390C>T	uc003pck.2	+	5	1737	c.1621C>T	c.(1621-1623)CGT>TGT	p.R541C		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	541				R -> S (in Ref. 4; BAB70873).						ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					TTCTCGGCTTCGTTCCTCTTT	0.418																0.384615	132.047688	133.413126	45	72	KEEP	---	---	---	---	26	21	27	49	-1	capture	Missense_Mutation	SNP	54805390	54805390	FAM83B	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5580	251
PRIM2	5558	broad.mit.edu	37	6	57498985	57498985	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:57498985G>C	uc003pdx.2	+	14	1336	c.1249G>C	c.(1249-1251)GGG>CGG	p.G417R		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	417					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTAGTAAAGGGGACACATTA	0.299																0.1875	4.885291	6.397159	3	13	KEEP	---	---	---	---	2	2	6	11	-1	capture	Missense_Mutation	SNP	57498985	57498985	PRIM2	6	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	12387	251
AHR	196	broad.mit.edu	37	7	17375305	17375305	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:17375305G>A	uc011jxz.1	+	9	1668	c.1055G>A	c.(1054-1056)CGG>CAG	p.R352Q	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	352	PAC.				apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					ATAGTTTTCCGGCTTCTTACA	0.333																0.292683	32.787179	34.362955	12	29	KEEP	---	---	---	---	7	5	9	20	-1	capture	Missense_Mutation	SNP	17375305	17375305	AHR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	416	251
AOAH	313	broad.mit.edu	37	7	36571798	36571798	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36571798G>A	uc003tfh.3	-	18	1781	c.1380C>T	c.(1378-1380)CAC>CAT	p.H460H	AOAH_uc010kxf.2_Silent_p.H460H|AOAH_uc011kba.1_Silent_p.H428H	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	460					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						ACATCCAGCCGTGGCAGGGGC	0.512																0.319372	167.120473	172.651263	61	130	KEEP	---	---	---	---	27	44	88	78	-1	capture	Silent	SNP	36571798	36571798	AOAH	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	719	251
LAT2	7462	broad.mit.edu	37	7	73630358	73630358	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73630358T>G	uc003uag.2	+	3	603	c.53T>G	c.(52-54)TTG>TGG	p.L18W	RFC2_uc011kfa.1_Intron|LAT2_uc003uah.2_Missense_Mutation_p.L18W|LAT2_uc003uai.2_Missense_Mutation_p.L18W|LAT2_uc010lbo.2_RNA	NM_032464	NP_115853	Q9GZY6	NTAL_HUMAN	linker for activation of T cells family member	18	Helical; Signal-anchor for type III membrane protein; (Potential).				B cell activation|B cell receptor signaling pathway|calcium-mediated signaling|mast cell degranulation	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding				0						CTGGTGCTGTTGGGGGTGGCA	0.637																0.076271	-16.768283	6.311772	9	109	KEEP	---	---	---	---	21	14	76	82	-1	capture	Missense_Mutation	SNP	73630358	73630358	LAT2	7	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	8565	251
SMO	6608	broad.mit.edu	37	7	128843306	128843306	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128843306G>A	uc003vor.2	+	2	693	c.413G>A	c.(412-414)CGG>CAG	p.R138Q		NM_005631	NP_005622	Q99835	SMO_HUMAN	smoothened precursor	138	FZ.|Extracellular (Potential).				adenohypophysis development|axon extension involved in axon guidance|canonical Wnt receptor signaling pathway|cardioblast differentiation|central nervous system neuron differentiation|cerebellar cortex morphogenesis|ciliary receptor clustering involved in smoothened signaling pathway|determination of left/right symmetry|dorsal/ventral neural tube patterning|embryonic camera-type eye development|embryonic digestive tract morphogenesis|embryonic neurocranium morphogenesis|embryonic viscerocranium morphogenesis|exocrine pancreas development|facial nerve development|floor plate formation|gonad development|heart morphogenesis|muscle cell fate commitment|negative regulation of apoptosis|neural crest cell migration|neuron fate commitment|neuron projection regeneration|odontogenesis of dentine-containing tooth|osteoblast differentiation|otolith morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of neuroblast proliferation|positive regulation of smoothened signaling pathway|semicircular canal morphogenesis|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation|smoothened signaling pathway involved in ventral spinal cord patterning|spermatogenesis|vasculogenesis	cilium|cytoplasm|integral to membrane|neuronal cell body|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			skin(19)|large_intestine(10)|central_nervous_system(3)|upper_aerodigestive_tract(2)|biliary_tract(1)|lung(1)|liver(1)	37						GAGAATGACCGGGTGGAGCTG	0.672					232	Mis		skin basal cell 								0.107143	2.204355	6.493875	3	25	KEEP	---	---	---	---	1	2	10	16	-1	capture	Missense_Mutation	SNP	128843306	128843306	SMO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14692	251
KEL	3792	broad.mit.edu	37	7	142639595	142639595	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142639595G>A	uc003wcb.2	-	18	2173	c.1963C>T	c.(1963-1965)CGG>TGG	p.R655W		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	655	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					CCATGGTGCCGTAACAGCCTC	0.597																0.129032	5.079398	9.23362	4	27	KEEP	---	---	---	---	2	5	15	19	-1	capture	Missense_Mutation	SNP	142639595	142639595	KEL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	8064	251
AGAP3	116988	broad.mit.edu	37	7	150835302	150835302	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150835302C>T	uc003wjg.1	+	12	1571	c.1568C>T	c.(1567-1569)CCG>CTG	p.P523L	AGAP3_uc003wje.1_Intron|AGAP3_uc003wjj.1_Intron|AGAP3_uc003wjk.1_5'Flank	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	487	PH.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						TGGGCTGGCCCGCGCCCTGAG	0.716																0.075	-0.705235	6.706467	3	37	KEEP	---	---	---	---	3	1	23	21	-1	capture	Missense_Mutation	SNP	150835302	150835302	AGAP3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	369	251
NUB1	51667	broad.mit.edu	37	7	151065966	151065966	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151065966G>A	uc003wjx.2	+	11	1318	c.1313G>A	c.(1312-1314)CGC>CAC	p.R438H	NUB1_uc003wjw.2_Missense_Mutation_p.R414H|NUB1_uc010lqc.2_RNA|uc003wjz.1_5'Flank	NM_016118	NP_057202	Q9Y5A7	NUB1_HUMAN	NEDD8 ultimate buster-1	414	Nuclear localization signal (Probable).				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|response to interferon-gamma|response to tumor necrosis factor|ubiquitin-dependent protein catabolic process	nucleus	protein binding				0			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		ATTACCAACCGCAGAGAGGTA	0.483																0.030928	-16.964699	6.42662	3	94	KEEP	---	---	---	---	1	2	56	54	-1	capture	Missense_Mutation	SNP	151065966	151065966	NUB1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10621	251
CTSB	1508	broad.mit.edu	37	8	11706616	11706616	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11706616C>T	uc003wum.2	-	7	709	c.385G>A	c.(385-387)GTC>ATC	p.V129I	CTSB_uc003wul.2_5'Flank|CTSB_uc011kxl.1_Missense_Mutation_p.V50I|CTSB_uc003wun.2_Missense_Mutation_p.V129I|CTSB_uc003wuo.2_Missense_Mutation_p.V129I|CTSB_uc003wup.2_Missense_Mutation_p.V129I|CTSB_uc003wuq.2_Missense_Mutation_p.V129I|CTSB_uc010lsc.2_Intron|CTSB_uc003wur.2_Missense_Mutation_p.V129I|CTSB_uc003wus.1_Missense_Mutation_p.V129I|CTSB_uc003wut.1_Missense_Mutation_p.V129I|CTSB_uc003wuu.2_5'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein	129					proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		TCCACGCTGACGTGCGCATTG	0.642																0.410714	63.197078	63.590925	23	33	KEEP	---	---	---	---	10	15	14	25	-1	capture	Missense_Mutation	SNP	11706616	11706616	CTSB	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3991	251
FAM92A1	137392	broad.mit.edu	37	8	94713461	94713461	+	Silent	SNP	A	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:94713461A>G	uc010maq.2	+	2	139	c.36A>G	c.(34-36)CAA>CAG	p.Q12Q	FAM92A1_uc003yfu.1_RNA|FAM92A1_uc003yfv.3_RNA	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392	12											0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GGAACGCTCAAACGAAACAAC	0.453																0.375	43.893172	44.331811	12	20	KEEP	---	---	---	---	9	4	11	11	-1	capture	Silent	SNP	94713461	94713461	FAM92A1	8	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	5598	251
PIGO	84720	broad.mit.edu	37	9	35092240	35092240	+	Silent	SNP	G	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35092240G>T	uc003zwd.2	-	7	2040	c.1644C>A	c.(1642-1644)CCC>CCA	p.P548P	PIGO_uc003zwc.1_3'UTR|PIGO_uc003zwe.2_Intron|PIGO_uc003zwf.2_Intron|PIGO_uc003zwg.1_Silent_p.P111P	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	548	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GTAACAGGACGGGCCCAGGGA	0.577																0.04	-10.739123	6.364547	3	72	KEEP	---	---	---	---	1	2	52	36	0.333333333333	capture	Silent	SNP	35092240	35092240	PIGO	9	G	T	T	T	1	0	0	0	0	0	0	0	1	496	39	4	4	11797	251
RUSC2	9853	broad.mit.edu	37	9	35561054	35561054	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35561054C>G	uc003zww.2	+	11	4564	c.4309C>G	c.(4309-4311)CAG>GAG	p.Q1437E	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.Q1437E	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1437						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GGAGAGCCTGCAGGAGCCACA	0.657																0.083333	2.264527	6.468042	2	22	KEEP	---	---	---	---	0	2	10	18	-1	capture	Missense_Mutation	SNP	35561054	35561054	RUSC2	9	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	13643	251
P2RY8	286530	broad.mit.edu	37	X	1584669	1584669	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1584669G>A	uc004cpz.2	-	2	1031	c.783C>T	c.(781-783)ATC>ATT	p.I261I		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	261	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCGGCTCACGATGTGCGCCA	0.612						T	CRLF2	B-ALL|Downs associated ALL								0.372549	108.439075	109.888208	38	64	KEEP	---	---	---	---	18	24	31	36	-1	capture	Silent	SNP	1584669	1584669	P2RY8	23	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	11259	251
GSPT2	23708	broad.mit.edu	37	X	51487887	51487887	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:51487887C>T	uc004dpl.2	+	1	1391	c.1165C>T	c.(1165-1167)CCC>TCC	p.P389S		NM_018094	NP_060564	Q8IYD1	ERF3B_HUMAN	peptide chain release factor 3	389					cell cycle|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|translational termination	cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1	Ovarian(276;0.236)					TCACTTTATGCCCTGCTCAGG	0.393																0.041096	-9.441726	7.100703	3	70	KEEP	---	---	---	---	1	2	33	39	-1	capture	Missense_Mutation	SNP	51487887	51487887	GSPT2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6759	251
PFKFB1	5207	broad.mit.edu	37	X	54986328	54986328	+	Splice_Site	SNP	T	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54986328T>C	uc004dty.1	-	4	389	c.318_splice	c.e4-1	p.K106_splice	PFKFB1_uc010nkd.1_Splice_Site_p.K92_splice|PFKFB1_uc011mol.1_Splice_Site_p.K41_splice	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,						energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						GCGCACTGCCTGAAATAGACC	0.443																0.103448	3.303058	7.843707	3	26	KEEP	---	---	---	---	1	2	12	23	-1	capture	Splice_Site	SNP	54986328	54986328	PFKFB1	23	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	11663	251
IL13RA2	3598	broad.mit.edu	37	X	114248418	114248418	+	Silent	SNP	G	A	A			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:114248418G>A	uc004epx.2	-	5	560	c.435C>T	c.(433-435)TGC>TGT	p.C145C	IL13RA2_uc010nqd.1_Silent_p.C145C	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	145	Extracellular (Potential).|Fibronectin type-III 2.					extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						TGTAATATACGCAATCCATAT	0.328																0.735294	161.779397	165.186805	50	18	KEEP	---	---	---	---	15	37	10	9	-1	capture	Silent	SNP	114248418	114248418	IL13RA2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	7553	251
FGD4	121512	broad.mit.edu	37	12	32791721	32791722	+	Frame_Shift_Ins	INS	-	C	C			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32791721_32791722insC	uc001rkz.2	+	16	2512_2513	c.2035_2036insC	c.(2035-2037)GCCfs	p.A679fs	FGD4_uc001rlc.2_Frame_Shift_Ins_p.A764fs|FGD4_uc001rky.2_Frame_Shift_Ins_p.A431fs|FGD4_uc001rla.2_Frame_Shift_Ins_p.A335fs|FGD4_uc010ske.1_Frame_Shift_Ins_p.A791fs|FGD4_uc001rlb.1_RNA	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	679	PH 2.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CATGTATGGTGCCCCCCAGGTA	0.505																0.32			62	131		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	32791721	32791722	FGD4	12	-	C	C	C	1	0	1	1	0	0	0	0	0	598	46	5	5	5781	251
ALPK2	115701	broad.mit.edu	37	18	56202092	56202092	+	Frame_Shift_Del	DEL	T	-	-			TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56202092delT	uc002lhj.3	-	5	5541	c.5327delA	c.(5326-5328)AAGfs	p.K1776fs	ALPK2_uc002lhk.1_Frame_Shift_Del_p.K1107fs	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1776							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						GCAAGATGGCTTTTTTGGGTC	0.408					343											0.01			9	642		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	56202092	56202092	ALPK2	18	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	545	251
AGXT	189	broad.mit.edu	37	2	241808307	241808308	+	Frame_Shift_Ins	INS	-	C	C	rs115014558	byFrequency	TCGA-41-2572-01	TCGA-41-2572-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:241808307_241808308insC	uc002waa.3	+	1	146_147	c.25_26insC	c.(25-27)ACCfs	p.T9fs	AGXT_uc010zoi.1_Frame_Shift_Ins_p.T9fs	NM_000030	NP_000021	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	9			T -> N (in HP1).		glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	GCTGCTGGTGACCCCCCCCAAG	0.663																0.32			16	34		---	---	---	---						capture_indel	Frame_Shift_Ins	INS	241808307	241808308	AGXT	2	-	C	C	C	1	0	1	1	0	0	0	0	0	130	10	5	5	404	251
