Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SDF4	51150	broad.mit.edu	37	1	1153991	1153991	+	Silent	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1153991G>A	uc001adh.3	-	6	1088	c.759C>T	c.(757-759)CTC>CTT	p.L253L	SDF4_uc001adg.2_RNA|SDF4_uc001adi.3_Silent_p.L253L|SDF4_uc009vjv.2_Silent_p.L131L|SDF4_uc009vjw.2_RNA	NM_016176	NP_057260	Q9BRK5	CAB45_HUMAN	stromal cell derived factor 4 isoform 2	253	4 (Potential).|EF-hand 4.				cerebellum development|fat cell differentiation|response to ethanol|UV protection|zymogen granule exocytosis	bleb|Golgi lumen|late endosome|soluble fraction	calcium ion binding|calcium ion binding|identical protein binding|protein binding			upper_aerodigestive_tract(1)|large_intestine(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;7.85e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.42e-21)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;4.83e-05)|Kidney(185;0.00252)|BRCA - Breast invasive adenocarcinoma(365;0.00263)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0368)|Lung(427;0.204)		CGGGCACAGAGAGCTGCTTGT	0.632													17	65	---	---	---	---	PASS
PGD	5226	broad.mit.edu	37	1	10477566	10477566	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10477566G>C	uc001arc.2	+	10	1199	c.1109G>C	c.(1108-1110)AGT>ACT	p.S370T	PGD_uc001ard.2_Missense_Mutation_p.S290T|PGD_uc010oak.1_Missense_Mutation_p.S348T|PGD_uc010oal.1_Missense_Mutation_p.S357T	NM_002631	NP_002622	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	370					pentose-phosphate shunt, oxidative branch	cytosol	NADP binding|phosphogluconate dehydrogenase (decarboxylating) activity|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)		ATCATTAGAAGGTAAGTGAGA	0.562													29	102	---	---	---	---	PASS
RPS6KA1	6195	broad.mit.edu	37	1	26883509	26883509	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26883509C>G	uc001bmr.1	+	13	1165	c.1002C>G	c.(1000-1002)ATC>ATG	p.I334M	RPS6KA1_uc010ofe.1_Missense_Mutation_p.I242M|RPS6KA1_uc010off.1_Missense_Mutation_p.I318M|RPS6KA1_uc001bms.1_Missense_Mutation_p.I343M|RPS6KA1_uc009vsl.1_Missense_Mutation_p.I177M	NM_002953	NP_002944	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	334	AGC-kinase C-terminal.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		GTCGTGAGATCAAGCCACCCT	0.587													30	108	---	---	---	---	PASS
HDAC1	3065	broad.mit.edu	37	1	32797376	32797376	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32797376G>C	uc001bvb.1	+	11	1251	c.1188G>C	c.(1186-1188)GAG>GAC	p.E396D	HDAC1_uc010ohf.1_Missense_Mutation_p.E367D|HDAC1_uc001bvc.1_Missense_Mutation_p.E152D	NM_004964	NP_004955	Q13547	HDAC1_HUMAN	histone deacetylase 1	396				Missing: Strongly decreases deacetylase activity, and disrupts interaction with NuRD and SIN3 complexes.	anti-apoptosis|blood coagulation|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|histone H3 deacetylation|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of androgen receptor signaling pathway|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytosol|NuRD complex|Sin3 complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|identical protein binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|RNA polymerase II transcription corepressor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)	3		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	GTGGCGATGAGGACGAAGACG	0.567													39	131	---	---	---	---	PASS
KTI12	112970	broad.mit.edu	37	1	52498835	52498835	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52498835G>A	uc001ctj.1	-	1	638	c.599C>T	c.(598-600)TCC>TTC	p.S200F	TXNDC12_uc001cti.2_Intron	NM_138417	NP_612426	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated	200							ATP binding			central_nervous_system(2)	2						AAAGGCACCGGACCCATGCTT	0.577													42	118	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52828391	52828391	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52828391C>G	uc001ctq.1	-	3	235	c.97G>C	c.(97-99)GAG>CAG	p.E33Q	CC2D1B_uc001cts.2_5'Flank	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	33										ovary(2)	2						AGCATGTCCTCAGGGCCAAAC	0.572													53	165	---	---	---	---	PASS
NPR1	4881	broad.mit.edu	37	1	153654196	153654196	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153654196C>A	uc001fcs.3	+	4	1473	c.1052C>A	c.(1051-1053)GCA>GAA	p.A351E	NPR1_uc010pdz.1_Missense_Mutation_p.A97E	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	351	Extracellular (Potential).				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	ACCATCCCAGCATCCTTCCAC	0.582													51	79	---	---	---	---	PASS
NUF2	83540	broad.mit.edu	37	1	163295920	163295920	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163295920G>A	uc001gcq.1	+	2	379	c.79G>A	c.(79-81)GAT>AAT	p.D27N	NUF2_uc001gcp.2_Missense_Mutation_p.D27N|NUF2_uc001gcr.1_Missense_Mutation_p.D27N|NUF2_uc009wvc.1_Missense_Mutation_p.D27N	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	27	Interaction with the N-terminus of NDC80.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					AACAGGAGCTGATGGTAAAAA	0.358													122	163	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178414802	178414802	+	Intron	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178414802G>A	uc001glr.2	+						RASAL2_uc001glq.2_Intron	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						CACTGGGTATGAAAGAGAAAA	0.368													34	126	---	---	---	---	PASS
ABL2	27	broad.mit.edu	37	1	179090794	179090794	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179090794T>C	uc001gmj.3	-	5	1183	c.896A>G	c.(895-897)TAT>TGT	p.Y299C	ABL2_uc010pnf.1_Missense_Mutation_p.Y299C|ABL2_uc010png.1_Missense_Mutation_p.Y278C|ABL2_uc010pnh.1_Missense_Mutation_p.Y278C|ABL2_uc009wxe.2_Missense_Mutation_p.Y278C|ABL2_uc001gmg.3_Missense_Mutation_p.Y284C|ABL2_uc001gmi.3_Missense_Mutation_p.Y284C|ABL2_uc001gmh.3_Missense_Mutation_p.Y263C|ABL2_uc010pne.1_Missense_Mutation_p.Y263C|ABL2_uc009wxf.1_Missense_Mutation_p.Y284C|ABL2_uc001gmk.2_Missense_Mutation_p.Y263C	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	299	ATP (By similarity).|Protein kinase.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	AACCTCTCCATACTGACCGCC	0.453			T	ETV6	AML								135	213	---	---	---	---	PASS
SOX13	9580	broad.mit.edu	37	1	204092245	204092245	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204092245C>T	uc001ham.2	+	11	1735	c.1140C>T	c.(1138-1140)CTC>CTT	p.L380L	SOX13_uc010pqp.1_Silent_p.L379L|SOX13_uc010pqq.1_Silent_p.L247L	NM_005686	NP_005677	Q9UN79	SOX13_HUMAN	SRY-box 13	380					anatomical structure morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CCTAGGACCTCATCAGCCTGG	0.612													56	104	---	---	---	---	PASS
C1orf74	148304	broad.mit.edu	37	1	209956220	209956220	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209956220C>T	uc001hhp.1	-	2	1003	c.760G>A	c.(760-762)GAT>AAT	p.D254N		NM_152485	NP_689698	Q96LT6	CA074_HUMAN	hypothetical protein LOC148304	254										skin(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		ATGCTGAGATCAGCAAAGTCA	0.478													53	231	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248263404	248263404	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263404C>T	uc001ids.2	+	3	1064	c.727C>T	c.(727-729)CAT>TAT	p.H243Y		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CATTTCAACACATTTAACTGT	0.453													83	144	---	---	---	---	PASS
APLF	200558	broad.mit.edu	37	2	68765102	68765102	+	Silent	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68765102T>C	uc002sep.2	+	7	1076	c.903T>C	c.(901-903)CTT>CTC	p.L301L	APLF_uc002seq.1_RNA|APLF_uc010fdf.2_Silent_p.L277L|APLF_uc002ser.1_Silent_p.L32L	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	301					double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						TAGAGGAACTTGGTAAAGTTT	0.363													33	97	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116572478	116572478	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116572478A>G	uc002tla.1	+	20	2267	c.1810A>G	c.(1810-1812)AGT>GGT	p.S604G	DPP10_uc002tlb.1_Missense_Mutation_p.S554G|DPP10_uc002tlc.1_Missense_Mutation_p.S600G|DPP10_uc002tle.2_Missense_Mutation_p.S608G|DPP10_uc002tlf.1_Missense_Mutation_p.S597G	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	604	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TGGCAGAGGAAGTGGATTCCA	0.423													56	150	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155158078	155158078	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155158078G>C	uc002tyr.3	+	9	1699	c.1132G>C	c.(1132-1134)GAT>CAT	p.D378H	GALNT13_uc002tyt.3_Missense_Mutation_p.D378H|GALNT13_uc010foc.1_Missense_Mutation_p.D197H|GALNT13_uc010fod.2_Missense_Mutation_p.D131H	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	378	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TGAATTTAAAGATTTCTTCTA	0.363													68	220	---	---	---	---	PASS
MAP1D	254042	broad.mit.edu	37	2	172944926	172944926	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172944926C>T	uc002uhk.2	+	9	994	c.921C>T	c.(919-921)GAC>GAT	p.D307D	MAP1D_uc010zdw.1_Silent_p.D189D	NM_199227	NP_954697	Q6UB28	AMP1D_HUMAN	methionine aminopeptidase 1D precursor	307					N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)			tctccctagacaatcAAAGGT	0.383													59	179	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196771521	196771521	+	Intron	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196771521T>C	uc002utj.3	-							NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CTGTAGGTAATCAGGAATGAA	0.353													43	109	---	---	---	---	PASS
TRIM59	286827	broad.mit.edu	37	3	160155865	160155865	+	Silent	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160155865T>C	uc003fdm.2	-	3	1302	c.1107A>G	c.(1105-1107)CTA>CTG	p.L369L	IFT80_uc003fda.2_Intron	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	369						integral to membrane|intracellular	zinc ion binding				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GGTAAACAGATAGAGAGGCTT	0.313													87	88	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56831872	56831872	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56831872C>T	uc003hbi.2	+	8	1125	c.891C>T	c.(889-891)ACC>ACT	p.T297T	CEP135_uc003hbj.2_Silent_p.T3T|CEP135_uc010igz.1_Silent_p.T127T	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	297	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					TTATGGAAACCAAGGAAACAG	0.353													44	75	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123268789	123268789	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123268789C>T	uc003ieh.2	+	74	13029	c.12984C>T	c.(12982-12984)TCC>TCT	p.S4328S	KIAA1109_uc003iem.2_Silent_p.S684S	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4328					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AGTCAGCCTCCTTCACCCACA	0.498													51	47	---	---	---	---	PASS
ANKH	56172	broad.mit.edu	37	5	14758688	14758688	+	Nonsense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14758688G>C	uc003jfm.3	-	3	664	c.333C>G	c.(331-333)TAC>TAG	p.Y111*		NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	111	Extracellular (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						TGATAATGTAGTATCCTAAAT	0.408													50	144	---	---	---	---	PASS
OR2B2	81697	broad.mit.edu	37	6	27879971	27879971	+	Silent	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27879971G>A	uc011dkw.1	-	1	127	c.127C>T	c.(127-129)CTG>TTG	p.L43L		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATTATTGTCAGATTGCCAAAG	0.393													52	88	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33403288	33403288	+	Intron	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33403288C>G	uc011dri.1	+						SYNGAP1_uc003oeo.1_Intron|SYNGAP1_uc010juy.2_Intron|SYNGAP1_uc010juz.2_5'Flank	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						ACACTCCTTTCTAGGTAACAA	0.517													146	212	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51907784	51907784	+	Silent	SNP	A	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51907784A>C	uc003pah.1	-	27	3246	c.2970T>G	c.(2968-2970)GTT>GTG	p.V990V	PKHD1_uc003pai.2_Silent_p.V990V	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	990	IPT/TIG 4.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GATGCATTCCAACAGGTAGCA	0.453													77	141	---	---	---	---	PASS
PHF3	23469	broad.mit.edu	37	6	64394489	64394489	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64394489C>T	uc003pep.1	+	3	892	c.866C>T	c.(865-867)TCA>TTA	p.S289L	PHF3_uc010kaf.1_Missense_Mutation_p.S289L|PHF3_uc003pem.2_Missense_Mutation_p.S242L|PHF3_uc010kag.1_Missense_Mutation_p.S201L|PHF3_uc010kah.1_Missense_Mutation_p.S103L|PHF3_uc003pen.2_Missense_Mutation_p.S201L|PHF3_uc011dxs.1_Intron|PHF3_uc003peo.2_Missense_Mutation_p.S289L	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3	289					multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TTTAAGTTTTCAGATAAAGAA	0.343													30	130	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69349286	69349286	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69349286G>A	uc003pev.3	+	3	1167	c.719G>A	c.(718-720)TGC>TAC	p.C240Y	BAI3_uc010kak.2_Missense_Mutation_p.C240Y	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	240	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				ACCCAAGTCTGCAATCTTACC	0.537													20	37	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76633407	76633407	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76633407C>T	uc003pik.1	-	16	2390	c.2260G>A	c.(2260-2262)GAA>AAA	p.E754K		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	754					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GCTTGATTTTCAGAGTGATCT	0.299													20	29	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129813638	129813638	+	Intron	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129813638T>C	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron|uc003qbq.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGTAAGTGTTTATATTATCCC	0.418													32	97	---	---	---	---	PASS
TAAR2	9287	broad.mit.edu	37	6	132939033	132939033	+	Silent	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132939033C>A	uc003qdl.1	-	2	312	c.312G>T	c.(310-312)TCG>TCT	p.S104S	TAAR2_uc010kfr.1_Silent_p.S59S	NM_001033080	NP_001028252	Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2 isoform 1	104	Extracellular (Potential).					plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		AGTTCTCCACCGATCTGATCA	0.423													48	107	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133077185	133077185	+	Intron	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133077185T>C	uc003qdt.2	-						VNN2_uc003qds.2_Intron|VNN2_uc010kgb.2_Intron|VNN2_uc003qdv.2_Intron	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor						cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTAAACCaaattataattaag	0.328													7	15	---	---	---	---	PASS
REPS1	85021	broad.mit.edu	37	6	139235823	139235823	+	Intron	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139235823T>C	uc003qii.2	-						REPS1_uc003qig.3_Intron|REPS1_uc011edr.1_Intron|REPS1_uc003qij.2_Intron|REPS1_uc003qik.2_Intron	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1							coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		ATAAATACCTTGGAGAATTAC	0.413													33	85	---	---	---	---	PASS
TTLL2	83887	broad.mit.edu	37	6	167754034	167754034	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167754034T>A	uc003qvs.1	+	3	734	c.646T>A	c.(646-648)TTA>ATA	p.L216I	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	216	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCCTGCTGAGTTATCTCGTGG	0.418													45	160	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20784946	20784946	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20784946G>T	uc003suw.3	+	17	2525	c.1979G>T	c.(1978-1980)TGC>TTC	p.C660F	ABCB5_uc010kuh.2_Missense_Mutation_p.C1105F	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	660	Cytoplasmic (Potential).|ABC transporter 2.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						CTCTTCAACTGCAGCATTGCT	0.448													48	110	---	---	---	---	PASS
TBX20	57057	broad.mit.edu	37	7	35242047	35242047	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35242047C>T	uc011kas.1	-	8	1350	c.1339G>A	c.(1339-1341)GTA>ATA	p.V447I		NM_001077653	NP_001071121	Q9UMR3	TBX20_HUMAN	T-box transcription factor TBX20	447						nucleus	DNA binding			central_nervous_system(1)	1						AAGAGTCATACAAATGGCGTC	0.507													9	17	---	---	---	---	PASS
FAM183B	340286	broad.mit.edu	37	7	38725545	38725545	+	3'UTR	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38725545G>A	uc011kbd.1	-	2						NR_028347				Homo sapiens cDNA FLJ42138 fis, clone TESTI2036684.												0						TACAGCTCCCGCAAGATCTGG	0.577													32	92	---	---	---	---	PASS
TNS3	64759	broad.mit.edu	37	7	47453597	47453597	+	Splice_Site	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47453597T>C	uc003tnv.2	-	12	954	c.587_splice	c.e12-1	p.V196_splice	TNS3_uc003tnw.2_Splice_Site_p.V196_splice|TNS3_uc010kyo.1_Splice_Site_p.V196_splice	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3							focal adhesion	protein binding			ovary(4)	4						GCCGGCACACTGAAAGAAAGG	0.463													32	112	---	---	---	---	PASS
TFR2	7036	broad.mit.edu	37	7	100230713	100230713	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230713C>A	uc003uvv.1	-	6	801	c.760G>T	c.(760-762)GAA>TAA	p.E254*	TFR2_uc010lhc.1_5'UTR|TFR2_uc003uvu.1_Nonsense_Mutation_p.E83*	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2	254	Extracellular (Potential).				cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TGCAGGTCTTCGGGCCGCCCG	0.697													25	71	---	---	---	---	PASS
EPHB6	2051	broad.mit.edu	37	7	142568388	142568388	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142568388C>T	uc011kst.1	+	19	3694	c.2907C>T	c.(2905-2907)TTC>TTT	p.F969F	EPHB6_uc011ksu.1_Silent_p.F969F|EPHB6_uc003wbs.2_Silent_p.F677F|EPHB6_uc003wbt.2_Silent_p.F443F|EPHB6_uc003wbu.2_Silent_p.F677F|EPHB6_uc003wbv.2_Silent_p.F353F	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	969	SAM.|Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					AGGACAACTTCTCCAAGTTTG	0.607													54	196	---	---	---	---	PASS
INSIG1	3638	broad.mit.edu	37	7	155094556	155094556	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155094556G>A	uc003wly.2	+	5	1015	c.804G>A	c.(802-804)ATG>ATA	p.M268I	INSIG1_uc011kvu.1_Missense_Mutation_p.M116I|INSIG1_uc003wlz.2_3'UTR	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1	268	Cytoplasmic.				cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTTAGCTATGGTAAGTGAAA	0.383													54	193	---	---	---	---	PASS
GPR124	25960	broad.mit.edu	37	8	37699012	37699012	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37699012C>T	uc003xkj.2	+	19	3519	c.3156C>T	c.(3154-3156)TGC>TGT	p.C1052C	GPR124_uc010lvy.2_Silent_p.C835C	NM_032777	NP_116166	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124 precursor	1052	Helical; Name=7; (Potential).				central nervous system development|endothelial cell migration|neuropeptide signaling pathway|regulation of angiogenesis|regulation of chemotaxis|sprouting angiogenesis	integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(2)|ovary(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGTGCAGCTGCTTGTACGGGG	0.697													39	91	---	---	---	---	PASS
INTS8	55656	broad.mit.edu	37	8	95879535	95879535	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95879535A>G	uc003yhb.2	+	20	2510	c.2384A>G	c.(2383-2385)CAC>CGC	p.H795R	INTS8_uc011lgq.1_RNA|INTS8_uc011lgr.1_RNA|INTS8_uc010mba.2_Missense_Mutation_p.H622R	NM_017864	NP_060334	Q75QN2	INT8_HUMAN	integrator complex subunit 8	795					snRNA processing	integrator complex	protein binding				0	Breast(36;1.05e-06)					ACAGCTGAACACATTTCTATT	0.274													59	208	---	---	---	---	PASS
MTERFD1	51001	broad.mit.edu	37	8	97263324	97263324	+	Splice_Site	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97263324C>G	uc003yhs.1	-	4	566	c.488_splice	c.e4-1	p.G163_splice	MTERFD1_uc003yhr.1_Splice_Site_p.G42_splice|MTERFD1_uc010mbd.1_Splice_Site_p.G163_splice	NM_015942	NP_057026	Q96E29	MTER1_HUMAN	MTERF domain containing 1 precursor						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	transcription regulatory region DNA binding			ovary(1)	1	Breast(36;5.16e-05)					AAATCCACGCCTATAATAAAT	0.333													28	98	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	134025901	134025901	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134025901G>C	uc003ytw.2	+	37	6495	c.6454G>C	c.(6454-6456)GTG>CTG	p.V2152L	TG_uc010mdw.2_Missense_Mutation_p.V911L|TG_uc011ljb.1_Missense_Mutation_p.V521L|TG_uc011ljc.1_Missense_Mutation_p.V285L	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2152	Type IIIA.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ACCTGGGGCTGTGAGATGTAT	0.517													37	122	---	---	---	---	PASS
DNM1	1759	broad.mit.edu	37	9	131004537	131004537	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131004537C>G	uc011mau.1	+	15	1671	c.1584C>G	c.(1582-1584)ATC>ATG	p.I528M	DNM1_uc011mat.1_Missense_Mutation_p.I528M|DNM1_uc004bub.1_Translation_Start_Site|DNM1_uc004buc.1_Translation_Start_Site|DNM1_uc004bud.3_RNA	NM_004408	NP_004399	Q05193	DYN1_HUMAN	dynamin 1 isoform 1	528	PH.				receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2						GGCTGACTATCAATAATATTG	0.557													14	23	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135804270	135804270	+	5'UTR	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135804270G>A	uc004cca.2	-	3					TSC1_uc004ccb.3_5'UTR|TSC1_uc011mcq.1_5'UTR|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_5'UTR|TSC1_uc004ccc.1_5'UTR|TSC1_uc004ccd.2_5'UTR|TSC1_uc004cce.1_5'UTR	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1						activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding			lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TCTCTCGCTCGAAGGCGCTGT	0.532			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				21	51	---	---	---	---	PASS
CEL	1056	broad.mit.edu	37	9	135945996	135945996	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135945996A>G	uc010naa.1	+	10	1460	c.1444A>G	c.(1444-1446)ACA>GCA	p.T482A		NM_001807	NP_001798	P19835	CEL_HUMAN	carboxyl ester lipase precursor	479					cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CCAAGACAGGACAGTCTCTAA	0.607													38	89	---	---	---	---	PASS
GBGT1	26301	broad.mit.edu	37	9	136029232	136029232	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136029232T>C	uc004ccw.2	-	7	1057	c.776A>G	c.(775-777)TAT>TGT	p.Y259C	RALGDS_uc011mcw.1_Intron|GBGT1_uc004ccx.2_Missense_Mutation_p.Y212C|GBGT1_uc010nab.2_3'UTR|GBGT1_uc011mcx.1_Missense_Mutation_p.Y242C|GBGT1_uc010nac.1_Missense_Mutation_p.Y123C|GBGT1_uc004ccy.1_3'UTR	NM_021996	NP_068836	Q8N5D6	GBGT1_HUMAN	globoside	259	Lumenal (Potential).				carbohydrate metabolic process|glycolipid biosynthetic process	Golgi membrane|integral to membrane	metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		CCCACCATAATAGAAGTCCCC	0.592													38	51	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1232469	1232469	+	Intron	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1232469C>A	uc009xhq.2	-						ADARB2_uc009xhp.2_Intron|ADARB2_uc001igl.3_Intron|ADARB2_uc001igm.3_Intron	NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GCCCAGCTGGCCGGGTGTCTC	0.622													20	47	---	---	---	---	PASS
AKR1CL1	340811	broad.mit.edu	37	10	5227068	5227068	+	RNA	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5227068C>T	uc009xhz.2	-	1		c.83G>A				NR_027916				Homo sapiens cDNA FLJ16347 fis, clone TESTI2036288, moderately similar to PROSTAGLANDIN-F SYNTHASE 1 (EC 1.1.1.188).												0						CCGTCATCATCCCCAGCTAAC	0.507													28	95	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21177072	21177072	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21177072G>A	uc001iqi.2	-	4	720	c.323C>T	c.(322-324)ACA>ATA	p.T108I	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	108	Nebulin 3.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						ACTGTCAATTGTGGCTGGCAT	0.353													40	69	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28233864	28233864	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28233864C>G	uc009xky.2	-	11	1512	c.1414G>C	c.(1414-1416)GCG>CCG	p.A472P	ARMC4_uc010qds.1_5'UTR|ARMC4_uc010qdt.1_Missense_Mutation_p.A164P|ARMC4_uc001itz.2_Missense_Mutation_p.A472P|ARMC4_uc010qdu.1_Missense_Mutation_p.A164P	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	472							binding			ovary(4)|skin(2)	6						GAACACAACGCAATCACTGTA	0.438													26	106	---	---	---	---	PASS
ARHGAP12	94134	broad.mit.edu	37	10	32098194	32098194	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32098194C>A	uc001ivz.1	-	17	2362	c.2092G>T	c.(2092-2094)GCA>TCA	p.A698S	ARHGAP12_uc001ivy.1_Missense_Mutation_p.A644S|ARHGAP12_uc009xls.2_Missense_Mutation_p.A649S|ARHGAP12_uc001iwb.1_Missense_Mutation_p.A691S|ARHGAP12_uc001iwc.1_Missense_Mutation_p.A666S|ARHGAP12_uc009xlq.1_Missense_Mutation_p.A619S|ARHGAP12_uc001ivw.1_5'Flank|ARHGAP12_uc001ivx.1_5'UTR	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	698	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				TGGATCACTGCGAGGTTGCCA	0.358													33	117	---	---	---	---	PASS
SCD	6319	broad.mit.edu	37	10	102116493	102116493	+	Silent	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102116493G>A	uc001kqy.2	+	5	1342	c.852G>A	c.(850-852)GAG>GAA	p.E284E		NM_005063	NP_005054	O00767	ACOD_HUMAN	stearoyl-CoA desaturase 1	284	Cytoplasmic (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity				0		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		GCCCCCGGGAGAATATCCTGG	0.502													12	45	---	---	---	---	PASS
CPT1A	1374	broad.mit.edu	37	11	68549256	68549256	+	Silent	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68549256G>A	uc001oog.3	-	11	1505	c.1335C>T	c.(1333-1335)CAC>CAT	p.H445H	CPT1A_uc001oof.3_Silent_p.H445H|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform	445	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	AACATCGGCCGTGTAGTAGAG	0.488													91	289	---	---	---	---	PASS
ALKBH8	91801	broad.mit.edu	37	11	107403129	107403129	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107403129C>A	uc010rvr.1	-	8	850	c.775G>T	c.(775-777)GTC>TTC	p.V259F	ALKBH8_uc001pjk.2_Missense_Mutation_p.V7F|ALKBH8_uc010rvq.1_Missense_Mutation_p.V122F|ALKBH8_uc009yxp.2_Missense_Mutation_p.V259F|ALKBH8_uc001pjl.2_RNA	NM_138775	NP_620130	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8	259	Fe2OG dioxygenase.				response to DNA damage stimulus	cytosol|nucleus	metal ion binding|nucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|protein binding|RNA binding|tRNA (uracil) methyltransferase activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		AAATCCATGACAATCTTGAAG	0.388													20	77	---	---	---	---	PASS
M6PR	4074	broad.mit.edu	37	12	9098176	9098176	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9098176C>G	uc001qvf.2	-	3	351	c.181G>C	c.(181-183)GAG>CAG	p.E61Q		NM_002355	NP_002346	P20645	MPRD_HUMAN	cation-dependent mannose-6-phosphate receptor	61	Lumenal (Potential).				endosome to lysosome transport|receptor-mediated endocytosis	cell surface|endosome|integral to plasma membrane|lysosomal membrane	mannose binding|mannose transmembrane transporter activity|transmembrane receptor activity				0		Hepatocellular(102;0.137)		BRCA - Breast invasive adenocarcinoma(232;0.0146)		ACAGTGCTCTCAAAGCTGTAA	0.468													25	79	---	---	---	---	PASS
KLRB1	3820	broad.mit.edu	37	12	9750713	9750713	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9750713C>T	uc010sgt.1	-	5	521	c.459G>A	c.(457-459)TGG>TGA	p.W153*		NM_002258	NP_002249	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B,	153	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	sugar binding|transmembrane receptor activity				0						TTAATCCAATCCAAAACAGAA	0.299													14	55	---	---	---	---	PASS
ETV6	2120	broad.mit.edu	37	12	11905406	11905406	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11905406C>A	uc001qzz.2	+	2	330	c.56C>A	c.(55-57)CCT>CAT	p.P19H		NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6	19						cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TCATATACACCTCCAGAGAGC	0.542			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								51	158	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31238029	31238029	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31238029G>A	uc001rjt.1	+	5	858	c.607G>A	c.(607-609)GAG>AAG	p.E203K	DDX11_uc010sjw.1_Missense_Mutation_p.E203K|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Missense_Mutation_p.E203K|DDX11_uc001rjs.1_Missense_Mutation_p.E203K|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Missense_Mutation_p.E203K|DDX11_uc001rjw.1_Missense_Mutation_p.E177K|DDX11_uc001rjx.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	203	Glu-rich.|Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CGCCGAATACGAGAGTGATGA	0.627										Multiple Myeloma(12;0.14)			7	9	---	---	---	---	PASS
CACNB3	784	broad.mit.edu	37	12	49221670	49221670	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49221670G>C	uc001rsl.1	+	13	1644	c.1443G>C	c.(1441-1443)AAG>AAC	p.K481N	CACNB3_uc010sly.1_Missense_Mutation_p.K468N|CACNB3_uc010slz.1_Missense_Mutation_p.K480N|CACNB3_uc001rsk.1_Missense_Mutation_p.K328N	NM_000725	NP_000716	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3	481					axon guidance|membrane depolarization|synaptic transmission	cytosol|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0					Verapamil(DB00661)	CTTGGCCCAAGGATAGCTACT	0.647													12	37	---	---	---	---	PASS
ALDH1L2	160428	broad.mit.edu	37	12	105434380	105434380	+	Intron	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105434380C>G	uc001tlc.2	-						ALDH1L2_uc009zuo.2_Intron|ALDH1L2_uc009zup.2_Intron	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2						10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						CATTTAGTGGCTTACCTGAGC	0.453													195	611	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111957681	111957681	+	Splice_Site	SNP	A	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111957681A>T	uc001tsj.2	-	8	1628	c.1466_splice	c.e8+1	p.R489_splice	ATXN2_uc001tsh.2_Splice_Site_p.R224_splice|ATXN2_uc001tsi.2_Splice_Site_p.R200_splice|ATXN2_uc001tsk.2_Splice_Site|ATXN2_uc001tsm.1_Splice_Site_p.R224_splice	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						TCCTTTAAATACCTAGTGTTT	0.388													87	231	---	---	---	---	PASS
DHX37	57647	broad.mit.edu	37	12	125461949	125461949	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125461949C>T	uc001ugy.2	-	5	925	c.826G>A	c.(826-828)GAG>AAG	p.E276K		NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	276	ATP (By similarity).|Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CTGCCGGTCTCACCACACACG	0.577													44	126	---	---	---	---	PASS
SLC15A4	121260	broad.mit.edu	37	12	129294641	129294641	+	Silent	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129294641G>C	uc001uhu.2	-	3	911	c.858C>G	c.(856-858)GTC>GTG	p.V286V	SLC15A4_uc001uhv.2_Intron	NM_145648	NP_663623	Q8N697	S15A4_HUMAN	solute carrier family 15, member 4	286					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		ATTGCTGAAAGACTCCAATGC	0.378													47	136	---	---	---	---	PASS
SLC15A4	121260	broad.mit.edu	37	12	129299345	129299345	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129299345G>A	uc001uhu.2	-	2	870	c.817C>T	c.(817-819)CGA>TGA	p.R273*	SLC15A4_uc001uhv.2_RNA|MGC16384_uc001uhw.2_5'Flank	NM_145648	NP_663623	Q8N697	S15A4_HUMAN	solute carrier family 15, member 4	273					oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		TCTCCACTTCGCTTCTGGGAA	0.453													59	111	---	---	---	---	PASS
PUS1	80324	broad.mit.edu	37	12	132425925	132425925	+	Silent	SNP	G	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132425925G>T	uc001ujf.2	+	5	1112	c.633G>T	c.(631-633)GCG>GCT	p.A211A	PUS1_uc001ujg.2_Silent_p.A183A|PUS1_uc001ujh.2_Silent_p.A183A|PUS1_uc001uji.2_Silent_p.A158A	NM_025215	NP_079491	Q9Y606	TRUA_HUMAN	pseudouridine synthase 1 isoform 1	211						mitochondrion	pseudouridine synthase activity|pseudouridylate synthase activity|RNA binding			breast(1)|central_nervous_system(1)	2	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		TTGCCTTTGCGCACAAGGACC	0.607													28	67	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19748035	19748035	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19748035C>T	uc009zzj.2	-	5	1370	c.1321G>A	c.(1321-1323)GAA>AAA	p.E441K		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	441					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GCCTCGGCTTCCACGGAATCC	0.587													106	98	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65197885	65197885	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65197885C>T	uc001xho.1	+	7	1116	c.847C>T	c.(847-849)CAG>TAG	p.Q283*	PLEKHG3_uc001xhn.1_Nonsense_Mutation_p.Q227*|PLEKHG3_uc001xhp.2_Nonsense_Mutation_p.Q283*|PLEKHG3_uc010aqh.1_5'UTR	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	283					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGTCCGGCTCCAGGTGCTCTG	0.652													14	34	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65209878	65209878	+	Silent	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65209878C>G	uc001xho.1	+	17	3386	c.3117C>G	c.(3115-3117)CTC>CTG	p.L1039L	PLEKHG3_uc001xhn.1_Silent_p.L983L|PLEKHG3_uc001xhp.2_Silent_p.L1160L|PLEKHG3_uc010aqh.1_Silent_p.L581L|PLEKHG3_uc001xhq.1_Silent_p.L544L	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	1039					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGAGCCCCCTCAGCCCCACAG	0.612													44	138	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20170354	20170354	+	IGR	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170354T>C								None (None upstream) : GOLGA6L6 (566740 downstream)																							GTCCAGCCCATGGTGAGGAGC	0.537													50	207	---	---	---	---	PASS
SNORD115-20	100033460	broad.mit.edu	37	15	25468388	25468388	+	Intron	SNP	G	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25468388G>T	uc001yzq.1	+						SNORD115-26_uc001yzw.1_Intron|SNORD115-11_uc001yzx.1_5'Flank|SNORD115-30_uc001yzy.1_5'Flank	NR_003313				Homo sapiens small nucleolar RNA, C/D box 115-15 (SNORD115-15), non-coding RNA.												0						GGGGTTCTCTGGGTTGGGTCA	0.527													96	424	---	---	---	---	PASS
IREB2	3658	broad.mit.edu	37	15	78782999	78782999	+	Silent	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78782999C>G	uc002bdr.2	+	18	2382	c.2220C>G	c.(2218-2220)GCC>GCG	p.A740A	IREB2_uc010unb.1_Silent_p.A490A	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	740							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TTGAAAATGCCCATGTCTTAT	0.378													97	328	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100331367	100331367	+	RNA	SNP	A	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100331367A>T	uc010urx.1	-	5		c.2825T>A			C15orf51_uc010ury.1_RNA	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						CCACCCCGCAATGGCAGAAGA	0.502													17	40	---	---	---	---	PASS
TEKT5	146279	broad.mit.edu	37	16	10770015	10770015	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10770015G>C	uc002czz.1	-	5	959	c.887C>G	c.(886-888)GCC>GGC	p.A296G		NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5	296					microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						ACTGAACTTGGCCCAGGTCTC	0.433													18	55	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20430718	20430718	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20430718G>T	uc002dhe.2	+	4	731	c.584G>T	c.(583-585)AGC>ATC	p.S195I	ACSM5_uc002dhd.1_Missense_Mutation_p.S195I	NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	195					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						GTGTCAGACAGCAGTCGGCCA	0.537													18	62	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20491959	20491959	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20491959T>C	uc010bwe.2	+	12	1585	c.1346T>C	c.(1345-1347)ATC>ACC	p.I449T	ACSM2A_uc010vax.1_Missense_Mutation_p.I370T|ACSM2A_uc002dhf.3_Missense_Mutation_p.I449T|ACSM2A_uc002dhg.3_Missense_Mutation_p.I449T|ACSM2A_uc010vay.1_Missense_Mutation_p.I370T|ACSM2A_uc002dhh.3_Missense_Mutation_p.I79T	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	449					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						GACCGGGGAATCAAAGATGAA	0.502													31	96	---	---	---	---	PASS
EEF2K	29904	broad.mit.edu	37	16	22291592	22291592	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22291592G>T	uc002dki.2	+	17	2448	c.1963G>T	c.(1963-1965)GAG>TAG	p.E655*	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	655					insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		TGAGGGCGGTGAGTACGACGG	0.607													18	49	---	---	---	---	PASS
TNRC6A	27327	broad.mit.edu	37	16	24801959	24801959	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24801959A>G	uc002dmm.2	+	6	2110	c.1996A>G	c.(1996-1998)ACA>GCA	p.T666A	TNRC6A_uc010bxs.2_Missense_Mutation_p.T413A|TNRC6A_uc010vcc.1_Missense_Mutation_p.T413A|TNRC6A_uc002dmn.2_Missense_Mutation_p.T413A|TNRC6A_uc002dmo.2_Missense_Mutation_p.T413A	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	666	Sufficient for interaction with EIF2C2.|Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)		GTGGGCCAAAACAGGAGGTAC	0.458													19	55	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5424256	5424256	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5424256C>T	uc002gci.2	-	14	4415	c.3860G>A	c.(3859-3861)GGC>GAC	p.G1287D	NLRP1_uc002gcg.1_Missense_Mutation_p.G1291D|NLRP1_uc002gck.2_Intron|NLRP1_uc002gcj.2_Missense_Mutation_p.G1257D|NLRP1_uc002gcl.2_Intron|NLRP1_uc002gch.3_Intron	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1287					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				GTAACGACAGCCCATATAAAG	0.498													12	15	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578239	7578239	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578239C>A	uc002gim.2	-	6	804	c.610G>T	c.(610-612)GAG>TAG	p.E204*	TP53_uc002gig.1_Nonsense_Mutation_p.E204*|TP53_uc002gih.2_Nonsense_Mutation_p.E204*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E72*|TP53_uc010cng.1_Nonsense_Mutation_p.E72*|TP53_uc002gii.1_Nonsense_Mutation_p.E72*|TP53_uc010cnh.1_Nonsense_Mutation_p.E204*|TP53_uc010cni.1_Nonsense_Mutation_p.E204*|TP53_uc002gij.2_Nonsense_Mutation_p.E204*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.E111*|TP53_uc002gio.2_Nonsense_Mutation_p.E72*|TP53_uc010vug.1_Nonsense_Mutation_p.E165*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	204	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> A (in sporadic cancers; somatic mutation).|VE -> LV (in a sporadic cancer; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E204*(23)|p.0?(7)|p.E204fs*5(3)|p.E204G(2)|p.E204E(2)|p.E204K(2)|p.E204fs*43(2)|p.K164_P219del(1)|p.E204Q(1)|p.E204D(1)|p.E204fs*4(1)|p.E204A(1)|p.V203_E204>V*(1)|p.E204V(1)|p.V203_E204>LV(1)|p.E204fs*39(1)|p.G199fs*42(1)|p.E204_N210delEYLDDRN(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCCAAATACTCCACACGCAAA	0.542		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			17	43	---	---	---	---	PASS
DHRS7C	201140	broad.mit.edu	37	17	9684839	9684839	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9684839T>C	uc010vvb.1	-	2	227	c.227A>G	c.(226-228)AAC>AGC	p.N76S	DHRS7C_uc010cof.2_Missense_Mutation_p.N76S	NM_001105571	NP_001099041	A6NNS2	DRS7C_HUMAN	dehydrogenase/reductase (SDR family) member 7C	76						extracellular region	binding|oxidoreductase activity				0						ATCATATAGGTTCTCTAGCCT	0.562													13	27	---	---	---	---	PASS
KRT23	25984	broad.mit.edu	37	17	39092695	39092695	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39092695G>A	uc002hvm.1	-	2	750	c.161C>T	c.(160-162)CCC>CTC	p.P54L	KRT23_uc010wfl.1_Intron|KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.2_Missense_Mutation_p.P54L|KRT23_uc002hvn.1_Missense_Mutation_p.P54L	NM_015515	NP_056330	Q9C075	K1C23_HUMAN	keratin 23	54	Head.					intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)|Ovarian(249;0.15)				CCCTCCAGGGGGTGGGCAGCT	0.682													44	74	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75190993	75190993	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75190993G>A	uc002jto.2	+	7	976	c.709G>A	c.(709-711)GAC>AAC	p.D237N	SEC14L1_uc010dhc.2_Missense_Mutation_p.D237N|SEC14L1_uc010wth.1_Missense_Mutation_p.D237N|SEC14L1_uc002jtm.2_Missense_Mutation_p.D237N|SEC14L1_uc010wti.1_Missense_Mutation_p.D203N	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	237					transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						CACCCCTGACGGTGGGTCTGG	0.632													34	113	---	---	---	---	PASS
AFG3L2	10939	broad.mit.edu	37	18	12353077	12353077	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12353077C>G	uc002kqz.1	-	10	1358	c.1245G>C	c.(1243-1245)AAG>AAC	p.K415N		NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2	415					cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	CTCTTCCTCTCTTCCTTCCCA	0.502													40	174	---	---	---	---	PASS
B4GALT6	9331	broad.mit.edu	37	18	29246305	29246305	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29246305C>G	uc002kwz.3	-	2	443	c.146G>C	c.(145-147)CGA>CCA	p.R49P	B4GALT6_uc010dma.2_Intron|B4GALT6_uc010dmb.2_Missense_Mutation_p.R49P	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6	49	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			CATTATACCTCGAGCTTGTAC	0.313													45	148	---	---	---	---	PASS
DIRAS1	148252	broad.mit.edu	37	19	2717450	2717450	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2717450C>T	uc002lwf.3	-	2	513	c.355G>A	c.(355-357)GTG>ATG	p.V119M		NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	119					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGTTGCCCACGAGCATCACG	0.637													17	28	---	---	---	---	PASS
CELF5	60680	broad.mit.edu	37	19	3293414	3293414	+	Silent	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3293414G>A	uc002lxm.2	+	12	1465	c.1428G>A	c.(1426-1428)AAG>AAA	p.K476K	CELF5_uc002lxl.1_3'UTR|CELF5_uc010dtj.1_3'UTR|CELF5_uc010xhg.1_3'UTR|CELF5_uc002lxn.2_RNA	NM_021938	NP_068757	Q8N6W0	CELF5_HUMAN	bruno-like 5, RNA binding protein	476	RRM 3.				mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2						TCCAGCTGAAGCGGCCCAAAG	0.677													13	30	---	---	---	---	PASS
FUT5	2527	broad.mit.edu	37	19	5867442	5867442	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5867442G>C	uc002mdo.3	-	2	383	c.295C>G	c.(295-297)CCC>GCC	p.P99A	FUT5_uc010duo.2_Missense_Mutation_p.P99A	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	99	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						GCCGCGCCGGGCACCATCTCT	0.632													17	53	---	---	---	---	PASS
KHSRP	8570	broad.mit.edu	37	19	6420434	6420434	+	Silent	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6420434C>A	uc002mer.3	-	5	584	c.474G>T	c.(472-474)CTG>CTT	p.L158L		NM_003685	NP_003676	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	158	Gly-rich.|KH 1.				mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding			skin(1)	1						CACACTCACTCAGGCCCACCA	0.597													10	26	---	---	---	---	PASS
ZNF562	54811	broad.mit.edu	37	19	9764312	9764312	+	Silent	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9764312G>C	uc010xks.1	-	6	757	c.594C>G	c.(592-594)CTC>CTG	p.L198L	ZNF562_uc002mly.2_Silent_p.L198L|ZNF562_uc002mlx.2_Silent_p.L126L|ZNF562_uc010xkt.1_Silent_p.L161L|ZNF562_uc010xku.1_Silent_p.L129L|ZNF562_uc010xkv.1_Silent_p.L197L|ZNF562_uc010xkw.1_Silent_p.L82L	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a	198	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCTTCCATTGAGAATTTCAA	0.398													30	116	---	---	---	---	PASS
KCNN1	3780	broad.mit.edu	37	19	18085079	18085079	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18085079T>C	uc002nht.2	+	3	692	c.382T>C	c.(382-384)TCC>CCC	p.S128P	KCNN1_uc010xqa.1_Missense_Mutation_p.S128P	NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance	128	Helical; Name=Segment S1; (Potential).				synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0						GACCGAGCTGTCCTGGGGGGT	0.632													16	45	---	---	---	---	PASS
TM6SF2	53345	broad.mit.edu	37	19	19375667	19375667	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19375667T>C	uc002nmd.1	-	10	990	c.940A>G	c.(940-942)ATG>GTG	p.M314V	HAPLN4_uc002nmb.2_5'Flank|HAPLN4_uc002nmc.2_Intron	NM_001001524	NP_001001524	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	314						integral to membrane					0			Epithelial(12;0.0151)			GAAGCCCCCATGTGCGAGAAC	0.607													17	48	---	---	---	---	PASS
APOC2	344	broad.mit.edu	37	19	45452030	45452030	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45452030C>G	uc002pah.2	+	3	231	c.128C>G	c.(127-129)TCT>TGT	p.S43C		NM_000483	NP_000474	P02655	APOC2_HUMAN	apolipoprotein C-II precursor	43	Lipid binding.				cholesterol efflux|chylomicron remnant clearance|high-density lipoprotein particle clearance|lipid catabolic process|lipoprotein metabolic process|negative regulation of cholesterol transport|negative regulation of lipid metabolic process|negative regulation of receptor-mediated endocytosis|negative regulation of very-low-density lipoprotein particle clearance|phospholipid efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of phospholipase activity|positive regulation of phospholipid catabolic process|positive regulation of triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	chylomicron|intermediate-density lipoprotein particle|low-density lipoprotein particle|spherical high-density lipoprotein particle|very-low-density lipoprotein particle	lipase inhibitor activity|lipid binding|lipoprotein lipase activator activity|phospholipase activator activity|phospholipase binding|protein homodimerization activity			kidney(1)	1	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		GTGAAGGAATCTCTCTCCAGT	0.582													41	119	---	---	---	---	PASS
PPP1R15A	23645	broad.mit.edu	37	19	49376765	49376765	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49376765A>G	uc002pky.3	+	2	544	c.275A>G	c.(274-276)GAC>GGC	p.D92G		NM_014330	NP_055145	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	92	Required for localization in the endoplasmic reticulum.				apoptosis|cell cycle arrest|regulation of translation|response to DNA damage stimulus	endoplasmic reticulum	protein binding			lung(1)	1		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CCTGGAGAGGACAGAGAAACA	0.577													26	93	---	---	---	---	PASS
LILRA4	23547	broad.mit.edu	37	19	54844833	54844833	+	3'UTR	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54844833C>T	uc002qfj.2	-	8					LILRA4_uc002qfi.2_3'UTR	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily							integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TCCAGAACCTCCTCAGATCAT	0.547													20	81	---	---	---	---	PASS
ZNF582	147948	broad.mit.edu	37	19	56896044	56896044	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56896044C>G	uc002qmz.1	-	5	901	c.742G>C	c.(742-744)GTT>CTT	p.V248L	ZNF582_uc002qmy.2_Missense_Mutation_p.V279L	NM_144690	NP_653291	Q96NG8	ZN582_HUMAN	zinc finger protein 582	248	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|large_intestine(1)	4		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		CCAGTATGAACTCTCTGATGT	0.378													22	94	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57326518	57326518	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57326518G>T	uc002qnu.2	-	7	3643	c.3292C>A	c.(3292-3294)CAG>AAG	p.Q1098K	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.Q1069K|PEG3_uc002qnv.2_Missense_Mutation_p.Q1098K|PEG3_uc002qnw.2_Missense_Mutation_p.Q974K|PEG3_uc002qnx.2_Missense_Mutation_p.Q972K|PEG3_uc010etr.2_Missense_Mutation_p.Q1098K	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1098					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCATCCTTCTGAGGGTCTTCC	0.517													64	191	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640619	57640619	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640619C>G	uc002qny.2	+	4	932	c.576C>G	c.(574-576)AAC>AAG	p.N192K		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	192					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTGTACCAAACAAGAAATATA	0.368													57	135	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9523233	9523233	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9523233C>T	uc002wnl.2	-	10	2549	c.2004G>A	c.(2002-2004)AAG>AAA	p.K668K	PAK7_uc002wnk.2_Silent_p.K668K|PAK7_uc002wnj.2_Silent_p.K668K|PAK7_uc010gby.1_Intron	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7	668	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			TGTTTCTCACCTTGTGTAGGT	0.483													71	237	---	---	---	---	PASS
C20orf94	128710	broad.mit.edu	37	20	10603339	10603339	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10603339C>G	uc010zre.1	+	8	719	c.539C>G	c.(538-540)ACG>AGG	p.T180R		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	180							protein binding				0						AGCAGTGTCACGAGCAAATCG	0.433													20	78	---	---	---	---	PASS
C20orf186	149954	broad.mit.edu	37	20	31671218	31671218	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31671218C>T	uc010zue.1	+	3	230	c.215C>T	c.(214-216)CCC>CTC	p.P72L		NM_182519	NP_872325	P59827	LPLC4_HUMAN	antimicrobial peptide RY2G5 precursor	72						cytoplasm|extracellular region	lipid binding				0						CGAGGACCCCCCCCAGTATAT	0.488													59	120	---	---	---	---	PASS
STAU1	6780	broad.mit.edu	37	20	47770589	47770589	+	Silent	SNP	T	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47770589T>C	uc002xud.2	-	4	636	c.225A>G	c.(223-225)GTA>GTG	p.V75V	STAU1_uc002xua.2_5'UTR|STAU1_uc002xub.2_5'UTR|STAU1_uc002xuc.2_5'UTR|STAU1_uc002xue.2_5'UTR|STAU1_uc002xuf.2_5'UTR|STAU1_uc002xug.2_Silent_p.V75V	NM_017453	NP_059347	O95793	STAU1_HUMAN	staufen isoform b	75	DRBM 1.					microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			CATTTAGTTCTACAGTAGGGG	0.368													64	191	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	40250479	40250479	+	IGR	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40250479G>C								ETS2 (53603 upstream) : PSMG1 (296911 downstream)																							TGTTACCCAAGAGAGCTGTCT	0.522													21	53	---	---	---	---	PASS
NYX	60506	broad.mit.edu	37	X	41333813	41333813	+	Silent	SNP	C	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41333813C>T	uc004dfh.2	+	2	1537	c.1107C>T	c.(1105-1107)GCC>GCT	p.A369A	NYX_uc011mku.1_Silent_p.A364A	NM_022567	NP_072089	Q9GZU5	NYX_HUMAN	nyctalopin precursor	369	LRRCT.				response to stimulus|visual perception	intracellular|proteinaceous extracellular matrix				lung(2)	2						GCTCCGTGGCCGGCCTGGACC	0.706													4	2	---	---	---	---	PASS
MAGIX	79917	broad.mit.edu	37	X	49021258	49021258	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49021258A>T	uc010nin.1	+	4	384	c.337A>T	c.(337-339)AGT>TGT	p.S113C	MAGIX_uc010nio.1_Intron|MAGIX_uc004dmt.2_Intron|MAGIX_uc004dmu.2_Missense_Mutation_p.S54C|MAGIX_uc004dmw.2_Missense_Mutation_p.S46C	NM_024859	NP_079135	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked isoform a	113											0						TAAGGCACATAGTGCTCCGAA	0.557													89	70	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66931320	66931320	+	Silent	SNP	G	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66931320G>A	uc004dwu.1	+	4	3077	c.1962G>A	c.(1960-1962)GAG>GAA	p.E654E	AR_uc004dwv.1_Silent_p.E122E	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	653	Interaction with HIPK3 (By similarity).|Interaction with MYST2.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	GCCCCACTGAGGAGACAACCC	0.507									Androgen_Insensitivity_Syndrome				8	10	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90690734	90690734	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90690734C>A	uc004efg.2	+	2	598	c.158C>A	c.(157-159)CCG>CAG	p.P53Q	PABPC5_uc004eff.1_Intron	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	53	RRM 1.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						TGCCGTGATCCGGTGACCCGC	0.542													15	17	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122613996	122613996	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122613996G>C	uc004etq.3	+	15	2700	c.2407G>C	c.(2407-2409)GGG>CGG	p.G803R	GRIA3_uc004etr.3_Intron|GRIA3_uc004ets.3_RNA	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	803	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	GTACGATAAGGGGGAATGTGG	0.438													34	33	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123514551	123514551	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123514551C>A	uc004euj.2	-	31	8077	c.8013G>T	c.(8011-8013)GAG>GAT	p.E2671D	ODZ1_uc011muj.1_Missense_Mutation_p.E2677D|ODZ1_uc010nqy.2_Missense_Mutation_p.E2678D	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2671	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CCCTAATCCCCTCTTCCCCCT	0.517													129	113	---	---	---	---	PASS
ZDHHC9	51114	broad.mit.edu	37	X	128946745	128946745	+	Silent	SNP	C	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128946745C>A	uc004euv.2	-	7	1095	c.726G>T	c.(724-726)CTG>CTT	p.L242L	ZDHHC9_uc004euw.2_Silent_p.L242L	NM_001008222	NP_001008223	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC domain containing 9	242	Helical; (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1						GAAATCCAGTCAGTCCCACGA	0.453													64	62	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21139892	21139892	+	Intron	DEL	A	-	-	rs34907792		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21139892delA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		cctatctcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	106435197	106435198	+	IGR	INS	-	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106435197_106435198insA								None (None upstream) : None (None downstream)																							CTCCAAGCAGCAATATTGAAGA	0.411													49	26	---	---	---	---	
CHI3L2	1117	broad.mit.edu	37	1	111772303	111772304	+	Intron	INS	-	AAAAAAA	AAAAAAA	rs61237890		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111772303_111772304insAAAAAAA	uc001eam.2	+						CHI3L2_uc001ean.2_Intron|CHI3L2_uc001eao.2_5'Flank|CHI3L2_uc009wga.2_5'Flank	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		gactccgtctcaaaaaaaaaaa	0.193													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200653780	200653781	+	IGR	DEL	AC	-	-	rs71135380		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200653780_200653781delAC								DDX59 (14654 upstream) : CAMSAP1L1 (54905 downstream)																							gtgtgtgtgtACACACACACGT	0.149													4	2	---	---	---	---	
WDR26	80232	broad.mit.edu	37	1	224599406	224599407	+	Intron	INS	-	T	T	rs67168562		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224599406_224599407insT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc010pvh.1_5'Flank	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		ATTTGTAAATCttttttttttt	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65932197	65932198	+	Intron	DEL	AC	-	-	rs71403739		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65932197_65932198delAC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		aaaactgtatacacacacacac	0.000													3	3	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242433013	242433013	+	Intron	DEL	T	-	-	rs113589065		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242433013delT	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CAATGCtttgttttttttttt	0.239													6	3	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						CATTTCTCTTtttatttatttatttatttatt	0.151													6	7	---	---	---	---	
GBE1	2632	broad.mit.edu	37	3	81541861	81541868	+	Intron	DEL	TTCCTTCC	-	-	rs67220037		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541861_81541868delTTCCTTCC	uc003dqg.2	-							NM_000158	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		ctttcttcctttccttccttccttcctt	0.000									Glycogen_Storage_Disease_type_IV				4	2	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132438748	132438749	+	Intron	DEL	AT	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132438748_132438749delAT	uc003epe.1	-						NCRNA00119_uc003epg.1_5'Flank|NPHP3_uc003epf.1_Intron|NCRNA00119_uc010htu.1_5'Flank	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						atatatatacatatatatatat	0.248													4	3	---	---	---	---	
UBXN7	26043	broad.mit.edu	37	3	196101913	196101914	+	Intron	INS	-	GAA	GAA			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196101913_196101914insGAA	uc003fwm.3	-						UBXN7_uc003fwn.3_Intron|UBXN7_uc010iae.2_Intron	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7								protein binding			ovary(2)|pancreas(1)	3						aaggaaggaagggaaaggaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57554288	57554290	+	IGR	DEL	AGG	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57554288_57554290delAGG								HOPX (6416 upstream) : SPINK2 (121744 downstream)																							gaaggaaaaaaggagggagggag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6571881	6571884	+	IGR	DEL	GAAG	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6571881_6571884delGAAG								UBE2QL1 (79176 upstream) : LOC255167 (10403 downstream)																							agggaggagagaaggaaggaagga	0.000													4	2	---	---	---	---	
GHR	2690	broad.mit.edu	37	5	42713311	42713312	+	Intron	INS	-	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42713311_42713312insT	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TTATTTTGAAGTTTTTTTTTAA	0.302													4	2	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137289730	137289731	+	Intron	INS	-	T	T	rs147698927		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137289730_137289731insT	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						CAATCTCTCTCttttttttttt	0.262													5	3	---	---	---	---	
FABP6	2172	broad.mit.edu	37	5	159650395	159650402	+	Intron	DEL	TCCTTCCT	-	-	rs57231428		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159650395_159650402delTCCTTCCT	uc003lxx.1	+						FABP6_uc003lxz.1_Intron	NM_001130958	NP_001124430	P51161	FABP6_HUMAN	gastrotropin isoform 1						bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			cctccctctctccttccttccttccttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	3606701	3606702	+	IGR	INS	-	ACAC	ACAC	rs4959250	by1000genomes	TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3606701_3606702insACAC								SLC22A23 (149908 upstream) : C6orf145 (116134 downstream)																							ATcacacacagacacacacaca	0.450													3	3	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31237576	31237577	+	Intron	DEL	CA	-	-	rs72558156		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237576_31237577delCA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						CCTTCATTGTCACATGTGCTTC	0.520													6	3	---	---	---	---	
GLP1R	2740	broad.mit.edu	37	6	39053973	39053982	+	3'UTR	DEL	ACACACACAT	-	-	rs58609195	byFrequency	TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39053973_39053982delACACACACAT	uc003ooj.3	+	13					GLP1R_uc003ooh.2_Intron|GLP1R_uc003ooi.2_Intron	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	acacacacacacacacacatacaTCCTGCT	0.462													11	10	---	---	---	---	
TINAG	27283	broad.mit.edu	37	6	54208331	54208332	+	Intron	INS	-	T	T	rs3836940		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54208331_54208332insT	uc003pcj.2	+						TINAG_uc010jzt.2_Intron	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TAGTCTAAAAGTTTTTTTTTTT	0.228													4	2	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70609058	70609058	+	Intron	DEL	T	-	-	rs112888229		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70609058delT	uc003pfc.1	+							NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						ttctttttaattttttttttt	0.124													7	5	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90489787	90489788	+	Intron	INS	-	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90489787_90489788insA	uc003pnn.1	-						MDN1_uc003pno.1_Intron	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		gacttcgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	92356678	92356678	+	Intron	DEL	A	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92356678delA	uc003pod.2	-											Homo sapiens cDNA clone IMAGE:5284581.																		aattttagccAAAAAAAAAAA	0.045													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145011208	145011210	+	Intron	DEL	CTG	-	-	rs7768069		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145011208_145011210delCTG	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ccaaaagtttctgtttttttttt	0.000													4	2	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21924150	21924150	+	Intron	DEL	G	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21924150delG	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTGGCCTTTTGggaaatttct	0.139									Kartagener_syndrome				7	4	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66772494	66772495	+	Intron	INS	-	T	T	rs113583073		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66772494_66772495insT	uc003tvt.3	+						STAG3L4_uc010laj.2_Intron	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				TGCTTGATTCCTTTTTTTTTTT	0.272													9	4	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3224464	3224465	+	Intron	DEL	AC	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3224464_3224465delAC	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		tgcacacattacacacacacac	0.347													5	4	---	---	---	---	
WNK2	65268	broad.mit.edu	37	9	96061682	96061682	+	Intron	DEL	A	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96061682delA	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc004atk.2_Intron	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						TAAAAAGGATAAAAAAAAAAA	0.493													4	2	---	---	---	---	
C10orf119	79892	broad.mit.edu	37	10	121602280	121602280	+	Intron	DEL	T	-	-	rs71935400		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121602280delT	uc001ler.2	-						C10orf119_uc001leq.1_Intron|C10orf119_uc001les.1_Intron	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119						cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		TGCATCCTCCttttttttttt	0.199													4	2	---	---	---	---	
COPB1	1315	broad.mit.edu	37	11	14498309	14498309	+	Intron	DEL	T	-	-	rs11337817		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14498309delT	uc001mli.2	-						COPB1_uc001mlg.2_Intron|COPB1_uc001mlh.2_Intron	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1						COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						CTACTGCttcttttttttttt	0.284													4	2	---	---	---	---	
ACTN3	89	broad.mit.edu	37	11	66321927	66321928	+	Intron	INS	-	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66321927_66321928insA	uc001oio.1	+						ACTN3_uc010rpi.1_Intron	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3						focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						gaccctgtctcaaaaaaaaaaa	0.248													5	3	---	---	---	---	
JAM3	83700	broad.mit.edu	37	11	134018851	134018852	+	Intron	DEL	AC	-	-	rs111255782		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134018851_134018852delAC	uc001qhb.1	+						JAM3_uc009zcz.1_Intron	NM_032801	NP_116190	Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3 precursor						angiogenesis|blood coagulation|regulation of neutrophil chemotaxis	cell-cell contact zone|desmosome|extracellular space|integral to membrane	integrin binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		CTTCACAGTAacacacacacac	0.371													6	3	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965094	117965107	+	Intron	DEL	ACACACACACACAG	-	-	rs59836858		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965094_117965107delACACACACACACAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CGacacacacacacacacacacagacacacacac	0.234													5	3	---	---	---	---	
TMEM120B	144404	broad.mit.edu	37	12	122188508	122188513	+	Intron	DEL	ACACCA	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122188508_122188513delACACCA	uc001ubc.3	+						TMEM120B_uc009zxh.2_Intron	NM_001080825	NP_001074294	A0PK00	T120B_HUMAN	transmembrane protein 120B							integral to membrane					0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;5.75e-05)|Epithelial(86;0.000128)|BRCA - Breast invasive adenocarcinoma(302;0.238)		caccccacccacaccaacaccaacac	0.000													4	3	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124285563	124285564	+	Intron	INS	-	A	A			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124285563_124285564insA	uc001uft.3	+						DNAH10_uc010tav.1_Intron|DNAH10_uc010taw.1_Intron	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PRSS21	10942	broad.mit.edu	37	16	2867531	2867531	+	Intron	DEL	A	-	-	rs111876704		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2867531delA	uc002crt.2	+						PRSS21_uc002crs.2_Intron|PRSS21_uc002crr.2_Intron	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN	testisin isoform 1						proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity			ovary(1)|skin(1)	2						GAGGGGGTAGAGGGGGGCCTT	0.697													2	4	---	---	---	---	
C17orf48	56985	broad.mit.edu	37	17	10609586	10609587	+	Intron	DEL	AT	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10609586_10609587delAT	uc002gmt.2	+						C17orf48_uc002gmu.2_Intron|C17orf48_uc002gmv.2_Intron|C17orf48_uc010vvg.1_Intron	NM_020233	NP_064618	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol pyrophosphatase								ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0						ATGCAGTGTGATATATATATAT	0.337													3	3	---	---	---	---	
UBTF	7343	broad.mit.edu	37	17	42284469	42284469	+	3'UTR	DEL	T	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42284469delT	uc002igb.2	-	20					UBTF_uc002igc.2_3'UTR|UBTF_uc010czs.2_3'UTR|UBTF_uc002igd.2_3'UTR|UBTF_uc010czt.2_3'UTR	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCCACCGTATTTTTTTTTTT	0.562													3	3	---	---	---	---	
EVPL	2125	broad.mit.edu	37	17	74017493	74017501	+	Intron	DEL	CCGCCCCTG	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74017493_74017501delCCGCCCCTG	uc002jqi.2	-						EVPL_uc010wss.1_Intron|EVPL_uc010wst.1_Intron	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin						keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						TGCTGTGCTCccgcccctgccgcccctgc	0.383													5	4	---	---	---	---	
RIOK3	8780	broad.mit.edu	37	18	21059548	21059548	+	Intron	DEL	T	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21059548delT	uc002kui.3	+						RIOK3_uc010dls.2_Intron|RIOK3_uc010xas.1_Intron|RIOK3_uc010xat.1_Intron	NM_003831	NP_003822	O14730	RIOK3_HUMAN	sudD suppressor of bimD6 homolog						chromosome segregation		ATP binding|protein binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					tctttttttcttttttttttt	0.139													4	2	---	---	---	---	
VPS4B	9525	broad.mit.edu	37	18	61078577	61078577	+	Intron	DEL	T	-	-	rs76661872		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61078577delT	uc002lix.2	-						VPS4B_uc010dpx.2_Intron|VPS4B_uc010dpy.2_Intron|VPS4B_uc010dpz.1_Intron	NM_004869	NP_004860	O75351	VPS4B_HUMAN	vacuolar protein sorting factor 4B						cell cycle|cell division|cellular membrane organization|endosome to lysosome transport via multivesicular body sorting pathway|intracellular cholesterol transport|protein transport|response to lipid	cytosol|early endosome|late endosome membrane|lysosome|nucleus|vacuolar membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding			ovary(1)	1						AAGTGGAGTATTTTTTTTTTT	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	72057056	72057056	+	IGR	DEL	A	-	-	rs142828698		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72057056delA								CYB5A (97835 upstream) : FAM69C (45908 downstream)																							ttttattattatttttttttG	0.169													4	2	---	---	---	---	
RPL18	6141	broad.mit.edu	37	19	49120252	49120253	+	Intron	INS	-	A	A	rs11382518		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49120252_49120253insA	uc002pjq.1	-						RPL18_uc002pjp.1_Intron|RPL18_uc010xzs.1_Intron|SPHK2_uc002pjr.2_5'Flank|SPHK2_uc010xzt.1_5'Flank|SPHK2_uc002pjs.2_5'Flank	NM_000979	NP_000970	Q07020	RL18_HUMAN	ribosomal protein L18						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	RNA binding|structural constituent of ribosome				0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		AAGCTCCAGATAAAAAAAAAAA	0.540													6	3	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445891	35445891	+	Intron	DEL	A	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445891delA	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				AGatttaattaaaaaaaaaaa	0.507													4	6	---	---	---	---	
ETS2	2114	broad.mit.edu	37	21	40187100	40187113	+	Intron	DEL	GTGTGTGTGTGTGT	-	-	rs5843932		TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40187100_40187113delGTGTGTGTGTGTGT	uc002yxg.2	+						ETS2_uc002yxf.2_Intron	NM_005239	NP_005230	P15036	ETS2_HUMAN	v-ets erythroblastosis virus E26 oncogene						positive regulation of transcription, DNA-dependent|skeletal system development	nucleus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)|pancreas(1)	4		Prostate(19;6.33e-08)|all_epithelial(19;0.123)				CTTTAtgtgagtgtgtgtgtgtgtgtgtgtgtgt	0.336													4	3	---	---	---	---	
PRMT2	3275	broad.mit.edu	37	21	48073849	48073849	+	Intron	DEL	T	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48073849delT	uc002zjx.2	+						PRMT2_uc002zjw.2_Intron|PRMT2_uc002zjy.2_Intron|PRMT2_uc010gqm.2_Intron|PRMT2_uc011aga.1_Intron|PRMT2_uc011agb.1_Intron|PRMT2_uc011agc.1_Intron|PRMT2_uc002zjz.1_Intron	NM_206962	NP_996845	P55345	ANM2_HUMAN	HMT1 hnRNP methyltransferase-like 1						developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity			ovary(1)	1	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		tcttttcttgttttttttttt	0.388													4	2	---	---	---	---	
C22orf30	253143	broad.mit.edu	37	22	32084031	32084031	+	Intron	DEL	G	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32084031delG	uc003alp.3	-						C22orf30_uc003alo.1_Intron|C22orf30_uc010gwj.1_Intron	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143												0						aaaaaaaaaaGACCCAATATT	0.179													5	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1501563	1501564	+	3'UTR	INS	-	T	T			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1501563_1501564insT	uc004cps.2	+	12					IL3RA_uc011mhd.1_3'UTR	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGATAAAGTGATTTTTTTTTTT	0.426													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42384560	42384561	+	IGR	DEL	AA	-	-			TCGA-60-2721-01A-01D-1522-08	TCGA-60-2721-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42384560_42384561delAA								CASK (602273 upstream) : PPP1R2P9 (252058 downstream)																							CAGCCAAGGGAAAAAAAAAAAA	0.218													5	3	---	---	---	---	
