Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11193214	11193214	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11193214C>A	uc001asd.2	-	38	5408	c.5287G>T	c.(5287-5289)GGC>TGC	p.G1763C	MTOR_uc001asc.2_5'Flank	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1763	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TCATTGATGCCCTGTAGATTC	0.542													23	78	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11193215	11193215	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11193215C>G	uc001asd.2	-	38	5407	c.5286G>C	c.(5284-5286)CAG>CAC	p.Q1762H	MTOR_uc001asc.2_5'Flank	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1762	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CATTGATGCCCTGTAGATTCA	0.542													23	77	---	---	---	---	PASS
TAS1R2	80834	broad.mit.edu	37	1	19181214	19181214	+	Silent	SNP	C	T	T	rs146100319		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19181214C>T	uc001bba.1	-	3	751	c.750G>A	c.(748-750)ACG>ACA	p.T250T		NM_152232	NP_689418	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2 precursor	250	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste	plasma membrane	protein heterodimerization activity|taste receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GCTCCTCTGACGTCATGTTCT	0.652													5	24	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22927417	22927417	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22927417C>A	uc001bfx.1	+	15	2690	c.2565C>A	c.(2563-2565)TAC>TAA	p.Y855*		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	855	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGAGGGGTACCGCCTGCCCG	0.701													22	54	---	---	---	---	PASS
C1orf128	57095	broad.mit.edu	37	1	24113866	24113866	+	Nonstop_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24113866A>T	uc001bhq.2	+	6	766	c.636A>T	c.(634-636)TAA>TAT	p.*212Y	C1orf128_uc010oeb.1_Nonstop_Mutation_p.*119Y	NM_020362	NP_065095	Q9GZP4	PITH1_HUMAN	chromosome 1 open reading frame 128	212											0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.0034)|all_lung(284;0.00519)|Breast(348;0.0222)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;1.97e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		TTATTTCCTAAGGGCTGGCCA	0.542													14	62	---	---	---	---	PASS
CNR2	1269	broad.mit.edu	37	1	24202075	24202075	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24202075A>T	uc001bif.2	-	2	160	c.33T>A	c.(31-33)AAT>AAA	p.N11K		NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	11	Extracellular (Potential).				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)	CCTTGGAGCCATTGGCTATCT	0.512													29	154	---	---	---	---	PASS
SESN2	83667	broad.mit.edu	37	1	28601391	28601391	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28601391G>T	uc001bps.2	+	8	1429	c.1076G>T	c.(1075-1077)GGT>GTT	p.G359V		NM_031459	NP_113647	P58004	SESN2_HUMAN	sestrin 2	359					cell cycle arrest	cytoplasm|nucleus				skin(3)|ovary(2)|pancreas(1)|lung(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		TACCCTGAGGGTGGGCAGCTG	0.572													23	86	---	---	---	---	PASS
STK40	83931	broad.mit.edu	37	1	36820883	36820883	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36820883T>A	uc001cak.1	-	6	901	c.494A>T	c.(493-495)AAG>ATG	p.K165M	STK40_uc001cal.1_Missense_Mutation_p.K170M|STK40_uc001cam.1_Missense_Mutation_p.K165M|STK40_uc009vva.1_Missense_Mutation_p.K165M|STK40_uc001can.1_Missense_Mutation_p.K165M	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	165	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)				CCTCTTCTCCTTGATGACGTA	0.582													53	134	---	---	---	---	PASS
MUTYH	4595	broad.mit.edu	37	1	45796905	45796905	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45796905C>A	uc001cnm.2	-	14	1632	c.1416G>T	c.(1414-1416)TGG>TGT	p.W472C	MUTYH_uc009vxn.2_Missense_Mutation_p.W297C|MUTYH_uc001cnf.2_Missense_Mutation_p.W447C|MUTYH_uc009vxo.2_Missense_Mutation_p.W447C|MUTYH_uc001cng.2_Missense_Mutation_p.W458C|MUTYH_uc001cnj.2_Missense_Mutation_p.W355C|MUTYH_uc001cni.2_Missense_Mutation_p.W447C|MUTYH_uc001cnh.2_Missense_Mutation_p.W448C|MUTYH_uc001cno.2_Missense_Mutation_p.W355C|MUTYH_uc001cnk.2_Missense_Mutation_p.W332C|MUTYH_uc010oll.1_Missense_Mutation_p.W156C|MUTYH_uc001cnl.2_Missense_Mutation_p.W461C|MUTYH_uc009vxp.2_Missense_Mutation_p.W475C|MUTYH_uc001cnn.2_Missense_Mutation_p.W462C	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1	472	Nudix hydrolase.				depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					CCTGCGTCAGCCAGCGAGCAC	0.507			Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				28	100	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52703701	52703701	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52703701A>T	uc001cto.2	+	4	784	c.612A>T	c.(610-612)GAA>GAT	p.E204D	ZFYVE9_uc001ctn.2_Missense_Mutation_p.E204D|ZFYVE9_uc001ctp.2_Missense_Mutation_p.E204D	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	204					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						AGTCCACTGAAAAAGATATGA	0.343													19	61	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82447526	82447526	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82447526C>G	uc001dit.3	+	18	3278	c.3097C>G	c.(3097-3099)CTT>GTT	p.L1033V	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.L1033V|LPHN2_uc001div.2_Missense_Mutation_p.L1033V|LPHN2_uc009wcd.2_Missense_Mutation_p.L1033V|LPHN2_uc001diw.2_Missense_Mutation_p.L617V|LPHN2_uc009wce.1_Missense_Mutation_p.L134V	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1046	Helical; Name=6; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TCTTCTGTGTCTTCTTGGCCT	0.403													61	249	---	---	---	---	PASS
PRKACB	5567	broad.mit.edu	37	1	84544037	84544037	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84544037G>T	uc001djj.2	+	1	293	c.29G>T	c.(28-30)GGC>GTC	p.G10V	PRKACB_uc001djh.1_RNA|PRKACB_uc001dji.2_Missense_Mutation_p.G10V	NM_002731	NP_002722	P22694	KAPCB_HUMAN	cAMP-dependent protein kinase catalytic subunit	10					activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|regulation of insulin secretion|synaptic transmission|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|magnesium ion binding|protein binding			lung(2)|ovary(1)	3				all cancers(265;0.00536)|Epithelial(280;0.0161)|OV - Ovarian serous cystadenocarcinoma(397;0.141)		GCCAAGAAAGGCAGCGAGGTG	0.711													3	31	---	---	---	---	PASS
ODF2L	57489	broad.mit.edu	37	1	86814554	86814554	+	3'UTR	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86814554T>C	uc001dll.1	-	18					ODF2L_uc001dlm.1_3'UTR|ODF2L_uc001dln.2_Missense_Mutation_p.Q605R|ODF2L_uc001dlo.2_Missense_Mutation_p.Q474R|ODF2L_uc001dlp.2_Missense_Mutation_p.Q581R|ODF2L_uc010osg.1_Missense_Mutation_p.Q552R	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform							centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		TTCCTGATGTTGTGCTTTCTA	0.274													10	40	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94546254	94546254	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94546254C>A	uc001dqh.2	-	8	983	c.879G>T	c.(877-879)ATG>ATT	p.M293I	ABCA4_uc010otn.1_Missense_Mutation_p.M293I	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	293	Extracellular.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GCAAGTCCTGCATACTCGGCC	0.517													26	72	---	---	---	---	PASS
LCE5A	254910	broad.mit.edu	37	1	152484143	152484143	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152484143C>T	uc001ezy.2	+	2	309	c.133C>T	c.(133-135)CCA>TCA	p.P45S	CRCT1_uc001ezz.2_5'Flank	NM_178438	NP_848525	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	45	Cys-rich.				keratinization					ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCCCATGCCCACCTCCAGT	0.502													20	66	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154543919	154543919	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154543919C>T	uc001ffg.2	+	5	884	c.620C>T	c.(619-621)GCG>GTG	p.A207V		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	207	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	GACATCGTGGCGCTGCCGGGC	0.592													15	68	---	---	---	---	PASS
FLAD1	80308	broad.mit.edu	37	1	154965044	154965044	+	Intron	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154965044A>G	uc001fgf.1	+						FLAD1_uc001fge.1_Intron|FLAD1_uc001fgg.1_Intron|FLAD1_uc001fgh.1_Missense_Mutation_p.Q140R|LENEP_uc001fgi.2_5'Flank	NM_025207	NP_079483	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase isoform						FAD biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|FMN adenylyltransferase activity			ovary(2)|skin(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TACATAGAGCAAGCTATACCA	0.522													16	27	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156639957	156639957	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156639957G>T	uc001fpq.2	-	4	4156	c.4023C>A	c.(4021-4023)GGC>GGA	p.G1341G		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	1341	Tail.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGGCCTCAAGGCCCTCGGAAG	0.537													24	96	---	---	---	---	PASS
KCNJ9	3765	broad.mit.edu	37	1	160054285	160054285	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160054285C>A	uc001fuy.1	+	2	707	c.465C>A	c.(463-465)GGC>GGA	p.G155G		NM_004983	NP_004974	Q92806	IRK9_HUMAN	potassium inwardly-rectifying channel subfamily	155	Helical; Name=M2; (By similarity).				synaptic transmission	integral to membrane|plasma membrane	G-protein activated inward rectifier potassium channel activity|protein binding			ovary(1)|skin(1)	2	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCATGGTGGGCTGCATGTTCG	0.667													17	28	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190195413	190195413	+	Missense_Mutation	SNP	G	T	T	rs148869641		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190195413G>T	uc001gse.1	-	6	992	c.760C>A	c.(760-762)CGT>AGT	p.R254S	FAM5C_uc010pot.1_Missense_Mutation_p.R152S	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	254						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TGTACAAAACGTTCCTGAAGA	0.353													11	54	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203017755	203017755	+	5'Flank	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203017755G>T	uc001gyz.2	+						PPFIA4_uc009xaj.2_Silent_p.L574L|PPFIA4_uc010pqf.1_Silent_p.L130L|PPFIA4_uc001gza.2_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						ACAAGCGGCTGTCGGACACAG	0.662													9	7	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220809369	220809369	+	Splice_Site	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220809369G>C	uc001hmn.3	+	13	2067	c.1470_splice	c.e13+1	p.S490_splice	MARK1_uc009xdw.2_Splice_Site_p.S490_splice|MARK1_uc010pun.1_Splice_Site_p.S490_splice|MARK1_uc001hmm.3_Splice_Site_p.S468_splice	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1						intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		TATTCCAAGTGTGAGTAAATA	0.333													6	41	---	---	---	---	PASS
SUSD4	55061	broad.mit.edu	37	1	223465960	223465960	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223465960C>T	uc001hnx.2	-	2	816	c.182G>A	c.(181-183)GGC>GAC	p.G61D	SUSD4_uc001hny.3_Missense_Mutation_p.G61D|SUSD4_uc010puw.1_5'UTR|SUSD4_uc001hnz.2_Missense_Mutation_p.G61D|SUSD4_uc010pux.1_Intron	NM_017982	NP_060452	Q5VX71	SUSD4_HUMAN	sushi domain containing 4 isoform a	61	Sushi 1.|Extracellular (Potential).					integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)		CTCGGGAATGCCGGGGTCAGC	0.522													3	72	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237801714	237801714	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237801714G>T	uc001hyl.1	+	45	6970	c.6850G>T	c.(6850-6852)GGC>TGC	p.G2284C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2284	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGTGTCTAAGGGCTATCCAGA	0.428													48	192	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248262831	248262831	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248262831C>T	uc001ids.2	+	3	491	c.154C>T	c.(154-156)CCT>TCT	p.P52S		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	52	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CCACGTGGATCCTCGTCTCCA	0.498													44	113	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248344136	248344136	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248344136C>T	uc010pzf.1	+	1	849	c.849C>T	c.(847-849)CCC>CCT	p.P283P		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCCTCACTCCCATGCTGAATC	0.483													41	140	---	---	---	---	PASS
OR2T6	254879	broad.mit.edu	37	1	248551173	248551173	+	Silent	SNP	C	A	A	rs151042656	byFrequency	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551173C>A	uc001iei.1	+	1	264	c.264C>A	c.(262-264)GGC>GGA	p.G88G		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.G88G(1)		ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCTCATGGGCGAGGGGACCA	0.527													33	73	---	---	---	---	PASS
OR2T5	401993	broad.mit.edu	37	1	248651974	248651974	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248651974G>T	uc001iem.1	+	1	85	c.85G>T	c.(85-87)GCT>TCT	p.A29S		NM_001004697	NP_001004697	Q6IEZ7	OR2T5_HUMAN	olfactory receptor, family 2, subfamily T,	29	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAACATCCAGCTCTACTTAG	0.507													23	130	---	---	---	---	PASS
FAM49A	81553	broad.mit.edu	37	2	16742721	16742721	+	Intron	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16742721C>A	uc010exm.1	-						FAM49A_uc002rck.1_Intron	NM_030797	NP_110424	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CCCAGGGACTCACGTGCATGT	0.468													18	40	---	---	---	---	PASS
HADHB	3032	broad.mit.edu	37	2	26502066	26502066	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26502066G>T	uc002rgz.2	+	9	945	c.694G>T	c.(694-696)GCT>TCT	p.A232S	HADHB_uc010ykv.1_Missense_Mutation_p.A210S|HADHB_uc010ykw.1_Missense_Mutation_p.A217S|HADHB_uc002rha.2_Intron|HADHB_uc010ykx.1_Missense_Mutation_p.A158S	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta	232					fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGACTGGCCGCTGCCTTTGC	0.542													30	109	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32740406	32740406	+	Missense_Mutation	SNP	G	T	T	rs112352145		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32740406G>T	uc010ezu.2	+	55	11052	c.10918G>T	c.(10918-10920)GCT>TCT	p.A3640S		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3640					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GAGGAGTCTGGCTAGTTTCTG	0.438													14	48	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32750596	32750596	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32750596A>T	uc010ezu.2	+	59	11955	c.11821A>T	c.(11821-11823)AGG>TGG	p.R3941W		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	3941					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CAGGAGGGGGAGGACAATACC	0.458													14	62	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50149153	50149153	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50149153C>A	uc010fbp.2	-	6	2065	c.1258G>T	c.(1258-1260)GAG>TAG	p.E420*	NRXN1_uc002rxb.3_Nonsense_Mutation_p.E1154*|NRXN1_uc010fbq.2_Nonsense_Mutation_p.E1525*|NRXN1_uc002rxe.3_Nonsense_Mutation_p.E1455*|NRXN1_uc010yon.1_Nonsense_Mutation_p.E120*|NRXN1_uc002rxa.3_Nonsense_Mutation_p.E117*	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	420	Cytoplasmic (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GGTTGTTTCTCCTTTACAACA	0.413													26	75	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99155388	99155388	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99155388C>T	uc002syy.2	+	9	1007	c.614C>T	c.(613-615)GCG>GTG	p.A205V	INPP4A_uc010yvj.1_Missense_Mutation_p.A205V|INPP4A_uc010yvk.1_Missense_Mutation_p.A205V|INPP4A_uc002syx.2_Missense_Mutation_p.A205V|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	205					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						TTGACGGAGGCGTTAGGAATC	0.438													6	25	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125284887	125284887	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125284887C>A	uc002tno.2	+	10	1864	c.1500C>A	c.(1498-1500)TCC>TCA	p.S500S	CNTNAP5_uc010flu.2_Silent_p.S501S	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	500	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCACCGATTCCCAATGTTTAA	0.463													11	62	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136399367	136399367	+	Intron	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136399367A>T	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		ACAGGTTGGTATCCAGAAAAA	0.383													16	50	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141116407	141116407	+	Missense_Mutation	SNP	T	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141116407T>G	uc002tvj.1	-	73	12212	c.11240A>C	c.(11239-11241)GAT>GCT	p.D3747A		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3747	Extracellular (Potential).|LDL-receptor class A 31.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTGATCTTCATCTGAATTGTC	0.388										TSP Lung(27;0.18)			4	129	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141660699	141660699	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141660699G>T	uc002tvj.1	-	23	4528	c.3556C>A	c.(3556-3558)CAC>AAC	p.H1186N	LRP1B_uc010fnl.1_Missense_Mutation_p.H368N	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1186	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACAGAACAGTGGTTGCTACAG	0.388										TSP Lung(27;0.18)			9	45	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141665614	141665614	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141665614C>T	uc002tvj.1	-	22	4324	c.3352G>A	c.(3352-3354)GGA>AGA	p.G1118R	LRP1B_uc010fnl.1_Missense_Mutation_p.G300R	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1118	Extracellular (Potential).|LDL-receptor class A 9.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCAATATCTCCATCACACACC	0.413										TSP Lung(27;0.18)			16	60	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141762970	141762970	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141762970G>T	uc002tvj.1	-	15	3409	c.2437C>A	c.(2437-2439)CCA>ACA	p.P813T	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	813	Extracellular (Potential).|EGF-like 3.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGGCCTCCTGGGATAGCCAAG	0.428										TSP Lung(27;0.18)			16	66	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145156530	145156530	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145156530G>T	uc002tvu.2	-	8	2704	c.2224C>A	c.(2224-2226)CCA>ACA	p.P742T	ZEB2_uc002tvv.2_Missense_Mutation_p.P736T|ZEB2_uc010zbm.1_Missense_Mutation_p.P713T|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.P771T	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	742						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GCTATAGATGGTGATGTTATG	0.418													60	205	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162760576	162760576	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162760576G>A	uc002ubx.3	+	13	1689	c.1505G>A	c.(1504-1506)AGA>AAA	p.R502K	SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.R472K|SLC4A10_uc010zcs.1_Missense_Mutation_p.R483K	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	502	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						AGTGACTTCAGAGATGCTTTC	0.433													4	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186671346	186671346	+	Intron	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186671346T>C	uc002upm.2	+						uc010zfu.1_Silent_p.P269P					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		CAGATGATCCTCAAAACCAAC	0.264													14	41	---	---	---	---	PASS
CALCRL	10203	broad.mit.edu	37	2	188210986	188210986	+	Silent	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188210986A>T	uc002upv.3	-	15	1859	c.1311T>A	c.(1309-1311)CCT>CCA	p.P437P	CALCRL_uc010frt.2_Silent_p.P437P	NM_005795	NP_005786	Q16602	CALRL_HUMAN	calcitonin receptor-like precursor	437	Cytoplasmic (Potential).					integral to plasma membrane				lung(3)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			AGTGTTCACTAGGACAGTCAT	0.363													10	41	---	---	---	---	PASS
DIRC1	116093	broad.mit.edu	37	2	189599601	189599601	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189599601G>T	uc002uqi.1	-	2	318	c.47C>A	c.(46-48)CCC>CAC	p.P16H		NM_052952	NP_443184	Q969H9	DIRC1_HUMAN	disrupted in renal carcinoma 1	16											0			OV - Ovarian serous cystadenocarcinoma(117;0.00842)|Epithelial(96;0.102)			GTCTGTGGTGGGCAGTGATGT	0.522													19	66	---	---	---	---	PASS
FAM117B	150864	broad.mit.edu	37	2	203622139	203622139	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203622139G>T	uc010zhx.1	+	6	1318	c.1308G>T	c.(1306-1308)CTG>CTT	p.L436L		NM_173511	NP_775782	Q6P1L5	F117B_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	436										ovary(1)	1						CGGATGACCTGCTTGTTGATC	0.468													15	44	---	---	---	---	PASS
GPR1	2825	broad.mit.edu	37	2	207040914	207040914	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207040914G>C	uc002vbl.3	-	3	1444	c.1058C>G	c.(1057-1059)ACA>AGA	p.T353R	GPR1_uc010fue.2_Missense_Mutation_p.T353R|GPR1_uc010fuf.2_Missense_Mutation_p.T353R	NM_005279	NP_005270	P46091	GPR1_HUMAN	G protein-coupled receptor 1	353	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TTATTGAGCTGTTTCCAGGAG	0.413													8	33	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10400554	10400554	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10400554G>A	uc003bvt.2	-	14	2396	c.1957C>T	c.(1957-1959)CGG>TGG	p.R653W	ATP2B2_uc003bvv.2_Missense_Mutation_p.R608W|ATP2B2_uc003bvw.2_Missense_Mutation_p.R608W|ATP2B2_uc010hdo.2_Missense_Mutation_p.R358W	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	653	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						ATCTCGTCCCGGTCGCGGGGC	0.637													5	52	---	---	---	---	PASS
FBLN2	2199	broad.mit.edu	37	3	13611931	13611931	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13611931G>T	uc011avb.1	+	2	201	c.76G>T	c.(76-78)GCA>TCA	p.A26S	FBLN2_uc011auz.1_Missense_Mutation_p.A52S|FBLN2_uc011ava.1_Missense_Mutation_p.A26S|FBLN2_uc011avc.1_Missense_Mutation_p.A26S	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	26						proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CAGCGTGGCCGCAGCTGCCCC	0.721													4	6	---	---	---	---	PASS
NR2C2	7182	broad.mit.edu	37	3	15064835	15064835	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15064835G>T	uc003bzj.3	+	6	902	c.685G>T	c.(685-687)GCA>TCA	p.A229S	NR2C2_uc003bzi.2_Missense_Mutation_p.A248S	NM_003298	NP_003289	P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	229					cell differentiation|nervous system development|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|spermatogenesis	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding				0						CACGTTTGTGGCAGACAAAGA	0.507													4	136	---	---	---	---	PASS
LRRC3B	116135	broad.mit.edu	37	3	26751354	26751354	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26751354C>A	uc003cdp.2	+	2	780	c.191C>A	c.(190-192)CCT>CAT	p.P64H	LRRC3B_uc003cdq.2_Missense_Mutation_p.P64H	NM_052953	NP_443185	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B precursor	64	LRRNT.					integral to membrane				pancreas(2)|ovary(1)|skin(1)	4						GATCTTCCTCCTGAAACAGTC	0.428													21	59	---	---	---	---	PASS
STAC	6769	broad.mit.edu	37	3	36524595	36524595	+	Intron	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36524595G>T	uc003cgh.1	+						STAC_uc010hgd.1_Intron|STAC_uc011aya.1_Intron	NM_003149	NP_003140	Q99469	STAC_HUMAN	SH3 and cysteine rich domain						intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4						GTAAGGGCTTGTGCCAGGAGT	0.587													11	31	---	---	---	---	PASS
USP19	10869	broad.mit.edu	37	3	49146522	49146522	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49146522G>A	uc003cwd.1	-	26	3987	c.3826C>T	c.(3826-3828)CCC>TCC	p.P1276S	USP19_uc003cwa.2_Intron|USP19_uc003cvz.3_Intron|USP19_uc011bcg.1_Intron|USP19_uc003cwb.2_Intron|USP19_uc003cwc.1_Missense_Mutation_p.P1034S|USP19_uc011bch.1_Missense_Mutation_p.P1377S	NM_006677	NP_006668	O94966	UBP19_HUMAN	ubiquitin thioesterase 19	1276	Cytoplasmic (Potential).				ER-associated protein catabolic process|positive regulation of cell cycle process|protein deubiquitination|regulation of protein stability|response to endoplasmic reticulum stress|skeletal muscle atrophy	endoplasmic reticulum membrane|integral to membrane	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(4)|breast(2)|lung(1)	7				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGTGGTAGGGGGCCCACCCAG	0.672													3	13	---	---	---	---	PASS
NT5DC2	64943	broad.mit.edu	37	3	52568677	52568677	+	5'UTR	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52568677G>T	uc003deo.2	-	1					NT5DC2_uc003den.2_5'Flank|NT5DC2_uc010hmi.2_5'Flank|NT5DC2_uc010hmj.2_5'UTR|LOC440957_uc003dep.2_5'Flank	NM_022908	NP_075059	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2 isoform 2								hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		CATTTCTTCTGCTCAGATCCG	0.597													35	122	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77147370	77147370	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77147370C>A	uc003dpy.3	+	2	910	c.267C>A	c.(265-267)TCC>TCA	p.S89S	ROBO2_uc003dpz.2_Silent_p.S89S|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.S89S	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	89	Ig-like C2-type 1.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGCGGATCCTTATTCTTCT	0.557													23	79	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100378607	100378607	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100378607C>A	uc003duc.2	+	14	2167	c.1899C>A	c.(1897-1899)ACC>ACA	p.T633T	GPR128_uc011bhc.1_Silent_p.T334T|GPR128_uc003dud.2_Silent_p.T156T	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	633	Helical; Name=5; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						TACCTGTAACCATTATCCTCA	0.403													20	72	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102183089	102183089	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102183089T>A	uc003dvs.1	+	14	1637	c.755T>A	c.(754-756)TTC>TAC	p.F252Y	ZPLD1_uc003dvt.1_Missense_Mutation_p.F268Y|ZPLD1_uc011bhg.1_Missense_Mutation_p.F252Y	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	252	ZP.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TATGATCTTTTCCTTAGGTAA	0.318													25	97	---	---	---	---	PASS
DRD3	1814	broad.mit.edu	37	3	113878657	113878657	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113878657C>T	uc003ebd.2	-	4	751	c.328G>A	c.(328-330)GAT>AAT	p.D110N	DRD3_uc010hqn.1_Missense_Mutation_p.D110N|DRD3_uc003ebb.1_Missense_Mutation_p.D110N|DRD3_uc003ebc.1_Missense_Mutation_p.D110N	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	110	Helical; Name=3.	Agonist.			activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)	ATCATGACATCCAGGGTGACA	0.502													61	107	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121228898	121228898	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121228898C>A	uc003eee.3	-	11	1933	c.1804G>T	c.(1804-1806)GAT>TAT	p.D602Y		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	602					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TCTGTTCCATCACTGGCTTCT	0.408								DNA_polymerases_(catalytic_subunits)					39	108	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140251217	140251217	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140251217G>A	uc003etn.2	+	9	1586	c.1396G>A	c.(1396-1398)GTA>ATA	p.V466I	CLSTN2_uc003etm.2_Missense_Mutation_p.V466I	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	466	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GTTTCCTGTGGTAACCTTATA	0.408										HNSCC(16;0.037)			14	118	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147113994	147113994	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147113994G>T	uc003ewd.1	-	3	606	c.333C>A	c.(331-333)CAC>CAA	p.H111Q	ZIC4_uc003ewc.1_Missense_Mutation_p.H41Q|ZIC4_uc011bno.1_Missense_Mutation_p.H161Q	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	111						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						CGCCAGGACCGTGGGGCGCAG	0.701													11	33	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128391	147128391	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128391G>T	uc003ewe.2	+	1	1211	c.492G>T	c.(490-492)AGG>AGT	p.R164S		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	164					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GGCAGATGAGGCTCGGCTTCT	0.701													16	20	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147130402	147130402	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147130402G>T	uc003ewe.2	+	2	1799	c.1080G>T	c.(1078-1080)AAG>AAT	p.K360N		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	360					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CGAGCGACAAGCCCTATCTTT	0.582													15	116	---	---	---	---	PASS
CPA3	1359	broad.mit.edu	37	3	148596536	148596536	+	Splice_Site	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148596536G>T	uc003ewm.2	+	5	526	c.474_splice	c.e5+1	p.K158_splice		NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor						proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TGTTCTGAAGGTAAAAATAAC	0.308													27	71	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169847268	169847268	+	Missense_Mutation	SNP	T	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169847268T>G	uc010hws.1	-	8	1020	c.956A>C	c.(955-957)AAA>ACA	p.K319T	PHC3_uc003fgl.2_Missense_Mutation_p.K331T|PHC3_uc011bpq.1_Missense_Mutation_p.K278T|PHC3_uc011bpr.1_Missense_Mutation_p.K245T	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	319					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			ATGGGAAACTTTGGAAGGTGG	0.408													58	141	---	---	---	---	PASS
ABCC5	10057	broad.mit.edu	37	3	183696311	183696311	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183696311A>T	uc003fmg.2	-	9	1441	c.1276T>A	c.(1276-1278)TTC>ATC	p.F426I	ABCC5_uc011bqt.1_5'UTR|ABCC5_uc010hxl.2_Missense_Mutation_p.F426I	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	426	ABC transmembrane type-1 1.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GTCAGATCGAAGCCCAGGGTC	0.443													21	75	---	---	---	---	PASS
CLDN1	9076	broad.mit.edu	37	3	190039968	190039968	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190039968C>G	uc003fsh.2	-	1	248	c.28G>C	c.(28-30)GGC>CGC	p.G10R		NM_021101	NP_066924	O95832	CLD1_HUMAN	claudin 1	10	Helical; (Potential).				calcium-independent cell-cell adhesion|interspecies interaction between organisms	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity			lung(1)	1	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		AGAATGAAGCCCAACAGCTGC	0.657													13	48	---	---	---	---	PASS
AMBN	258	broad.mit.edu	37	4	71472446	71472446	+	Nonstop_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71472446G>C	uc003hfl.2	+	13	1418	c.1343G>C	c.(1342-1344)TGA>TCA	p.*448S		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	448					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			CAAGAGCCCTGACAGCTCTAA	0.483													22	25	---	---	---	---	PASS
ANTXR2	118429	broad.mit.edu	37	4	80990634	80990634	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80990634C>T	uc003hlz.3	-	3	1015	c.252G>A	c.(250-252)GTG>GTA	p.V84V	ANTXR2_uc003hly.3_Silent_p.V84V|ANTXR2_uc003hlx.1_RNA|ANTXR2_uc010ijn.2_Silent_p.V84V	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2	84	Extracellular (Potential).|VWFA.					endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1						GAGAAGAAAACACAATGAAAG	0.313									Juvenile_Hyaline_Fibromatosis				5	10	---	---	---	---	PASS
MAPK10	5602	broad.mit.edu	37	4	86988994	86988994	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86988994C>A	uc003hpq.2	-	9	984	c.917G>T	c.(916-918)GGA>GTA	p.G306V	MAPK10_uc010ikg.2_Missense_Mutation_p.G268V|MAPK10_uc003hpr.2_Missense_Mutation_p.G268V|MAPK10_uc003hps.2_Missense_Mutation_p.G306V|MAPK10_uc003hpt.2_Missense_Mutation_p.G306V|MAPK10_uc003hpu.2_Missense_Mutation_p.G306V|MAPK10_uc003hpv.2_Missense_Mutation_p.G161V|MAPK10_uc003hpn.2_Missense_Mutation_p.G54V|MAPK10_uc003hpo.2_Missense_Mutation_p.G161V|MAPK10_uc011ccw.1_Missense_Mutation_p.G192V|MAPK10_uc003hpp.2_Missense_Mutation_p.G161V	NM_138982	NP_620448	P53779	MK10_HUMAN	mitogen-activated protein kinase 10 isoform 2	306	Protein kinase.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GAAGGTGAGTCCCGCATACTT	0.458													22	36	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114277038	114277038	+	Missense_Mutation	SNP	A	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114277038A>C	uc003ibe.3	+	38	7364	c.7264A>C	c.(7264-7266)AGC>CGC	p.S2422R	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Intron|ANK2_uc011cgb.1_Missense_Mutation_p.S2437R	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2389					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CGAAGTCCTCAGCGCTGTGGC	0.483													9	55	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32101331	32101331	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32101331A>G	uc003jhl.2	+	24	8727	c.8339A>G	c.(8338-8340)AAA>AGA	p.K2780R	PDZD2_uc003jhm.2_Missense_Mutation_p.K2780R|PDZD2_uc003jhn.2_RNA	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2780	PDZ 6.				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TTGGTCATTAAAAGAGTGTAC	0.468													15	32	---	---	---	---	PASS
MTMR12	54545	broad.mit.edu	37	5	32274181	32274181	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32274181C>A	uc003jhq.2	-	3	360	c.190G>T	c.(190-192)GAA>TAA	p.E64*	MTMR12_uc010iuk.2_Nonsense_Mutation_p.E64*|MTMR12_uc010iul.2_Nonsense_Mutation_p.E64*	NM_001040446	NP_001035536	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	64						cytoplasm	phosphatase activity			ovary(1)	1						CAGGAATCTTCCTGGACATAC	0.458													35	105	---	---	---	---	PASS
CAPSL	133690	broad.mit.edu	37	5	35921196	35921196	+	Silent	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35921196T>A	uc003jjt.1	-	2	122	c.27A>T	c.(25-27)CGA>CGT	p.R9R	CAPSL_uc003jju.1_Silent_p.R9R	NM_001042625	NP_001036090	Q8WWF8	CAPSL_HUMAN	calcyphosine-like	9						cytoplasm	calcium ion binding			skin(1)	1	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			TCGCCATCTCTCGGTCATGGC	0.612													19	45	---	---	---	---	PASS
IL31RA	133396	broad.mit.edu	37	5	55195757	55195757	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55195757C>A	uc003jql.2	+	8	931	c.866C>A	c.(865-867)GCC>GAC	p.A289D	IL31RA_uc003jqk.2_Missense_Mutation_p.A289D|IL31RA_uc011cqj.1_Missense_Mutation_p.A147D|IL31RA_uc003jqm.2_Missense_Mutation_p.A257D|IL31RA_uc003jqn.2_Missense_Mutation_p.A289D|IL31RA_uc010iwa.1_Missense_Mutation_p.A257D|IL31RA_uc003jqo.2_Missense_Mutation_p.A147D	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	257	Extracellular (Potential).|Fibronectin type-III 3.				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				GCAAGAGGAGCCCCAGTCCTA	0.433													12	64	---	---	---	---	PASS
DEPDC1B	55789	broad.mit.edu	37	5	59893658	59893658	+	Silent	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59893658T>C	uc003jsh.2	-	11	1585	c.1512A>G	c.(1510-1512)AAA>AAG	p.K504K	DEPDC1B_uc011cqm.1_Silent_p.K442K|DEPDC1B_uc011cqn.1_Silent_p.K415K	NM_018369	NP_060839	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B isoform 1	504					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)	1		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				GTGGTTTCGGTTTGGGTTTTT	0.388													3	126	---	---	---	---	PASS
ERBB2IP	55914	broad.mit.edu	37	5	65344565	65344565	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65344565C>T	uc003juk.1	+	19	2167	c.1859C>T	c.(1858-1860)TCT>TTT	p.S620F	ERBB2IP_uc003juh.1_Missense_Mutation_p.S616F|ERBB2IP_uc003jui.1_Missense_Mutation_p.S620F|ERBB2IP_uc003juj.1_Missense_Mutation_p.S620F|ERBB2IP_uc011cqx.1_Missense_Mutation_p.S620F|ERBB2IP_uc011cqy.1_Missense_Mutation_p.S620F|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Missense_Mutation_p.S616F|ERBB2IP_uc003jul.1_Missense_Mutation_p.S616F	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	620					basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ATTGAAACCTCTATTAACCAG	0.353													9	55	---	---	---	---	PASS
TTC37	9652	broad.mit.edu	37	5	94848321	94848321	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94848321G>A	uc003klb.2	-	28	3050	c.2780C>T	c.(2779-2781)ACT>ATT	p.T927I		NM_014639	NP_055454	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	927							binding			ovary(3)|pancreas(1)	4						TGCTCCTTCAGTCTTTAAAAA	0.333													13	62	---	---	---	---	PASS
COMMD10	51397	broad.mit.edu	37	5	115628185	115628185	+	Silent	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115628185G>A	uc003krt.1	+	7	631	c.608G>A	c.(607-609)TGA>TAA	p.*203*		NM_016144	NP_057228	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	203							protein binding			ovary(1)	1		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		TCCCTTACATGATGTTTTCGA	0.373													23	94	---	---	---	---	PASS
AFF4	27125	broad.mit.edu	37	5	132269995	132269995	+	Silent	SNP	A	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132269995A>C	uc003kyd.2	-	3	1170	c.762T>G	c.(760-762)ACT>ACG	p.T254T	AFF4_uc011cxk.1_5'UTR|AFF4_uc003kye.1_Silent_p.T254T|AFF4_uc003kyf.3_Silent_p.T254T	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31	254	Ser-rich.				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCACATAGGCAGTGGGTTTCT	0.502													17	122	---	---	---	---	PASS
AFF4	27125	broad.mit.edu	37	5	132269996	132269996	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132269996G>A	uc003kyd.2	-	3	1169	c.761C>T	c.(760-762)ACT>ATT	p.T254I	AFF4_uc011cxk.1_5'UTR|AFF4_uc003kye.1_Missense_Mutation_p.T254I|AFF4_uc003kyf.3_Missense_Mutation_p.T254I	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31	254	Ser-rich.				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACATAGGCAGTGGGTTTCTG	0.507													16	123	---	---	---	---	PASS
FAM13B	51306	broad.mit.edu	37	5	137284746	137284746	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137284746G>T	uc003lbz.2	-	17	2526	c.1992C>A	c.(1990-1992)GTC>GTA	p.V664V	FAM13B_uc003lcb.2_Silent_p.V568V|FAM13B_uc003lca.2_Silent_p.V664V	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	664					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						CCTTCTGAATGACCTTGGGTT	0.383													4	142	---	---	---	---	PASS
PCDHA4	56144	broad.mit.edu	37	5	140188054	140188054	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140188054C>T	uc003lhi.2	+	1	1383	c.1282C>T	c.(1282-1284)CGA>TGA	p.R428*	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhh.1_Nonsense_Mutation_p.R428*|PCDHA4_uc011daa.1_Nonsense_Mutation_p.R428*	NM_018907	NP_061730	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4 isoform 1 precursor	428	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(4)|skin(2)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGACCGCGCGAGACGGGGG	0.622													36	122	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140215252	140215252	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140215252G>T	uc003lhq.2	+	1	1284	c.1284G>T	c.(1282-1284)CGG>CGT	p.R428R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Silent_p.R428R	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	428	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTACCGCGCGGGACGGGGGCT	0.622													35	159	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140590315	140590315	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590315C>T	uc003liz.2	+	1	2025	c.1836C>T	c.(1834-1836)CCC>CCT	p.P612P	PCDHB12_uc011dak.1_Silent_p.P275P	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	612	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCACGGAGCCCGGGCTATTCG	0.701													12	139	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140720255	140720255	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140720255A>T	uc003ljk.1	+	1	1902	c.1717A>T	c.(1717-1719)ACT>TCT	p.T573S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.T573S	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	573	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGACGGTTCCACTGGCGTGGA	0.627													42	154	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140799073	140799073	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140799073C>T	uc003lkn.1	+	1	1792	c.1647C>T	c.(1645-1647)CGC>CGT	p.R549R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Silent_p.R549R|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	549	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGCCTGCGCGTGTTGGTGG	0.726													6	50	---	---	---	---	PASS
PCDHGA11	56105	broad.mit.edu	37	5	140801878	140801878	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140801878C>T	uc003lkq.1	+	1	1342	c.1084C>T	c.(1084-1086)CCT>TCT	p.P362S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Missense_Mutation_p.P362S|PCDHGA11_uc003lkp.1_Missense_Mutation_p.P362S	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	362	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAAACTCTCCTCCAGGTAC	0.388													6	33	---	---	---	---	PASS
PCDHGA12	26025	broad.mit.edu	37	5	140812405	140812405	+	Silent	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140812405G>C	uc003lkt.1	+	1	2248	c.2079G>C	c.(2077-2079)CTG>CTC	p.L693L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Silent_p.L693L	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	693	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTGTACCTGGTGGTAGCGG	0.652													32	147	---	---	---	---	PASS
NDST1	3340	broad.mit.edu	37	5	149907838	149907838	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149907838G>T	uc003lsk.3	+	3	1488	c.986G>T	c.(985-987)CGC>CTC	p.R329L	NDST1_uc011dcj.1_Missense_Mutation_p.R329L|NDST1_uc003lsl.2_Missense_Mutation_p.R329L	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	329	Heparan sulfate N-deacetylase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGGGCACACGCATGAAGGTG	0.632													19	59	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154397042	154397042	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154397042C>T	uc010jih.1	+	1	3783	c.3623C>T	c.(3622-3624)CCA>CTA	p.P1208L		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	1208	Interaction with PRC1 (By similarity).|Globular (By similarity).				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AATAAGCCTCCAGGGAAGAAA	0.507													11	31	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156590131	156590131	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156590131G>T	uc003lwn.2	-	2	1245	c.1145C>A	c.(1144-1146)ACC>AAC	p.T382N		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	382						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACACTTGCTGGTCGTAATACT	0.572													15	55	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156590133	156590133	+	Silent	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156590133C>G	uc003lwn.2	-	2	1243	c.1143G>C	c.(1141-1143)ACG>ACC	p.T381T		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	381						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTTGCTGGTCGTAATACTGC	0.572													17	55	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156590401	156590401	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156590401G>T	uc003lwn.2	-	2	975	c.875C>A	c.(874-876)GCA>GAA	p.A292E		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	292	Ala-rich.					nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGCACCTGTTGCAGGACTCAT	0.537													37	138	---	---	---	---	PASS
SLIT3	6586	broad.mit.edu	37	5	168201328	168201328	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168201328G>C	uc003mab.2	-	13	1627	c.1207C>G	c.(1207-1209)CAG>GAG	p.Q403E	SLIT3_uc010jjg.2_Missense_Mutation_p.Q403E|SLIT3_uc010jji.2_Missense_Mutation_p.Q403E|SLIT3_uc003mac.1_Missense_Mutation_p.Q200E	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	403					apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTGAGGTTCTGCAGGTCCTGA	0.517													64	211	---	---	---	---	PASS
ERGIC1	57222	broad.mit.edu	37	5	172351073	172351073	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172351073G>T	uc003mbw.3	+	6	635	c.441G>T	c.(439-441)ACG>ACT	p.T147T	ERGIC1_uc003mby.3_Silent_p.T55T|ERGIC1_uc011dfa.1_Silent_p.T92T	NM_001031711	NP_001026881	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate	147	Lumenal (Potential).				ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGACATGACGCATGTCATCC	0.602													5	30	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33403080	33403080	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33403080G>A	uc011dri.1	+	6	856	c.661G>A	c.(661-663)GAG>AAG	p.E221K	SYNGAP1_uc003oeo.1_Missense_Mutation_p.E206K|SYNGAP1_uc010juy.2_Missense_Mutation_p.E206K|SYNGAP1_uc010juz.2_5'Flank	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	221	PH.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						GTTCTGTTTTGAGGTACTGGG	0.562													35	31	---	---	---	---	PASS
DEF6	50619	broad.mit.edu	37	6	35278241	35278241	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35278241G>T	uc003okk.2	+	3	282	c.243G>T	c.(241-243)GAG>GAT	p.E81D	DEF6_uc010jvs.2_Missense_Mutation_p.E81D|DEF6_uc010jvt.2_Translation_Start_Site	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	81						cytoplasm|nucleus|plasma membrane					0						GGCAGGTGGAGGAGGGGGCTT	0.542													25	40	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69349089	69349089	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69349089G>T	uc003pev.3	+	3	970	c.522G>T	c.(520-522)TGG>TGT	p.W174C	BAI3_uc010kak.2_Missense_Mutation_p.W174C	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	174	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				TATGTACTTGGTTGGAGAGCT	0.418													44	44	---	---	---	---	PASS
KPNA5	3841	broad.mit.edu	37	6	117037477	117037477	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117037477G>T	uc003pxh.2	+	8	883	c.752G>T	c.(751-753)AGT>ATT	p.S251I		NM_002269	NP_002260	O15131	IMA5_HUMAN	karyopherin alpha 5	248	ARM 5.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		CCAAACTTTAGTAAGGTATGA	0.328													27	33	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117248301	117248301	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117248301C>T	uc003pxm.2	+	17	2060	c.1997C>T	c.(1996-1998)CCA>CTA	p.P666L		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	666					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						GGGAGGCCCCCAAGTGTGGGC	0.527													59	90	---	---	---	---	PASS
NCOA7	135112	broad.mit.edu	37	6	126176353	126176353	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126176353A>G	uc010kes.2	+	5	687	c.238A>G	c.(238-240)AGG>GGG	p.R80G	NCOA7_uc003qae.3_Missense_Mutation_p.R80G|NCOA7_uc003qah.2_Missense_Mutation_p.R80G|NCOA7_uc003qai.2_Missense_Mutation_p.R80G|NCOA7_uc010ket.2_Intron|NCOA7_uc003qaf.2_Missense_Mutation_p.R80G|NCOA7_uc003qag.2_Missense_Mutation_p.R80G|NCOA7_uc003qaj.2_Missense_Mutation_p.R80G	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1	80					cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		AAAGGAGATCAGGCGTACAGA	0.313													3	160	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31617997	31617997	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31617997G>C	uc003tcj.1	+	8	2112	c.1119G>C	c.(1117-1119)AAG>AAC	p.K373N	CCDC129_uc011kad.1_Missense_Mutation_p.K383N|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Missense_Mutation_p.K399N|CCDC129_uc003tck.1_Missense_Mutation_p.K281N	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	373											0						ACAAGCTCAAGAGCTTGTCTC	0.498													20	72	---	---	---	---	PASS
BMPER	168667	broad.mit.edu	37	7	34182925	34182925	+	Missense_Mutation	SNP	A	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34182925A>C	uc011kap.1	+	14	1943	c.1829A>C	c.(1828-1830)CAG>CCG	p.Q610P		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	610					blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CGGGCCTGCCAGAGAGAGGGC	0.473													54	86	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81667449	81667449	+	Missense_Mutation	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81667449T>C	uc003uhr.1	-	11	1238	c.982A>G	c.(982-984)AAA>GAA	p.K328E		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	328	Extracellular (Potential).|VWFA.					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	gtaattcctttggctGTGATA	0.294													39	64	---	---	---	---	PASS
POT1	25913	broad.mit.edu	37	7	124499166	124499166	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124499166C>A	uc003vlm.2	-	9	1148	c.547G>T	c.(547-549)GTA>TTA	p.V183L	POT1_uc011koe.1_RNA|POT1_uc003vlk.2_RNA|POT1_uc003vll.2_RNA|POT1_uc003vlo.2_Missense_Mutation_p.V52L|POT1_uc003vln.2_RNA	NM_015450	NP_056265	Q9NUX5	POTE1_HUMAN	protection of telomeres 1 isoform 1	183					DNA duplex unwinding|negative regulation of telomere maintenance via telomerase|positive regulation of DNA strand elongation|positive regulation of helicase activity|positive regulation of telomerase activity|positive regulation of telomere maintenance via telomerase|telomere capping|telomere formation via telomerase|telomere maintenance via telomerase	nuclear telomere cap complex|nucleoplasm	DEAD/H-box RNA helicase binding|single-stranded telomeric DNA binding|telomerase inhibitor activity			central_nervous_system(1)	1						CCATCCCATACCTGCCATAAG	0.353													18	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142028315	142028315	+	Intron	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142028315G>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vxl.1_Splice_Site					SubName: Full=V_segment translation product; Flags: Fragment;																		CTTCTCTGCAGGTCCAGTGAA	0.532													5	90	---	---	---	---	PASS
OR2A5	393046	broad.mit.edu	37	7	143747807	143747807	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143747807A>G	uc011ktw.1	+	1	313	c.313A>G	c.(313-315)ATG>GTG	p.M105V		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	105	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					CTTTTTATACATGGCTTTTGC	0.438													18	129	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10464903	10464903	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10464903C>T	uc003wtc.2	-	4	6934	c.6705G>A	c.(6703-6705)GGG>GGA	p.G2235G		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2235					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		GCTGGGCCTCCCCTTCAGCCT	0.592													23	118	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25234906	25234906	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25234906A>G	uc003xeg.2	+	38	4039	c.3902A>G	c.(3901-3903)TAT>TGT	p.Y1301C	PPP2R2A_uc003xek.2_Missense_Mutation_p.Y90C|DOCK5_uc003xei.2_Missense_Mutation_p.Y871C|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1301	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAGAAGCTGTATCAAGAAATC	0.378													7	37	---	---	---	---	PASS
DUSP4	1846	broad.mit.edu	37	8	29202894	29202894	+	Intron	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29202894C>A	uc003xhm.2	-						DUSP4_uc003xhl.2_Missense_Mutation_p.E51D	NM_001394	NP_001385	Q13115	DUS4_HUMAN	dual specificity phosphatase 4 isoform 1						endoderm formation|inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/threonine phosphatase activity			lung(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.094)|Kidney(114;0.113)		CACCTTGAGACTCTGAACACA	0.493													13	52	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113299485	113299485	+	Intron	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113299485A>T	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCTGCAATGCAGTACAGTTCA	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			17	50	---	---	---	---	PASS
NOV	4856	broad.mit.edu	37	8	120435214	120435214	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120435214A>G	uc003yoq.2	+	5	1137	c.916A>G	c.(916-918)ACC>GCC	p.T306A		NM_002514	NP_002505	P48745	NOV_HUMAN	nephroblastoma overexpressed precursor	306	CTCK.				regulation of cell growth		growth factor activity|insulin-like growth factor binding			ovary(2)|skin(2)|kidney(1)	5	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCCCCACAATACCAAAACCAT	0.552													18	107	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125083789	125083789	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125083789G>C	uc003yqw.2	+	31	4215	c.4009G>C	c.(4009-4011)GAG>CAG	p.E1337Q	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1337	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TTCTAGCTCTGAGGACAGCGG	0.512													9	61	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630959	140630959	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630959A>T	uc003yvf.1	-	2	731	c.667T>A	c.(667-669)TTT>ATT	p.F223I	KCNK9_uc003yvg.1_Missense_Mutation_p.F223I|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	223	Helical; (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			ATAAAGCTAAAGGCCACGTAG	0.562													9	67	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143958589	143958589	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143958589G>T	uc003yxi.2	-	3	452	c.445C>A	c.(445-447)CTG>ATG	p.L149M	CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.L149M|CYP11B1_uc010mey.2_Missense_Mutation_p.L220M	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	149					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	TTGGGCGACAGCACTTCTGGA	0.627									Familial_Hyperaldosteronism_type_I				4	40	---	---	---	---	PASS
TPD52L3	89882	broad.mit.edu	37	9	6328676	6328676	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6328676C>T	uc003zjw.2	+	1	302	c.81C>T	c.(79-81)CCC>CCT	p.P27P	TPD52L3_uc003zjv.2_Silent_p.P27P|TPD52L3_uc003zjx.1_Silent_p.P27P	NM_033516	NP_277051	Q96J77	TPD55_HUMAN	protein kinase NYD-SP25 isoform 1	27							protein binding				0		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0198)|Lung(218;0.1)		TGACAGAGCCCGAGCAAAGAG	0.502													39	85	---	---	---	---	PASS
C9orf3	84909	broad.mit.edu	37	9	97522149	97522149	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97522149G>T	uc004ava.2	+	1	219	c.84G>T	c.(82-84)CTG>CTT	p.L28L	C9orf3_uc011lui.1_RNA|C9orf3_uc004aux.1_Silent_p.L28L|C9orf3_uc004auy.2_Silent_p.L28L|C9orf3_uc004auz.1_Silent_p.L28L	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O	28					leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		ACTATGTACTGGATTTGGATG	0.448													19	34	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17157565	17157565	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17157565G>A	uc001ioo.2	-	7	677	c.625C>T	c.(625-627)CAG>TAG	p.Q209*		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	209	EGF-like 2; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GATGCACACTGGGGTCCGTAC	0.537													21	73	---	---	---	---	PASS
ZNF239	8187	broad.mit.edu	37	10	44052638	44052638	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44052638C>A	uc001jaw.3	-	2	1543	c.890G>T	c.(889-891)GGG>GTG	p.G297V	ZNF239_uc001jax.3_Missense_Mutation_p.G297V|ZNF239_uc009xmj.2_Missense_Mutation_p.G297V|ZNF239_uc009xmk.2_Missense_Mutation_p.G297V	NM_005674	NP_005665	Q16600	ZN239_HUMAN	zinc finger protein 239	297	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|RNA binding|zinc ion binding				0						AAAGCCCTTCCCACACTTGTC	0.507													28	115	---	---	---	---	PASS
KIAA1279	26128	broad.mit.edu	37	10	70748591	70748591	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70748591G>T	uc001joy.2	+	1	99	c.3G>T	c.(1-3)ATG>ATT	p.M1I		NM_015634	NP_056449	Q96EK5	KBP_HUMAN	KIF1 binding protein	1					cell differentiation|mitochondrial transport|nervous system development	mitochondrion	kinesin binding			ovary(1)	1						AGGCCGCTATGGCGAACGTTC	0.562											OREG0020215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	41	---	---	---	---	PASS
COL13A1	1305	broad.mit.edu	37	10	71654421	71654421	+	Intron	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71654421C>G	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194	Q5TAT6	CODA1_HUMAN	alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)	TCATCTCCGTCTCTTTGTAGG	0.512													17	99	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74690336	74690336	+	Missense_Mutation	SNP	G	A	A	rs149032084		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74690336G>A	uc001jte.1	+	8	1626	c.1408G>A	c.(1408-1410)GAT>AAT	p.D470N	OIT3_uc009xqs.1_RNA	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	470	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					CACATCCCGGGATCACCTAGC	0.443													56	201	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100401681	100401681	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100401681G>T	uc001kpn.1	-	7	1081	c.1021C>A	c.(1021-1023)CGG>AGG	p.R341R	HPSE2_uc009xwc.1_Silent_p.R331R|HPSE2_uc001kpo.1_Silent_p.R273R|HPSE2_uc009xwd.1_Silent_p.R219R	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	341					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TTGACCACCCGGCCATCAATG	0.403													47	190	---	---	---	---	PASS
XPNPEP1	7511	broad.mit.edu	37	10	111630550	111630550	+	Silent	SNP	G	A	A	rs143796899		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111630550G>A	uc001kyp.1	-	18	1646	c.1506C>T	c.(1504-1506)TGC>TGT	p.C502C	XPNPEP1_uc009xxt.1_Silent_p.C521C|XPNPEP1_uc001kyq.1_Silent_p.C431C	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	502					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		AACTGATGCCGCAAGGACCCT	0.498													4	128	---	---	---	---	PASS
PNLIPRP2	5408	broad.mit.edu	37	10	118389530	118389530	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118389530G>T	uc001lcq.2	+	9	680	c.657G>T	c.(655-657)GTG>GTT	p.V219V	PNLIPRP2_uc009xyu.1_RNA|PNLIPRP2_uc009xyv.1_RNA	NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2	218					galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		CCGTGTTTGTGGATGTGATTC	0.537													5	22	---	---	---	---	PASS
C10orf88	80007	broad.mit.edu	37	10	124708324	124708324	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124708324C>A	uc001lgw.2	-	4	714	c.489G>T	c.(487-489)GTG>GTT	p.V163V	C10orf88_uc001lgx.2_Silent_p.V65V	NM_024942	NP_079218	Q9H8K7	CJ088_HUMAN	hypothetical protein LOC80007	163											0		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		TCATGTGTACCACAACTTTAC	0.373													12	68	---	---	---	---	PASS
C10orf88	80007	broad.mit.edu	37	10	124708325	124708325	+	Missense_Mutation	SNP	A	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124708325A>C	uc001lgw.2	-	4	713	c.488T>G	c.(487-489)GTG>GGG	p.V163G	C10orf88_uc001lgx.2_Missense_Mutation_p.V65G	NM_024942	NP_079218	Q9H8K7	CJ088_HUMAN	hypothetical protein LOC80007	163											0		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		CATGTGTACCACAACTTTACT	0.368													13	68	---	---	---	---	PASS
FAM196A	642938	broad.mit.edu	37	10	128973730	128973730	+	Silent	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128973730C>G	uc001lju.1	-	1	971	c.930G>C	c.(928-930)CCG>CCC	p.P310P	DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Silent_p.P310P|FAM196A_uc001ljv.1_Silent_p.P310P|FAM196A_uc009yap.1_Silent_p.P310P	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN	hypothetical protein LOC642938	310										ovary(2)	2						GGCACTGCATCGGGGGTGAGC	0.672													25	78	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1021225	1021225	+	Silent	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1021225G>A	uc001lsw.2	-	27	3630	c.3579C>T	c.(3577-3579)TGC>TGT	p.C1193C		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1193					maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCAGGGCACGCACACCCCCT	0.632													8	19	---	---	---	---	PASS
MRGPRE	116534	broad.mit.edu	37	11	3249654	3249654	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3249654G>A	uc001lxq.3	-	2	683	c.373C>T	c.(373-375)CTC>TTC	p.L125F		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	125	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTGGGAAGAGGGCGGCCAGG	0.687													8	17	---	---	---	---	PASS
OR51V1	283111	broad.mit.edu	37	11	5221315	5221315	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221315A>T	uc010qyz.1	-	1	616	c.616T>A	c.(616-618)TAC>AAC	p.Y206N		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGGCATAGTAACTATTGAAT	0.423													18	75	---	---	---	---	PASS
OR52E8	390079	broad.mit.edu	37	11	5878717	5878717	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5878717C>A	uc010qzr.1	-	1	216	c.216G>T	c.(214-216)TTG>TTT	p.L72F	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAATGGAATCCAACATGGCCA	0.468													39	152	---	---	---	---	PASS
ILK	3611	broad.mit.edu	37	11	6631392	6631392	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6631392G>T	uc001mee.2	+	12	1227	c.1092G>T	c.(1090-1092)AAG>AAT	p.K364N	ILK_uc001mef.2_Missense_Mutation_p.K364N|ILK_uc010rap.1_Missense_Mutation_p.K230N|ILK_uc010raq.1_Missense_Mutation_p.K303N|ILK_uc001meg.2_Missense_Mutation_p.K210N|ILK_uc001meh.2_Missense_Mutation_p.K364N|ILK_uc001mei.2_5'UTR	NM_001014794	NP_001014794	Q13418	ILK_HUMAN	integrin-linked kinase	364	Protein kinase.				cell junction assembly|cell proliferation|cell-matrix adhesion|integrin-mediated signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent	cytosol|focal adhesion	ATP binding|protein serine/threonine kinase activity			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		TGCAGAAGAAGCCTGAAGACA	0.532													36	77	---	---	---	---	PASS
ILK	3611	broad.mit.edu	37	11	6631393	6631393	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6631393C>A	uc001mee.2	+	12	1228	c.1093C>A	c.(1093-1095)CCT>ACT	p.P365T	ILK_uc001mef.2_Missense_Mutation_p.P365T|ILK_uc010rap.1_Missense_Mutation_p.P231T|ILK_uc010raq.1_Missense_Mutation_p.P304T|ILK_uc001meg.2_Missense_Mutation_p.P211T|ILK_uc001meh.2_Missense_Mutation_p.P365T|ILK_uc001mei.2_5'UTR	NM_001014794	NP_001014794	Q13418	ILK_HUMAN	integrin-linked kinase	365	Protein kinase.				cell junction assembly|cell proliferation|cell-matrix adhesion|integrin-mediated signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent	cytosol|focal adhesion	ATP binding|protein serine/threonine kinase activity			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		GCAGAAGAAGCCTGAAGACAC	0.527													37	76	---	---	---	---	PASS
OR10A3	26496	broad.mit.edu	37	11	7960135	7960135	+	Silent	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7960135T>C	uc010rbi.1	-	1	933	c.933A>G	c.(931-933)TTA>TTG	p.L311L		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	311	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGAATGTGTGTAAAATCACTT	0.383													8	47	---	---	---	---	PASS
RRAS2	22800	broad.mit.edu	37	11	14316390	14316390	+	Missense_Mutation	SNP	T	A	A	rs113954997		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14316390T>A	uc001mlf.3	-	3	528	c.215A>T	c.(214-216)CAA>CTA	p.Q72L	RRAS2_uc009ygq.2_5'UTR|RRAS2_uc010rco.1_Missense_Mutation_p.Q78L	NM_012250	NP_036382	P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2	72	GTP (By similarity).		Q -> L (in an ovarian cancer sample; somatic mutation).			endoplasmic reticulum|plasma membrane	GTP binding|GTPase activity|protein binding			breast(1)	1				Epithelial(150;0.203)		AAACTCTTCTTGTCCTGCTGT	0.393													406	131	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40137376	40137376	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137376C>T	uc001mxa.1	-	2	2431	c.467G>A	c.(466-468)CGA>CAA	p.R156Q	LRRC4C_uc001mxc.1_Missense_Mutation_p.R152Q|LRRC4C_uc001mxd.1_Missense_Mutation_p.R152Q|LRRC4C_uc001mxb.1_Missense_Mutation_p.R152Q	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	156	LRR 4.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GGGGTTGTTTCGCAACCAGAG	0.428													32	41	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51515501	51515501	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51515501G>T	uc010ric.1	+	1	220	c.220G>T	c.(220-222)GTC>TTC	p.V74F		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	74	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CTATTCCTCTGTCAATACCCC	0.483													39	214	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55419064	55419064	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55419064G>T	uc001nhs.1	+	1	685	c.685G>T	c.(685-687)GAA>TAA	p.E229*		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	229	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				GCAGTCAGCAGAAGGCAGGCG	0.502													44	34	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904844	55904844	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904844C>A	uc010riz.1	-	1	351	c.351G>T	c.(349-351)GTG>GTT	p.V117V		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					CATAGGCCATCACAGCCAGCA	0.488													72	118	---	---	---	---	PASS
OR5M9	390162	broad.mit.edu	37	11	56230220	56230220	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56230220C>A	uc010rjj.1	-	1	658	c.658G>T	c.(658-660)GTA>TTA	p.V220L		NM_001004743	NP_001004743	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					ACAGCTACTACAATGAGAGTG	0.498													9	19	---	---	---	---	PASS
OR5AP2	338675	broad.mit.edu	37	11	56409790	56409790	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56409790C>A	uc001njb.1	-	1	126	c.126G>T	c.(124-126)ATG>ATT	p.M42I		NM_001002925	NP_001002925	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						CCATGTTTGCCATATAGATCA	0.403													27	85	---	---	---	---	PASS
OR9G4	283189	broad.mit.edu	37	11	56510447	56510447	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56510447A>G	uc010rjo.1	-	1	841	c.841T>C	c.(841-843)TAC>CAC	p.Y281H		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	281	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						TCTAGGGAGTAGGTGGAACTA	0.458													38	108	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58978773	58978773	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58978773G>T	uc001nnu.3	-	1	1722	c.1566C>A	c.(1564-1566)AGC>AGA	p.S522R		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	522	Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				CCGCAAACCTGCTTCCCAACT	0.507													39	52	---	---	---	---	PASS
TMEM151A	256472	broad.mit.edu	37	11	66061904	66061904	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66061904C>T	uc001ohl.2	+	2	299	c.187C>T	c.(187-189)CGC>TGC	p.R63C		NM_153266	NP_694998	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	63	Helical; (Potential).					integral to membrane				central_nervous_system(1)	1						GGCCTGGTGTCGCCTGGCCAC	0.741													4	71	---	---	---	---	PASS
LRP5	4041	broad.mit.edu	37	11	68201211	68201211	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68201211A>T	uc001ont.2	+	18	3980	c.3905A>T	c.(3904-3906)CAG>CTG	p.Q1302L	LRP5_uc009ysg.2_Missense_Mutation_p.Q712L	NM_002335	NP_002326	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein	1302	LDL-receptor class A 2.|Extracellular (Potential).				adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7						TCCGCCGCCCAGTTCCCCTGC	0.701													268	120	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70189989	70189989	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70189989A>T	uc001opo.2	+	15	2120	c.1922A>T	c.(1921-1923)AAA>ATA	p.K641I	PPFIA1_uc001opn.1_Missense_Mutation_p.K641I|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	641	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			GCCATCAACAAAGAGATCAGG	0.537													8	27	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104879648	104879648	+	Nonsense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104879648G>A	uc010rva.1	-	2	99	c.67C>T	c.(67-69)CAG>TAG	p.Q23*	CASP5_uc010ruz.1_Nonsense_Mutation_p.Q36*|CASP5_uc010rvb.1_Intron|CASP5_uc010rvc.1_Intron|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	23					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		AATCCACTCTGAAGGATACCT	0.398													35	46	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120345304	120345304	+	Silent	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120345304A>G	uc001pxl.1	+	32	3076	c.3069A>G	c.(3067-3069)GAA>GAG	p.E1023E	ARHGEF12_uc009zat.2_Silent_p.E1004E|ARHGEF12_uc010rzn.1_Silent_p.E920E|ARHGEF12_uc009zau.1_Silent_p.E920E	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	1023	PH.				apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		TGATTCATGAAGGGCCATTGG	0.343			T	MLL	AML								37	51	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6132840	6132840	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6132840G>T	uc001qnn.1	-	25	3586	c.3336C>A	c.(3334-3336)GCC>GCA	p.A1112A	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1112					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TGCCATGCTGGGCACACACGT	0.567													25	77	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9349036	9349036	+	Splice_Site	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9349036C>T	uc001qvl.2	-	10	1012	c.983_splice	c.e10-1	p.D328_splice	PZP_uc009zgl.2_Splice_Site_p.D197_splice	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						ACTTCCAGGTCTGAAAAATAT	0.318													16	38	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21207473	21207473	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21207473G>T	uc010sin.1	+	10	1444	c.1444G>T	c.(1444-1446)GCT>TCT	p.A482S	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.A529S	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	482						membrane	transporter activity				0						AAGAGATGATGCTTGTACAAG	0.378													27	49	---	---	---	---	PASS
SYT10	341359	broad.mit.edu	37	12	33579085	33579085	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579085G>T	uc001rll.1	-	2	794	c.497C>A	c.(496-498)ACG>AAG	p.T166K	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	166	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					GGTTGATGACGTAGGCTCAGT	0.284													72	164	---	---	---	---	PASS
SP1	6667	broad.mit.edu	37	12	53776695	53776695	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53776695A>T	uc001scw.2	+	3	1061	c.964A>T	c.(964-966)ACC>TCC	p.T322S	SP1_uc010sog.1_Missense_Mutation_p.T315S	NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	322	Transactivation domain B (Gln-rich).|Ser/Thr-rich.				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)		CTCCTTTTTCACCAATGCCAA	0.502													21	131	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54903516	54903516	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54903516G>T	uc001sgc.3	+	6	649	c.570G>T	c.(568-570)CTG>CTT	p.L190L	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Silent_p.L140L	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	190					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						TGAAGAAGCTGACAGAAGAGT	0.498													36	231	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57567680	57567680	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57567680A>T	uc001snd.2	+	22	3930	c.3464A>T	c.(3463-3465)AAC>ATC	p.N1155I		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1155	LDL-receptor class A 10.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGTGCCAACAACACCTCAGTC	0.627													8	71	---	---	---	---	PASS
SLC26A10	65012	broad.mit.edu	37	12	58017834	58017834	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58017834C>A	uc001spe.2	+	9	1491	c.1180C>A	c.(1180-1182)CAG>AAG	p.Q394K	SLC26A10_uc001spf.2_RNA|SLC26A10_uc009zpz.1_RNA	NM_133489	NP_597996	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	394						integral to membrane	antiporter activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(17;0.122)					GGTGTTCTGCCAGATGCAGGA	0.542													29	151	---	---	---	---	PASS
BEST3	144453	broad.mit.edu	37	12	70048997	70048997	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70048997G>T	uc001svg.2	-	10	1924	c.1697C>A	c.(1696-1698)ACA>AAA	p.T566K	BEST3_uc001svd.1_Intron|BEST3_uc001sve.1_Intron|BEST3_uc001svf.2_Missense_Mutation_p.T353K|BEST3_uc010stm.1_Missense_Mutation_p.T460K	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	566	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GGCTGAAACTGTCTGGGGACT	0.557													30	51	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100433449	100433449	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100433449C>A	uc001tgq.2	-	20	4429	c.4200G>T	c.(4198-4200)CAG>CAT	p.Q1400H	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.Q1050H	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	1400										ovary(2)	2						CTGGGCTTGTCTGAGTGGCTT	0.453													30	57	---	---	---	---	PASS
GLT8D2	83468	broad.mit.edu	37	12	104413419	104413419	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104413419A>G	uc001tkh.1	-	3	414	c.8T>C	c.(7-9)CTG>CCG	p.L3P	GLT8D2_uc001tki.1_Missense_Mutation_p.L3P	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	3	Cytoplasmic (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						TTTTCGTAACAGAGCCATGTG	0.338													9	22	---	---	---	---	PASS
DAO	1610	broad.mit.edu	37	12	109283249	109283249	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109283249C>T	uc001tnr.3	+	4	467	c.314C>T	c.(313-315)CCT>CTT	p.P105L	DAO_uc001tnq.3_Intron|DAO_uc009zvb.2_RNA|DAO_uc001tns.3_RNA	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase	105					glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						CTTCAGGACCCTTCCTGGAAG	0.408													15	83	---	---	---	---	PASS
CCDC63	160762	broad.mit.edu	37	12	111336867	111336867	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111336867A>G	uc001trv.1	+	10	1475	c.1280A>G	c.(1279-1281)AAG>AGG	p.K427R	CCDC63_uc010sye.1_Missense_Mutation_p.K387R|CCDC63_uc001trw.1_Missense_Mutation_p.K342R	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	427										skin(6)|ovary(1)|pancreas(1)	8						GACGCCACCAAGATCCTGGTG	0.488													9	54	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117768451	117768451	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117768451C>T	uc001twm.1	-	2	1110	c.424G>A	c.(424-426)GGC>AGC	p.G142S		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	142	Interaction with NOSIP (By similarity).				multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	TGTTCTTTGCCGGCCGGTGGC	0.662													19	60	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123099563	123099563	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123099563G>A	uc001ucv.2	+	56	6066	c.5903G>A	c.(5902-5904)TGT>TAT	p.C1968Y	KNTC1_uc010taf.1_Missense_Mutation_p.C893Y	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1968					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ACTGAGCTGTGTTTAGAATAC	0.403													9	22	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124839419	124839419	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124839419T>A	uc010tba.1	-	25	3589	c.3472A>T	c.(3472-3474)ATG>TTG	p.M1158L	NCOR2_uc010tay.1_Missense_Mutation_p.M1157L|NCOR2_uc010taz.1_Missense_Mutation_p.M1141L|NCOR2_uc010tbb.1_Missense_Mutation_p.M1150L|NCOR2_uc010tbc.1_Missense_Mutation_p.M1140L|NCOR2_uc001ugj.1_Missense_Mutation_p.M1158L	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	1158					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GGCAGCCCCATGGTGACAGGG	0.672													17	47	---	---	---	---	PASS
ZMYM5	9205	broad.mit.edu	37	13	20426215	20426215	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20426215C>A	uc010tcn.1	-	3	371	c.106G>T	c.(106-108)GGT>TGT	p.G36C	ZMYM5_uc001umm.1_5'UTR|ZMYM5_uc001umn.2_Missense_Mutation_p.G36C|ZMYM5_uc001umo.2_Missense_Mutation_p.G36C	NM_001142684	NP_001136156	Q9UJ78	ZMYM5_HUMAN	zinc finger protein 237 isoform 3	36						nucleus	zinc ion binding				0		all_cancers(29;2.96e-22)|all_epithelial(30;3.76e-20)|all_lung(29;4.38e-20)|Lung NSC(5;5.8e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.61e-05)|Epithelial(112;4.89e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00171)|Lung(94;0.00942)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GCTGGATGACCAAATGAATCC	0.373													38	168	---	---	---	---	PASS
DACH1	1602	broad.mit.edu	37	13	72014825	72014825	+	Intron	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72014825C>A	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		AGTCTTCCATCTAGAAATGAA	0.303													27	97	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454735	84454735	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454735G>T	uc001vlk.2	-	1	1794	c.908C>A	c.(907-909)TCT>TAT	p.S303Y		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	303	Extracellular (Potential).					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GTTTGGAGCAGACCCTGGTGT	0.562													13	59	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88327856	88327856	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88327856C>A	uc001vln.2	+	2	432	c.213C>A	c.(211-213)ATC>ATA	p.I71I	SLITRK5_uc010tic.1_Intron	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	71	Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GGGGGATCATCAGTCTCTCTG	0.448													60	176	---	---	---	---	PASS
DCT	1638	broad.mit.edu	37	13	95095825	95095825	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95095825C>T	uc001vlv.3	-	7	1673	c.1246G>A	c.(1246-1248)GCC>ACC	p.A416T	DCT_uc010afh.2_Missense_Mutation_p.A449T	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	416	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TGAGGCCAGGCATCTGCAGGA	0.428													8	48	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103460094	103460094	+	Silent	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103460094A>T	uc001vpu.1	+	1	599	c.477A>T	c.(475-477)TCA>TCT	p.S159S	BIVM_uc001vps.2_Silent_p.S159S|BIVM_uc010agc.2_Intron|BIVM_uc001vpt.2_Silent_p.S159S	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AACACAAATCAGGTAAGGAGG	0.378			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				6	31	---	---	---	---	PASS
SLC7A7	9056	broad.mit.edu	37	14	23242900	23242900	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23242900G>T	uc001wgr.3	-	10	1593	c.1455C>A	c.(1453-1455)GTC>GTA	p.V485V	SLC7A7_uc001wgs.3_Silent_p.V485V|SLC7A7_uc001wgt.3_Silent_p.V485V|SLC7A7_uc001wgu.3_Silent_p.V485V|SLC7A7_uc001wgv.3_Silent_p.V485V	NM_003982	NP_003973	Q9UM01	YLAT1_HUMAN	solute carrier family 7 member 7	485					blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)		ACATACACAGGACCTGGAGGT	0.473													23	85	---	---	---	---	PASS
IPO4	79711	broad.mit.edu	37	14	24657005	24657005	+	Intron	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24657005G>A	uc001wmv.1	-						IPO4_uc001wmu.2_Intron|IPO4_uc001wmx.1_Intron|IPO4_uc001wmy.1_Intron|IPO4_uc010tnz.1_Intron|IPO4_uc001wmw.1_RNA|IPO4_uc001wmz.1_Intron	NM_024658	NP_078934	Q8TEX9	IPO4_HUMAN	importin 4						intracellular protein transport	cytoplasm|nucleus	protein binding|protein transporter activity			kidney(1)	1				GBM - Glioblastoma multiforme(265;0.0087)		CACAGTGCCTGCAAACAGGAG	0.557													9	39	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55636119	55636119	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55636119G>T	uc001xbs.2	-	12	1763	c.1546C>A	c.(1546-1548)CAG>AAG	p.Q516K	DLGAP5_uc001xbt.2_Missense_Mutation_p.Q516K	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	516					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						CCACATACCTGAAAACTAACC	0.269													36	83	---	---	---	---	PASS
SERPINA5	5104	broad.mit.edu	37	14	95058452	95058452	+	Missense_Mutation	SNP	C	A	A	rs150557947		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95058452C>A	uc001ydm.2	+	6	1307	c.1097C>A	c.(1096-1098)ACG>AAG	p.T366K	SERPINA3_uc001ydo.3_5'UTR	NM_000624	NP_000615	P05154	IPSP_HUMAN	serine (or cysteine) proteinase inhibitor, clade	366					fusion of sperm to egg plasma membrane|regulation of proteolysis|spermatogenesis	extracellular region|membrane|protein complex	acrosin binding|heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(2)	2				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	GCGGCAGCCACGGGGACAATA	0.567													110	273	---	---	---	---	PASS
AK7	122481	broad.mit.edu	37	14	96909082	96909082	+	Nonsense_Mutation	SNP	G	T	T	rs114393353	by1000genomes	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96909082G>T	uc001yfn.2	+	7	750	c.706G>T	c.(706-708)GAG>TAG	p.E236*		NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7	236	Potential.				cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		TTGGTTGGGCGAGATTCCTGC	0.448													43	196	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105419189	105419189	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105419189C>T	uc010axc.1	-	7	2719	c.2599G>A	c.(2599-2601)GTG>ATG	p.V867M	AHNAK2_uc001ypx.2_Missense_Mutation_p.V767M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	867						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGAGGCTCACGTCGGCCTCC	0.612													65	266	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29393969	29393969	+	Silent	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29393969T>C	uc001zck.2	+	9	1713	c.1506T>C	c.(1504-1506)CAT>CAC	p.H502H	APBA2_uc010azj.2_Silent_p.H490H|APBA2_uc010uat.1_Silent_p.H490H|APBA2_uc001zcl.2_Silent_p.H490H|APBA2_uc001zcm.1_Silent_p.H194H	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	502	PID.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		TGATCTGCCATGTGTTCGAGT	0.612													9	22	---	---	---	---	PASS
DUOXA1	90527	broad.mit.edu	37	15	45413282	45413282	+	Intron	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45413282C>A	uc001zuq.1	-						DUOXA1_uc010uem.1_Intron|DUOXA1_uc001zup.2_Intron|DUOXA1_uc010bec.2_Intron|DUOXA1_uc001zur.1_Intron|DUOXA1_uc010bed.1_Intron	NM_144565	NP_653166	Q1HG43	DOXA1_HUMAN	Numb-interacting protein						protein transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		AGCCCTCCCTCACCTGTGAGT	0.557													13	35	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48777639	48777639	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48777639G>C	uc001zwx.1	-	30	3972	c.3644C>G	c.(3643-3645)TCT>TGT	p.S1215C		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1215	EGF-like 19; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCTGCCTTCAGAGTTTGTGCA	0.388													25	91	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59494513	59494513	+	Intron	SNP	A	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59494513A>C	uc002aga.2	-							NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE						actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		AACTTCCTAAAATAGAACTAA	0.458													7	94	---	---	---	---	PASS
CCDC33	80125	broad.mit.edu	37	15	74559079	74559079	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74559079C>T	uc002axo.2	+	4	774	c.380C>T	c.(379-381)CCC>CTC	p.P127L	CCDC33_uc002axp.2_5'UTR	NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1	330							protein binding			ovary(3)|skin(2)	5						TACAAAATCCCCATCAAGTAC	0.493													24	136	---	---	---	---	PASS
C15orf26	161502	broad.mit.edu	37	15	81436089	81436089	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81436089C>T	uc002bgb.2	+	5	591	c.564C>T	c.(562-564)TCC>TCT	p.S188S	C15orf26_uc010blp.1_Silent_p.S163S	NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	188											0						ATGAGGTCTCCCATGTGAACT	0.537													38	127	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86259125	86259125	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86259125C>T	uc002blv.1	+	20	5876	c.5706C>T	c.(5704-5706)TCC>TCT	p.S1902S	AKAP13_uc002blu.1_Silent_p.S1906S|AKAP13_uc010bnf.1_Silent_p.S523S|AKAP13_uc002blw.1_Silent_p.S369S|AKAP13_uc002blx.1_Silent_p.S147S	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1902					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						TCTCGCTCTCCAAAAGTGTCT	0.478													21	69	---	---	---	---	PASS
SOX8	30812	broad.mit.edu	37	16	1035307	1035307	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1035307A>G	uc002ckn.2	+	3	1377	c.1262A>G	c.(1261-1263)AAC>AGC	p.N421S		NM_014587	NP_055402	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	421					adipose tissue development|enteric nervous system development|fat cell differentiation|in utero embryonic development|metanephric nephron tubule formation|morphogenesis of a branching epithelium|negative regulation of apoptosis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|neural crest cell migration|oligodendrocyte differentiation|osteoblast differentiation|peripheral nervous system development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of gliogenesis|positive regulation of osteoblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone levels|renal vesicle induction|retinal rod cell differentiation|Sertoli cell development|signal transduction|spermatogenesis|ureter morphogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2		Hepatocellular(780;0.00308)				CCCCTGCTCAACGGCCTGGCC	0.716													6	12	---	---	---	---	PASS
C16orf90	646174	broad.mit.edu	37	16	3544718	3544718	+	Missense_Mutation	SNP	A	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3544718A>T	uc002cvi.2	-	2	206	c.206T>A	c.(205-207)CTG>CAG	p.L69Q		NM_001080524	NP_001073993	A8MZG2	CP090_HUMAN	hypothetical protein LOC646174	59											0						GTGGCTCTCCAGGTAGAGGCC	0.726													8	16	---	---	---	---	PASS
NKD1	85407	broad.mit.edu	37	16	50666270	50666270	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50666270C>G	uc002egg.1	+	9	998	c.774C>G	c.(772-774)CAC>CAG	p.H258Q		NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1	258					Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		GGAGAAACCACTACTTAGATC	0.577													11	36	---	---	---	---	PASS
CCDC135	84229	broad.mit.edu	37	16	57762439	57762439	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57762439C>A	uc002emi.2	+	16	2423	c.2334C>A	c.(2332-2334)AGC>AGA	p.S778R	CCDC135_uc002emj.2_Missense_Mutation_p.S778R|CCDC135_uc002emk.2_Missense_Mutation_p.S713R	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	778						cytoplasm				central_nervous_system(1)	1						AGTGCCTCAGCGACTTCAAGC	0.592													10	29	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70219866	70219866	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70219866C>T	uc002exy.2	+	12	1410	c.1290C>T	c.(1288-1290)TAC>TAT	p.Y430Y	CLEC18C_uc010vlt.1_Silent_p.Y430Y|CLEC18C_uc002eyk.2_Silent_p.Y430Y	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor	430	C-type lectin.					extracellular region	sugar binding				0						GAAACCGTTACATCTGCCAGT	0.587													17	72	---	---	---	---	PASS
KCNG4	93107	broad.mit.edu	37	16	84270969	84270969	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84270969G>T	uc010voc.1	-	2	244	c.123C>A	c.(121-123)TAC>TAA	p.Y41*	KCNG4_uc002fhu.1_Nonsense_Mutation_p.Y41*	NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	41	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3						GCACCCTCCGGTAGTAAAGGC	0.632													16	52	---	---	---	---	PASS
OR1D4	8385	broad.mit.edu	37	17	2966415	2966415	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2966415G>T	uc010vra.1	-	1	541	c.541C>A	c.(541-543)CTG>ATG	p.L181M		NM_003552	NP_003543			olfactory receptor, family 1, subfamily D,												0						ACCCTGGTCAGGAGGAAGGTG	0.557													7	36	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7690250	7690250	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7690250G>C	uc002giu.1	+	41	6516	c.6502G>C	c.(6502-6504)GGC>CGC	p.G2168R		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2168	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CCTGTTCGATGGCCCCGTGGA	0.582													13	44	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15983977	15983977	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15983977G>A	uc002gpo.2	-	24	3482	c.3242C>T	c.(3241-3243)CCG>CTG	p.P1081L	NCOR1_uc002gpn.2_Missense_Mutation_p.P1097L|NCOR1_uc002gpp.1_Missense_Mutation_p.P988L|NCOR1_uc010vwb.1_5'Flank|NCOR1_uc010coy.2_5'Flank|NCOR1_uc010vwc.1_5'Flank	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	1081	Interaction with ETO.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCCCACTGACGGCTTGGGTGT	0.403													14	104	---	---	---	---	PASS
RASD1	51655	broad.mit.edu	37	17	17399430	17399430	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17399430C>A	uc002gri.2	-	1	278	c.66G>T	c.(64-66)AAG>AAT	p.K22N		NM_016084	NP_057168	Q9Y272	RASD1_HUMAN	RAS, dexamethasone-induced 1 precursor	22					G-protein coupled receptor protein signaling pathway|small GTPase mediated signal transduction	nucleus|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity				0						GATAGCAGTTCTTGGCCGGGA	0.657													3	40	---	---	---	---	PASS
TAOK1	57551	broad.mit.edu	37	17	27861296	27861296	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27861296G>A	uc002hdz.1	+	19	2716	c.2522G>A	c.(2521-2523)CGG>CAG	p.R841Q	TAOK1_uc010wbe.1_Missense_Mutation_p.R693Q|TAOK1_uc010wbf.1_Missense_Mutation_p.R841Q	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	841	Potential.				mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			GTCTCCCTCCGGAGGGCACTC	0.403													9	45	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35913588	35913588	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35913588T>A	uc002hoa.2	-	14	2320	c.2237A>T	c.(2236-2238)GAT>GTT	p.D746V	SYNRG_uc010wde.1_Missense_Mutation_p.D668V|SYNRG_uc010wdf.1_Missense_Mutation_p.D668V|SYNRG_uc002hoc.2_Missense_Mutation_p.D667V|SYNRG_uc002hoe.2_Missense_Mutation_p.D668V|SYNRG_uc002hod.2_Missense_Mutation_p.D668V|SYNRG_uc010wdg.1_Missense_Mutation_p.D585V|SYNRG_uc002hob.2_Missense_Mutation_p.D746V|SYNRG_uc002hof.2_Missense_Mutation_p.D458V|SYNRG_uc010cvd.1_Missense_Mutation_p.D546V	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	746	Interaction with A1P1G1 and A1P1G2.				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						TCTGAAGACATCGTACTTGGT	0.478													24	68	---	---	---	---	PASS
KRT38	8687	broad.mit.edu	37	17	39596681	39596681	+	Intron	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39596681C>T	uc002hwq.1	-							NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38							intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)				CCACACCTCACCTTCTGTTGG	0.562													22	75	---	---	---	---	PASS
KRT16	3868	broad.mit.edu	37	17	39767921	39767921	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39767921G>A	uc002hxg.3	-	2	723	c.584C>T	c.(583-585)GCC>GTC	p.A195V	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	195	Coil 1B.|Rod.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				TGCCAGCCTGGCATTGTCAAT	0.607													3	43	---	---	---	---	PASS
KLHL11	55175	broad.mit.edu	37	17	40011341	40011341	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40011341C>G	uc002hyf.1	-	2	784	c.778G>C	c.(778-780)GTT>CTT	p.V260L		NM_018143	NP_060613	Q9NVR0	KLH11_HUMAN	kelch-like 11 precursor	260	BACK.					extracellular region					0		Breast(137;0.00156)				TCAGAATCAACTGTAATTTCC	0.353													17	66	---	---	---	---	PASS
DBF4B	80174	broad.mit.edu	37	17	42800368	42800368	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42800368G>C	uc002ihf.2	+	3	416	c.203G>C	c.(202-204)GGG>GCG	p.G68A	DBF4B_uc002ihd.1_Missense_Mutation_p.G68A|DBF4B_uc010wjb.1_RNA|DBF4B_uc002ihe.2_5'UTR|DBF4B_uc010wjc.1_Missense_Mutation_p.G52A|DBF4B_uc002ihg.2_Missense_Mutation_p.G52A	NM_145663	NP_663696	Q8NFT6	DBF4B_HUMAN	DBF4 homolog B isoform 1	68	BRCT.				cell cycle	nucleus	nucleic acid binding|zinc ion binding				0		Prostate(33;0.0322)				TTTTTGACGGGGGCCATTCAG	0.512													20	75	---	---	---	---	PASS
CDC27	996	broad.mit.edu	37	17	45235565	45235565	+	Intron	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45235565C>A	uc002ild.3	-						CDC27_uc002ile.3_Intron|CDC27_uc002ilf.3_Intron|CDC27_uc010wkp.1_Intron|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						CAACCCCACCCACCTACCTAT	0.423													9	38	---	---	---	---	PASS
HSF5	124535	broad.mit.edu	37	17	56536130	56536130	+	Silent	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56536130A>G	uc002iwi.1	-	5	1843	c.1719T>C	c.(1717-1719)CCT>CCC	p.P573P		NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	573						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AATCCTTACCAGGGGACTTTC	0.418													12	43	---	---	---	---	PASS
TBX2	6909	broad.mit.edu	37	17	59485479	59485479	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59485479C>T	uc010wox.1	+	7	2032	c.1751C>T	c.(1750-1752)GCC>GTC	p.A584V	TBX2_uc002ize.2_3'UTR|TBX2_uc002izg.2_Missense_Mutation_p.A430V	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2	584	Ala-rich.				cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						gcagcagcagccgcagccgcc	0.388													10	28	---	---	---	---	PASS
EFCAB3	146779	broad.mit.edu	37	17	60469293	60469293	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60469293G>T	uc002izu.1	+	4	340	c.262G>T	c.(262-264)GTC>TTC	p.V88F	EFCAB3_uc010wpc.1_Missense_Mutation_p.V140F	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	88	EF-hand 2.						calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			CAAGCATGATGTCTATAATGA	0.353													29	114	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78896603	78896603	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78896603A>G	uc002jyt.1	+	22	3405	c.2600A>G	c.(2599-2601)AAG>AGG	p.K867R	RPTOR_uc010wug.1_Missense_Mutation_p.K709R	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	867					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						CCCACCAACAAGGGCGTGCAC	0.726													2	3	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9257705	9257705	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9257705G>T	uc002knv.2	+	9	4697	c.4440G>T	c.(4438-4440)CAG>CAT	p.Q1480H	ANKRD12_uc002knw.2_Missense_Mutation_p.Q1457H|ANKRD12_uc002knx.2_Missense_Mutation_p.Q1457H|ANKRD12_uc010dkx.1_Missense_Mutation_p.Q1187H	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	1480						nucleus				ovary(2)|central_nervous_system(1)	3						CTTGTGCTCAGGATCCGGCAT	0.418													13	79	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9257706	9257706	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9257706G>T	uc002knv.2	+	9	4698	c.4441G>T	c.(4441-4443)GAT>TAT	p.D1481Y	ANKRD12_uc002knw.2_Missense_Mutation_p.D1458Y|ANKRD12_uc002knx.2_Missense_Mutation_p.D1458Y|ANKRD12_uc010dkx.1_Missense_Mutation_p.D1188Y	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	1481						nucleus				ovary(2)|central_nervous_system(1)	3						TTGTGCTCAGGATCCGGCATC	0.413													14	78	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28986104	28986104	+	Silent	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28986104G>T	uc002kwq.2	+	12	1836	c.1701G>T	c.(1699-1701)CTG>CTT	p.L567L	DSG4_uc002kwr.2_Silent_p.L567L	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	567	Extracellular (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TCCCAATCCTGGTGAAGGACA	0.448													12	55	---	---	---	---	PASS
GALNT1	2589	broad.mit.edu	37	18	33263543	33263543	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33263543G>T	uc010dmu.2	+	5	723	c.670G>T	c.(670-672)GCC>TCC	p.A224S	GALNT1_uc002kyz.3_Missense_Mutation_p.A164S|GALNT1_uc002kzb.2_Missense_Mutation_p.A224S	NM_020474	NP_065207	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1	224	Lumenal (Potential).|Catalytic subdomain A.				protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						GCCTCTCTTGGCCAGGATCAA	0.423													5	34	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65178549	65178549	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65178549C>A	uc002lke.1	-	2	4551	c.3327G>T	c.(3325-3327)TTG>TTT	p.L1109F		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	1099						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				ACAAGTGAGACAAGAGGGACA	0.393													14	34	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15569435	15569435	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15569435G>T	uc002nbe.2	-	7	780	c.694C>A	c.(694-696)CTG>ATG	p.L232M	RASAL3_uc010eaa.1_5'Flank	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	232	PH.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						AGTGTGGCCAGCGACTCCCTA	0.647													9	21	---	---	---	---	PASS
SLC27A1	376497	broad.mit.edu	37	19	17608160	17608160	+	Missense_Mutation	SNP	G	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17608160G>A	uc002ngu.1	+	7	1143	c.1093G>A	c.(1093-1095)GGG>AGG	p.G365R	SLC27A1_uc002ngt.1_Missense_Mutation_p.G97R|SLC27A1_uc010xpp.1_Missense_Mutation_p.G186R|SLC27A1_uc002ngv.1_5'UTR	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1	365	Sufficient for oligomerization (By similarity).|Cytoplasmic (Potential).				cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						GGTGGGGAACGGGCTGCGTCC	0.662													6	25	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20829130	20829130	+	Missense_Mutation	SNP	A	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20829130A>G	uc002npb.1	-	2	235	c.85T>C	c.(85-87)TAT>CAT	p.Y29H	ZNF626_uc002npc.1_Intron|ZNF626_uc002npd.1_Missense_Mutation_p.Y29H	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	29	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						ACATTCCTATATAAATTCCGC	0.383													39	92	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039987	31039987	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039987G>T	uc002nsu.1	+	4	3599	c.3461G>T	c.(3460-3462)AGT>ATT	p.S1154I	ZNF536_uc010edd.1_Missense_Mutation_p.S1154I	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1154					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GAAACCACGAGTAAGAACACT	0.547													19	53	---	---	---	---	PASS
ZFP14	57677	broad.mit.edu	37	19	36853129	36853129	+	Silent	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36853129T>A	uc002odx.1	-	2	114	c.21A>T	c.(19-21)ACA>ACT	p.T7T	ZFP14_uc010xtd.1_Silent_p.T7T|ZFP14_uc010eex.1_Silent_p.T7T	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	7	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					CATCCCTGAATGTCACTGAAC	0.403													14	53	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38959968	38959968	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38959968G>T	uc002oit.2	+	27	3710	c.3580G>T	c.(3580-3582)GGA>TGA	p.G1194*	RYR1_uc002oiu.2_Nonsense_Mutation_p.G1194*	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1194	6 X approximate repeats.|Cytoplasmic.|B30.2/SPRY 2.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CTGCAGCTTGGGACCTGGCCA	0.388													13	72	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38981255	38981255	+	Intron	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38981255C>A	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TTTGACCTTCCCCTAGATCAA	0.418													7	31	---	---	---	---	PASS
ADCK4	79934	broad.mit.edu	37	19	41201934	41201934	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41201934C>A	uc002oor.2	-	13	1471	c.1169G>T	c.(1168-1170)AGC>ATC	p.S390I	ADCK4_uc002oop.1_Missense_Mutation_p.S67I|ADCK4_uc002ooq.1_Missense_Mutation_p.S349I	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a	390	Protein kinase.					integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			AAACTCCCGGCTTGCACCAAA	0.557													29	121	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42847671	42847671	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42847671C>T	uc002otl.3	+	9	2191	c.1556C>T	c.(1555-1557)GCG>GTG	p.A519V	MEGF8_uc002otm.3_Missense_Mutation_p.A60V	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	519	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				CATGTAGCTGCGGTGCTTGGT	0.632													6	52	---	---	---	---	PASS
PSG9	5678	broad.mit.edu	37	19	43763083	43763083	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43763083G>T	uc002owd.3	-	4	1013	c.914C>A	c.(913-915)ACA>AAA	p.T305K	PSG9_uc002owe.3_Intron|PSG9_uc010xwm.1_Missense_Mutation_p.T212K|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Intron|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	305	Ig-like C2-type 2.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				ATAGGGTCCTGTTTCATTTCT	0.498													67	188	---	---	---	---	PASS
IRGQ	126298	broad.mit.edu	37	19	44097332	44097332	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44097332C>T	uc002oww.2	-	2	836	c.718G>A	c.(718-720)GAC>AAC	p.D240N	IRGQ_uc010eiv.2_Missense_Mutation_p.D240N	NM_001007561	NP_001007562	Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	240							protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)				AGCAGCATGTCCACCACAAGG	0.687													14	64	---	---	---	---	PASS
NUP62	23636	broad.mit.edu	37	19	50413004	50413004	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50413004C>A	uc002pqx.2	-	2	165	c.61G>T	c.(61-63)GCA>TCA	p.A21S	IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron|NUP62_uc002pqy.2_Missense_Mutation_p.A21S|NUP62_uc002pqz.2_Missense_Mutation_p.A21S|NUP62_uc002pra.2_Missense_Mutation_p.A21S|NUP62_uc002prb.2_Missense_Mutation_p.A21S|NUP62_uc002prc.2_Missense_Mutation_p.A21S	NM_153719	NP_714941	P37198	NUP62_HUMAN	nucleoporin 62kDa	21	15 X 9 AA approximate repeats.|2.|Thr-rich.				carbohydrate metabolic process|cell death|cell surface receptor linked signaling pathway|glucose transport|hormone-mediated signaling pathway|mRNA transport|negative regulation of apoptosis|negative regulation of cell proliferation|nucleocytoplasmic transport|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|protein transport|regulation of glucose transport|transcription, DNA-dependent|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleocytoplasmic shuttling complex|ribonucleoprotein complex|spindle pole	chromatin binding|protein serine/threonine kinase activity|receptor signaling complex scaffold activity|SH2 domain binding|structural constituent of nuclear pore|thyroid hormone receptor binding|ubiquitin binding				0		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GCCGTCTTTGCAGTGCCAAAC	0.567													14	60	---	---	---	---	PASS
KCNC3	3748	broad.mit.edu	37	19	50824011	50824011	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50824011G>T	uc002pru.1	-	3	2304	c.2009C>A	c.(2008-2010)GCT>GAT	p.A670D	KCNC3_uc002prt.1_Missense_Mutation_p.A306D	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel	670	Cytoplasmic (Potential).|Poly-Ala.				cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		GGCAAGCGCAGCTGCTGCCGG	0.642													4	50	---	---	---	---	PASS
CEACAM18	729767	broad.mit.edu	37	19	51983848	51983848	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51983848C>A	uc002pwv.1	+	3	497	c.497C>A	c.(496-498)ACT>AAT	p.T166N		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	166						integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		ATCAGGCCGACTGCATTAAAT	0.557													19	64	---	---	---	---	PASS
SIGLEC5	8778	broad.mit.edu	37	19	52131184	52131184	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52131184C>G	uc002pxe.2	-	5	1039	c.900G>C	c.(898-900)GAG>GAC	p.E300D		NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor	300	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		CTCGACGAAGCTCCAAGATCC	0.582													25	89	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56244704	56244704	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56244704C>T	uc002qly.2	-	2	521	c.493G>A	c.(493-495)GTG>ATG	p.V165M		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	165	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TCCAACATCACTTTTCTTAAA	0.438													22	61	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57327108	57327108	+	Missense_Mutation	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57327108C>T	uc002qnu.2	-	7	3053	c.2702G>A	c.(2701-2703)CGT>CAT	p.R901H	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.R872H|PEG3_uc002qnv.2_Missense_Mutation_p.R901H|PEG3_uc002qnw.2_Missense_Mutation_p.R777H|PEG3_uc002qnx.2_Missense_Mutation_p.R775H|PEG3_uc010etr.2_Missense_Mutation_p.R901H	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	901					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGGTTTGGCACGGAATACACT	0.463													27	119	---	---	---	---	PASS
ENTPD6	955	broad.mit.edu	37	20	25203568	25203568	+	Silent	SNP	T	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25203568T>C	uc002wuj.2	+	12	1320	c.1140T>C	c.(1138-1140)TAT>TAC	p.Y380Y	ENTPD6_uc010zsz.1_Silent_p.Y162Y|ENTPD6_uc002wum.2_Silent_p.Y363Y|ENTPD6_uc010zta.1_Silent_p.Y380Y|ENTPD6_uc002wun.2_Silent_p.Y346Y|ENTPD6_uc002wuk.2_Silent_p.Y379Y|ENTPD6_uc002wul.2_Silent_p.Y379Y|ENTPD6_uc010ztb.1_Silent_p.Y352Y|ENTPD6_uc010ztc.1_Silent_p.Y352Y|ENTPD6_uc002wuo.2_Silent_p.Y132Y|ENTPD6_uc010ztd.1_Silent_p.Y128Y|ENTPD6_uc010gdk.1_RNA|ENTPD6_uc010gdl.1_RNA	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6	380	Lumenal (Potential).					Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0						TGGACTTCTATGCTTTCTCCT	0.612													54	94	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33345744	33345744	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33345744C>T	uc002xav.2	-	8	3378	c.807G>A	c.(805-807)CAG>CAA	p.Q269Q	NCOA6_uc002xaw.2_Silent_p.Q269Q|NCOA6_uc010gew.1_Silent_p.Q226Q	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	TBP/GTF2A-binding region.|NCOA1-binding region.|Gln-rich.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						gctgctgctgctgttgttgtt	0.313													4	59	---	---	---	---	PASS
SPAG4	6676	broad.mit.edu	37	20	34207663	34207663	+	Missense_Mutation	SNP	G	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34207663G>T	uc002xdb.1	+	10	1189	c.1072G>T	c.(1072-1074)GTC>TTC	p.V358F	SPAG4_uc010zvi.1_Missense_Mutation_p.V281F	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4	358	SUN.				spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			CGATTTCGCGGTCTTTGTGAG	0.567													3	49	---	---	---	---	PASS
ZFP64	55734	broad.mit.edu	37	20	50781293	50781293	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50781293C>A	uc002xwl.2	-	4	801	c.452G>T	c.(451-453)TGC>TTC	p.C151F	ZFP64_uc002xwk.2_Missense_Mutation_p.C151F|ZFP64_uc002xwm.2_Missense_Mutation_p.C149F|ZFP64_uc002xwn.2_Missense_Mutation_p.C97F	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	151					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CTTGAATTGGCAACCTAAAAA	0.254													13	48	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61944518	61944518	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61944518G>C	uc011aau.1	+	17	2226	c.2126G>C	c.(2125-2127)AGG>ACG	p.R709T	COL20A1_uc011aav.1_Missense_Mutation_p.R530T	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	709	Fibronectin type-III 5.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					GGCCTAGGGAGGCACACAGAG	0.657													8	31	---	---	---	---	PASS
KRTAP11-1	337880	broad.mit.edu	37	21	32253437	32253437	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32253437C>A	uc002yov.2	-	1	438	c.407G>T	c.(406-408)GGA>GTA	p.G136V		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	136	3.|4 X 10 AA approximate repeats.					keratin filament	structural molecule activity			pancreas(1)	1						AGTAGAGACTCCTCCCACTGG	0.597													13	68	---	---	---	---	PASS
RIPK4	54101	broad.mit.edu	37	21	43164076	43164076	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43164076C>A	uc002yzn.1	-	7	1209	c.1161G>T	c.(1159-1161)CTG>CTT	p.L387L		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	387						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						AGGACAGCGACAGTGATCCTC	0.632													16	54	---	---	---	---	PASS
CCT8L2	150160	broad.mit.edu	37	22	17073086	17073086	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17073086C>A	uc002zlp.1	-	1	615	c.355G>T	c.(355-357)GCA>TCA	p.A119S		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	119					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				AGCTGCTCTGCCTGTTCCAGC	0.657													12	33	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17669238	17669238	+	Missense_Mutation	SNP	C	G	G	rs45511697	by1000genomes	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17669238C>G	uc002zmk.1	-	6	1284	c.1072G>C	c.(1072-1074)GGA>CGA	p.G358R	CECR1_uc010gqu.1_Missense_Mutation_p.G358R|CECR1_uc011agi.1_Missense_Mutation_p.G316R|CECR1_uc002zmj.1_Missense_Mutation_p.G117R	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1	358					adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CCTGTTTCTCCGGCGTGGAAG	0.602													12	79	---	---	---	---	PASS
CECR1	51816	broad.mit.edu	37	22	17669239	17669239	+	Silent	SNP	G	A	A	rs144447953		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17669239G>A	uc002zmk.1	-	6	1283	c.1071C>T	c.(1069-1071)GCC>GCT	p.A357A	CECR1_uc010gqu.1_Silent_p.A357A|CECR1_uc011agi.1_Silent_p.A315A|CECR1_uc002zmj.1_Silent_p.A116A	NM_017424	NP_059120	Q9NZK5	CECR1_HUMAN	cat eye syndrome critical region protein 1	357					adenosine catabolic process|hypoxanthine salvage|inosine biosynthetic process|multicellular organismal development|purine ribonucleoside monophosphate biosynthetic process	extracellular space|Golgi apparatus	adenosine deaminase activity|adenosine receptor binding|growth factor activity|heparin binding|protein homodimerization activity|proteoglycan binding|zinc ion binding			ovary(1)	1		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				CTGTTTCTCCGGCGTGGAAGA	0.597													12	79	---	---	---	---	PASS
NCRNA00207	388910	broad.mit.edu	37	22	44966431	44966431	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44966431T>A	uc003bev.1	+	2	155	c.88T>A	c.(88-90)TCA>ACA	p.S30T	NCRNA00207_uc011aqg.1_RNA|NCRNA00207_uc011aqh.1_RNA	NM_001012986	NP_001013004			SubName: Full=Novel gene;												0						TGGGATCCAATCACTGAACCA	0.473													7	23	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45802744	45802744	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45802744C>A	uc003bgc.2	-	3	353	c.301G>T	c.(301-303)GGA>TGA	p.G101*	SMC1B_uc003bgd.2_Nonsense_Mutation_p.G101*|SMC1B_uc003bge.1_5'UTR	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	101					chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCTGAGCATCCCCCTAAAATA	0.279													5	40	---	---	---	---	PASS
FAM19A5	25817	broad.mit.edu	37	22	49042449	49042449	+	Silent	SNP	C	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49042449C>T	uc003bim.3	+	2	270	c.153C>T	c.(151-153)GAC>GAT	p.D51D	FAM19A5_uc003bio.3_Silent_p.D44D	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine	51						extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		TGACCTTGGACCGGGACAGCA	0.657													6	43	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3242791	3242791	+	Missense_Mutation	SNP	T	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3242791T>A	uc004crg.3	-	5	1092	c.935A>T	c.(934-936)CAA>CTA	p.Q312L		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	312						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CTGGGGCAGTTGGAATTTCTC	0.493													24	33	---	---	---	---	PASS
MAGEB10	139422	broad.mit.edu	37	X	27839468	27839468	+	Silent	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27839468C>A	uc004dbw.2	+	3	272	c.45C>A	c.(43-45)CGC>CGA	p.R15R		NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	15										lung(1)|breast(1)|central_nervous_system(1)	3						GGGAAAAACGCCGTCAGGCCC	0.532													10	16	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109694807	109694807	+	Missense_Mutation	SNP	C	G	G			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109694807C>G	uc004eor.1	+	3	1208	c.962C>G	c.(961-963)TCC>TGC	p.S321C	RGAG1_uc011msr.1_Missense_Mutation_p.S321C	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	321										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GAAGTAATGTCCACACCGCTA	0.493													62	109	---	---	---	---	PASS
GABRE	2564	broad.mit.edu	37	X	151138714	151138714	+	Missense_Mutation	SNP	G	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151138714G>C	uc004ffi.2	-	2	271	c.217C>G	c.(217-219)CGC>GGC	p.R73G	GABRE_uc011myd.1_RNA|GABRE_uc011mye.1_RNA	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	73	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TTCAGGATGCGAGAGGCTTCT	0.547													37	55	---	---	---	---	PASS
RENBP	5973	broad.mit.edu	37	X	153207088	153207088	+	Missense_Mutation	SNP	C	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153207088C>A	uc004fjo.1	-	8	958	c.788G>T	c.(787-789)GGC>GTC	p.G263V	RENBP_uc011mzh.1_Missense_Mutation_p.A236S	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein	263					mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	CAGAAACCAGCCGGCTTCCAG	0.627													16	17	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11587001	11587002	+	Intron	INS	-	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11587001_11587002insT	uc001ash.3	+							NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2						cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GGCCCCCTCACttttttttttt	0.292													4	2	---	---	---	---	
C1D	10438	broad.mit.edu	37	2	68269961	68269967	+	3'UTR	DEL	GGGGGGG	-	-	rs3038891		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68269961_68269967delGGGGGGG	uc002sea.3	-	5					C1D_uc002seb.2_3'UTR|C1D_uc002sec.2_3'UTR|C1D_uc010fdc.2_3'UTR	NM_173177	NP_775269	Q13901	C1D_HUMAN	nuclear DNA-binding protein						apoptosis|maturation of 5.8S rRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear exosome (RNase complex)|nucleolus	DNA binding|RNA binding				0						ATTATTTTgcggggggggggggggggg	0.251													4	2	---	---	---	---	
GMCL1	64395	broad.mit.edu	37	2	70070122	70070123	+	Intron	INS	-	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70070122_70070123insA	uc002sfu.2	+							NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						TTGGACTTGTTAAAAAAAAAAA	0.243													3	3	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160628210	160628211	+	3'UTR	DEL	TT	-	-	rs3836181		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160628210_160628211delTT	uc002ubb.3	-	39					LY75_uc010fos.2_3'UTR|CD302_uc002uba.2_3'UTR|CD302_uc010zco.1_3'UTR	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		ACCTAAAGACTTTTCACAGCAG	0.302													4	3	---	---	---	---	
ZNF732	654254	broad.mit.edu	37	4	290096	290096	+	5'Flank	DEL	G	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:290096delG	uc011buu.1	-						ZNF732_uc010ibb.1_Intron	NM_001137608	NP_001131080	B4DXR9	ZN732_HUMAN	zinc finger protein 732						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTATAGCTCTGCAGAAAAAGG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													7	5	---	---	---	---	
METTL14	57721	broad.mit.edu	37	4	119613381	119613382	+	Intron	INS	-	T	T			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119613381_119613382insT	uc003icf.2	+						METTL14_uc003icg.2_Intron	NM_020961	NP_066012	Q9HCE5	MTL14_HUMAN	methyltransferase like 14							nucleus	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity				0						cttttcttttcttttttttttt	0.139													4	3	---	---	---	---	
INTU	27152	broad.mit.edu	37	4	128621135	128621136	+	Intron	DEL	TA	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128621135_128621136delTA	uc003ifk.1	+						INTU_uc011cgq.1_Intron	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6											ovary(1)	1						GTCAAATGTTTATGTTACTCTT	0.307													63	48	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58287555	58287556	+	Intron	DEL	AC	-	-	rs148212719		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58287555_58287556delAC	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc003jrs.2_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	AAAAAAAAAAACCCCAATTAAT	0.317													3	4	---	---	---	---	
SYNGAP1	8831	broad.mit.edu	37	6	33406897	33406897	+	Intron	DEL	A	-	-	rs72093601		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33406897delA	uc011dri.1	+						SYNGAP1_uc010juy.2_Intron|SYNGAP1_uc010juz.2_Intron	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						aaattagaagaaaaaaaaaaa	0.154													5	3	---	---	---	---	
FAM162B	221303	broad.mit.edu	37	6	117073894	117073895	+	Intron	INS	-	AG	AG	rs61228007		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117073894_117073895insAG	uc003pxi.2	-							NM_001085480	NP_001078949	Q5T6X4	F162B_HUMAN	hypothetical protein LOC221303							integral to membrane					0						tatatatatatatagatacacg	0.292													7	4	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155497875	155497875	+	Intron	DEL	C	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155497875delC	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron|TIAM2_uc010kjj.2_Intron|TIAM2_uc003qqf.2_Intron|TIAM2_uc011efl.1_Intron|TIAM2_uc003qqg.2_Intron	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CGTAAATGAACAGGACATTTG	0.418													25	17	---	---	---	---	
STRA8	346673	broad.mit.edu	37	7	134936765	134936766	+	Intron	INS	-	GT	GT	rs142941773	by1000genomes	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134936765_134936766insGT	uc011kpx.1	+							NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8						DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0						agagagagagagtgtgtgtgtg	0.183													8	4	---	---	---	---	
INSL6	11172	broad.mit.edu	37	9	5185131	5185131	+	Intron	DEL	A	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5185131delA	uc003zix.2	-							NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor							extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		CCTCCAAGTTAAAAAAAAAAG	0.219													4	2	---	---	---	---	
DCTN3	11258	broad.mit.edu	37	9	34615896	34615897	+	Intron	INS	-	A	A	rs144108229		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34615896_34615897insA	uc003zux.1	-						DCTN3_uc003zuw.1_Intron	NM_007234	NP_009165	O75935	DCTN3_HUMAN	dynactin 3 isoform 1						cytokinesis|G2/M transition of mitotic cell cycle|mitosis	centrosome|cleavage furrow|condensed chromosome kinetochore|cytosol|dynactin complex|midbody|perinuclear region of cytoplasm|spindle	protein binding|structural molecule activity				0	all_epithelial(49;0.0863)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.0388)		cgactctgtccaaaaaaaaaaa	0.203													4	2	---	---	---	---	
PHF19	26147	broad.mit.edu	37	9	123629364	123629364	+	Intron	DEL	C	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123629364delC	uc004bks.1	-						PHF19_uc011lyf.1_Intron|PHF19_uc004bkr.2_Intron	NM_015651	NP_056466	Q5T6S3	PHF19_HUMAN	PHD finger protein 19 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|breast(1)	2						aattcagttactgagcactta	0.234													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138398099	138398099	+	RNA	DEL	C	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138398099delC	uc004cfy.2	-	1		c.195delG								Homo sapiens, clone IMAGE:4662750, mRNA.																		ACCCCAAGAGCCCCCAGAAGA	0.642													4	2	---	---	---	---	
PTF1A	256297	broad.mit.edu	37	10	23482393	23482393	+	Intron	DEL	T	-	-	rs72117811		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23482393delT	uc001irp.2	+							NM_178161	NP_835455	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a						endocrine pancreas development|exocrine pancreas development|regulation of transcription, DNA-dependent|tissue development|transcription, DNA-dependent	cytoplasm|transcription factor complex				pancreas(1)|skin(1)	2						GCGTTTCTCGttttttttttt	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383716	42383717	+	IGR	INS	-	G	G	rs145968937		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383716_42383717insG								None (None upstream) : LOC441666 (443598 downstream)																							tggaatcaaaataaccatcatc	0.000													7	4	---	---	---	---	
OIT3	170392	broad.mit.edu	37	10	74683836	74683837	+	Intron	INS	-	A	A	rs112952142		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74683836_74683837insA	uc001jte.1	+						OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor							nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					AGGGCAGTGGGAAAAAAAAACA	0.287													4	3	---	---	---	---	
OSBPL5	114879	broad.mit.edu	37	11	3118223	3118225	+	Intron	DEL	AGA	-	-	rs71035479	by1000genomes	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3118223_3118225delAGA	uc001lxk.2	-						OSBPL5_uc010qxq.1_Intron|OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron|OSBPL5_uc001lxj.2_5'Flank	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		tgggaggaggagaagaggaaaga	0.025													2	4	---	---	---	---	
MRPS35	60488	broad.mit.edu	37	12	27872605	27872606	+	Intron	INS	-	A	A	rs34620750		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27872605_27872606insA	uc001rih.2	+						MRPS35_uc001rii.2_Intron	NM_021821	NP_068593	P82673	RT35_HUMAN	mitochondrial ribosomal protein S35 precursor						DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0	Lung SC(9;0.0873)					gactctgtctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34319397	34319397	+	IGR	DEL	C	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34319397delC								ALG10 (138163 upstream) : None (None downstream)																							GGGAGGGTCGCCGTTCCCAGG	0.607													9	5	---	---	---	---	
MIP	4284	broad.mit.edu	37	12	56844931	56844932	+	3'UTR	DEL	AC	-	-	rs71081362		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56844931_56844932delAC	uc001slh.2	-	4					TIMELESS_uc001slf.2_5'Flank|TIMELESS_uc001slg.2_5'Flank	NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber						response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1						AAAAAAAAAAACAACCACATAC	0.426													8	5	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119560098	119560105	+	Intron	DEL	AGGAAGGA	-	-	rs146974381	by1000genomes	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119560098_119560105delAGGAAGGA	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						gcaggaaggcaggaaggaaggaaggaag	0.197													4	2	---	---	---	---	
SDCCAG1	9147	broad.mit.edu	37	14	50269012	50269013	+	Intron	INS	-	A	A			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50269012_50269013insA	uc001wxc.2	-						SDCCAG1_uc010anj.1_Intron|SDCCAG1_uc001wwz.2_5'Flank|SDCCAG1_uc001wxa.2_5'Flank|SDCCAG1_uc010tqi.1_Intron|SDCCAG1_uc001wxe.2_Intron|SDCCAG1_uc001wxd.1_Intron	NM_004713	NP_004704	O60524	NEMF_HUMAN	serologically defined colon cancer antigen 1							cytoplasm|nucleus					0	all_epithelial(31;0.000822)|Breast(41;0.0117)	all_lung(585;1.02e-05)		OV - Ovarian serous cystadenocarcinoma(311;5.99e-34)		TTAGCATTTCCAAAAAAAAAAA	0.203													5	3	---	---	---	---	
SGSM2	9905	broad.mit.edu	37	17	2282203	2282220	+	Intron	DEL	TCAGCCCCAGCCCCAGCC	-	-	rs11269049	by1000genomes	TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2282203_2282220delTCAGCCCCAGCCCCAGCC	uc002fun.3	+						SGSM2_uc002fum.3_Intron|SGSM2_uc010vqw.1_Intron|SGSM2_uc002fup.1_Intron|SGSM2_uc002fuq.2_Intron	NM_001098509	NP_001091979	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 2							intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CCGGccagcatcagccccagccccagcctcagcctcag	0.353													3	3	---	---	---	---	
NCRNA00188	125144	broad.mit.edu	37	17	16344167	16344167	+	Intron	DEL	A	-	-	rs140410248		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16344167delA	uc002gqc.2	+						NCRNA00188_uc010vwf.1_Intron|NCRNA00188_uc010vwg.1_Intron|NCRNA00188_uc010vwh.1_Intron|NCRNA00188_uc010cpd.2_Intron|NCRNA00188_uc002gqb.3_Intron|NCRNA00188_uc010vwi.1_Intron|NCRNA00188_uc010vwj.1_Intron|NCRNA00188_uc002gqa.3_Intron|NCRNA00188_uc010vwk.1_Intron|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|SNORD65_uc002gqf.1_5'Flank	NR_027667				RecName: Full=Putative uncharacterized protein C17orf45, mitochondrial; Flags: Precursor;												0						actccatctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
HELZ	9931	broad.mit.edu	37	17	65146246	65146247	+	Intron	INS	-	TT	TT	rs11372378		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65146246_65146247insTT	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TATTttctttcttttttttttt	0.124													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78516456	78516456	+	5'Flank	DEL	A	-	-	rs143567101		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78516456delA	uc002jyt.1	+						RPTOR_uc002jys.2_5'Flank|RPTOR_uc010wuf.1_5'Flank|RPTOR_uc010wug.1_5'Flank|RPTOR_uc002jyr.1_5'Flank	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						TAAAAACTGCAAAAAAAaaaa	0.224													5	4	---	---	---	---	
SERPINB11	89778	broad.mit.edu	37	18	61388270	61388271	+	Intron	DEL	AC	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61388270_61388271delAC	uc002ljk.3	+						SERPINB11_uc010xes.1_Intron|SERPINB11_uc010dqd.2_Intron|SERPINB11_uc002ljj.3_Intron|SERPINB11_uc010dqe.2_Intron|SERPINB11_uc010dqf.2_Intron	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11						regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)				GTGCATGTTAACACACACACAC	0.386													6	3	---	---	---	---	
LOC284441	284441	broad.mit.edu	37	19	20368479	20368479	+	5'UTR	DEL	G	-	-			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20368479delG	uc002nov.2	+	1						NR_003128				SubName: Full=cDNA FLJ51655, highly similar to Actin-like protein 2;												0						ACGGCAGGGCGGCAGCGGCTG	0.448													13	7	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085863	11085864	+	Intron	INS	-	C	C			TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085863_11085864insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		catcaccaccaccaccatcacc	0.000													4	2	---	---	---	---	
HIC2	23119	broad.mit.edu	37	22	21797102	21797102	+	5'UTR	DEL	G	-	-	rs66532305		TCGA-43-6771-01A-11D-1817-08	TCGA-43-6771-11A-01D-1817-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21797102delG	uc002zur.3	+	2					HIC2_uc002zus.3_5'UTR	NM_015094	NP_055909	Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	focal adhesion|nucleus	DNA binding|protein C-terminus binding|zinc ion binding			skin(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				AGCCCCCCCCGCCGCTGGCTG	0.672													4	2	---	---	---	---	
