Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	1854086	1854086	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1854086A>G	uc001aik.2	-	10	1608	c.758T>C	c.(757-759)GTG>GCG	p.V253A	uc001ail.2_Missense_Mutation_p.V253A					RecName: Full=Uncharacterized protein C1orf222;																		GCCGCGCTCCACGGAGCCCCT	0.617													6	73	---	---	---	---	PASS
GPR153	387509	broad.mit.edu	37	1	6314831	6314831	+	Silent	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6314831C>G	uc001amp.1	-	2	395	c.135G>C	c.(133-135)CTG>CTC	p.L45L		NM_207370	NP_997253	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	45	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		GTGTACACAGCAGGAACTCCA	0.647													13	80	---	---	---	---	PASS
PHF13	148479	broad.mit.edu	37	1	6680213	6680213	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6680213C>T	uc001aob.3	+	3	863	c.492C>T	c.(490-492)CCC>CCT	p.P164P		NM_153812	NP_722519	Q86YI8	PHF13_HUMAN	PHD finger protein 13	164					cell division|chromatin modification|mitotic chromosome condensation	nucleoplasm	chromatin binding|methylated histone residue binding|zinc ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		CCCAGGCTCCCAGCGACCCCT	0.592													8	61	---	---	---	---	PASS
SLC2A7	155184	broad.mit.edu	37	1	9086385	9086385	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9086385C>T	uc009vmo.1	-	1	20	c.20G>A	c.(19-21)GGA>GAA	p.G7E		NM_207420	NP_997303	Q6PXP3	GTR7_HUMAN	intestinal facilitative glucose transporter 7	7	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity				0	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		TGGAGGGGTTCCCGCCTCTTT	0.587													7	17	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10363951	10363951	+	Intron	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10363951G>A	uc001aqx.3	+						KIF1B_uc001aqv.3_Missense_Mutation_p.R903H|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AAAGAAGAACGTGTTTCCCAG	0.473													14	90	---	---	---	---	PASS
MIIP	60672	broad.mit.edu	37	1	12082510	12082510	+	Intron	SNP	A	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12082510A>C	uc001ato.1	+							NM_021933	NP_068752	Q5JXC2	MIIP_HUMAN	invasion inhibitory protein 45											ovary(1)	1						GTAACGTGGGAGAGCGGGACA	0.597													6	13	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17397890	17397890	+	Intron	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17397890C>A	uc001baf.2	-						PADI2_uc010ocm.1_Intron	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	GCACCCCTGCCCTGCCCTCAC	0.602													11	80	---	---	---	---	PASS
ZMYM6	9204	broad.mit.edu	37	1	35484984	35484984	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35484984G>A	uc001byh.2	-	4	626	c.398C>T	c.(397-399)CCT>CTT	p.P133L	ZMYM6_uc001byf.1_Missense_Mutation_p.P133L|ZMYM6_uc010oht.1_Missense_Mutation_p.P36L|ZMYM6_uc009vup.2_Intron|ZMYM6_uc009vuq.1_Missense_Mutation_p.P133L|ZMYM6_uc009vur.1_Intron|ZMYM6_uc001byj.2_Missense_Mutation_p.P133L|ZMYM6_uc001byi.2_Missense_Mutation_p.P133L|ZMYM6_uc001byk.2_Missense_Mutation_p.P133L	NM_007167	NP_009098	O95789	ZMYM6_HUMAN	zinc finger protein 258	133	MYM-type 1.				multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTCTTGGGAGGAGGTGGCAG	0.403													42	134	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39818705	39818705	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39818705G>C	uc010oiu.1	+	8	6677	c.6546G>C	c.(6544-6546)GAG>GAC	p.E2182D	MACF1_uc010ois.1_Missense_Mutation_p.E1680D|MACF1_uc001cda.1_Missense_Mutation_p.E1588D|MACF1_uc001cdc.1_Missense_Mutation_p.E767D|MACF1_uc001cdb.1_Missense_Mutation_p.E767D	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3747					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AACTGGCAGAGAACAAGAAGA	0.483													9	74	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54610287	54610287	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54610287C>A	uc001cwv.1	-	2	1127	c.279G>T	c.(277-279)GGG>GGT	p.G93G		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	93	CUB 1.					extracellular region				ovary(1)	1						CTGGTGAGGCCCCATTGTAGA	0.597													11	38	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54610288	54610288	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54610288C>T	uc001cwv.1	-	2	1126	c.278G>A	c.(277-279)GGG>GAG	p.G93E		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	93	CUB 1.					extracellular region				ovary(1)	1						TGGTGAGGCCCCATTGTAGAT	0.597													11	39	---	---	---	---	PASS
NFIA	4774	broad.mit.edu	37	1	61553950	61553950	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61553950G>C	uc001czw.2	+	2	641	c.157G>C	c.(157-159)GAG>CAG	p.E53Q	NFIA_uc001czy.2_Missense_Mutation_p.E45Q|NFIA_uc010oos.1_Missense_Mutation_p.E98Q|NFIA_uc001czv.2_Missense_Mutation_p.E53Q	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1	53	CTF/NF-I.				DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						AAAAGAAGAAGAGAGAGCCGT	0.473													62	150	---	---	---	---	PASS
GADD45A	1647	broad.mit.edu	37	1	68152230	68152230	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68152230G>T	uc001ddz.1	+	3	639	c.344G>T	c.(343-345)GGC>GTC	p.G115V	GADD45A_uc009wbb.1_Missense_Mutation_p.G81V|GADD45A_uc009wbc.1_Intron|GADD45A_uc009wbd.1_Intron	NM_001924	NP_001915	P24522	GA45A_HUMAN	growth arrest and DNA-damage-inducible, alpha	115					apoptosis|cell cycle arrest|cellular response to ionizing radiation|cellular response to mechanical stimulus|DNA repair|positive regulation of reactive oxygen species metabolic process|regulation of cyclin-dependent protein kinase activity|signal transduction in response to DNA damage	nucleus	protein binding			ovary(1)	1						GCGAGCGAGGGCGCCGAGCAG	0.706													6	35	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038770	75038770	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038770G>T	uc001dgg.2	-	14	2843	c.2624C>A	c.(2623-2625)GCT>GAT	p.A875D		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	875	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTTTTCAGGAGCCTCATCTTT	0.522													123	312	---	---	---	---	PASS
USP33	23032	broad.mit.edu	37	1	78194184	78194184	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78194184C>G	uc001dht.2	-	11	1371	c.1024G>C	c.(1024-1026)GAT>CAT	p.D342H	USP33_uc001dhs.2_Missense_Mutation_p.D63H|USP33_uc001dhu.2_Missense_Mutation_p.D311H|USP33_uc001dhv.2_Missense_Mutation_p.D147H|USP33_uc001dhw.2_Missense_Mutation_p.D342H	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1	342					axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						TCATTATTATCTTCAGAAAAG	0.333													29	170	---	---	---	---	PASS
IFI44L	10964	broad.mit.edu	37	1	79094042	79094042	+	Missense_Mutation	SNP	C	G	G	rs273258	byFrequency	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79094042C>G	uc010oro.1	+	2	621	c.442C>G	c.(442-444)CGT>GGT	p.R148G	IFI44L_uc010orp.1_Intron|IFI44L_uc010orq.1_Intron	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	148						cytoplasm					0						TTATGGCCACCGTCAGTATTT	0.303													33	82	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79387408	79387408	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79387408T>A	uc001diq.3	-	9	1303	c.1147A>T	c.(1147-1149)AGC>TGC	p.S383C		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	383	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GAAGACCAGCTGCCATTCATG	0.418													20	104	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92713425	92713425	+	Intron	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92713425C>A	uc001dor.2	-						GLMN_uc009wdg.2_Intron|GLMN_uc001dos.2_Intron	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin						muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		CAAAATTGCACATTACCAACC	0.274									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				34	118	---	---	---	---	PASS
SARS	6301	broad.mit.edu	37	1	109779178	109779178	+	Intron	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109779178G>A	uc001dwu.1	+						SARS_uc001dwv.1_Intron|SARS_uc001dww.1_Intron|SARS_uc001dwx.1_Intron|SARS_uc009wfa.1_Intron|SARS_uc001dwy.1_Intron|SARS_uc001dwz.1_Intron	NM_006513	NP_006504	P49591	SYSC_HUMAN	seryl-tRNA synthetase						seryl-tRNA aminoacylation|tRNA processing	cytosol	ATP binding|protein binding|RNA binding|serine-tRNA ligase activity			central_nervous_system(1)	1		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	AAGGTAGATGGCCCCCAGGGA	0.537													11	75	---	---	---	---	PASS
DRAM2	128338	broad.mit.edu	37	1	111663190	111663190	+	Silent	SNP	G	C	C	rs12408306		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111663190G>C	uc001ead.3	-	6	722	c.465C>G	c.(463-465)GTC>GTG	p.V155V	DRAM2_uc001eae.3_Silent_p.V155V|DRAM2_uc009wfy.2_RNA|DRAM2_uc001eaf.3_Silent_p.V25V	NM_178454	NP_848549	Q6UX65	DRAM2_HUMAN	transmembrane protein 77	155					apoptosis|induction of apoptosis	Golgi apparatus|integral to membrane|lysosomal membrane					0						TGATCCAGAAGACTTGTTTGC	0.423													11	89	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112524810	112524810	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112524810G>A	uc001ebu.1	-	2	1019	c.539C>T	c.(538-540)ACG>ATG	p.T180M	KCND3_uc001ebv.1_Missense_Mutation_p.T180M	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	180	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		CAGGGCCAGCGTGCTGGTGTG	0.632													7	41	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144855817	144855817	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144855817C>A	uc001elw.3	-	41	7027	c.6736G>T	c.(6736-6738)GAG>TAG	p.E2246*	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Nonsense_Mutation_p.E2140*|PDE4DIP_uc001elv.3_Nonsense_Mutation_p.E1253*	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2246					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAAGCTGACTCCTCTAGGGCA	0.577			T	PDGFRB	MPD								13	142	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144886319	144886319	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144886319A>G	uc001elw.3	-	23	3206	c.2915T>C	c.(2914-2916)GTG>GCG	p.V972A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.V1038A|PDE4DIP_uc001elv.3_5'UTR	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	972					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCCAAAGCCACCTTGACAAG	0.443			T	PDGFRB	MPD								44	447	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145273436	145273436	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145273436G>A	uc001emn.3	+	3	660	c.290G>A	c.(289-291)GGG>GAG	p.G97E	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Missense_Mutation_p.G97E|NOTCH2NL_uc001emo.2_Missense_Mutation_p.G97E|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	97	EGF-like 3.				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						TGTCAAGTCGGGTTTACAGGT	0.463													32	573	---	---	---	---	PASS
SF3B4	10262	broad.mit.edu	37	1	149898740	149898740	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149898740T>C	uc001etj.1	-	3	285	c.234A>G	c.(232-234)AAA>AAG	p.K78K	SF3B4_uc001eti.1_5'Flank|SF3B4_uc001etk.1_Silent_p.K78K|SF3B4_uc009wll.1_Silent_p.K78K	NM_005850	NP_005841	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4	78	RRM 1.					nucleoplasm|U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TCCCATAGAGTTTGATCATGT	0.443													34	111	---	---	---	---	PASS
TARS2	80222	broad.mit.edu	37	1	150478140	150478140	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150478140G>C	uc001euq.2	+	17	1974	c.1967G>C	c.(1966-1968)AGA>ACA	p.R656T	TARS2_uc001eur.2_Missense_Mutation_p.R574T|TARS2_uc009wlt.2_Missense_Mutation_p.R282T|TARS2_uc009wls.2_Missense_Mutation_p.R526T|ECM1_uc010pce.1_5'Flank|ECM1_uc010pcf.1_5'Flank|ECM1_uc001eus.2_5'Flank|ECM1_uc001eut.2_5'Flank|ECM1_uc001euu.2_5'Flank|ECM1_uc001euv.2_5'Flank|ECM1_uc009wlu.2_5'Flank	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial	656					threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	CTCAGCCGGAGAATCCGCCGG	0.567													33	164	---	---	---	---	PASS
PI4KB	5298	broad.mit.edu	37	1	151288358	151288358	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151288358G>T	uc001ext.2	-	2	1015	c.600C>A	c.(598-600)CAC>CAA	p.H200Q	PI4KB_uc001exr.2_Missense_Mutation_p.H212Q|PI4KB_uc001exs.2_Missense_Mutation_p.H200Q|PI4KB_uc001exu.2_Missense_Mutation_p.H200Q|PI4KB_uc010pcw.1_Intron|PI4KB_uc009wmq.1_Missense_Mutation_p.H212Q	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	200					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGCGGCAACGGTGGACTATGT	0.517													32	103	---	---	---	---	PASS
ZBTB7B	51043	broad.mit.edu	37	1	154987962	154987962	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154987962G>C	uc001fgk.3	+	3	984	c.826G>C	c.(826-828)GAG>CAG	p.E276Q	ZBTB7B_uc009wpa.2_Missense_Mutation_p.E276Q|ZBTB7B_uc001fgj.3_Missense_Mutation_p.E310Q|ZBTB7B_uc010peq.1_Missense_Mutation_p.E310Q|ZBTB7B_uc001fgl.3_Missense_Mutation_p.E276Q	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	276					cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTATGAGGGTGAGGAAGAAGA	0.667													6	90	---	---	---	---	PASS
DAP3	7818	broad.mit.edu	37	1	155701182	155701182	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155701182G>A	uc001flq.2	+	10	1048	c.879G>A	c.(877-879)TTG>TTA	p.L293L	DAP3_uc001flr.2_Silent_p.L293L|DAP3_uc001fls.2_Silent_p.L293L|DAP3_uc010pgl.1_Silent_p.L252L|DAP3_uc001flt.2_Silent_p.L259L|DAP3_uc001flu.2_Silent_p.L266L|DAP3_uc010pgm.1_Silent_p.L259L	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3	293					induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TTCACAACTTGAGGAAAATGA	0.378													19	225	---	---	---	---	PASS
DAP3	7818	broad.mit.edu	37	1	155701194	155701194	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155701194G>C	uc001flq.2	+	10	1060	c.891G>C	c.(889-891)ATG>ATC	p.M297I	DAP3_uc001flr.2_Missense_Mutation_p.M297I|DAP3_uc001fls.2_Missense_Mutation_p.M297I|DAP3_uc010pgl.1_Missense_Mutation_p.M256I|DAP3_uc001flt.2_Missense_Mutation_p.M263I|DAP3_uc001flu.2_Missense_Mutation_p.M270I|DAP3_uc010pgm.1_Missense_Mutation_p.M263I	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3	297					induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					GGAAAATGATGAAAAATGATT	0.358													12	200	---	---	---	---	PASS
DAP3	7818	broad.mit.edu	37	1	155701791	155701791	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155701791G>A	uc001flq.2	+	11	1129	c.960G>A	c.(958-960)CGG>CGA	p.R320R	DAP3_uc001flr.2_Silent_p.R320R|DAP3_uc001fls.2_Silent_p.R320R|DAP3_uc010pgl.1_Silent_p.R279R|DAP3_uc001flt.2_Silent_p.R286R|DAP3_uc001flu.2_Silent_p.R293R|DAP3_uc010pgm.1_Silent_p.R286R	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3	320					induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TTAAGCCCCGGAAAGCCTATC	0.408													5	38	---	---	---	---	PASS
APOA1BP	128240	broad.mit.edu	37	1	156563782	156563782	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156563782T>C	uc001fph.2	+	6	812	c.773T>C	c.(772-774)CTG>CCG	p.L258P	APOA1BP_uc001fpg.2_3'UTR|APOA1BP_uc001fpi.2_Silent_p.P239P|APOA1BP_uc001fpj.2_Missense_Mutation_p.L175P|APOA1BP_uc001fpk.2_Missense_Mutation_p.L155P|APOA1BP_uc010php.1_Missense_Mutation_p.L155P	NM_144772	NP_658985	Q8NCW5	AIBP_HUMAN	apolipoprotein A-I binding protein precursor	258	YjeF N-terminal.					extracellular region	protein binding			central_nervous_system(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TACCATTACCTGGGGGGTCGT	0.552													66	236	---	---	---	---	PASS
OR6N1	128372	broad.mit.edu	37	1	158736259	158736259	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158736259C>T	uc010piq.1	-	1	214	c.214G>A	c.(214-216)GGC>AGC	p.G72S		NM_001005185	NP_001005185	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N,	72	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					GCTGTATAGCCAAGCTCTGAG	0.488													36	83	---	---	---	---	PASS
FMO1	2326	broad.mit.edu	37	1	171251429	171251429	+	Silent	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171251429T>A	uc009wvz.2	+	7	1276	c.1140T>A	c.(1138-1140)CCT>CCA	p.P380P	FMO1_uc010pme.1_Silent_p.P317P|FMO1_uc001ghl.2_Silent_p.P380P|FMO1_uc001ghm.2_Silent_p.P380P|FMO1_uc001ghn.2_Silent_p.P380P	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	380					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCATGATACCTACAGGAGAAA	0.483													41	116	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180003168	180003168	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180003168G>A	uc001gnt.2	+	16	4280	c.3897G>A	c.(3895-3897)CTG>CTA	p.L1299L	CEP350_uc009wxl.2_Silent_p.L1298L|CEP350_uc001gnu.2_Silent_p.L1132L	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1299						centrosome|nucleus|spindle				ovary(4)	4						TCACTGATCTGAACCCGGCAG	0.403													18	62	---	---	---	---	PASS
GLUL	2752	broad.mit.edu	37	1	182356423	182356423	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182356423C>A	uc001gpa.1	-	3	383	c.171G>T	c.(169-171)TTG>TTT	p.L57F	GLUL_uc010pnt.1_5'Flank|GLUL_uc001gpb.1_Missense_Mutation_p.L57F|GLUL_uc001gpc.1_Missense_Mutation_p.L57F|GLUL_uc001gpd.1_Missense_Mutation_p.L57F	NM_001033056	NP_001028228	P15104	GLNA_HUMAN	glutamine synthetase	57					cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding				0					Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)	TCCACTCAGGCAACTCTGGGG	0.468													32	103	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196646728	196646728	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196646728A>G	uc001gtj.3	+	5	790	c.550A>G	c.(550-552)ATT>GTT	p.I184V	CFH_uc001gti.3_Missense_Mutation_p.I184V|CFH_uc009wyw.2_Missense_Mutation_p.I184V|CFH_uc009wyx.2_Intron	NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	184	Sushi 3.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						AGGCTACAAGATTGAAGGAGA	0.383													68	218	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196883661	196883661	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196883661C>A	uc001gto.2	+	4	545	c.476C>A	c.(475-477)GCC>GAC	p.A159D	CFHR4_uc009wyy.2_Missense_Mutation_p.A405D|CFHR4_uc001gtp.2_Missense_Mutation_p.A406D	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	159	Sushi 3.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						AATTCCAGAGCCAAGAGTAAT	0.383													33	129	---	---	---	---	PASS
CSRP1	1465	broad.mit.edu	37	1	201457979	201457979	+	Intron	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201457979T>C	uc001gws.2	-						CSRP1_uc001gwr.1_Intron|CSRP1_uc010ppr.1_Intron|CSRP1_uc010pps.1_Intron	NM_004078	NP_004069	P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1 isoform 1							nucleus	zinc ion binding			ovary(1)	1						AGCAGCCACCTTACCTTCCCA	0.552													19	56	---	---	---	---	PASS
NAV1	89796	broad.mit.edu	37	1	201682034	201682034	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201682034C>A	uc001gwu.2	+	2	1194	c.847C>A	c.(847-849)CAG>AAG	p.Q283K		NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	283					cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						GCGAGGGTCCCAGGTGACTCA	0.622													41	151	---	---	---	---	PASS
TIMM17A	10440	broad.mit.edu	37	1	201924671	201924671	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201924671G>C	uc001gxc.2	+	1	53	c.17G>C	c.(16-18)CGA>CCA	p.R6P		NM_006335	NP_006326	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17	6					protein targeting to mitochondrion	integral to membrane|mitochondrial inner membrane presequence translocase complex	P-P-bond-hydrolysis-driven protein transmembrane transporter activity				0						GAGTACGCGCGAGAGCCTTGG	0.632													13	101	---	---	---	---	PASS
DSTYK	25778	broad.mit.edu	37	1	205117450	205117450	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205117450C>G	uc001hbw.2	-	12	2549	c.2485G>C	c.(2485-2487)GTG>CTG	p.V829L	DSTYK_uc001hbx.2_Intron	NM_015375	NP_056190	Q6XUX3	DUSTY_HUMAN	receptor interacting protein kinase 5 isoform 1	829	Protein kinase.					cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(1)	1						TAGACATCCACGGAATTATCG	0.483													21	70	---	---	---	---	PASS
PM20D1	148811	broad.mit.edu	37	1	205817012	205817012	+	Splice_Site	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205817012C>T	uc001hdj.2	-	2	301	c.256_splice	c.e2+1	p.V86_splice	PM20D1_uc009xbr.2_Splice_Site	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1 precursor							extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			TTGCAGCTGACCTTTATGAAT	0.433													29	119	---	---	---	---	PASS
PM20D1	148811	broad.mit.edu	37	1	205819137	205819137	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205819137C>T	uc001hdj.2	-	1	109	c.64G>A	c.(64-66)GTC>ATC	p.V22I	PM20D1_uc009xbr.2_RNA	NM_152491	NP_689704	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1 precursor	22						extracellular region	metal ion binding|peptidase activity			skin(1)	1	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GATCTGGAGACGGTAGGGAAA	0.607													14	65	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848158	215848158	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848158C>A	uc001hku.1	-	63	13482	c.13095G>T	c.(13093-13095)TGG>TGT	p.W4365C		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4365	Extracellular (Potential).|Fibronectin type-III 29.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CACTGACGGCCCAAAGATCTG	0.483										HNSCC(13;0.011)			26	109	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215848159	215848159	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215848159C>A	uc001hku.1	-	63	13481	c.13094G>T	c.(13093-13095)TGG>TTG	p.W4365L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4365	Extracellular (Potential).|Fibronectin type-III 29.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACTGACGGCCCAAAGATCTGG	0.483										HNSCC(13;0.011)			26	110	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216850834	216850834	+	Splice_Site	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850834C>T	uc001hkw.1	-	2	223	c.57_splice	c.e2-1	p.E19_splice	ESRRG_uc001hky.1_Splice_Site|ESRRG_uc009xdp.1_Splice_Site|ESRRG_uc001hkz.1_Splice_Site|ESRRG_uc010puc.1_Splice_Site|ESRRG_uc001hla.1_Splice_Site|ESRRG_uc001hlb.1_Splice_Site|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Splice_Site|ESRRG_uc001hld.1_Splice_Site|ESRRG_uc001hkx.1_Splice_Site_p.R24_splice|ESRRG_uc009xdo.1_Splice_Site|ESRRG_uc001hle.1_Splice_Site	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	GCAGAGAAGCCTGAGATTGAG	0.284													19	50	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220178660	220178660	+	Nonsense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220178660T>A	uc001hly.1	-	16	2263	c.1993A>T	c.(1993-1995)AAA>TAA	p.K665*	EPRS_uc010puf.1_Nonsense_Mutation_p.K416*|EPRS_uc001hlz.1_Nonsense_Mutation_p.K672*|EPRS_uc009xdt.1_Nonsense_Mutation_p.K253*	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	665	Glutamyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	TCTCCTTTTTTCAAATCCTTA	0.338													48	163	---	---	---	---	PASS
LEFTY2	7044	broad.mit.edu	37	1	226125443	226125443	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226125443C>A	uc001hpt.1	-	4	879	c.799G>T	c.(799-801)GAG>TAG	p.E267*	LEFTY2_uc010pvk.1_Nonsense_Mutation_p.E233*|LEFTY2_uc009xek.1_3'UTR	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	267					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					ATGTACATCTCCTGGCGGCAG	0.637													13	22	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227327318	227327318	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227327318C>A	uc001hqr.2	-	10	2292	c.1349G>T	c.(1348-1350)CGC>CTC	p.R450L	CDC42BPA_uc001hqs.2_Missense_Mutation_p.R450L|CDC42BPA_uc009xes.2_Missense_Mutation_p.R450L|CDC42BPA_uc010pvs.1_Missense_Mutation_p.R450L	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	450	Potential.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TTGCTCAAGGCGCTTAATTCT	0.358													16	49	---	---	---	---	PASS
URB2	9816	broad.mit.edu	37	1	229773946	229773946	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229773946G>C	uc001hts.1	+	4	3722	c.3586G>C	c.(3586-3588)GAC>CAC	p.D1196H	URB2_uc009xfd.1_Missense_Mutation_p.D1196H	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	1196						nucleolus				central_nervous_system(2)|ovary(1)	3						TCCCAAAAAGGACTCCGTGTT	0.453													54	216	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235386562	235386562	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235386562G>T	uc001hwq.2	-	13	1482	c.984C>A	c.(982-984)AAC>AAA	p.N328K	ARID4B_uc001hwr.2_Missense_Mutation_p.N328K|ARID4B_uc001hws.3_Missense_Mutation_p.N328K|ARID4B_uc001hwt.3_Missense_Mutation_p.N9K	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	328	ARID.|Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CAGGTCGTTTGTTAATAGGTG	0.284													17	49	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236717960	236717960	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236717960C>G	uc001hyd.1	-	42	6141	c.6016G>C	c.(6016-6018)GAT>CAT	p.D2006H	HEATR1_uc009xgh.1_Missense_Mutation_p.D1168H	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	2006					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGCTGGGTATCAAAAAGGAAG	0.393													4	261	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237789106	237789106	+	Splice_Site	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237789106T>A	uc001hyl.1	+	40	6286	c.6166_splice	c.e40+2	p.S2056_splice		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAAGTCCTGTAAGCAGTATG	0.428													15	45	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238053355	238053355	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238053355C>G	uc001hym.2	-	2	297	c.297G>C	c.(295-297)TGG>TGC	p.W99C	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	99	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCATACTCACCCACTCAGTGA	0.567													61	215	---	---	---	---	PASS
C1orf101	257044	broad.mit.edu	37	1	244735962	244735962	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244735962A>G	uc001iam.2	+	11	1897	c.1838A>G	c.(1837-1839)TAT>TGT	p.Y613C	C1orf101_uc001iak.1_Missense_Mutation_p.Y167C|C1orf101_uc001ial.2_Missense_Mutation_p.Y613C|C1orf101_uc010pym.1_Missense_Mutation_p.Y462C|C1orf101_uc010pyn.1_Missense_Mutation_p.Y546C	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1	613	Extracellular (Potential).					integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			CAGATCGTCTATCCAGAAAAC	0.393													38	123	---	---	---	---	PASS
OR2M2	391194	broad.mit.edu	37	1	248343775	248343775	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248343775C>T	uc010pzf.1	+	1	488	c.488C>T	c.(487-489)ACA>ATA	p.T163I		NM_001004688	NP_001004688	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M,	163	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCTGTAGCCACATTTTCCTTC	0.418													109	436	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685164	248685164	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685164T>C	uc001ien.1	+	1	217	c.217T>C	c.(217-219)TTT>CTT	p.F73L		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGACATCTGCTTTACCACCAG	0.512													45	143	---	---	---	---	PASS
OR2T11	127077	broad.mit.edu	37	1	248789685	248789685	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248789685A>T	uc001ier.1	-	1	745	c.745T>A	c.(745-747)TAT>AAT	p.Y249N		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCAGCCCCATAGAAGATGCTA	0.532													24	60	---	---	---	---	PASS
OR2T11	127077	broad.mit.edu	37	1	248789955	248789955	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248789955T>C	uc001ier.1	-	1	475	c.475A>G	c.(475-477)ATC>GTC	p.I159V		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	159	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCATGGTGATGGGAGTGAGC	0.527													33	111	---	---	---	---	PASS
OR14I1	401994	broad.mit.edu	37	1	248845000	248845000	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248845000T>C	uc001ieu.1	-	1	606	c.606A>G	c.(604-606)TCA>TCG	p.S202S		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	202	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAACCAAGCATGAGCTCAGGG	0.483													28	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	905315	905315	+	Intron	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:905315G>T	uc010ewg.2	-						uc010ewh.1_Missense_Mutation_p.P211T					Homo sapiens cDNA FLJ46162 fis, clone TESTI4002520.																		GACACCAGAGGCTTCTCACCA	0.502													20	81	---	---	---	---	PASS
ALLC	55821	broad.mit.edu	37	2	3727499	3727499	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3727499C>A	uc010ewt.2	+	5	374	c.213C>A	c.(211-213)GTC>GTA	p.V71V		NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	90							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCCAAGGAGTCATCCGGGGCT	0.552										HNSCC(21;0.051)			42	159	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11772040	11772040	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11772040T>A	uc002rbk.1	+	27	4917	c.4617T>A	c.(4615-4617)CAT>CAA	p.H1539Q	GREB1_uc002rbp.1_Missense_Mutation_p.H537Q	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1539						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGCAGAGCCATGAATATATAA	0.303													22	62	---	---	---	---	PASS
EPT1	85465	broad.mit.edu	37	2	26597907	26597907	+	Splice_Site	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26597907G>T	uc010ykz.1	+	6	721	c.574_splice	c.e6-1	p.T192_splice	EPT1_uc010eyl.1_Splice_Site	NM_033505	NP_277040	Q9C0D9	EPT1_HUMAN	selenoprotein I						phospholipid biosynthetic process	integral to membrane	ethanolaminephosphotransferase activity|metal ion binding				0						TTTCCTTCCAGACTATTTCTT	0.383													79	256	---	---	---	---	PASS
EMILIN1	11117	broad.mit.edu	37	2	27306531	27306531	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27306531G>C	uc002rii.3	+	4	2520	c.2092G>C	c.(2092-2094)GAG>CAG	p.E698Q	EMILIN1_uc002rik.3_5'UTR	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	698	Potential.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGGCCACAGAGCATGCTAC	0.612													31	153	---	---	---	---	PASS
SLC5A6	8884	broad.mit.edu	37	2	27426157	27426157	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27426157C>A	uc002rjd.2	-	11	1542	c.1151G>T	c.(1150-1152)CGA>CTA	p.R384L	SLC5A6_uc010eyv.1_Missense_Mutation_p.R384L	NM_021095	NP_066918	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium-dependent	384					biotin metabolic process|pantothenate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|Lipoic Acid(DB00166)	GAACCAAGGTCGAATCAGGTC	0.478													19	83	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31589728	31589728	+	Intron	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31589728G>C	uc002rnv.1	-							NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GACCCAAAAGGCATCTACCTG	0.562													47	320	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656907	40656907	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656907C>G	uc002rrx.2	-	1	538	c.514G>C	c.(514-516)GTG>CTG	p.V172L	SLC8A1_uc002rry.2_Missense_Mutation_p.V172L|SLC8A1_uc002rrz.2_Missense_Mutation_p.V172L|SLC8A1_uc002rsa.2_Missense_Mutation_p.V172L|SLC8A1_uc002rsd.3_Missense_Mutation_p.V172L|SLC8A1_uc002rsb.1_Missense_Mutation_p.V172L|SLC8A1_uc010fan.1_Missense_Mutation_p.V172L|SLC8A1_uc002rsc.1_Missense_Mutation_p.V172L	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	172	Alpha-1.|Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCACTTCCCACGATGGTGCTA	0.468													13	133	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60773218	60773218	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60773218C>T	uc002sae.1	-	2	501	c.273G>A	c.(271-273)GAG>GAA	p.E91E	BCL11A_uc002sab.2_Silent_p.E91E|BCL11A_uc002sac.2_Silent_p.E91E|BCL11A_uc010ypi.1_5'UTR|BCL11A_uc010ypj.1_Silent_p.E91E|BCL11A_uc002saf.1_Silent_p.E91E|BCL11A_uc010fcg.2_Silent_p.E91E	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	91	Required for nuclear body formation and for SUMO1 recruitment (By similarity).				negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CTTTTTTCATCTCGATTGGTG	0.468			T	IGH@	B-CLL								18	183	---	---	---	---	PASS
PROKR1	10887	broad.mit.edu	37	2	68873182	68873182	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68873182G>A	uc010yqj.1	+	1	229	c.229G>A	c.(229-231)GGC>AGC	p.G77S	PROKR1_uc002ses.2_RNA	NM_138964	NP_620414	Q8TCW9	PKR1_HUMAN	G protein-coupled receptor 73	77	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(1)	1						GCTGGTCTGCGGCATTGGAAA	0.522													81	238	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73678659	73678659	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73678659G>T	uc002sje.1	+	10	5119	c.5008G>T	c.(5008-5010)GGG>TGG	p.G1670W	ALMS1_uc002sjf.1_Missense_Mutation_p.G1626W|ALMS1_uc002sjg.2_Missense_Mutation_p.G1056W|ALMS1_uc002sjh.1_Missense_Mutation_p.G1056W	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1668	24.|34 X 47 AA approximate tandem repeat.				G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CTCAAATAGGGGGAAGCCTGT	0.463													51	180	---	---	---	---	PASS
SEMA4F	10505	broad.mit.edu	37	2	74907075	74907075	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74907075G>T	uc002sna.1	+	14	2163	c.2052G>T	c.(2050-2052)CAG>CAT	p.Q684H	SEMA4F_uc010ffr.1_Missense_Mutation_p.Q296H|SEMA4F_uc002snb.1_Missense_Mutation_p.Q296H|SEMA4F_uc002snc.1_Missense_Mutation_p.Q529H	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	684	Cytoplasmic (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						GTCGGCGTCAGCAGCGACGGC	0.627													30	92	---	---	---	---	PASS
SEMA4F	10505	broad.mit.edu	37	2	74907083	74907083	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74907083G>C	uc002sna.1	+	14	2171	c.2060G>C	c.(2059-2061)CGG>CCG	p.R687P	SEMA4F_uc010ffr.1_Missense_Mutation_p.R299P|SEMA4F_uc002snb.1_Missense_Mutation_p.R299P|SEMA4F_uc002snc.1_Missense_Mutation_p.R532P	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	687	Cytoplasmic (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CAGCAGCGACGGCGACAGAGG	0.632													34	100	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79349975	79349975	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79349975C>A	uc002snz.2	+	5	433	c.330C>A	c.(328-330)CGC>CGA	p.R110R	REG1A_uc010ysd.1_Silent_p.R110R	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	110	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						AGAACCGCCGCTGGCACTGGA	0.552													54	185	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136755	80136755	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136755G>T	uc010ysh.1	+	6	893	c.888G>T	c.(886-888)GAG>GAT	p.E296D	CTNNA2_uc010yse.1_Missense_Mutation_p.E296D|CTNNA2_uc010ysf.1_Missense_Mutation_p.E296D|CTNNA2_uc010ysg.1_Missense_Mutation_p.E296D	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	296					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CGTTCAGCGAGGCCAGGTTCC	0.587													26	132	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88874543	88874543	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88874543C>T	uc002stc.3	-	13	2660	c.2458G>A	c.(2458-2460)GAA>AAA	p.E820K		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	820	Cytoplasmic (Potential).|Protein kinase.				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						TTCGGCTCTTCTTTACTGGAA	0.398													36	317	---	---	---	---	PASS
PROM2	150696	broad.mit.edu	37	2	95947943	95947943	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95947943A>G	uc002suh.1	+	14	1830	c.1697A>G	c.(1696-1698)TAC>TGC	p.Y566C	PROM2_uc002sui.2_Missense_Mutation_p.Y566C|PROM2_uc002suj.2_Missense_Mutation_p.Y220C|PROM2_uc002suk.2_Missense_Mutation_p.Y566C|PROM2_uc002sul.2_Missense_Mutation_p.Y92C|PROM2_uc002sum.2_RNA	NM_144707	NP_653308	Q8N271	PROM2_HUMAN	prominin 2 precursor	566	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|cilium membrane|integral to membrane|microvillus membrane				ovary(1)	1						AACGACTCCTACGACCTGGAG	0.597													8	34	---	---	---	---	PASS
SLC9A4	389015	broad.mit.edu	37	2	103125362	103125362	+	Silent	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103125362A>G	uc002tbz.3	+	6	1915	c.1458A>G	c.(1456-1458)AAA>AAG	p.K486K		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	486	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						CCAATAAAAAAGAATCCATCA	0.353													3	181	---	---	---	---	PASS
CCDC138	165055	broad.mit.edu	37	2	109429163	109429163	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109429163A>T	uc002ten.1	+	8	992	c.932A>T	c.(931-933)CAG>CTG	p.Q311L	CCDC138_uc002teo.1_Missense_Mutation_p.Q311L|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	311	Potential.										0						GATAATTTACAGGTAAGTTGC	0.318													57	198	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112621316	112621316	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112621316G>A	uc002thi.2	-	9	1235	c.988C>T	c.(988-990)CGC>TGC	p.R330C		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	330					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						GAGGTTGAGCGACTCTGGCTG	0.478													16	136	---	---	---	---	PASS
EPB41L5	57669	broad.mit.edu	37	2	120776748	120776748	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120776748G>A	uc002tmg.2	+	2	214	c.88G>A	c.(88-90)GCC>ACC	p.A30T	EPB41L5_uc010flk.2_Missense_Mutation_p.A30T|EPB41L5_uc010fll.2_Missense_Mutation_p.A30T|EPB41L5_uc002tmh.3_Missense_Mutation_p.A30T	NM_020909	NP_065960	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	30						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1						ACAACGCGCCGCCACACATAT	0.493													74	426	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121747649	121747649	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121747649C>G	uc010flp.2	+	13	4189	c.4159C>G	c.(4159-4161)CGT>GGT	p.R1387G	GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Missense_Mutation_p.R1059G|GLI2_uc002tmu.3_Missense_Mutation_p.R1042G	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	1387					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				CCGTGGGGTACGTGCTGTGCA	0.692													5	26	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141110527	141110527	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141110527G>T	uc002tvj.1	-	76	12617	c.11645C>A	c.(11644-11646)GCA>GAA	p.A3882E		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3882	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTACCTTCTGCTATGCAGGT	0.323										TSP Lung(27;0.18)			27	207	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141460034	141460034	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141460034C>T	uc002tvj.1	-	38	7084	c.6112G>A	c.(6112-6114)GGA>AGA	p.G2038R		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2038	Extracellular (Potential).|LDL-receptor class B 21.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATGCTATTCCCATGCTTACA	0.423										TSP Lung(27;0.18)			20	139	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141773277	141773277	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141773277C>T	uc002tvj.1	-	13	3150	c.2178G>A	c.(2176-2178)GGG>GGA	p.G726G	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	726	Extracellular (Potential).|LDL-receptor class B 8.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCTGTGAGTCCCATTCAAAA	0.373										TSP Lung(27;0.18)			7	62	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163133387	163133387	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163133387C>A	uc002uce.2	-	11	2336	c.2114G>T	c.(2113-2115)AGA>ATA	p.R705I		NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	705	Helicase C-terminal.				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						TATGGTATTTCTTAATTTGGT	0.328													112	272	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168100713	168100713	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168100713T>C	uc002udx.2	+	8	2829	c.2811T>C	c.(2809-2811)CTT>CTC	p.L937L	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.L762L|XIRP2_uc010fpq.2_Silent_p.L715L|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	762					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CAGTGAAACTTGAAGAAGTTG	0.338													13	89	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170042302	170042302	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170042302G>T	uc002ues.2	-	50	9769	c.9556C>A	c.(9556-9558)CCA>ACA	p.P3186T		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3186	EGF-like 12; calcium-binding (Potential).|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTTCCATCTGGTTCTCGGAGG	0.413													53	268	---	---	---	---	PASS
HAT1	8520	broad.mit.edu	37	2	172822353	172822353	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172822353C>T	uc002uhi.2	+	6	611	c.535C>T	c.(535-537)CAG>TAG	p.Q179*	HAT1_uc010fqi.2_Nonsense_Mutation_p.Q14*|HAT1_uc002uhj.2_Nonsense_Mutation_p.Q94*	NM_003642	NP_003633	O14929	HAT1_HUMAN	histone acetyltransferase 1	179					chromatin silencing at telomere|DNA packaging	cytoplasm|nuclear matrix|nucleoplasm	histone acetyltransferase activity|protein binding			large_intestine(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TGAAAGGCTTCAGACCTTTTT	0.398													126	318	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179516051	179516051	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179516051C>T	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_Intron|TTN_uc002umx.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAGGCACTTCAAATATATTA	0.393													15	117	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186672112	186672112	+	Intron	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186672112A>G	uc002upm.2	+						uc010zfu.1_Missense_Mutation_p.T525A					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		AATTTTCTCAACAATATCCAG	0.343													67	200	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191905825	191905825	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191905825T>G	uc002usm.1	-	15	1555	c.1301A>C	c.(1300-1302)CAG>CCG	p.Q434P	STAT4_uc002usn.1_Missense_Mutation_p.Q434P|STAT4_uc010zgk.1_Missense_Mutation_p.Q279P|STAT4_uc002uso.2_Missense_Mutation_p.Q434P	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription	434					JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			GAGGCAGATCTGTGTTTCAAA	0.383													29	163	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196681578	196681578	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196681578C>A	uc002utj.3	-	51	9636	c.9535G>T	c.(9535-9537)GCT>TCT	p.A3179S		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3179	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATCTCATTAGCCAAGGCCTTG	0.398													22	125	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197184089	197184089	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197184089C>T	uc002utm.1	-	9	1708	c.1525G>A	c.(1525-1527)GAG>AAG	p.E509K	HECW2_uc002utl.1_Missense_Mutation_p.E153K	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	509					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						GGGTTGTCCTCCAGCTTTGTC	0.522													11	69	---	---	---	---	PASS
KCTD18	130535	broad.mit.edu	37	2	201371747	201371747	+	5'UTR	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201371747C>A	uc002uvs.2	-	2					KCTD18_uc002uvt.2_5'UTR|KCTD18_uc002uvu.1_5'UTR	NM_152387	NP_689600	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1						CATTTCTCCCCCAGGCACCTG	0.507													9	64	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	206165365	206165365	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206165365G>A	uc002var.1	+	17	2504	c.2297G>A	c.(2296-2298)AGG>AAG	p.R766K	PARD3B_uc010fub.1_Missense_Mutation_p.R766K|PARD3B_uc002vao.1_Missense_Mutation_p.R766K|PARD3B_uc002vap.1_Missense_Mutation_p.R704K|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	766					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CCCTTTCACAGGCCCCGGCCG	0.522													61	115	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207436469	207436469	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207436469T>C	uc002vbq.2	+	17	1808	c.1585T>C	c.(1585-1587)TGT>CGT	p.C529R	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	529	Disintegrin.|Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TGGATTATGCTGTAAGAAATG	0.458													28	96	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212568930	212568930	+	Intron	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212568930A>G	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CTACAAGTGAAGAGTAGAAAA	0.363										TSP Lung(8;0.080)			31	122	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217285226	217285226	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217285226T>C	uc002vgc.3	+	5	1397	c.1067T>C	c.(1066-1068)CTT>CCT	p.L356P	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.L356P|SMARCAL1_uc010fvg.2_Missense_Mutation_p.L356P	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	356	HARP 2.				chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CTTATTGCGCTTTTTAAACAG	0.443									Schimke_Immuno-Osseous_Dysplasia				3	134	---	---	---	---	PASS
WNT10A	80326	broad.mit.edu	37	2	219754802	219754802	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219754802G>T	uc002vjd.1	+	3	936	c.473G>T	c.(472-474)GGC>GTC	p.G158V		NM_025216	NP_079492	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family,	158					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			lung(1)|skin(1)	2		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGGCCTGTGGCTGTGATGCG	0.632													12	83	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220355204	220355204	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220355204T>C	uc010fwg.2	+	37	8995	c.8995T>C	c.(8995-8997)TAT>CAT	p.Y2999H		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	2999	Protein kinase 2.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GATCGTGCCCTATGCTGCCGA	0.672													17	45	---	---	---	---	PASS
NEU2	4759	broad.mit.edu	37	2	233899526	233899526	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233899526C>G	uc010zmn.1	+	2	902	c.902C>G	c.(901-903)TCC>TGC	p.S301C		NM_005383	NP_005374	Q9Y3R4	NEUR2_HUMAN	neuraminidase 2	301							exo-alpha-sialidase activity				0		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)		CCCACACACTCCTGGCAGAGG	0.706													20	50	---	---	---	---	PASS
USP40	55230	broad.mit.edu	37	2	234449396	234449396	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234449396G>C	uc010zmr.1	-	9	1115	c.1115C>G	c.(1114-1116)CCT>CGT	p.P372R	USP40_uc010zmt.1_Missense_Mutation_p.P16R	NM_018218	NP_060688	Q9NVE5	UBP40_HUMAN	ubiquitin thioesterase 40	360					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		CTGATCAACAGGAATTAGATT	0.378													23	213	---	---	---	---	PASS
UGT1A8	54576	broad.mit.edu	37	2	234526712	234526712	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234526712T>G	uc002vup.2	+	1	422	c.359T>G	c.(358-360)TTT>TGT	p.F120C	UGT1A8_uc010zmv.1_Missense_Mutation_p.F120C	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8	120					drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		TTTAACTTATTTTTTTCGCAT	0.368													5	334	---	---	---	---	PASS
CNTN4	152330	broad.mit.edu	37	3	2787353	2787353	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2787353T>C	uc003bpc.2	+	5	551	c.330T>C	c.(328-330)GTT>GTC	p.V110V	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Silent_p.V110V	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	110	Ig-like C2-type 1.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GAACAATTGTTAGCAGAGAAG	0.388													3	128	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35835264	35835264	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35835264G>T	uc003cgb.2	+	20	2517	c.2253G>T	c.(2251-2253)CAG>CAT	p.Q751H	ARPP21_uc003cga.2_Missense_Mutation_p.Q732H|ARPP21_uc011axy.1_Missense_Mutation_p.Q752H|ARPP21_uc003cgf.2_Missense_Mutation_p.Q587H|ARPP21_uc003cgg.2_Missense_Mutation_p.Q274H	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	751	Gln-rich.					cytoplasm	nucleic acid binding	p.Q751Q(1)		ovary(2)|skin(1)	3						TACCTAACCAGGCAGGTCAAG	0.537													16	48	---	---	---	---	PASS
TRAK1	22906	broad.mit.edu	37	3	42201973	42201973	+	Intron	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42201973C>G	uc003cky.2	+						TRAK1_uc011azh.1_Intron|TRAK1_uc011azi.1_Intron|TRAK1_uc003ckz.3_Intron|TRAK1_uc011azj.1_Intron|TRAK1_uc003cla.2_Intron	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein						endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						AGGGTAAATTCTGTACTTGGC	0.413													26	43	---	---	---	---	PASS
MST1	4485	broad.mit.edu	37	3	49723522	49723522	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49723522G>A	uc003cxg.2	-	9	1192	c.1120C>T	c.(1120-1122)CGT>TGT	p.R374C	MST1_uc011bcs.1_Silent_p.G412G|MST1_uc010hkx.2_3'UTR|MST1_uc011bct.1_3'UTR	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	360	Kringle 3.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCTGTACAACGCCGGATCTGG	0.697													3	25	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52662986	52662986	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52662986A>G	uc003des.2	-	12	1379	c.1367T>C	c.(1366-1368)TTT>TCT	p.F456S	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.F456S|PBRM1_uc003der.2_Missense_Mutation_p.F424S|PBRM1_uc003det.2_Missense_Mutation_p.F456S|PBRM1_uc003deu.2_Missense_Mutation_p.F456S|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.F456S|PBRM1_uc010hmk.1_Missense_Mutation_p.F456S|PBRM1_uc003dey.2_Missense_Mutation_p.F456S|PBRM1_uc003dez.1_Missense_Mutation_p.F456S|PBRM1_uc003dfb.1_Missense_Mutation_p.F354S	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	456	Bromo 3.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GGCATTTTCAAACATTAAATT	0.338			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								30	75	---	---	---	---	PASS
SPATA12	353324	broad.mit.edu	37	3	57107973	57107973	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57107973G>C	uc003dij.1	+	2	926	c.251G>C	c.(250-252)AGA>ACA	p.R84T	ARHGEF3_uc003dih.2_Intron	NM_181727	NP_859078	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	84											0				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		ACCTGTCAGAGATATTTACAA	0.532													16	121	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108147662	108147662	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108147662C>T	uc003dxa.1	-	28	3496	c.3439G>A	c.(3439-3441)GAG>AAG	p.E1147K		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1147	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TCAGCTCTCTCCCTTTCCATC	0.428													69	203	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108572722	108572722	+	Nonstop_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108572722T>C	uc003dxi.1	+	6	703	c.559T>C	c.(559-561)TAG>CAG	p.*187Q	TRAT1_uc010hpx.1_Nonstop_Mutation_p.*150Q	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	187					cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						ACCTATAAACTAGCTGGACCA	0.448													67	222	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109023503	109023503	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109023503C>G	uc003dxo.2	-	7	920	c.673G>C	c.(673-675)GTG>CTG	p.V225L		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	225						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						CCATGGACCACACACCACCTG	0.502													11	102	---	---	---	---	PASS
ATP6V1A	523	broad.mit.edu	37	3	113524309	113524309	+	Silent	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113524309A>G	uc003eao.2	+	14	1764	c.1698A>G	c.(1696-1698)ACA>ACG	p.T566T	ATP6V1A_uc011bik.1_Silent_p.T533T	NM_001690	NP_001681	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit A	566					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3						ATAAAATCACATGGTCCATTA	0.383													52	135	---	---	---	---	PASS
C3orf30	152405	broad.mit.edu	37	3	118865717	118865717	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118865717C>A	uc003ecb.1	+	1	721	c.681C>A	c.(679-681)GAC>GAA	p.D227E	IGSF11_uc003eby.2_5'Flank|IGSF11_uc003ebz.2_5'Flank|IGSF11_uc010hqs.2_5'Flank|C3orf30_uc011biw.1_Missense_Mutation_p.D227E	NM_152539	NP_689752	Q96M34	CC030_HUMAN	hypothetical protein LOC152405	227										ovary(2)	2				GBM - Glioblastoma multiforme(114;0.222)		TGCAGATTGACAGTGGGTCAT	0.493													51	144	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126749164	126749164	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126749164G>A	uc003ejg.2	+	28	5075	c.5071G>A	c.(5071-5073)GCC>ACC	p.A1691T	PLXNA1_uc003ejh.2_Missense_Mutation_p.A359T	NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	1714	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		CCTGCCGCTGGCCATCAAGTA	0.602													20	120	---	---	---	---	PASS
RHO	6010	broad.mit.edu	37	3	129247867	129247867	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129247867C>A	uc003emt.2	+	1	386	c.291C>A	c.(289-291)ACC>ACA	p.T97T		NM_000539	NP_000530	P08100	OPSD_HUMAN	rhodopsin	97	Helical; Name=2; (Potential).				protein-chromophore linkage|rhodopsin mediated signaling pathway	Golgi apparatus|integral to plasma membrane|photoreceptor inner segment membrane|photoreceptor outer segment membrane	G-protein coupled receptor activity|metal ion binding|photoreceptor activity|protein binding				0		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	CCCTCTACACCTCTCTGCATG	0.587													50	182	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130290018	130290018	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290018G>A	uc010htl.2	+	6	2789	c.2758G>A	c.(2758-2760)GAT>AAT	p.D920N		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	920	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TGTGATCACCGATGGGGAATC	0.557													21	83	---	---	---	---	PASS
C3orf72	401089	broad.mit.edu	37	3	138669104	138669104	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138669104C>T	uc003esx.1	+						C3orf72_uc011bmr.1_3'UTR	NM_001040061	NP_001035150	Q6ZUU3	CC072_HUMAN	chromosome 3 open reading frame 72												0						CTTTTCTCCCCAGGGCCGGGA	0.706													8	24	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138738890	138738890	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138738890C>A	uc003esy.1	-	1	879	c.614G>T	c.(613-615)AGT>ATT	p.S205I		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	205	Pro-rich.									breast(1)	1						TCTCTCTGAACTGGGGTTGGG	0.622													9	87	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170784011	170784011	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170784011G>C	uc003fhh.2	-	32	4309	c.3964C>G	c.(3964-3966)CAA>GAA	p.Q1322E	TNIK_uc003fhi.2_Missense_Mutation_p.Q1267E|TNIK_uc003fhj.2_Missense_Mutation_p.Q1293E|TNIK_uc003fhk.2_Missense_Mutation_p.Q1314E|TNIK_uc003fhl.2_Missense_Mutation_p.Q1238E|TNIK_uc003fhm.2_Missense_Mutation_p.Q1259E|TNIK_uc003fhn.2_Missense_Mutation_p.Q1285E|TNIK_uc003fho.2_Missense_Mutation_p.Q1230E|TNIK_uc003fhg.2_Missense_Mutation_p.Q500E	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	1322	CNH.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTTAACCTTTGAGCTCGCTTA	0.398													18	141	---	---	---	---	PASS
MCCC1	56922	broad.mit.edu	37	3	182733285	182733285	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182733285T>C	uc003fle.2	-	19	2256	c.2119A>G	c.(2119-2121)AGA>GGA	p.R707G	MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.R590G|MCCC1_uc003flg.2_Missense_Mutation_p.R598G	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	707	Biotinyl-binding.				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	GGAGTGTGTCTGTTGGCCTGA	0.443													97	408	---	---	---	---	PASS
TMEM175	84286	broad.mit.edu	37	4	941927	941927	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:941927G>T	uc003gbq.2	+	3	275	c.177G>T	c.(175-177)GAG>GAT	p.E59D	TMEM175_uc010ibl.1_Missense_Mutation_p.E59D|TMEM175_uc003gbp.1_5'UTR|TMEM175_uc003gbr.2_5'UTR|TMEM175_uc003gbu.2_Intron|TMEM175_uc003gbs.2_5'UTR|TMEM175_uc003gbt.2_5'UTR|TMEM175_uc003gbv.2_Intron	NM_032326	NP_115702	Q9BSA9	TM175_HUMAN	transmembrane protein 175	59						integral to membrane					0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CCCACACGGAGATCTCCCCAG	0.607													10	105	---	---	---	---	PASS
FGFRL1	53834	broad.mit.edu	37	4	1019001	1019001	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1019001G>T	uc003gce.2	+	7	1542	c.1381G>T	c.(1381-1383)GGC>TGC	p.G461C	FGFRL1_uc003gcf.2_Missense_Mutation_p.G461C|FGFRL1_uc003gcg.2_Missense_Mutation_p.G461C|FGFRL1_uc010ibo.2_Missense_Mutation_p.G461C	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	461	Cytoplasmic (Potential).				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCACTTACTGGGCCCAGGCCC	0.498													8	18	---	---	---	---	PASS
D4S234E	27065	broad.mit.edu	37	4	4419139	4419139	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4419139G>A	uc011bvz.1	+	8	1816	c.535G>A	c.(535-537)GAA>AAA	p.E179K	D4S234E_uc011bwa.1_Missense_Mutation_p.E140K|D4S234E_uc003ghz.2_Missense_Mutation_p.E179K|D4S234E_uc003gia.2_Missense_Mutation_p.E179K|D4S234E_uc003gib.2_Missense_Mutation_p.E179K	NM_014392	NP_055207	P42857	NSG1_HUMAN	brain neuron cytoplasmic protein 1	179	Lumenal (Potential).				dopamine receptor signaling pathway	Golgi membrane|integral to membrane|nucleus	dopamine receptor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		GCAGGAGACTGAAGCGGCTGA	0.478													14	118	---	---	---	---	PASS
SH3TC1	54436	broad.mit.edu	37	4	8229143	8229143	+	Silent	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8229143C>G	uc003gkv.3	+	12	1823	c.1722C>G	c.(1720-1722)CTC>CTG	p.L574L	SH3TC1_uc003gkw.3_Silent_p.L498L|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	574	TPR 1.						binding			large_intestine(2)|pancreas(1)	3						GCAGGAGGCTCAAGCTGTCCC	0.692													3	120	---	---	---	---	PASS
WDR19	57728	broad.mit.edu	37	4	39274621	39274621	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39274621C>G	uc003gtv.2	+	32	3659	c.3505C>G	c.(3505-3507)CAC>GAC	p.H1169D	WDR19_uc011byi.1_Missense_Mutation_p.H1009D|WDR19_uc003gtw.1_Missense_Mutation_p.H766D	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1169					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						AAATGGAGATCACATGAAAGG	0.423													4	15	---	---	---	---	PASS
GRXCR1	389207	broad.mit.edu	37	4	42895560	42895560	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42895560G>C	uc003gwt.2	+	1	277	c.277G>C	c.(277-279)GGT>CGT	p.G93R		NM_001080476	NP_001073945	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	93					cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1						GAAGGGTTTTGGTACAAGAAG	0.448													27	159	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55976815	55976815	+	Intron	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55976815A>G	uc003has.2	-						KDR_uc003hat.1_Intron|KDR_uc011bzx.1_Intron	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor						angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TATTTCCAGTAGTTACCATTT	0.428			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			29	155	---	---	---	---	PASS
TMPRSS11D	9407	broad.mit.edu	37	4	68704024	68704024	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68704024G>T	uc003hdq.2	-	5	406	c.341C>A	c.(340-342)GCG>GAG	p.A114E	LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_5'UTR	NM_004262	NP_004253	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	114	SEA.|Extracellular (Potential).				proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GACAACATCCGCTCTCACACC	0.313													26	87	---	---	---	---	PASS
PF4	5196	broad.mit.edu	37	4	74846927	74846927	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74846927C>G	uc003hhi.2	-	3	345	c.300G>C	c.(298-300)GAG>GAC	p.E100D		NM_002619	NP_002610	P02776	PLF4_HUMAN	platelet factor 4 (chemokine (C-X-C motif)	100					cytokine-mediated signaling pathway|immune response|leukocyte chemotaxis|negative regulation of angiogenesis|negative regulation of apoptosis|negative regulation of cytolysis|negative regulation of megakaryocyte differentiation|negative regulation of MHC class II biosynthetic process|platelet activation|platelet degranulation|positive regulation of gene expression|positive regulation of macrophage derived foam cell differentiation|positive regulation of macrophage differentiation|positive regulation of tumor necrosis factor production	extracellular space|platelet alpha granule lumen	chemokine activity|heparin binding				0	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	GTAGCTAACTCTCCAAAAGTT	0.398													11	64	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77305543	77305543	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77305543C>A	uc003hkb.3	-	5	577	c.424G>T	c.(424-426)GAT>TAT	p.D142Y	CCDC158_uc003hkd.2_Missense_Mutation_p.D142Y	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	142	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TTTCTTAAATCCTCCTGGGAC	0.353													32	135	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77305544	77305544	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77305544C>T	uc003hkb.3	-	5	576	c.423G>A	c.(421-423)GAG>GAA	p.E141E	CCDC158_uc003hkd.2_Silent_p.E141E	NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	141	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TTCTTAAATCCTCCTGGGACT	0.353													31	132	---	---	---	---	PASS
THAP9	79725	broad.mit.edu	37	4	83839905	83839905	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83839905G>C	uc003hnt.2	+	5	2659	c.2540G>C	c.(2539-2541)AGA>ACA	p.R847T	THAP9_uc003hns.1_Missense_Mutation_p.R703T|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_Missense_Mutation_p.R564T	NM_024672	NP_078948	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	847							DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)				TTAAATATCAGAGCTAAAAAT	0.323													13	136	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85638146	85638146	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85638146C>G	uc003hpd.2	-	49	8186	c.7778G>C	c.(7777-7779)AGA>ACA	p.R2593T	WDFY3_uc003hpe.1_Missense_Mutation_p.R204T	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	2593						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTGGCTCCTCTAGGAATAAT	0.418													41	175	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89400577	89400577	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89400577C>A	uc003hrt.2	+	13	1809	c.1656C>A	c.(1654-1656)TGC>TGA	p.C552*	HERC5_uc011cdm.1_Nonsense_Mutation_p.C190*	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	552					innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		CCGTCATATGCCAGTTGGATT	0.418													36	121	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89427028	89427028	+	Nonstop_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89427028G>T	uc003hrt.2	+	23	3227	c.3074G>T	c.(3073-3075)TGA>TTA	p.*1025L	HERC5_uc011cdm.1_Nonstop_Mutation_p.*663L	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	1025					innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		GGATTTGGCTGACCAGCTTgc	0.234													9	29	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94690534	94690534	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94690534C>G	uc011cdt.1	+	15	2792	c.2534C>G	c.(2533-2535)TCC>TGC	p.S845C	GRID2_uc011cdu.1_Missense_Mutation_p.S750C	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	845	Helical; (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	ATTGTCCTCTCCTGCTTCATA	0.498													9	123	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114120187	114120187	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114120187C>G	uc003ibe.3	+	4	406	c.306C>G	c.(304-306)CAC>CAG	p.H102Q	ANK2_uc003ibd.3_Missense_Mutation_p.H81Q|ANK2_uc003ibf.3_Missense_Mutation_p.H102Q|ANK2_uc003ibc.2_Missense_Mutation_p.H78Q|ANK2_uc011cgb.1_Missense_Mutation_p.H117Q	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	102	ANK 3.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCGCTCTTCACATTGCATCTT	0.373													26	107	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115858639	115858639	+	Missense_Mutation	SNP	G	C	C	rs139847624	byFrequency	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115858639G>C	uc003ibu.2	-	5	1921	c.1242C>G	c.(1240-1242)AAC>AAG	p.N414K	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	414	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CATAGCCCATGTTGATTGGTA	0.418													27	87	---	---	---	---	PASS
MYOZ2	51778	broad.mit.edu	37	4	120107146	120107146	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120107146G>T	uc003icp.3	+	6	799	c.586G>T	c.(586-588)GAA>TAA	p.E196*		NM_016599	NP_057683	Q9NPC6	MYOZ2_HUMAN	myozenin 2	196							protein phosphatase 2B binding				0						TGGAGGTTTTGAAAAAGCATC	0.323													52	131	---	---	---	---	PASS
TNIP3	79931	broad.mit.edu	37	4	122068292	122068292	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122068292G>A	uc010ing.2	-	7	843	c.647C>T	c.(646-648)TCG>TTG	p.S216L	TNIP3_uc010inh.2_Missense_Mutation_p.S216L|TNIP3_uc011cgj.1_Missense_Mutation_p.S274L	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3	216	Potential.									ovary(1)	1						CTCTCGATCCGATCGTTCCTT	0.378													28	223	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126240599	126240599	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126240599G>T	uc003ifj.3	+	1	3033	c.3033G>T	c.(3031-3033)GTG>GTT	p.V1011V		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1011	Cadherin 10.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CAGAACCTGTGAATTCTCGAT	0.388													73	246	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134072210	134072210	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134072210G>T	uc003iha.2	+	1	1741	c.915G>T	c.(913-915)CCG>CCT	p.P305P	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Silent_p.P305P	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	305	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		GACTCTCGCCGCGCACTGGCA	0.637													24	75	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134084205	134084205	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134084205T>C	uc003iha.2	+	4	3697	c.2871T>C	c.(2869-2871)TCT>TCC	p.S957S		NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	957	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		GGATGCCTTCTTTTGTCCCTT	0.493													33	148	---	---	---	---	PASS
FGB	2244	broad.mit.edu	37	4	155488788	155488788	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155488788G>T	uc003ioa.3	+	4	573	c.534G>T	c.(532-534)AAG>AAT	p.K178N	FGB_uc003iob.3_Missense_Mutation_p.K175N|FGB_uc010ipv.2_Missense_Mutation_p.K116N|FGB_uc010ipw.2_Missense_Mutation_p.K175N|FGB_uc003ioc.3_5'UTR	NM_005141	NP_005132	P02675	FIBB_HUMAN	fibrinogen, beta chain preproprotein	178	Potential.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen|soluble fraction	chaperone binding|eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AACTGGAAAAGCACCAATTAT	0.333													29	171	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158284166	158284166	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158284166C>T	uc003ipm.3	+	15	3081	c.2622C>T	c.(2620-2622)AAC>AAT	p.N874N	GRIA2_uc011cit.1_Silent_p.N827N|GRIA2_uc003ipl.3_Silent_p.N874N|GRIA2_uc003ipk.3_Silent_p.N827N|GRIA2_uc011civ.1_RNA|GRIA2_uc011ciw.1_RNA|GRIA2_uc011cix.1_3'UTR|GRIA2_uc011ciy.1_3'UTR|GRIA2_uc011ciz.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	874	Cytoplasmic (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	AAGGTTACAACGTATATGGCA	0.408													65	261	---	---	---	---	PASS
NAF1	92345	broad.mit.edu	37	4	164050477	164050477	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164050477G>C	uc003iqj.2	-	8	1251	c.1057C>G	c.(1057-1059)CAG>GAG	p.Q353E	NAF1_uc010iqw.1_Intron	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	353					rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				TTCCAATTCTGATGTACTTCA	0.368													14	99	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169197313	169197313	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169197313T>A	uc003irp.2	-	15	2290	c.1998A>T	c.(1996-1998)TTA>TTT	p.L666F		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	666							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CAGCTATACTTAAATCTTTCG	0.318													31	120	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5200358	5200358	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5200358G>A	uc003jdl.2	+	9	1565	c.1427G>A	c.(1426-1428)CGC>CAC	p.R476H	ADAMTS16_uc003jdk.1_Missense_Mutation_p.R476H|ADAMTS16_uc003jdj.1_Missense_Mutation_p.R476H	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	476	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CCCTGCAGCCGCCAGTATCTA	0.512													32	90	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11397307	11397307	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11397307G>T	uc003jfa.1	-	6	593	c.448C>A	c.(448-450)CTG>ATG	p.L150M	CTNND2_uc010itt.2_Missense_Mutation_p.L59M|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Translation_Start_Site|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	150					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						TGGGAGAGCAGGCTGGGCCCT	0.488													21	71	---	---	---	---	PASS
ANKH	56172	broad.mit.edu	37	5	14871536	14871536	+	Silent	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14871536G>C	uc003jfm.3	-	1	352	c.21C>G	c.(19-21)CTC>CTG	p.L7L		NM_054027	NP_473368	Q9HCJ1	ANKH_HUMAN	progressive ankylosis protein	7	Cytoplasmic (Potential).				locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1						AGTAGTGCGTGAGCGCCGGGA	0.602													7	34	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16758264	16758264	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16758264C>T	uc003jft.3	-	18	2279	c.1811G>A	c.(1810-1812)AGC>AAC	p.S604N	MYO10_uc010itx.2_Missense_Mutation_p.S227N	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	604	Myosin head-like.				axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CCGATGTTTGCTTCCACATTT	0.443													39	109	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26915968	26915968	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26915968C>A	uc003jgs.1	-	3	462	c.293G>T	c.(292-294)GGC>GTC	p.G98V	CDH9_uc010iug.2_Missense_Mutation_p.G98V	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	98	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.G98C(1)		ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						AAATAGACTGCCAGCCCCATC	0.363													65	275	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26915969	26915969	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26915969C>G	uc003jgs.1	-	3	461	c.292G>C	c.(292-294)GGC>CGC	p.G98R	CDH9_uc010iug.2_Missense_Mutation_p.G98R	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	98	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.G98C(1)		ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						AATAGACTGCCAGCCCCATCT	0.363													66	275	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33937066	33937066	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937066C>T	uc003jic.1	+	1	578	c.221C>T	c.(220-222)GCG>GTG	p.A74V		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	74	Extracellular (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						GCAGAGAGCGCGGACACAGAG	0.692													13	83	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34818921	34818921	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34818921G>A	uc003jir.2	+	13	1155	c.959G>A	c.(958-960)CGA>CAA	p.R320Q	RAI14_uc010iur.2_Missense_Mutation_p.R291Q|RAI14_uc011coj.1_Missense_Mutation_p.R320Q|RAI14_uc010ius.1_Missense_Mutation_p.R249Q|RAI14_uc003jis.2_Missense_Mutation_p.R323Q|RAI14_uc003jit.2_Missense_Mutation_p.R320Q|RAI14_uc011cok.1_Missense_Mutation_p.R312Q	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	320						cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					AGTTCTATACGAGAAAACAAA	0.328													22	150	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41065440	41065440	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41065440G>T	uc003jmj.3	-	4	844	c.354C>A	c.(352-354)ACC>ACA	p.T118T		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	118							binding			ovary(6)|central_nervous_system(2)	8						TACCATAGCTGGTTGCCAATT	0.408													10	43	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41160380	41160380	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41160380G>A	uc003jmk.2	-	11	1758	c.1548C>T	c.(1546-1548)GCC>GCT	p.A516A	C6_uc003jml.1_Silent_p.A516A	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	516	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GATCGAACTTGGCTGCATACT	0.517													54	147	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63256368	63256368	+	Silent	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63256368A>T	uc011cqt.1	-	1	1179	c.1179T>A	c.(1177-1179)TCT>TCA	p.S393S		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	393	Helical; Name=7; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	GGTTAAGCAGAGAGTTGGAGT	0.502													39	411	---	---	---	---	PASS
SLC30A5	64924	broad.mit.edu	37	5	68419159	68419159	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68419159C>A	uc003jvh.2	+	14	2106	c.1905C>A	c.(1903-1905)CTC>CTA	p.L635L	SLC30A5_uc003jvj.2_RNA|SLC30A5_uc003jvk.2_Silent_p.L364L|SLC30A5_uc003jvi.2_Silent_p.L464L	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),	635	Helical; (Potential).				cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TAATATTTCTCAGTGTTGTTC	0.393													21	135	---	---	---	---	PASS
COL4A3BP	10087	broad.mit.edu	37	5	74696088	74696088	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74696088G>A	uc011csu.1	-	10	1474	c.1052C>T	c.(1051-1053)ACA>ATA	p.T351I	COL4A3BP_uc003kds.2_Missense_Mutation_p.T351I|COL4A3BP_uc003kdt.2_Missense_Mutation_p.T479I|COL4A3BP_uc003kdu.2_Missense_Mutation_p.T351I	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform	351					ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		GGGCAAGGATGTAGGCCAATG	0.358													15	37	---	---	---	---	PASS
ARSB	411	broad.mit.edu	37	5	78076486	78076486	+	Intron	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78076486C>A	uc003kfq.2	-							NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor						lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		TAACCACAGCCTAGCAAAGAA	0.493													18	24	---	---	---	---	PASS
PAPD4	167153	broad.mit.edu	37	5	78952809	78952809	+	Silent	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78952809C>G	uc010jae.1	+	12	1474	c.1056C>G	c.(1054-1056)CTC>CTG	p.L352L	PAPD4_uc003kgb.2_Silent_p.L352L|PAPD4_uc010jaf.1_Silent_p.L352L|PAPD4_uc003kga.2_Silent_p.L348L|PAPD4_uc003kfz.2_Silent_p.L309L	NM_001114393	NP_001107865	Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	352					histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity			ovary(1)	1		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		TTCCATCCCTCCAAAAAATTT	0.294													24	130	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90024634	90024634	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90024634G>T	uc003kju.2	+	49	10406	c.10310G>T	c.(10309-10311)TGG>TTG	p.W3437L	GPR98_uc003kjt.2_Missense_Mutation_p.W1143L|GPR98_uc003kjv.2_Missense_Mutation_p.W1037L	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3437	EAR 4.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTATTCAGATGGTCTGGCAGT	0.473													50	62	---	---	---	---	PASS
FER	2241	broad.mit.edu	37	5	108207797	108207797	+	Silent	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108207797A>T	uc003kop.1	+	8	1191	c.807A>T	c.(805-807)ACA>ACT	p.T269T	FER_uc011cvf.1_RNA|FER_uc011cvg.1_Silent_p.T94T	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	269	Important for interaction with membranes containing phosphoinositides.				intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		TTACTAGAACAACGGCTGCTA	0.303													14	35	---	---	---	---	PASS
MYOT	9499	broad.mit.edu	37	5	137222564	137222564	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137222564A>G	uc011cye.1	+	9	1219	c.1202A>G	c.(1201-1203)GAT>GGT	p.D401G	PKD2L2_uc010jep.1_5'Flank|PKD2L2_uc003lbw.1_5'Flank|PKD2L2_uc003lbx.2_5'Flank|PKD2L2_uc003lby.2_5'Flank|MYOT_uc003lbv.2_Missense_Mutation_p.D401G|MYOT_uc011cyg.1_Missense_Mutation_p.D217G|MYOT_uc011cyh.1_Missense_Mutation_p.D286G	NM_001135940	NP_001129412	Q9UBF9	MYOTI_HUMAN	myotilin isoform b	401	Necessary for interaction with ACTA1.|Ig-like C2-type 2.|Necessary for interaction with FLNC.				muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTATATCAAGATAACACTGGA	0.343													19	57	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140590583	140590583	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590583C>T	uc003liz.2	+	1	2293	c.2104C>T	c.(2104-2106)CTC>TTC	p.L702F	PCDHB12_uc011dak.1_Missense_Mutation_p.L365F|PCDHB13_uc003lja.1_5'Flank	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	702	Helical; (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTCGCTCTTCCTCTTCTCGGT	0.706													53	126	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140723766	140723766	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140723766C>A	uc003ljm.1	+	1	166	c.166C>A	c.(166-168)CCC>ACC	p.P56T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.P56T	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	56	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGCTAGAGCCCCGGGAGCT	0.607											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	140	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140723767	140723767	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140723767C>A	uc003ljm.1	+	1	167	c.167C>A	c.(166-168)CCC>CAC	p.P56H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.P56H	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	56	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTAGAGCCCCGGGAGCTG	0.607											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	59	139	---	---	---	---	PASS
HTR4	3360	broad.mit.edu	37	5	147889143	147889143	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147889143A>G	uc003lpn.2	-	6	1116	c.952T>C	c.(952-954)TCT>CCT	p.S318P	HTR4_uc010jgu.1_RNA|HTR4_uc003lpi.1_Missense_Mutation_p.S318P|HTR4_uc003lpj.1_Missense_Mutation_p.S318P|HTR4_uc003lpk.2_Missense_Mutation_p.S318P|HTR4_uc011dby.1_Missense_Mutation_p.S318P|HTR4_uc003lpl.2_Missense_Mutation_p.S332P|HTR4_uc003lpm.2_Missense_Mutation_p.S318P|HTR4_uc010jgv.2_RNA|HTR4_uc003lpo.1_Missense_Mutation_p.S318P	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b	318	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	CGTCTAAAAGACTTATTCAAG	0.502													6	83	---	---	---	---	PASS
SH3TC2	79628	broad.mit.edu	37	5	148411217	148411217	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148411217C>G	uc003lpu.2	-	9	1187	c.1035G>C	c.(1033-1035)GAG>GAC	p.E345D	SH3TC2_uc003lpp.1_RNA|SH3TC2_uc010jgw.2_5'UTR|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_5'UTR|SH3TC2_uc010jgx.2_Missense_Mutation_p.E338D|SH3TC2_uc003lpv.1_5'UTR|SH3TC2_uc011dbz.1_Missense_Mutation_p.E230D	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	345							binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAGCATCTCTCCTCATCAC	0.522													25	56	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169138961	169138961	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169138961T>A	uc003maf.2	+	16	1585	c.1505T>A	c.(1504-1506)ATG>AAG	p.M502K	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.C29S|DOCK2_uc010jjl.1_Missense_Mutation_p.M20K	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	502	DHR-1.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATTGAAGACATGCAGAGGATC	0.517													74	122	---	---	---	---	PASS
BTNL9	153579	broad.mit.edu	37	5	180482998	180482998	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180482998G>T	uc003mmt.2	+	9	1169	c.938G>T	c.(937-939)CGG>CTG	p.R313L		NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor	313	Cytoplasmic (Potential).|B30.2/SPRY.|Potential.					integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACTGGAGACGGGCTGAAGGC	0.537													61	143	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	9900680	9900680	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9900680C>T	uc003myg.1	-						uc010jog.1_Intron|uc003myh.1_Intron|uc003myi.2_RNA|uc003myj.1_Intron|uc003myk.1_RNA|uc003myn.2_Missense_Mutation_p.G152E|uc010joi.1_Missense_Mutation_p.G197E|uc010joh.1_RNA|uc011dif.1_Missense_Mutation_p.G156E|uc011dig.1_Missense_Mutation_p.G152E					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																		ATTGGAACTCCCAGGTGCTTC	0.433													20	192	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12124417	12124417	+	Silent	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12124417A>G	uc003nac.2	+	4	4568	c.4389A>G	c.(4387-4389)CCA>CCG	p.P1463P	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1463					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATGCAGTGCCATATCAGGGGC	0.438													35	129	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	12718981	12718981	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12718981A>G	uc010jpc.2	+	3	337	c.5A>G	c.(4-6)GAT>GGT	p.D2G	PHACTR1_uc011dir.1_Missense_Mutation_p.D2G|PHACTR1_uc003nag.1_Missense_Mutation_p.D2G|PHACTR1_uc003nah.1_Missense_Mutation_p.D2G|PHACTR1_uc003nai.2_Missense_Mutation_p.D2G	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	2						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TCAAGGATGGATTATCCCAAA	0.373													2	11	---	---	---	---	PASS
NRSN1	140767	broad.mit.edu	37	6	24145808	24145808	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24145808C>A	uc010jpq.1	+	4	459	c.222C>A	c.(220-222)ATC>ATA	p.I74I		NM_080723	NP_542454	Q8IZ57	NRSN1_HUMAN	neurensin 1	74	Helical; (Potential).				nervous system development	growth cone|integral to membrane|neuronal cell body|transport vesicle					0						TTTTTGTGATCCTCGGATTGA	0.512													22	163	---	---	---	---	PASS
NRSN1	140767	broad.mit.edu	37	6	24145809	24145809	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24145809C>A	uc010jpq.1	+	4	460	c.223C>A	c.(223-225)CTC>ATC	p.L75I		NM_080723	NP_542454	Q8IZ57	NRSN1_HUMAN	neurensin 1	75	Helical; (Potential).				nervous system development	growth cone|integral to membrane|neuronal cell body|transport vesicle					0						TTTTGTGATCCTCGGATTGAC	0.512													20	165	---	---	---	---	PASS
HIST1H4F	8361	broad.mit.edu	37	6	26240649	26240649	+	5'Flank	SNP	C	G	G	rs3734534	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26240649C>G	uc003nhe.1	+							NM_003540	NP_003531	P62805	H4_HUMAN	histone cluster 1, H4f						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				TGTTTGTCTTCGATCATGTCT	0.473													4	31	---	---	---	---	PASS
PRSS16	10279	broad.mit.edu	37	6	27215710	27215710	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27215710C>A	uc003nja.2	+	2	132	c.120C>A	c.(118-120)AGC>AGA	p.S40R	PRSS16_uc011dkt.1_RNA|PRSS16_uc003njb.2_Missense_Mutation_p.S40R|PRSS16_uc010jqq.1_5'Flank|PRSS16_uc010jqr.1_5'Flank|PRSS16_uc003njc.1_5'Flank	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16 precursor	40					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)|skin(1)	5						TTCAGGAGAGCTCTGCCCAGG	0.637													12	74	---	---	---	---	PASS
ZNF165	7718	broad.mit.edu	37	6	28056825	28056825	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28056825G>T	uc003nkg.2	+	5	2119	c.1035G>T	c.(1033-1035)CAG>CAT	p.Q345H	ZNF165_uc003nkh.2_Missense_Mutation_p.Q345H|ZNF165_uc003nki.3_Missense_Mutation_p.Q345H|ZSCAN12P1_uc003nkj.3_5'Flank	NM_003447	NP_003438	P49910	ZN165_HUMAN	zinc finger protein 165	345	C2H2-type 2.				viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AAACTCATCAGTGTAATGAAT	0.388													10	85	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294523	28294523	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294523G>C	uc003nla.2	-	4	1041	c.641C>G	c.(640-642)TCT>TGT	p.S214C	ZNF323_uc003nld.2_Missense_Mutation_p.S214C|ZNF323_uc010jra.2_Missense_Mutation_p.S214C|ZNF323_uc003nlb.2_Missense_Mutation_p.S55C|ZNF323_uc010jrb.2_Missense_Mutation_p.S55C|ZNF323_uc003nlc.2_Missense_Mutation_p.S214C	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	214					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TCTGTACTTAGAATCCAAAGA	0.433													38	169	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28295160	28295160	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28295160C>A	uc003nla.2	-	3	932	c.532G>T	c.(532-534)GAT>TAT	p.D178Y	ZNF323_uc003nld.2_Missense_Mutation_p.D178Y|ZNF323_uc010jra.2_Missense_Mutation_p.D178Y|ZNF323_uc003nlb.2_Missense_Mutation_p.D19Y|ZNF323_uc010jrb.2_Missense_Mutation_p.D19Y|ZNF323_uc003nlc.2_Missense_Mutation_p.D178Y	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	178					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						AAATCCTTACCTTGTTCTTGA	0.328													29	193	---	---	---	---	PASS
OR11A1	26531	broad.mit.edu	37	6	29395345	29395345	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29395345A>G	uc003nmg.2	-	1	165	c.74T>C	c.(73-75)CTG>CCG	p.L25P		NM_013937	NP_039225	Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A,	25	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CAAGAAATGCAGTTCAGGGAT	0.418													14	80	---	---	---	---	PASS
RING1	6015	broad.mit.edu	37	6	33179559	33179559	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33179559C>G	uc003odk.2	+	6	1093	c.899C>G	c.(898-900)GCC>GGC	p.A300G	RING1_uc003odl.2_Missense_Mutation_p.A271G	NM_002931	NP_002922	Q06587	RING1_HUMAN	ring finger protein 1	300	Necessary for interaction with CBX2 (By similarity).				histone H2A monoubiquitination|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear speck|PcG protein complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						AAGTACTTGGCCCTGCGCATT	0.627													31	209	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34008084	34008084	+	Silent	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34008084T>A	uc003oir.3	-	7	1547	c.1377A>T	c.(1375-1377)GCA>GCT	p.A459A	GRM4_uc011dsn.1_Silent_p.A412A|GRM4_uc010jvh.2_Silent_p.A459A|GRM4_uc010jvi.2_Silent_p.A151A|GRM4_uc003oio.2_Silent_p.A151A|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Silent_p.A319A|GRM4_uc003oiq.2_Silent_p.A326A|GRM4_uc011dsm.1_Silent_p.A290A	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	459	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CAGGGTTCCCTGCGATGCCTG	0.567													23	172	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54806713	54806713	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54806713A>G	uc003pck.2	+	5	3060	c.2944A>G	c.(2944-2946)AAC>GAC	p.N982D		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	982										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					GCTTAATTACAACACTGGTGT	0.363													11	106	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75843650	75843650	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75843650C>A	uc003phs.2	-	33	5754	c.5588G>T	c.(5587-5589)CGC>CTC	p.R1863L	COL12A1_uc003pht.2_Missense_Mutation_p.R699L	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1863	Fibronectin type-III 14.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						ATGGTCCCAGCGGACATTCAA	0.448													7	58	---	---	---	---	PASS
RARS2	57038	broad.mit.edu	37	6	88255364	88255364	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88255364T>A	uc003pme.2	-	7	565	c.505A>T	c.(505-507)AAT>TAT	p.N169Y	RARS2_uc003pmb.2_5'UTR|RARS2_uc003pmc.2_5'UTR|RARS2_uc003pmd.2_Intron|RARS2_uc003pmf.2_RNA	NM_020320	NP_064716	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	169					arginyl-tRNA aminoacylation	mitochondrial matrix	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		CCAAGGTAATTTATTCTTATT	0.284													50	207	---	---	---	---	PASS
C6orf203	51250	broad.mit.edu	37	6	107361404	107361404	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107361404T>G	uc003prq.2	+	2	521	c.440T>G	c.(439-441)GTC>GGC	p.V147G	C6orf203_uc011eaj.1_Missense_Mutation_p.V152G|C6orf203_uc010kde.2_Missense_Mutation_p.V147G	NM_016487	NP_057571	Q9P0P8	CF203_HUMAN	hypothetical protein LOC51250 isoform a	147											0	Breast(9;0.00124)|all_epithelial(6;0.0729)	all_cancers(87;0.00461)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|Colorectal(196;0.171)|all_epithelial(87;0.23)	BRCA - Breast invasive adenocarcinoma(8;0.000395)|all cancers(7;0.00065)|Epithelial(6;0.000834)|OV - Ovarian serous cystadenocarcinoma(5;0.244)	BRCA - Breast invasive adenocarcinoma(108;0.117)		TATGATGTTGTCCTGAAGACG	0.388													14	87	---	---	---	---	PASS
C6orf186	728464	broad.mit.edu	37	6	110644054	110644054	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110644054G>T	uc010kdu.1	-	2	340	c.340C>A	c.(340-342)CTC>ATC	p.L114I	C6orf186_uc003pub.2_5'UTR	NM_001123364	NP_001116836	Q5JXM2	CF186_HUMAN	chromosome 6 open reading frame 186 precursor	114						extracellular region					0						CAAGGCTGGAGATCTATATGC	0.522													15	72	---	---	---	---	PASS
RFPL4B	442247	broad.mit.edu	37	6	112671478	112671478	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112671478C>G	uc003pvx.1	+	3	880	c.568C>G	c.(568-570)CAT>GAT	p.H190D		NM_001013734	NP_001013756	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	190	B30.2/SPRY.						zinc ion binding				0		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		AGGAGCAATCCATGCTAACAC	0.512													20	81	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117245953	117245953	+	Silent	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117245953A>G	uc003pxm.2	+	15	1740	c.1677A>G	c.(1675-1677)TCA>TCG	p.S559S		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	559					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TGAAGAATTCAGGTAACTTAA	0.308													18	96	---	---	---	---	PASS
SMPDL3A	10924	broad.mit.edu	37	6	123124805	123124805	+	Intron	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123124805A>G	uc003pzg.2	+						SMPDL3A_uc003pzh.2_Intron	NM_006714	NP_006705	Q92484	ASM3A_HUMAN	acid sphingomyelinase-like phosphodiesterase 3A						sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity				0				GBM - Glioblastoma multiforme(226;0.236)		AATTGTTTTTATAGGTGGTTT	0.343													13	73	---	---	---	---	PASS
ENPP3	5169	broad.mit.edu	37	6	131973776	131973776	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131973776T>C	uc003qcu.3	+	5	719	c.372T>C	c.(370-372)GAT>GAC	p.D124D	ENPP3_uc010kfn.1_RNA|ENPP3_uc011ecc.1_Silent_p.D90D|ENPP3_uc010kfo.1_RNA|ENPP3_uc010kfp.1_RNA|ENPP3_uc010kfq.2_RNA|ENPP3_uc003qcv.2_Silent_p.D124D	NM_005021	NP_005012	O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	124	Extracellular (Potential).|SMB 2.				immune response|nucleoside triphosphate catabolic process|phosphate metabolic process	extracellular region|integral to plasma membrane|perinuclear region of cytoplasm	metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity			ovary(3)|skin(1)	4	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		AGAGGAAAGATTGCTGTGCTG	0.458													30	123	---	---	---	---	PASS
EPM2A	7957	broad.mit.edu	37	6	145948803	145948803	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145948803C>A	uc003qkw.2	-	4	1102	c.745G>T	c.(745-747)GTG>TTG	p.V249L	EPM2A_uc003qkv.2_Missense_Mutation_p.V249L|EPM2A_uc010khr.2_Missense_Mutation_p.G168V|EPM2A_uc003qkx.2_Missense_Mutation_p.V111L|EPM2A_uc003qku.2_Missense_Mutation_p.V95L	NM_005670	NP_005661	O95278	EPM2A_HUMAN	laforin isoform a	249	Tyrosine-protein phosphatase.				glycogen metabolic process	cytosol|endoplasmic reticulum|nucleus|plasma membrane|polysome	carbohydrate binding|identical protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		AGCAGGCACACCGCCTGGGGC	0.632													10	39	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146755509	146755509	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146755509C>A	uc010khw.1	+	9	3632	c.3162C>A	c.(3160-3162)GGC>GGA	p.G1054G	GRM1_uc010khv.1_3'UTR|GRM1_uc003qll.2_3'UTR|GRM1_uc011edz.1_3'UTR|GRM1_uc011eea.1_3'UTR	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	1054	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	TGCTGGCAGGCCCCGGTGGTC	0.667													11	40	---	---	---	---	PASS
RAB32	10981	broad.mit.edu	37	6	146870741	146870741	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146870741C>T	uc003qln.1	+	2	572	c.392C>T	c.(391-393)CCA>CTA	p.P131L		NM_006834	NP_006825	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	131					protein transport|small GTPase mediated signal transduction	mitochondrion	GTP binding				0		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		GTTCATCTTCCAAATGGCAGC	0.433													24	121	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	160998304	160998304	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160998304C>A	uc003qtl.2	-	29	4615	c.4495G>T	c.(4495-4497)GTC>TTC	p.V1499F		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	4007	Kringle 36.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAATCCTGGACCACAGGGCTT	0.428													21	146	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161139397	161139397	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161139397G>C	uc003qtm.3	+	8	922	c.859G>C	c.(859-861)GTG>CTG	p.V287L		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	287	Kringle 3.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCGCGGGAATGTGGCTGTTAC	0.512													33	151	---	---	---	---	PASS
GLCCI1	113263	broad.mit.edu	37	7	8125922	8125922	+	Silent	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8125922A>T	uc003srk.2	+	8	1957	c.1398A>T	c.(1396-1398)CTA>CTT	p.L466L		NM_138426	NP_612435	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	466											0		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		TAAAACTTCTAGGCCCCCTCT	0.507													139	498	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20198137	20198137	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20198137A>G	uc003sus.3	-	5	2156	c.1847T>C	c.(1846-1848)GTG>GCG	p.V616A	MACC1_uc010kug.2_Missense_Mutation_p.V616A	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	616	SH3.				positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						CTTTGAAATCACCTTGACATT	0.363													99	322	---	---	---	---	PASS
EVX1	2128	broad.mit.edu	37	7	27282757	27282757	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27282757G>T	uc003szd.1	+	1	594	c.108G>T	c.(106-108)CCG>CCT	p.P36P	EVX1_uc011jzn.1_5'UTR|EVX1_uc010kuy.1_Silent_p.P36P	NM_001989	NP_001980	P49640	EVX1_HUMAN	even-skipped homeobox 1	36						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						GCCCGCTGCCGGAGCCGCCCG	0.682													5	8	---	---	---	---	PASS
ADCYAP1R1	117	broad.mit.edu	37	7	31125012	31125012	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31125012G>T	uc003tca.1	+	9	847	c.624G>T	c.(622-624)TGG>TGT	p.W208C	ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.W187C|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.W208C|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.W208C|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.W208C|ADCYAP1R1_uc003tcf.1_5'Flank	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	208	Extracellular (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						TCAAAGACTGGATTCTGTATG	0.547													47	159	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31682967	31682967	+	Silent	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31682967A>G	uc003tcj.1	+	11	2976	c.1983A>G	c.(1981-1983)GAA>GAG	p.E661E	CCDC129_uc011kad.1_Silent_p.E671E|CCDC129_uc003tci.1_Silent_p.E512E|CCDC129_uc011kae.1_Silent_p.E687E|CCDC129_uc003tck.1_Silent_p.E569E	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	661											0						AAACATCTGAAAAGCTCATTC	0.488													24	90	---	---	---	---	PASS
NPSR1	387129	broad.mit.edu	37	7	34851423	34851423	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34851423C>T	uc003teg.1	+	4	554	c.426C>T	c.(424-426)CTC>CTT	p.L142L	AAA1_uc010kwq.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Silent_p.L142L|NPSR1_uc010kwt.1_5'UTR|NPSR1_uc010kwu.1_Intron|NPSR1_uc010kwv.1_Intron|NPSR1_uc003tei.1_Silent_p.L142L|NPSR1_uc010kww.1_Silent_p.L131L|NPSR1_uc011kar.1_Intron|AAA1_uc010kwy.2_Intron|AAA1_uc003tek.3_Intron	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma	142	Helical; Name=3; (Potential).					cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	TGGTGTCCCTCAGCATAGACA	0.483													31	259	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48349667	48349667	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48349667C>G	uc003toq.2	+	24	9470	c.9445C>G	c.(9445-9447)CCA>GCA	p.P3149A	ABCA13_uc010kys.1_Missense_Mutation_p.P223A|ABCA13_uc003tos.1_5'Flank	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3149					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CTGTAGCCTGCCAGGGTCAAA	0.488													80	312	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48349668	48349668	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48349668C>A	uc003toq.2	+	24	9471	c.9446C>A	c.(9445-9447)CCA>CAA	p.P3149Q	ABCA13_uc010kys.1_Missense_Mutation_p.P223Q|ABCA13_uc003tos.1_5'Flank	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	3149					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TGTAGCCTGCCAGGGTCAAAA	0.493													82	313	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48450198	48450198	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48450198G>T	uc003toq.2	+	40	12177	c.12152G>T	c.(12151-12153)AGG>ATG	p.R4051M	ABCA13_uc010kys.1_Missense_Mutation_p.R1125M|ABCA13_uc010kyt.1_RNA	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4051	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CAGCATGGGAGGCTCAGGTGC	0.602													66	188	---	---	---	---	PASS
ZPBP	11055	broad.mit.edu	37	7	50121367	50121367	+	Intron	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50121367T>A	uc003tou.2	-						ZPBP_uc011kci.1_Intron|ZPBP_uc010kyw.2_Intron	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1						binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					AACAAAATCCTACCTGAAACA	0.338													19	99	---	---	---	---	PASS
ZNF117	51351	broad.mit.edu	37	7	64438970	64438970	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64438970G>A	uc003ttr.2	-	4	2264	c.979C>T	c.(979-981)CAT>TAT	p.H327Y		NM_015852	NP_056936	Q03924	ZN117_HUMAN	zinc finger protein 117	327	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TCTCCAGTATGAATTTTTTTA	0.353													24	171	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66483032	66483032	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66483032C>T	uc003tvn.2	+	6	912	c.763C>T	c.(763-765)CAC>TAC	p.H255Y	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	255					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				CTGTGGCGGCCACTGCAAGAA	0.527													8	32	---	---	---	---	PASS
MLXIPL	51085	broad.mit.edu	37	7	73009956	73009956	+	Intron	SNP	A	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73009956A>C	uc003tyn.1	-						MLXIPL_uc003tyj.1_Intron|MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CATGGGCTTGAGGGAGGATAC	0.622													19	95	---	---	---	---	PASS
CCL26	10344	broad.mit.edu	37	7	75401323	75401323	+	Splice_Site	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75401323T>A	uc003udt.1	-	3	182	c.74_splice	c.e3-1	p.R25_splice		NM_006072	NP_006063	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						CACTCCCACCTAAAAATCAGG	0.547													31	83	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	78150907	78150907	+	Silent	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78150907A>G	uc003ugx.2	-	4	848	c.594T>C	c.(592-594)AAT>AAC	p.N198N	MAGI2_uc003ugy.2_Silent_p.N198N|MAGI2_uc011kgr.1_Silent_p.N30N|MAGI2_uc011kgs.1_Silent_p.N35N	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	198	Guanylate kinase-like.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GGTCTGTTACATTTAACAATA	0.423													123	352	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88962778	88962778	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88962778G>T	uc011khi.1	+	4	1020	c.482G>T	c.(481-483)TGC>TTC	p.C161F		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	161						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAGGTATCATGCATGAAGAGT	0.443										HNSCC(36;0.09)			33	85	---	---	---	---	PASS
CLDN12	9069	broad.mit.edu	37	7	90042515	90042515	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90042515G>T	uc003ukp.2	+	5	1161	c.525G>T	c.(523-525)GTG>GTT	p.V175V	CLDN12_uc003ukq.2_Silent_p.V175V|CLDN12_uc010leq.2_Silent_p.V175V|CLDN12_uc003ukr.2_Silent_p.V175V|CLDN12_uc003uks.2_Silent_p.V175V	NM_012129	NP_036261	P56749	CLD12_HUMAN	claudin 12	175	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						ACTATGCAGTGTATGTCACTA	0.418													125	399	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94056332	94056332	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94056332G>A	uc003ung.1	+	47	3589	c.3118G>A	c.(3118-3120)GAT>AAT	p.D1040N	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	1040					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TCACCATGGTGATCAAGGTGC	0.438										HNSCC(75;0.22)			8	85	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100547265	100547265	+	IGR	SNP	G	T	T	rs139303233	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100547265G>T								ACHE (52726 upstream) : MUC12 (100810 downstream)																							CCATGCAGCTGTTGGGGCTCC	0.652													2	2	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100681403	100681403	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100681403G>C	uc003uxp.1	+	3	6759	c.6706G>C	c.(6706-6708)GAG>CAG	p.E2236Q	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2236	Extracellular (Potential).|35.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTTACTTCTGAGGCTAGCAC	0.498													8	688	---	---	---	---	PASS
CDHR3	222256	broad.mit.edu	37	7	105658488	105658488	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105658488C>T	uc003vdl.3	+	12	1731	c.1623C>T	c.(1621-1623)GCC>GCT	p.A541A	CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Silent_p.A528A|CDHR3_uc011klt.1_Silent_p.A453A|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	541	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GAATCCAGGCCACCAACAACG	0.483													12	44	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106509389	106509389	+	Silent	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106509389C>G	uc003vdv.3	+	2	1468	c.1383C>G	c.(1381-1383)CTC>CTG	p.L461L	PIK3CG_uc003vdu.2_Silent_p.L461L|PIK3CG_uc003vdw.2_Silent_p.L461L	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	461					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						TTCAGCTTCTCTATTATGTGA	0.532													49	138	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113558590	113558590	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113558590C>A	uc010ljy.1	-	1	493	c.462G>T	c.(460-462)GAG>GAT	p.E154D		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	154	CBM21.				glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						ATACTAACTTCTCAAAAGAAA	0.353													44	178	---	---	---	---	PASS
COPG2	26958	broad.mit.edu	37	7	130295841	130295841	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130295841T>C	uc003vqh.1	-	9	810	c.720A>G	c.(718-720)CTA>CTG	p.L240L		NM_012133	NP_036265	Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2	240					intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)					CAGTTTCTTTTAGTAAGCGAC	0.363													65	165	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142111566	142111566	+	Intron	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142111566G>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGACCCAGGGCCTGTTGGTA	0.507													33	165	---	---	---	---	PASS
OR2A12	346525	broad.mit.edu	37	7	143792422	143792422	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143792422G>A	uc011kty.1	+	1	222	c.222G>A	c.(220-222)TCG>TCA	p.S74S		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					CCTATGCCTCGAGTACTGTCC	0.453													78	173	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147926793	147926793	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147926793C>T	uc003weu.1	+	20	3819	c.3303C>T	c.(3301-3303)GAC>GAT	p.D1101D		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	1101	Laminin G-like 4.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACAATATTGACGTAGACCACA	0.433										HNSCC(39;0.1)			36	87	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148506222	148506222	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148506222C>T	uc003wfd.1	-	19	2287	c.2121G>A	c.(2119-2121)AGG>AGA	p.R707R	EZH2_uc011kug.1_Silent_p.R656R|EZH2_uc003wfb.1_Silent_p.R712R|EZH2_uc003wfc.1_Silent_p.R668R|EZH2_uc011kuh.1_Silent_p.R698R	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	707	SET.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			AAATACCTATCCTGTGATCAC	0.443			Mis		DLBCL								12	237	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150556093	150556093	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150556093C>A	uc003why.1	+	4	6031	c.1813C>A	c.(1813-1815)CTG>ATG	p.L605M	ABP1_uc003whz.1_Missense_Mutation_p.L605M|ABP1_uc003wia.1_Missense_Mutation_p.L605M	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	605					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	CGACCAGGTGCTGCCCCCAGG	0.627													9	25	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154379700	154379700	+	Intron	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154379700A>T	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Missense_Mutation_p.Y323F|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CCATTGTCATACGAGTGTGGC	0.602													60	115	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16026285	16026285	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16026285G>T	uc003wwz.2	-	4	510	c.312C>A	c.(310-312)AGC>AGA	p.S104R	MSR1_uc010lsu.2_Missense_Mutation_p.S122R|MSR1_uc003wxa.2_Missense_Mutation_p.S104R|MSR1_uc003wxb.2_Missense_Mutation_p.S104R|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	104	Spacer (Probable).|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTTCCTCTTCGCTGTCATTTC	0.398													97	220	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25898521	25898521	+	Intron	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25898521G>A	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc003xet.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CCTTGTTCCTGAAAAGACAGG	0.537													6	67	---	---	---	---	PASS
CLVS1	157807	broad.mit.edu	37	8	62212824	62212824	+	Silent	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62212824C>G	uc003xuh.2	+	2	762	c.438C>G	c.(436-438)GCC>GCG	p.A146A	CLVS1_uc003xug.2_Silent_p.A146A|CLVS1_uc003xui.2_Intron|CLVS1_uc010lyp.2_Silent_p.A146A	NM_173519	NP_775790	Q8IUQ0	CLVS1_HUMAN	retinaldehyde binding protein 1-like 1	146	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			skin(4)|ovary(1)	5						TGTTTGCAGCCAATTGGGATC	0.448													29	75	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68931877	68931877	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68931877C>T	uc003xxv.1	+	3	334	c.307C>T	c.(307-309)CAA>TAA	p.Q103*	PREX2_uc003xxu.1_Nonsense_Mutation_p.Q103*|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	103	DH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TAATGCTCAACAAGAAGTGGG	0.353													22	112	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77765850	77765850	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77765850G>A	uc003yav.2	+	10	6945	c.6558G>A	c.(6556-6558)ACG>ACA	p.T2186T	ZFHX4_uc003yau.1_Silent_p.T2231T|ZFHX4_uc003yaw.1_Silent_p.T2186T	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2186	Homeobox 2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTTCTAGAACGAGATTTACTG	0.383										HNSCC(33;0.089)			21	98	---	---	---	---	PASS
UQCRB	7381	broad.mit.edu	37	8	97243321	97243321	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97243321G>A	uc003yhq.3	-	4	402	c.298C>T	c.(298-300)CGG>TGG	p.R100W	UQCRB_uc011lgt.1_RNA|UQCRB_uc010mbc.2_RNA	NM_006294	NP_006285	P14927	QCR7_HUMAN	ubiquinol-cytochrome c reductase binding	100					aerobic respiration|mitochondrial electron transport, ubiquinol to cytochrome c	mitochondrial respiratory chain	ubiquinol-cytochrome-c reductase activity			ovary(1)	1	Breast(36;5.16e-05)					TTTCTTTCCCGAATAACCTCT	0.338													156	195	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100866426	100866426	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100866426G>A	uc003yiv.2	+	56	10995	c.10884G>A	c.(10882-10884)GCG>GCA	p.A3628A	VPS13B_uc003yiw.2_Silent_p.A3603A	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3628					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TCACCACTGCGAGGCAGCTTG	0.562													14	139	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	105161076	105161076	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105161076G>T	uc003yls.2	+	23	3629	c.3388G>T	c.(3388-3390)GAA>TAA	p.E1130*	RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Nonsense_Mutation_p.E1119*|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAGCCAAACGGGTAGGAATTT	0.408										HNSCC(12;0.0054)			26	252	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106814808	106814808	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106814808G>T	uc003ymd.2	+	8	2521	c.2498G>T	c.(2497-2499)AGC>ATC	p.S833I	ZFPM2_uc011lhs.1_Missense_Mutation_p.S564I	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	833	Interaction with CTBP2 (Probable).				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			ATAGATCTCAGCAAAAAGTGT	0.458													7	63	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110401328	110401328	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110401328A>T	uc003yne.2	+	8	748	c.644A>T	c.(643-645)CAT>CTT	p.H215L		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	215	Extracellular (Potential).|IPT/TIG 2.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAACTGGATCATCCAAATGGA	0.313										HNSCC(38;0.096)			157	170	---	---	---	---	PASS
KLHL38	340359	broad.mit.edu	37	8	124658216	124658216	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124658216T>C	uc003yqs.1	-	3	1533	c.1509A>G	c.(1507-1509)AAA>AAG	p.K503K		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	503	Kelch 5.										0						TGTCCGCACATTTGACAAATT	0.517													26	175	---	---	---	---	PASS
OC90	729330	broad.mit.edu	37	8	133044300	133044300	+	Splice_Site	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133044300C>A	uc003ytg.2	-	11	860	c.860_splice	c.e11-1	p.A287_splice	OC90_uc011lix.1_Splice_Site_p.A287_splice	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90						lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			CTGTCACAGGCTGAAAGGAAC	0.547													16	166	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144947018	144947018	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144947018T>C	uc003zaa.1	-	1	417	c.404A>G	c.(403-405)CAG>CGG	p.Q135R		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	135	Plectin 3.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCGATGGCCTGAAAGAGGGC	0.677													3	80	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90498077	90498077	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90498077C>A	uc004app.3	+	1	306	c.271C>A	c.(271-273)CCC>ACC	p.P91T	C9orf79_uc004apo.1_Intron	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	91						integral to membrane				ovary(3)	3						CAGTGACCCACCCTCACCCCC	0.572													6	18	---	---	---	---	PASS
OR13C2	392376	broad.mit.edu	37	9	107367467	107367467	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107367467A>T	uc011lvq.1	-	1	442	c.442T>A	c.(442-444)TCC>ACC	p.S148T		NM_001004481	NP_001004481	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C,	148	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATGATCCAGGACCCAGCTGCC	0.458													65	106	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136298499	136298499	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136298499G>T	uc004cdv.3	+	10	1538	c.1094G>T	c.(1093-1095)TGG>TTG	p.W365L	ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Missense_Mutation_p.W365L|ADAMTS13_uc004cdu.1_Missense_Mutation_p.W334L|ADAMTS13_uc004cdw.3_Missense_Mutation_p.W365L|ADAMTS13_uc004cdx.3_Missense_Mutation_p.W334L|ADAMTS13_uc004cdy.1_RNA|ADAMTS13_uc004cdz.3_Missense_Mutation_p.W35L|ADAMTS13_uc004cds.1_Intron|ADAMTS13_uc004cdr.1_RNA	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	365	Cysteine-rich.|Disintegrin.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCCTTGCAGTGGTGCTCCAAG	0.632													27	107	---	---	---	---	PASS
PMPCA	23203	broad.mit.edu	37	9	139311537	139311537	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139311537G>A	uc004chl.2	+	7	773	c.768G>A	c.(766-768)GTG>GTA	p.V256V	PMPCA_uc010nbl.2_Silent_p.V156V|PMPCA_uc011mdz.1_Silent_p.V125V|PMPCA_uc004chm.1_Silent_p.V6V|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	256					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		TGGCCGGCGTGGGCGTGGAGC	0.612													17	42	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7214090	7214090	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7214090C>A	uc009xio.1	-	19	2273	c.2182G>T	c.(2182-2184)GAC>TAC	p.D728Y	SFMBT2_uc001ijn.1_Missense_Mutation_p.D728Y|SFMBT2_uc010qay.1_Missense_Mutation_p.D563Y	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	728					regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						GTGTCATCGTCCATGGCGTCA	0.687													6	20	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7214091	7214091	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7214091C>A	uc009xio.1	-	19	2272	c.2181G>T	c.(2179-2181)ATG>ATT	p.M727I	SFMBT2_uc001ijn.1_Missense_Mutation_p.M727I|SFMBT2_uc010qay.1_Missense_Mutation_p.M562I	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	727					regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						TGTCATCGTCCATGGCGTCAG	0.692													6	20	---	---	---	---	PASS
TAF3	83860	broad.mit.edu	37	10	7866291	7866291	+	Silent	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7866291A>T	uc010qbd.1	+	2	177	c.177A>T	c.(175-177)ACA>ACT	p.T59T		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	59					maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						ATGGCCGAACAGACCCAATTT	0.353													57	224	---	---	---	---	PASS
MCM10	55388	broad.mit.edu	37	10	13251236	13251236	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13251236G>T	uc001ima.2	+	20	2655	c.2554G>T	c.(2554-2556)GGT>TGT	p.G852C	MCM10_uc001imb.2_Missense_Mutation_p.G851C|MCM10_uc001imc.2_3'UTR	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	852					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						GGAAAAGACTGGTCCAAAGAT	0.368													39	117	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16911630	16911630	+	Intron	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16911630C>G	uc001ioo.2	-						CUBN_uc009xjq.1_Intron	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTCCAGAATTCTTACCCAATG	0.438													23	355	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16981140	16981140	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16981140C>G	uc001ioo.2	-	38	5607	c.5555G>C	c.(5554-5556)GGC>GCC	p.G1852A		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1852	CUB 13.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATTATCATTGCCAAATACTAG	0.388													30	110	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18789804	18789804	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18789804C>T	uc001ipr.2	+	5	580	c.520C>T	c.(520-522)CCA>TCA	p.P174S	CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Missense_Mutation_p.P174S|CACNB2_uc001ipt.2_Missense_Mutation_p.P174S|CACNB2_uc010qcl.1_RNA|CACNB2_uc001ipu.2_Missense_Mutation_p.P146S|CACNB2_uc001ipv.2_Missense_Mutation_p.P146S|CACNB2_uc009xka.1_Missense_Mutation_p.P146S|CACNB2_uc001ipw.2_Missense_Mutation_p.P119S|CACNB2_uc001ipx.2_Missense_Mutation_p.P119S|CACNB2_uc009xkb.1_Missense_Mutation_p.P120S|CACNB2_uc010qcm.1_Missense_Mutation_p.P120S|CACNB2_uc001ipz.2_Missense_Mutation_p.P120S|CACNB2_uc001ipy.2_Missense_Mutation_p.P120S|CACNB2_uc010qcn.1_Missense_Mutation_p.P126S|CACNB2_uc010qco.1_Missense_Mutation_p.P126S|CACNB2_uc001iqa.2_Missense_Mutation_p.P126S	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2	174	SH3.				axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CGGATTCATTCCAAGCCCAGT	0.408													12	111	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26559634	26559634	+	Silent	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26559634C>G	uc001isp.2	+	10	1544	c.1041C>G	c.(1039-1041)CTC>CTG	p.L347L	GAD2_uc001isq.2_Silent_p.L347L	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	347					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	TTGACCCCCTCTTAGCTGTCG	0.488													32	311	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37436287	37436287	+	Intron	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37436287A>G	uc001iza.1	+							NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TATTGATACTACTTTTAACAG	0.269													22	62	---	---	---	---	PASS
C10orf71	118461	broad.mit.edu	37	10	50530680	50530680	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50530680C>G	uc010qgp.1	+	3	429	c.90C>G	c.(88-90)AGC>AGG	p.S30R		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	30											0						GGGAGGTGAGCAGCCTAACAG	0.557													10	20	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64946154	64946154	+	Intron	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64946154G>A	uc001jmn.2	-						JMJD1C_uc001jml.2_Intron|JMJD1C_uc001jmm.2_Intron|JMJD1C_uc010qiq.1_Intron|JMJD1C_uc009xpi.2_Intron|JMJD1C_uc009xpj.1_Intron|JMJD1C_uc001jmo.2_Intron	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					CTTATAAATAGATAAATAAAT	0.234													13	91	---	---	---	---	PASS
OIT3	170392	broad.mit.edu	37	10	74684372	74684372	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74684372A>T	uc001jte.1	+	7	1555	c.1337A>T	c.(1336-1338)GAG>GTG	p.E446V	OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	446	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)					AAGATCGACGAGGTCCTGAAA	0.557													7	38	---	---	---	---	PASS
SYNPO2L	79933	broad.mit.edu	37	10	75410749	75410749	+	Intron	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75410749G>T	uc001jut.3	-						SYNPO2L_uc001jus.3_Missense_Mutation_p.P6H	NM_001114133	NP_001107605	Q9H987	SYP2L_HUMAN	synaptopodin 2-like isoform a							cytoplasm|cytoskeleton	actin binding			ovary(1)	1	Prostate(51;0.0112)					TTGGCTGATGGGCTCAAAGGT	0.567													23	88	---	---	---	---	PASS
DYDC2	84332	broad.mit.edu	37	10	82122201	82122201	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82122201T>A	uc001kca.1	+	3	382	c.2T>A	c.(1-3)ATG>AAG	p.M1K	DYDC2_uc001kbz.1_RNA|DYDC2_uc001kcb.1_Missense_Mutation_p.M1K	NM_032372	NP_115748	Q96IM9	DYDC2_HUMAN	DPY30 domain containing 2	1							protein binding				0			Colorectal(32;0.229)			GCTGCCAGGATGGAAACTAAC	0.423													23	105	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	83635523	83635523	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83635523G>A	uc001kco.2	+	1	454	c.427G>A	c.(427-429)GGG>AGG	p.G143R	NRG3_uc010qlz.1_Missense_Mutation_p.G143R|NRG3_uc001kcp.2_5'Flank|NRG3_uc001kcq.2_5'Flank	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	143	Ser/Thr-rich.|Extracellular (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		cccctccgccGGGGGTGCCGC	0.527													4	15	---	---	---	---	PASS
CYP2C18	1562	broad.mit.edu	37	10	96447970	96447970	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96447970C>T	uc001kjv.3	+	3	746	c.420C>T	c.(418-420)AGC>AGT	p.S140S	CYP2C18_uc001kjw.3_Silent_p.S140S|CYP2C19_uc009xus.1_Silent_p.S5S|CYP2C19_uc010qny.1_5'UTR	NM_000772	NP_000763	P33260	CP2CI_HUMAN	cytochrome P450 family 2 subfamily C polypeptide	140					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(3)|lung(1)|skin(1)	5		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)		GGAAGAGGAGCATCGAGGACC	0.468													24	101	---	---	---	---	PASS
HABP2	3026	broad.mit.edu	37	10	115338382	115338382	+	Intron	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115338382G>T	uc001lai.3	+						HABP2_uc010qrz.1_Intron|HABP2_uc010qry.1_Intron	NM_004132	NP_004123	Q14520	HABP2_HUMAN	hyaluronan binding protein 2 preproprotein						cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)		CTGCTCTCTCGGAGGTTCTGA	0.512													20	109	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118220583	118220583	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118220583T>A	uc001lcl.3	+	6	772	c.671T>A	c.(670-672)ATC>AAC	p.I224N		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	224					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		GCAGCTCGCATCCTCTTTGAG	0.418													41	184	---	---	---	---	PASS
PDZD8	118987	broad.mit.edu	37	10	119043529	119043529	+	Silent	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119043529A>T	uc001lde.1	-	5	2914	c.2715T>A	c.(2713-2715)CTT>CTA	p.L905L		NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	905					intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)		CTTCCAGCCTAAGGTTTTTCA	0.433													33	102	---	---	---	---	PASS
FAM175B	23172	broad.mit.edu	37	10	126505162	126505162	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126505162C>T	uc001lib.3	+	3	226	c.181C>T	c.(181-183)CCT>TCT	p.P61S		NM_032182	NP_115558	Q15018	F175B_HUMAN	hypothetical protein LOC23172	61	MPN-like.					BRISC complex	polyubiquitin binding				0						TAACCATCAGCCTTGTTCAAA	0.303													12	122	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127422226	127422226	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127422226G>A	uc001liq.1	+	11	1592	c.1299G>A	c.(1297-1299)AAG>AAA	p.K433K	C10orf137_uc001lin.2_Silent_p.K399K|C10orf137_uc001lio.1_Silent_p.K399K|C10orf137_uc001lip.1_Silent_p.K137K|C10orf137_uc001lir.2_5'Flank	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	433					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATATAGTGAAGCTCTATGACC	0.373													35	136	---	---	---	---	PASS
TCERG1L	256536	broad.mit.edu	37	10	132891470	132891470	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132891470C>G	uc001lkp.2	-	12	1802	c.1716G>C	c.(1714-1716)AAG>AAC	p.K572N		NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	572										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TGTCCCGTTTCTTAAGAATAA	0.468													3	119	---	---	---	---	PASS
PHRF1	57661	broad.mit.edu	37	11	608828	608828	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:608828C>T	uc001lqe.2	+	14	3503	c.3372C>T	c.(3370-3372)TCC>TCT	p.S1124S	PHRF1_uc010qwc.1_Silent_p.S1123S|PHRF1_uc010qwd.1_Silent_p.S1122S|PHRF1_uc010qwe.1_Silent_p.S1120S|PHRF1_uc009ybz.1_Silent_p.S914S|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1124	Arg-rich.						RNA polymerase binding|zinc ion binding				0						GGGAGTGCTCCCCCACCAGCA	0.632													5	18	---	---	---	---	PASS
OR52N2	390077	broad.mit.edu	37	11	5841740	5841740	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5841740C>G	uc010qzp.1	+	1	175	c.175C>G	c.(175-177)CGG>GGG	p.R59G	TRIM5_uc001mbq.1_Intron	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N,	59	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.H53_F64del(1)		ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCCTGCACCGGCCCATGTA	0.522													50	107	---	---	---	---	PASS
OR2AG2	338755	broad.mit.edu	37	11	6789994	6789994	+	Missense_Mutation	SNP	C	A	A	rs148881109	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6789994C>A	uc001meq.1	-	1	195	c.195G>T	c.(193-195)CAG>CAT	p.Q65H		NM_001004490	NP_001004490	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGAGAGAGAGCTGCCCAAGCA	0.547													38	107	---	---	---	---	PASS
ZNF214	7761	broad.mit.edu	37	11	7022255	7022255	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7022255C>A	uc001mfa.2	-	3	962	c.659G>T	c.(658-660)GGA>GTA	p.G220V	ZNF214_uc010ray.1_Missense_Mutation_p.G220V|ZNF214_uc009yfh.1_Missense_Mutation_p.G220V	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN	zinc finger protein 214	220					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TTTATTACATCCACAGTACTT	0.398													65	132	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26677763	26677763	+	Intron	SNP	T	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26677763T>G	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTACTTATAATAGTTATCTTT	0.393													45	96	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30034013	30034013	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30034013A>T	uc001msk.2	-	2	1365	c.213T>A	c.(211-213)TGT>TGA	p.C71*		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	71						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CATGGGAGGTACAGGCCCCGC	0.647													21	43	---	---	---	---	PASS
SLC1A2	6506	broad.mit.edu	37	11	35313935	35313935	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35313935G>A	uc001mwd.2	-	7	1582	c.990C>T	c.(988-990)ATC>ATT	p.I330I	SLC1A2_uc001mwe.2_Silent_p.I321I|SLC1A2_uc010rev.1_Silent_p.I330I	NM_004171	NP_004162	P43004	EAA2_HUMAN	excitatory amino acid transporter 2	330	Helical; (Potential).				D-aspartate import|L-glutamate import|synaptic transmission	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|central_nervous_system(1)	3	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)		L-Glutamic Acid(DB00142)	AGGGGAGAAAGATGCCCCCGT	0.483													25	150	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43411364	43411364	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43411364G>A	uc001mxi.2	+	3	426	c.412G>A	c.(412-414)GAC>AAC	p.D138N	TTC17_uc001mxh.2_Missense_Mutation_p.D138N|TTC17_uc010rfj.1_Missense_Mutation_p.D81N	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	138							binding			ovary(5)	5						GGAGAGCAAAGACATCAGGTA	0.363													41	92	---	---	---	---	PASS
ACCS	84680	broad.mit.edu	37	11	44102761	44102761	+	Silent	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44102761G>C	uc009yks.1	+	12	1146	c.1002G>C	c.(1000-1002)ACG>ACC	p.T334T	EXT2_uc010rfo.1_Intron|ACCS_uc001mxx.2_Silent_p.T334T	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase	334							1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						GCTTTGGCACGCTGTACACAG	0.622													26	73	---	---	---	---	PASS
PRDM11	56981	broad.mit.edu	37	11	45246232	45246232	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45246232C>G	uc001myo.2	+	8	1558	c.1309C>G	c.(1309-1311)CAT>GAT	p.H437D		NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11	437										upper_aerodigestive_tract(1)	1						ATCTGACCCTCATGAACTTCC	0.527													62	352	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55111022	55111022	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55111022A>T	uc010rie.1	+	1	346	c.346A>T	c.(346-348)ATG>TTG	p.M116L		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						TTTGGTGGTGATGGCCTATGA	0.463													104	357	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433006	55433006	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433006G>T	uc001nht.3	+	3	629	c.364G>T	c.(364-366)GTG>TTG	p.V122L	OR4C6_uc010rik.1_Missense_Mutation_p.V122L	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TGACCGCTACGTGGCCATCTG	0.547													51	170	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861452	55861452	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861452C>A	uc010rix.1	+	1	669	c.669C>A	c.(667-669)GCC>GCA	p.A223A		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	223	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					TCATCTCAGCCATCCTGAGGA	0.468													61	187	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	56000216	56000216	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56000216G>T	uc010rjc.1	-	1	446	c.446C>A	c.(445-447)ACA>AAA	p.T149K		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	149	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					AAAGCATTCTGTGGTTCCAAA	0.413													70	242	---	---	---	---	PASS
OR9I1	219954	broad.mit.edu	37	11	57886014	57886014	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57886014G>A	uc001nml.1	-	1	903	c.903C>T	c.(901-903)TTC>TTT	p.F301F	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	301	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				CGACCTTTCTGAAGGCGTCTT	0.428													46	357	---	---	---	---	PASS
OR9I1	219954	broad.mit.edu	37	11	57886577	57886577	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57886577G>C	uc001nml.1	-	1	340	c.340C>G	c.(340-342)CTG>GTG	p.L114V	OR9Q1_uc001nmj.2_Intron	NM_001005211	NP_001005211	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I,	114	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Breast(21;0.0589)				ACTGCCAGCAGAAAGCACTCT	0.552													8	65	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57958547	57958547	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57958547G>T	uc010rka.1	+	1	585	c.585G>T	c.(583-585)CAG>CAT	p.Q195H		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	195	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				GCTACACTCAGGAAGTGGTGA	0.453													45	122	---	---	---	---	PASS
OR9Q2	219957	broad.mit.edu	37	11	57958548	57958548	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57958548G>T	uc010rka.1	+	1	586	c.586G>T	c.(586-588)GAA>TAA	p.E196*		NM_001005283	NP_001005283	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)|central_nervous_system(1)	4		Breast(21;0.0589)				CTACACTCAGGAAGTGGTGAT	0.448													45	122	---	---	---	---	PASS
OR10W1	81341	broad.mit.edu	37	11	58034403	58034403	+	3'UTR	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58034403C>T	uc001nmq.1	-	1						NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				AGGCTGTCCCCTCGTCTTTCC	0.453													37	162	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58207079	58207079	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207079G>A	uc010rkh.1	-	1	546	c.546C>T	c.(544-546)CTC>CTT	p.L182L		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGAGAGTCAAGAGAGGAGGAG	0.413													13	99	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58207084	58207084	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207084G>A	uc010rkh.1	-	1	541	c.541C>T	c.(541-543)CCT>TCT	p.P181S		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTCAAGAGAGGAGGAGCATCA	0.408													13	100	---	---	---	---	PASS
PRPF19	27339	broad.mit.edu	37	11	60671174	60671174	+	Intron	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60671174C>G	uc001nqf.2	-							NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN	PRP19/PSO4 pre-mRNA processing factor 19						DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						CTAAGGCAGCCAATAGGCACC	0.552													25	85	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61067638	61067638	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61067638C>A	uc001nrc.3	-	27	3619	c.3393G>T	c.(3391-3393)AAG>AAT	p.K1131N		NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	1131	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						CCTCCACAACCTTGATGAGGT	0.602								NER					13	46	---	---	---	---	PASS
DAGLA	747	broad.mit.edu	37	11	61503805	61503805	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61503805G>T	uc001nsa.2	+	13	1465	c.1354G>T	c.(1354-1356)GCC>TCC	p.A452S		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	452	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		CCTGTCCCAGGCCTTTGGGCG	0.572													23	67	---	---	---	---	PASS
RTN3	10313	broad.mit.edu	37	11	63487075	63487075	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63487075G>A	uc001nxq.2	+	3	1288	c.1101G>A	c.(1099-1101)ATG>ATA	p.M367I	RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Missense_Mutation_p.M348I|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Missense_Mutation_p.M255I|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	367					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						GACTTGACATGAGTGAATATA	0.373													7	130	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83585513	83585513	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83585513G>T	uc001paj.2	-	11	1503	c.1200C>A	c.(1198-1200)ACC>ACA	p.T400T	DLG2_uc001pai.2_Silent_p.T297T|DLG2_uc010rsy.1_Silent_p.T367T|DLG2_uc010rsz.1_Silent_p.T400T|DLG2_uc010rta.1_Silent_p.T400T|DLG2_uc001pak.2_Silent_p.T505T|DLG2_uc010rtb.1_Silent_p.T367T|DLG2_uc001pal.1_Silent_p.T400T|DLG2_uc001pam.1_Silent_p.T439T	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	400						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GACGAGTTGCGGTGCTATGTT	0.338													18	57	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93800830	93800830	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93800830T>A	uc001pep.2	+	5	1134	c.977T>A	c.(976-978)TTC>TAC	p.F326Y	uc001pen.1_RNA	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	326	Plastocyanin-like 2.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GTCAACCTGTTCCCAGCCACC	0.453													24	224	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93844934	93844934	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93844934C>A	uc001pep.2	+	20	3511	c.3354C>A	c.(3352-3354)ATC>ATA	p.I1118I	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	1118	Helical; (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CCTTGGTCATCCTTTTCATCA	0.478													22	188	---	---	---	---	PASS
RNF26	79102	broad.mit.edu	37	11	119206154	119206154	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119206154G>C	uc001pwh.2	+	1	918	c.322G>C	c.(322-324)GCA>CCA	p.A108P		NM_032015	NP_114404	Q9BY78	RNF26_HUMAN	ring finger protein 26	108	Leu-rich.						zinc ion binding			ovary(1)	1		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		CTCTCATGGGGCACTGCGGAG	0.602													26	189	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124757085	124757085	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124757085G>T	uc001qbg.2	-	15	2363	c.2223C>A	c.(2221-2223)CCC>CCA	p.P741P	ROBO4_uc010sas.1_Silent_p.P596P|ROBO4_uc001qbh.2_Silent_p.P631P|ROBO4_uc001qbi.2_Silent_p.P299P	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	741	Pro/Ser-rich.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GGATGGAGGAGGGAGCCTGTG	0.642													19	106	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124757306	124757306	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124757306G>A	uc001qbg.2	-	14	2286	c.2146C>T	c.(2146-2148)CCA>TCA	p.P716S	ROBO4_uc010sas.1_Missense_Mutation_p.P571S|ROBO4_uc001qbh.2_Missense_Mutation_p.P606S|ROBO4_uc001qbi.2_Missense_Mutation_p.P274S	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	716	Pro/Ser-rich.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		AGGGGTGCTGGAGGGAGATGA	0.607													13	107	---	---	---	---	PASS
PRMT8	56341	broad.mit.edu	37	12	3649958	3649958	+	Splice_Site	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3649958G>A	uc001qmf.2	+	2	628	c.261_splice	c.e2+1	p.E87_splice	PRMT8_uc009zed.2_Splice_Site_p.E78_splice|PRMT8_uc009zee.1_Splice_Site	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4						regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			GATCCACGAGGTAAAGTGTCC	0.527													55	221	---	---	---	---	PASS
ACSM4	341392	broad.mit.edu	37	12	7476890	7476890	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7476890G>T	uc001qsx.1	+	10	1330	c.1330G>T	c.(1330-1332)GCC>TCC	p.A444S		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	444					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						GAAAACTGCTGCCACGATAAG	0.448													8	36	---	---	---	---	PASS
DPPA3	359787	broad.mit.edu	37	12	7869565	7869565	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7869565G>A	uc001qtf.2	+	4	450	c.372G>A	c.(370-372)AAG>AAA	p.K124K		NM_199286	NP_954980	Q6W0C5	DPPA3_HUMAN	stella	124						cytoplasm|nucleus					0				Kidney(36;0.0887)		TTTTTCAGAAGGAATCAAGAC	0.378													37	144	---	---	---	---	PASS
CD69	969	broad.mit.edu	37	12	9913424	9913424	+	5'UTR	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9913424C>T	uc001qwk.2	-	1					CD69_uc010sgu.1_5'UTR|CD69_uc010sgv.1_5'UTR	NM_001781	NP_001772	Q07108	CD69_HUMAN	CD69 molecule							integral to plasma membrane	sugar binding|transmembrane receptor activity				0						CATCTTTATTCTCAAGATTCC	0.428													29	178	---	---	---	---	PASS
CLEC12A	160364	broad.mit.edu	37	12	10133281	10133281	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10133281C>A	uc001qwr.3	+	4	668	c.480C>A	c.(478-480)GCC>GCA	p.A160A	CLEC12A_uc001qwq.2_Silent_p.A170A|CLEC12A_uc001qws.3_Silent_p.A127A|CLEC12A_uc001qwt.2_Silent_p.A89A	NM_138337	NP_612210	Q5QGZ9	CL12A_HUMAN	myeloid inhibitory C-type lectin-like receptor	160	Extracellular (Potential).|C-type lectin.					integral to membrane|plasma membrane	receptor activity|sugar binding	p.A160T(1)		skin(1)	1						GTAAAATGGCCTGTGCTGCTC	0.448													41	107	---	---	---	---	PASS
CSDA	8531	broad.mit.edu	37	12	10854608	10854608	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10854608T>A	uc001qyt.2	-	8	1247	c.1004A>T	c.(1003-1005)TAC>TTC	p.Y335F	CSDA_uc001qyu.2_Missense_Mutation_p.Y266F	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a	335					negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					GCGACGCCGGTAATTGTAGGG	0.542													82	256	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13906731	13906731	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13906731G>A	uc001rbt.2	-	3	709	c.530C>T	c.(529-531)CCT>CTT	p.P177L		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	177	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CTGGTAGCCAGGGAAATAGGT	0.478													53	141	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19408041	19408041	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19408041C>A	uc001reb.2	+	5	460	c.374C>A	c.(373-375)GCT>GAT	p.A125D	PLEKHA5_uc010sie.1_Missense_Mutation_p.A125D|PLEKHA5_uc001rea.2_Missense_Mutation_p.A125D|PLEKHA5_uc009zin.2_5'UTR|PLEKHA5_uc010sif.1_Missense_Mutation_p.A17D|PLEKHA5_uc010sig.1_Missense_Mutation_p.A17D|PLEKHA5_uc010sih.1_Missense_Mutation_p.A17D	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	125							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					ATAAATGAAGCTTCTAACTAT	0.348													4	174	---	---	---	---	PASS
LDHB	3945	broad.mit.edu	37	12	21788641	21788641	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21788641C>A	uc001rfc.2	-	7	858	c.840G>T	c.(838-840)GGG>GGT	p.G280G	LDHB_uc001rfd.2_Silent_p.G280G|LDHB_uc001rfe.2_Silent_p.G280G	NM_002300	NP_002291	P07195	LDHB_HUMAN	L-lactate dehydrogenase B	280					glycolysis|pyruvate metabolic process	cytosol	L-lactate dehydrogenase activity			breast(2)|ovary(1)	3					NADH(DB00157)	TGCCATACATCCCCTGCCAGA	0.348													24	88	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40760848	40760848	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40760848G>T	uc001rmg.3	+	50	7552	c.7431G>T	c.(7429-7431)CGG>CGT	p.R2477R	LRRK2_uc009zjw.2_Silent_p.R1315R|LRRK2_uc001rmi.2_3'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2477					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GCTACAACCGGAAAAATACTG	0.328													16	83	---	---	---	---	PASS
ACVR1B	91	broad.mit.edu	37	12	52380679	52380679	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52380679C>T	uc001rzn.2	+	7	1256	c.1214C>T	c.(1213-1215)GCC>GTC	p.A405V	ACVR1B_uc001rzl.2_Missense_Mutation_p.A405V|ACVR1B_uc001rzm.2_Missense_Mutation_p.A405V|ACVR1B_uc010snn.1_Missense_Mutation_p.A446V	NM_004302	NP_004293	P36896	ACV1B_HUMAN	activin A receptor, type IB isoform a precursor	405	Protein kinase.|Cytoplasmic (Potential).				G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GATATTTATGCCCTCGGGCTT	0.418													5	251	---	---	---	---	PASS
NR4A1	3164	broad.mit.edu	37	12	52451220	52451220	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52451220G>A	uc001rzs.2	+	7	1760	c.1446G>A	c.(1444-1446)TGG>TGA	p.W482*	NR4A1_uc010sno.1_Nonsense_Mutation_p.W495*|NR4A1_uc001rzt.2_Nonsense_Mutation_p.W482*|NR4A1_uc009zmc.2_Missense_Mutation_p.G96E	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	482					nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		TCGGGGACTGGATTGACAGTA	0.612													16	68	---	---	---	---	PASS
KRT1	3848	broad.mit.edu	37	12	53070088	53070088	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53070088G>A	uc001sau.1	-	7	1505	c.1446C>T	c.(1444-1446)TAC>TAT	p.Y482Y	KRT1_uc001sav.1_Silent_p.Y482Y	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	482	Rod.|Coil 2.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)|skin(1)	2						GGAGGGTCCTGTAGGTGGCAA	0.572													12	61	---	---	---	---	PASS
HOXC10	3226	broad.mit.edu	37	12	54379542	54379542	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54379542G>A	uc001sen.2	+	1	597	c.499G>A	c.(499-501)GCC>ACC	p.A167T		NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	167					positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						CTGTTCTGGGGCCAACGACTT	0.657													7	55	---	---	---	---	PASS
HOXC10	3226	broad.mit.edu	37	12	54379543	54379543	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54379543C>A	uc001sen.2	+	1	598	c.500C>A	c.(499-501)GCC>GAC	p.A167D		NM_017409	NP_059105	Q9NYD6	HXC10_HUMAN	homeobox C10	167					positive regulation of cell proliferation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1						TGTTCTGGGGCCAACGACTTC	0.657													6	55	---	---	---	---	PASS
HSD17B6	8630	broad.mit.edu	37	12	57167625	57167625	+	Translation_Start_Site	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57167625A>T	uc001smg.1	+	2	99	c.-11A>T	c.(-13--9)GAAGC>GATGC			NM_003725	NP_003716	O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6						androgen biosynthetic process|androgen catabolic process	early endosome membrane|endoplasmic reticulum|microsome	binding|electron carrier activity|estradiol 17-beta-dehydrogenase activity|retinol dehydrogenase activity|testosterone 17-beta-dehydrogenase (NAD+) activity			upper_aerodigestive_tract(1)|pancreas(1)	2					Succinic acid(DB00139)	AAGAGAAGGAAGCACCCTCAC	0.363													24	71	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72962382	72962382	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72962382G>C	uc001sxa.2	+	10	1972	c.1942G>C	c.(1942-1944)GGA>CGA	p.G648R		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	648	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TATTGTGGTAGGAAATAGAAG	0.318													23	121	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73056875	73056875	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73056875C>T	uc001sxa.2	+	19	3005	c.2975C>T	c.(2974-2976)TCT>TTT	p.S992F		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	992	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GCTGCTGCTTCTTTCTCACGA	0.408													32	97	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78515828	78515828	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78515828C>A	uc001syp.2	+	16	4031	c.3858C>A	c.(3856-3858)GGC>GGA	p.G1286G	NAV3_uc001syo.2_Silent_p.G1286G|NAV3_uc010sub.1_Silent_p.G786G|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1286	Ser-rich.					nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CGCGGCAAGGCAGTCTGGAGT	0.562										HNSCC(70;0.22)			18	91	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80645556	80645556	+	IGR	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80645556G>T								PPP1R12A (316321 upstream) : PTPRQ (192570 downstream)																							ATTCAAGACTGGAGAGATGAC	0.418													3	18	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80645557	80645557	+	IGR	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80645557G>T								PPP1R12A (316322 upstream) : PTPRQ (192569 downstream)																							TTCAAGACTGGAGAGATGACT	0.413													3	17	---	---	---	---	PASS
CDK17	5128	broad.mit.edu	37	12	96683066	96683066	+	Splice_Site	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96683066C>A	uc001tep.1	-	11	1487	c.998_splice	c.e11-1	p.G333_splice	CDK17_uc009ztk.2_Splice_Site_p.G333_splice|CDK17_uc010svb.1_Splice_Site_p.G280_splice	NM_002595	NP_002586	Q00537	CDK17_HUMAN	PCTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity			ovary(3)|lung(2)|kidney(1)|central_nervous_system(1)	7						CGGGCTAGTCCTTCATAGGGA	0.448													4	160	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99222964	99222964	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99222964C>A	uc001tge.1	-	19	3471	c.3054G>T	c.(3052-3054)AGG>AGT	p.R1018S	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Missense_Mutation_p.R315S|ANKS1B_uc010svd.1_Missense_Mutation_p.R24S|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc009ztq.2_5'UTR|ANKS1B_uc010sve.1_Missense_Mutation_p.R24S|ANKS1B_uc001tgh.3_Missense_Mutation_p.R24S|ANKS1B_uc001tgi.2_Missense_Mutation_p.R244S|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Missense_Mutation_p.R24S|ANKS1B_uc010svf.1_Missense_Mutation_p.R24S|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Missense_Mutation_p.R244S	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	1018						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GAGCCATCTGCCTCTCCAGTT	0.418													72	360	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102067297	102067297	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102067297C>A	uc001tii.2	+	24	2787	c.2685C>A	c.(2683-2685)ATC>ATA	p.I895I	MYBPC1_uc001tig.2_Silent_p.I902I|MYBPC1_uc010svq.1_Silent_p.I864I|MYBPC1_uc001tih.2_Silent_p.I902I|MYBPC1_uc001tij.2_Silent_p.I877I|MYBPC1_uc010svr.1_Silent_p.I877I|MYBPC1_uc010svs.1_Silent_p.I895I|MYBPC1_uc010svt.1_Silent_p.I865I|MYBPC1_uc010svu.1_Silent_p.I858I|MYBPC1_uc001tik.2_Silent_p.I851I|MYBPC1_uc001til.2_5'UTR|MYBPC1_uc001tim.2_5'UTR	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	895	Ig-like C2-type 6.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						CTGATACAATCATATTTATTA	0.383													88	248	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104099407	104099407	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104099407C>T	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						TAATATTTCACAGGGTAATGA	0.433													28	72	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112513519	112513519	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112513519C>G	uc001ttm.2	-	8	759	c.739G>C	c.(739-741)GAG>CAG	p.E247Q	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Missense_Mutation_p.E219Q|NAA25_uc009zwa.1_Missense_Mutation_p.E247Q	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	247						cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						GCATTGCACTCTGGCCACCTG	0.403													3	110	---	---	---	---	PASS
SDSL	113675	broad.mit.edu	37	12	113867083	113867083	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113867083C>T	uc001tvi.2	+	5	543	c.333C>T	c.(331-333)GCC>GCT	p.A111A	SDSL_uc009zwh.2_Silent_p.A111A	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN	serine dehydratase-like	111					cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	GGGAGGGGGCCGAGGTTCAGC	0.627													11	93	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116429528	116429528	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116429528G>A	uc001tvw.2	-	17	3286	c.3231C>T	c.(3229-3231)ACC>ACT	p.T1077T		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1077					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		ATCCTTGATCGGTGCTATCAT	0.602													11	105	---	---	---	---	PASS
CCDC62	84660	broad.mit.edu	37	12	123282703	123282703	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123282703G>A	uc001udc.2	+	8	1078	c.933G>A	c.(931-933)CAG>CAA	p.Q311Q	CCDC62_uc010tah.1_RNA|CCDC62_uc001udf.2_Silent_p.Q311Q|CCDC62_uc001ude.2_Silent_p.Q72Q	NM_201435	NP_958843	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62 isoform b	311	Potential.					cytoplasm|nucleus				ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AATTAATACAGATGTATGACT	0.299													23	59	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130832721	130832721	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130832721A>T	uc001uik.2	+	7	817	c.727A>T	c.(727-729)AGT>TGT	p.S243C	PIWIL1_uc001uij.1_Missense_Mutation_p.S243C	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	243					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TGATATTCCAAGTCACAGGTT	0.328													12	91	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133363343	133363343	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133363343C>A	uc001ukz.1	-	14	3401	c.2842G>T	c.(2842-2844)GCG>TCG	p.A948S	GOLGA3_uc001ula.1_Missense_Mutation_p.A948S|GOLGA3_uc001ulb.2_Missense_Mutation_p.A948S	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	948	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TCTGTGACCGCGACCATCTGC	0.622													31	103	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29608164	29608164	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29608164G>T	uc001usl.3	+	2	2436	c.2378G>T	c.(2377-2379)AGC>ATC	p.S793I		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	783	Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						TCTGCAAAGAGCAGGATTCTG	0.512													8	70	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32722036	32722036	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32722036G>T	uc001utx.2	+	13	1840	c.1344G>T	c.(1342-1344)AGG>AGT	p.R448S	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	448					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGGTACCAAGGGACATGCCTC	0.468													28	116	---	---	---	---	PASS
NUFIP1	26747	broad.mit.edu	37	13	45533569	45533569	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45533569C>G	uc001uzp.2	-	7	1010	c.968G>C	c.(967-969)GGT>GCT	p.G323A		NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein	323					box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		CTCCGGTGGACCTTCTAGCTT	0.403													37	187	---	---	---	---	PASS
DACH1	1602	broad.mit.edu	37	13	72204792	72204792	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72204792G>A	uc010thn.1	-	4	1445	c.1022C>T	c.(1021-1023)GCA>GTA	p.A341V	DACH1_uc010tho.1_Missense_Mutation_p.A341V|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	341	Interaction with SIX6 and HDAC3 (By similarity).				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CACCTTCATTGCTTcagcaat	0.259													17	233	---	---	---	---	PASS
KLF5	688	broad.mit.edu	37	13	73636282	73636282	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73636282C>T	uc001vje.2	+	2	869	c.545C>T	c.(544-546)CCG>CTG	p.P182L	KLF5_uc001vjd.2_Missense_Mutation_p.P91L	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5	182					transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		CCTCCGGCCCCGACCCAGGCC	0.527													28	118	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88329495	88329495	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88329495G>A	uc001vln.2	+	2	2071	c.1852G>A	c.(1852-1854)GTA>ATA	p.V618I	SLITRK5_uc010tic.1_Missense_Mutation_p.V377I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	618	Extracellular (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					CTATTCAGATGTAGTAGTTTC	0.597													21	179	---	---	---	---	PASS
FGF14	2259	broad.mit.edu	37	13	102527548	102527548	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102527548T>A	uc001vpe.2	-	2	292	c.292A>T	c.(292-294)AGC>TGC	p.S98C	FGF14_uc001vpf.2_Missense_Mutation_p.S103C	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A	98					cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GAATTAGTGCTGTCATCCTTG	0.433													10	76	---	---	---	---	PASS
EFNB2	1948	broad.mit.edu	37	13	107187250	107187250	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107187250T>C	uc001vqi.2	-	1	88	c.63A>G	c.(61-63)AGA>AGG	p.R21R		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	21					cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AAATCGCAGTTCTGCATAAAA	0.493													6	47	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249325	20249325	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249325C>T	uc010tku.1	+	1	844	c.844C>T	c.(844-846)CCT>TCT	p.P282S		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	282	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGTAATATTCCCTTTACTTAA	0.383													29	204	---	---	---	---	PASS
OR4K17	390436	broad.mit.edu	37	14	20586279	20586279	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20586279C>T	uc001vwo.1	+	1	714	c.714C>T	c.(712-714)TCC>TCT	p.S238S		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	210	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GCATAATCTCCCTGAGCTGTT	0.408													99	341	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23866269	23866269	+	Missense_Mutation	SNP	C	A	A	rs148915045	byFrequency	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23866269C>A	uc001wjv.2	-	18	2138	c.2071G>T	c.(2071-2073)GTC>TTC	p.V691F		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	691	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TGGTGCATGACCAGGGGGTTG	0.612													28	103	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23866270	23866270	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23866270C>A	uc001wjv.2	-	18	2137	c.2070G>T	c.(2068-2070)CTG>CTT	p.L690L		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	690	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGTGCATGACCAGGGGGTTGT	0.612													28	107	---	---	---	---	PASS
FAM158A	51016	broad.mit.edu	37	14	24610496	24610496	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24610496G>A	uc001wmi.2	-	2	181	c.18C>T	c.(16-18)ATC>ATT	p.I6I		NM_016049	NP_057133	Q9Y3B6	F158A_HUMAN	hypothetical protein LOC51016	6											0						CCAGGGCCGAGATCTCCACCT	0.652											OREG0022618	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	84	---	---	---	---	PASS
FOXG1	2290	broad.mit.edu	37	14	29237890	29237890	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29237890G>T	uc001wqe.2	+	1	1604	c.1405G>T	c.(1405-1407)GGG>TGG	p.G469W		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	469					axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GGGACTGTCTGGGGGACTGTC	0.532													46	161	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63269063	63269063	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63269063C>A	uc001xfx.2	-	9	1857	c.1806G>T	c.(1804-1806)GAG>GAT	p.E602D	KCNH5_uc001xfy.2_Missense_Mutation_p.E602D|KCNH5_uc001xfz.1_Missense_Mutation_p.E544D	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	602	cNMP.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TAGCCACCACCTCATCATCCT	0.423													4	145	---	---	---	---	PASS
GALNTL1	57452	broad.mit.edu	37	14	69798220	69798220	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69798220A>T	uc010aqu.1	+	7	823	c.730A>T	c.(730-732)AGT>TGT	p.S244C	GALNTL1_uc001xla.1_Missense_Mutation_p.S244C|GALNTL1_uc001xlb.1_Missense_Mutation_p.S244C	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	244	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		TGATGTCATCAGTCTGGATAA	0.542													113	322	---	---	---	---	PASS
DPF3	8110	broad.mit.edu	37	14	73220073	73220073	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73220073G>T	uc001xnc.2	-	3	213	c.200C>A	c.(199-201)GCC>GAC	p.A67D	DPF3_uc001xnf.2_RNA|DPF3_uc010ari.1_Missense_Mutation_p.A67D|DPF3_uc010ttq.1_Missense_Mutation_p.A77D	NM_012074	NP_036206	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	67					chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CTGGCCCGGGGCAAGGCCTGT	0.383													9	26	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96768355	96768355	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96768355T>A	uc001yfi.2	-	34	5493	c.5128A>T	c.(5128-5130)AAT>TAT	p.N1710Y		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1710										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TGGTCAATATTGAGGCGGAGC	0.453													17	49	---	---	---	---	PASS
C14orf177	283598	broad.mit.edu	37	14	99183499	99183499	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99183499C>T	uc001yfz.1	+	4	685	c.266C>T	c.(265-267)CCA>CTA	p.P89L		NM_182560	NP_872366	Q52M58	CN177_HUMAN	hypothetical protein LOC283598	89											0		Melanoma(154;0.128)				GAAACTTCTCCAGGGTCATGT	0.438													33	133	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105412132	105412132	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105412132C>G	uc010axc.1	-	7	9776	c.9656G>C	c.(9655-9657)GGA>GCA	p.G3219A	AHNAK2_uc001ypx.2_Missense_Mutation_p.G3119A	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3219						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGGCCAGCTCCCTCGAGAAC	0.597													4	168	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25453289	25453289	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25453289C>T	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_Intron|SNORD115-22_uc001yzr.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AAATCATGCTCAATAGGATTA	0.527													40	302	---	---	---	---	PASS
SNORD115-20	100033460	broad.mit.edu	37	15	25474130	25474130	+	Intron	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25474130C>A	uc001yzq.1	+						SNORD115-26_uc001yzw.1_Intron|SNORD115-32_uc001zaa.1_RNA|SNORD115-33_uc001zab.1_5'Flank	NR_003313				Homo sapiens small nucleolar RNA, C/D box 115-15 (SNORD115-15), non-coding RNA.												0						ATGATGAGAACCTGATATTGC	0.498													70	240	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28501024	28501024	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28501024C>T	uc001zbj.2	-	19	2971	c.2865G>A	c.(2863-2865)GAG>GAA	p.E955E	HERC2_uc001zbl.1_Silent_p.E650E	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	955	Potential.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATACCTGGATCTCTGCAGTAA	0.488													29	67	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28501025	28501025	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28501025T>C	uc001zbj.2	-	19	2970	c.2864A>G	c.(2863-2865)GAG>GGG	p.E955G	HERC2_uc001zbl.1_Missense_Mutation_p.E650G	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	955	Potential.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TACCTGGATCTCTGCAGTAAT	0.483													28	65	---	---	---	---	PASS
ZNF770	54989	broad.mit.edu	37	15	35273851	35273851	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35273851G>A	uc001ziw.2	-	3	2096	c.1785C>T	c.(1783-1785)CCC>CCT	p.P595P		NM_014106	NP_054825	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	595					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		TAGGAAGACAGGGTTGCCCGG	0.443													49	292	---	---	---	---	PASS
TTBK2	146057	broad.mit.edu	37	15	43067484	43067484	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43067484A>G	uc001zqo.2	-	13	2286	c.1847T>C	c.(1846-1848)GTG>GCG	p.V616A	TTBK2_uc010bcy.2_Missense_Mutation_p.V547A	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	616					cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		TGCTAAGACCACACCTGAGGT	0.468													34	265	---	---	---	---	PASS
CCNDBP1	23582	broad.mit.edu	37	15	43484984	43484984	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43484984C>T	uc001zqv.2	+	9	1135	c.904C>T	c.(904-906)CTG>TTG	p.L302L	CCNDBP1_uc001zqu.2_Silent_p.L174L|CCNDBP1_uc010bdc.2_Silent_p.L302L|CCNDBP1_uc010bdb.2_Silent_p.L174L|CCNDBP1_uc010udl.1_Silent_p.L141L|CCNDBP1_uc001zqw.2_RNA|CCNDBP1_uc001zqx.2_Silent_p.L174L|CCNDBP1_uc010bdd.2_Silent_p.L174L|CCNDBP1_uc001zqy.2_Silent_p.L174L	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1	302	Interaction with TCF3.|Interaction with RPLP0.				cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		TATGTGTCACCTGACCGTGCG	0.398													23	171	---	---	---	---	PASS
PPIP5K1	9677	broad.mit.edu	37	15	43827232	43827232	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43827232G>C	uc001zrw.2	-	31	4125	c.3942C>G	c.(3940-3942)AGC>AGG	p.S1314R	PPIP5K1_uc001zrx.1_Missense_Mutation_p.S1287R|PPIP5K1_uc001zru.2_Missense_Mutation_p.S1289R|PPIP5K1_uc001zry.3_Missense_Mutation_p.S1289R|PPIP5K1_uc001zrv.2_Missense_Mutation_p.S1075R	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	1314					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						GGCACAGTTGGCTGGACTTCT	0.567													51	153	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48782253	48782253	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48782253G>C	uc001zwx.1	-	25	3205	c.2877C>G	c.(2875-2877)TTC>TTG	p.F959L		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	959	TB 5.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CGTACCTCAGGAAGCAGGTTT	0.587													14	62	---	---	---	---	PASS
USP8	9101	broad.mit.edu	37	15	50733609	50733609	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50733609G>A	uc001zym.3	+	4	668	c.168G>A	c.(166-168)GAG>GAA	p.E56E	USP8_uc001zyk.1_5'UTR|USP8_uc001zyl.3_Silent_p.E56E|USP8_uc001zyn.3_Silent_p.E56E|USP8_uc010ufh.1_Intron|USP8_uc010bev.1_5'UTR	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8	56	MIT.				cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		ATCGTGATGAGGAAAGGGCCT	0.323													26	84	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53815464	53815464	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53815464G>C	uc002acj.2	-	19	3246	c.3204C>G	c.(3202-3204)GAC>GAG	p.D1068E	WDR72_uc010bfh.1_RNA	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	1068										lung(1)|skin(1)	2				all cancers(107;0.0511)		TGTCCTCCACGTCTTGGAAGT	0.363													42	366	---	---	---	---	PASS
NOX5	79400	broad.mit.edu	37	15	69323869	69323869	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69323869C>T	uc002ars.1	+	4	357	c.337C>T	c.(337-339)CAG>TAG	p.Q113*	NOX5_uc002arp.1_Nonsense_Mutation_p.Q95*|NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002arr.1_Intron|NOX5_uc010bie.1_5'UTR|NOX5_uc010bif.1_5'Flank	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	113	Cytoplasmic (Potential).|EF-hand 3; atypical; contains an insert of 28 residues.|N-terminal regulatory region; interacts with the C-terminal catalytic region in a calcium-dependent manner.				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						GTGTGCACGGCAGGGGGCGTC	0.607													4	53	---	---	---	---	PASS
THAP10	56906	broad.mit.edu	37	15	71184338	71184338	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71184338C>A	uc002asv.2	-	1	416	c.274G>T	c.(274-276)GTG>TTG	p.V92L	LRRC49_uc002asu.2_Intron|LRRC49_uc002asw.2_5'Flank|LRRC49_uc002asx.2_5'Flank|LRRC49_uc010ukf.1_5'Flank	NM_020147	NP_064532	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	92							DNA binding|metal ion binding			ovary(1)|skin(1)	2						GGGGCGGGCACCCGGTGCAGG	0.677													6	18	---	---	---	---	PASS
THAP10	56906	broad.mit.edu	37	15	71184339	71184339	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71184339C>A	uc002asv.2	-	1	415	c.273G>T	c.(271-273)CGG>CGT	p.R91R	LRRC49_uc002asu.2_Intron|LRRC49_uc002asw.2_5'Flank|LRRC49_uc002asx.2_5'Flank|LRRC49_uc010ukf.1_5'Flank	NM_020147	NP_064532	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	91							DNA binding|metal ion binding			ovary(1)|skin(1)	2						GGGCGGGCACCCGGTGCAGGG	0.672													6	18	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72057526	72057526	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72057526C>A	uc002atb.1	+	15	2836	c.2757C>A	c.(2755-2757)ACC>ACA	p.T919T	THSD4_uc002ate.2_Silent_p.T559T|THSD4_uc002atg.1_Silent_p.T122T	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	919	TSP type-1 6.					proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						GGTTTAGCACCGAATGGAGCA	0.552													3	67	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76225439	76225439	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76225439A>G	uc002bbk.2	+	7	1313	c.1208A>G	c.(1207-1209)AAA>AGA	p.K403R	FBXO22_uc002bbl.2_Missense_Mutation_p.K299R|FBXO22OS_uc002bbm.1_RNA	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	403					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						GGGTCATCTAAATAATAATTA	0.318													41	131	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85326498	85326498	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85326498G>C	uc002bld.2	+	4	928	c.592G>C	c.(592-594)GAT>CAT	p.D198H	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	198					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCATATGTTTGATCATTTTTG	0.552													22	174	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85327594	85327594	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85327594A>C	uc002bld.2	+	4	2024	c.1688A>C	c.(1687-1689)AAC>ACC	p.N563T	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	563					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CACAGCTCCAACCCCGTGCCC	0.592													41	121	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89074851	89074851	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89074851G>C	uc002bmr.2	-	2	238	c.86C>G	c.(85-87)TCA>TGA	p.S29*	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Nonsense_Mutation_p.S40*	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	29						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGCCTTGCCTGAACTGATCCG	0.468													4	180	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89382026	89382026	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89382026C>A	uc010upo.1	+	3	577	c.203C>A	c.(202-204)CCA>CAA	p.P68Q	ACAN_uc002bmx.2_Missense_Mutation_p.P68Q|ACAN_uc010upp.1_Missense_Mutation_p.P68Q|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	68					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TCTACCGCCCCACTGGCCCCA	0.632													10	69	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89386799	89386799	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89386799G>T	uc010upo.1	+	6	1345	c.971G>T	c.(970-972)GGC>GTC	p.G324V	ACAN_uc002bmx.2_Missense_Mutation_p.G324V|ACAN_uc010upp.1_Missense_Mutation_p.G324V|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	324					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AACCTCCTGGGCGTGAGGACC	0.687													13	47	---	---	---	---	PASS
PLIN1	5346	broad.mit.edu	37	15	90213330	90213330	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90213330G>T	uc010upx.1	-	5	589	c.479C>A	c.(478-480)ACT>AAT	p.T160N	PLIN1_uc002boh.2_Missense_Mutation_p.T160N	NM_001145311	NP_001138783	O60240	PLIN1_HUMAN	perilipin 1	160					triglyceride catabolic process	lipid particle	lipid binding			central_nervous_system(1)|skin(1)	2						AAATTCCGCAGTGTCTCTGGC	0.632													4	36	---	---	---	---	PASS
RHBDF1	64285	broad.mit.edu	37	16	111894	111894	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:111894C>A	uc002cfl.3	-	11	1258	c.1110G>T	c.(1108-1110)CCG>CCT	p.P370P	RHBDF1_uc010uty.1_Silent_p.P393P|RHBDF1_uc010utz.1_Silent_p.P370P|RHBDF1_uc010bqo.1_RNA	NM_022450	NP_071895	Q96CC6	RHDF1_HUMAN	rhomboid family 1	370	Cytoplasmic (Potential).				cell migration|cell proliferation|negative regulation of protein secretion|protein transport|proteolysis|regulation of epidermal growth factor receptor signaling pathway|regulation of proteasomal protein catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity			ovary(1)|pancreas(1)	2		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				CCAGCCCATACGGCCGCTTCT	0.687													8	12	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4458262	4458262	+	Intron	SNP	A	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4458262A>C	uc002cwh.3	-						CORO7_uc002cwe.2_5'Flank|CORO7_uc002cwf.2_Intron|CORO7_uc002cwg.3_Intron|CORO7_uc010uxh.1_Intron|CORO7_uc010uxi.1_Intron|CORO7_uc002cwi.1_5'Flank|CORO7_uc010uxj.1_Intron|CORO7_uc010btp.1_Intron|CORO7_uc010btr.1_Intron	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						TCTGTGGGAGAGGAATGGCTG	0.557													21	70	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18827849	18827849	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18827849G>A	uc002dfm.2	-	58	10440	c.10077C>T	c.(10075-10077)GAC>GAT	p.D3359D	SMG1_uc010bwb.2_Silent_p.D3219D|SMG1_uc010bwa.2_Silent_p.D2090D	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	3359					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						CAAGACCAGTGTCCTAAATAG	0.388													6	54	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20331589	20331589	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20331589G>A	uc002dgv.2	-	6	945	c.862C>T	c.(862-864)CTG>TTG	p.L288L	GP2_uc002dgw.2_Silent_p.L285L|GP2_uc002dgx.2_Silent_p.L141L|GP2_uc002dgy.2_Silent_p.L138L	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	288	ZP.					anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						CTTACCTCCAGAATGTTCCTG	0.458													17	142	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20634799	20634799	+	3'UTR	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20634799C>T	uc002dhm.1	-	13					ACSM1_uc002dhn.1_RNA|ACSM1_uc010bwg.1_3'UTR	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member						benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						GTTCTGAGTTCACTGCCGATT	0.507													18	94	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21065834	21065834	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21065834C>G	uc010vbe.1	-	28	3946	c.3946G>C	c.(3946-3948)GAT>CAT	p.D1316H		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1316	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GCAATCTGATCATTGCTCTTT	0.532													24	73	---	---	---	---	PASS
PRKCB	5579	broad.mit.edu	37	16	24202448	24202448	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24202448G>C	uc002dmd.2	+	16	1957	c.1760G>C	c.(1759-1761)GGA>GCA	p.G587A	PRKCB_uc002dme.2_Missense_Mutation_p.G587A	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	587	Protein kinase.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)	CTGGGTTGTGGACCTGAAGGC	0.433													38	136	---	---	---	---	PASS
IL21R	50615	broad.mit.edu	37	16	27460372	27460372	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27460372G>C	uc002doq.1	+	9	1618	c.1385G>C	c.(1384-1386)GGA>GCA	p.G462A	IL21R_uc002dor.1_Missense_Mutation_p.G462A|IL21R_uc002dos.1_Missense_Mutation_p.G462A|uc002dot.2_RNA	NM_181078	NP_851564	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	462	Cytoplasmic (Potential).				natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4						TGGGCTGGGGGACTGCCCTGG	0.662			T	BCL6	NHL								21	61	---	---	---	---	PASS
OGFOD1	55239	broad.mit.edu	37	16	56487240	56487240	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56487240G>C	uc002ejb.2	+	2	321	c.220G>C	c.(220-222)GAC>CAC	p.D74H	OGFOD1_uc002ejc.2_5'UTR|NUDT21_uc002eja.2_5'Flank	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase	74							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)	CCAAAGCCAAGACTTCTTAGA	0.393													28	148	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81161382	81161382	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81161382G>T	uc002fgh.1	-	38	6334	c.6334C>A	c.(6334-6336)CGC>AGC	p.R2112S	PKD1L2_uc002fgf.1_5'UTR|PKD1L2_uc002fgg.1_RNA	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	2112	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GTGCTTTGGCGATCAGTCCCC	0.512													16	29	---	---	---	---	PASS
USP6	9098	broad.mit.edu	37	17	5039998	5039998	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5039998C>G	uc002gau.1	+	18	2958	c.728C>G	c.(727-729)CCC>CGC	p.P243R	USP6_uc002gav.1_Missense_Mutation_p.P243R|USP6_uc010ckz.1_5'UTR|uc002gbb.2_5'Flank|uc002gbd.2_RNA	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	243	Rab-GAP TBC.				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						CATGTGGTACCCAAGTCACAA	0.582			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								67	146	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577079	7577079	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577079C>A	uc002gim.2	-	8	1053	c.859G>T	c.(859-861)GAG>TAG	p.E287*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.E287*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E155*|TP53_uc010cng.1_Nonsense_Mutation_p.E155*|TP53_uc002gii.1_Nonsense_Mutation_p.E155*|TP53_uc010cnh.1_Nonsense_Mutation_p.E287*|TP53_uc010cni.1_Nonsense_Mutation_p.E287*|TP53_uc002gij.2_Nonsense_Mutation_p.E287*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	287	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> V (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.N288fs*13(17)|p.E287*(8)|p.0?(7)|p.E287K(6)|p.E287E(5)|p.E287G(2)|p.E287D(2)|p.?(2)|p.R283fs*16(2)|p.E286fs*17(2)|p.E285_N288delEEEN(1)|p.E287V(1)|p.E287fs*17(1)|p.E287A(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.E285_L289delEEENL(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGGAGATTCTCTTCCTCTGTG	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			32	54	---	---	---	---	PASS
CHD3	1107	broad.mit.edu	37	17	7798230	7798230	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7798230C>T	uc002gje.2	+						CHD3_uc002gjd.2_Intron|CHD3_uc002gjf.2_Intron|CHD3_uc002gjg.1_Intron	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				TCCTTGGCCCCCTAGGAGAAG	0.348													26	58	---	---	---	---	PASS
SLC25A35	399512	broad.mit.edu	37	17	8194247	8194247	+	Missense_Mutation	SNP	C	T	T	rs138474953		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8194247C>T	uc002gla.3	-	4	687	c.642G>A	c.(640-642)ATG>ATA	p.M214I	SLC25A35_uc002gku.1_Missense_Mutation_p.M214I|SLC25A35_uc002gkt.2_Missense_Mutation_p.M214I|SLC25A35_uc002gkz.1_RNA	NM_201520	NP_958928	Q3KQZ1	S2535_HUMAN	solute carrier family 25, member 35	214	Solcar 3.|Helical; Name=5; (Potential).				transport	integral to membrane|mitochondrial inner membrane					0						CAATGCCACTCATCATGGCAG	0.547													14	68	---	---	---	---	PASS
GLP2R	9340	broad.mit.edu	37	17	9729400	9729400	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9729400G>T	uc002gmd.1	+	1	20	c.20G>T	c.(19-21)AGG>ATG	p.R7M	GLP2R_uc010cog.1_RNA	NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	7	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	GGATCGAGCAGGGCAGGGCCT	0.637													8	26	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10298533	10298533	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10298533C>A	uc002gmm.2	-	34	4974	c.4879G>T	c.(4879-4881)GAA>TAA	p.E1627*	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1627	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						ATTTCCATTTCATTCAGATCT	0.458									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				70	209	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18041567	18041567	+	Intron	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18041567C>A	uc010vxh.1	+							NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV						sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					ccaggtgagccgcaggcactg	0.323													3	48	---	---	---	---	PASS
TAOK1	57551	broad.mit.edu	37	17	27794161	27794161	+	Splice_Site	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27794161A>T	uc002hdz.1	+	3	327	c.133_splice	c.e3-2	p.A45_splice	TAOK1_uc010wbe.1_Splice_Site_p.A45_splice|TAOK1_uc010wbf.1_Splice_Site_p.A45_splice	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			TTTCTTCTTTAGGCACGAGAT	0.353													26	71	---	---	---	---	PASS
CCDC55	84081	broad.mit.edu	37	17	28506279	28506279	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28506279G>A	uc002heu.2	+	5	500	c.472G>A	c.(472-474)GAA>AAA	p.E158K	CCDC55_uc002hev.2_Missense_Mutation_p.E104K|CCDC55_uc010wbl.1_Missense_Mutation_p.E104K|CCDC55_uc010wbm.1_Missense_Mutation_p.E104K|CCDC55_uc002hex.2_Missense_Mutation_p.E104K	NM_032141	NP_115517	Q9H0G5	NSRP1_HUMAN	coiled-coil domain containing 55 isoform 1	158	Necessary for alternative splicing activity.|Potential.				developmental process|nucleocytoplasmic transport|regulation of alternative nuclear mRNA splicing, via spliceosome	nuclear speck|ribonucleoprotein complex	mRNA binding|protein binding				0						GAGAGCTGAAGAAGAAGAAAG	0.418													5	37	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29527558	29527558	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29527558G>A	uc002hgg.2	+	9	1340	c.1007G>A	c.(1006-1008)TGG>TAG	p.W336*	NF1_uc002hge.1_Nonsense_Mutation_p.W336*|NF1_uc002hgf.1_Nonsense_Mutation_p.W336*|NF1_uc002hgh.2_Nonsense_Mutation_p.W336*|NF1_uc010csn.1_Nonsense_Mutation_p.W196*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	336					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)|p.W336*(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TACATCAATTGGGAAGATAAC	0.393			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			62	112	---	---	---	---	PASS
PEX12	5193	broad.mit.edu	37	17	33904106	33904106	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33904106G>C	uc002hjp.2	-	2	1247	c.631C>G	c.(631-633)CTG>GTG	p.L211V		NM_000286	NP_000277	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	211	Peroxisomal matrix (Potential).				protein import into peroxisome matrix	integral to peroxisomal membrane	protein C-terminus binding|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTGTGCTCCAGAGCTTGTATA	0.468													22	188	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42328923	42328923	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42328923C>A	uc002igf.3	-	18	2494	c.2345G>T	c.(2344-2346)CGC>CTC	p.R782L		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	782	Membrane (anion exchange).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CAGGGGGATGCGGGACAGGAT	0.632													31	47	---	---	---	---	PASS
TTLL6	284076	broad.mit.edu	37	17	46868812	46868812	+	Silent	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46868812G>C	uc010wlo.1	-	10	1187	c.1152C>G	c.(1150-1152)CTC>CTG	p.L384L	TTLL6_uc002iob.2_Silent_p.L77L|TTLL6_uc010dbi.2_RNA|TTLL6_uc002ioc.2_Silent_p.L137L|TTLL6_uc002iod.2_Silent_p.L231L	NM_001130918	NP_001124390	Q8N841	TTLL6_HUMAN	tubulin tyrosine ligase-like family, member 6	336	TTL.					cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0						AGGCGCTGTTGAGTGTGTGGT	0.527											OREG0024526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	53	56	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901585	51901585	+	Silent	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901585G>T	uc002iua.2	+	1	1347	c.1191G>T	c.(1189-1191)GTG>GTT	p.V397V	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	397	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TGTGTTGTGTGGAGGAAGTGC	0.502													33	63	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75210048	75210048	+	Silent	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75210048G>C	uc002jto.2	+	17	2358	c.2091G>C	c.(2089-2091)CTG>CTC	p.L697L	SEC14L1_uc010dhc.2_Silent_p.L697L|SEC14L1_uc010wth.1_Silent_p.L697L|SEC14L1_uc002jtm.2_Silent_p.L697L|SEC14L1_uc010wti.1_Silent_p.L663L|SEC14L1_uc010wtj.1_3'UTR|SEC14L1_uc002jtr.2_3'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a	697					transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						TCTCCCAGCTGAGTGCCGCCA	0.667													16	23	---	---	---	---	PASS
TNRC6C	57690	broad.mit.edu	37	17	76067255	76067255	+	Intron	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76067255C>T	uc002jud.2	+						TNRC6C_uc002juf.2_Intron|TNRC6C_uc002jue.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CGGTAACTGGCGTCGTAGTTT	0.483													4	7	---	---	---	---	PASS
ZNF750	79755	broad.mit.edu	37	17	80789004	80789004	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80789004C>A	uc002kga.2	-	2	1638	c.1327G>T	c.(1327-1329)GGA>TGA	p.G443*	TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	NM_024702	NP_078978	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	443						intracellular	zinc ion binding			central_nervous_system(1)	1	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TAGAGTCTTCCCAGTGCGCTG	0.617													97	118	---	---	---	---	PASS
TXNDC2	84203	broad.mit.edu	37	18	9886703	9886703	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9886703G>A	uc002koi.3	+	2	676	c.227G>A	c.(226-228)CGC>CAC	p.R76H	TXNDC2_uc010wzq.1_RNA|TXNDC2_uc002koh.3_Missense_Mutation_p.R9H	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN	thioredoxin domain-containing 2 isoform 2	76					cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity			ovary(1)|pancreas(1)	2						TTCCACATGCGCACAGAGGAG	0.572													5	105	---	---	---	---	PASS
ESCO1	114799	broad.mit.edu	37	18	19154062	19154062	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19154062C>A	uc002kth.1	-	4	1677	c.743G>T	c.(742-744)AGA>ATA	p.R248I	ESCO1_uc002kti.1_RNA	NM_052911	NP_443143	Q5FWF5	ESCO1_HUMAN	establishment of cohesion 1 homolog 1	248					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding				0						CATTTTTGATCTTTTCACCTC	0.423													147	339	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32446126	32446126	+	Intron	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32446126C>G	uc010dmn.1	+						DTNA_uc010xbx.1_3'UTR|DTNA_uc002kxv.3_3'UTR|DTNA_uc002kxw.2_Intron|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dml.2_3'UTR|DTNA_uc002kyb.3_3'UTR|DTNA_uc010dmm.2_3'UTR|DTNA_uc010xby.1_Intron|DTNA_uc010dmo.2_3'UTR|DTNA_uc002kyd.3_3'UTR|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						CAGGTCTTAACTAACAGTGGA	0.408													14	96	---	---	---	---	PASS
MBD2	8932	broad.mit.edu	37	18	51750520	51750520	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51750520C>G	uc002lfg.1	-	1	639	c.410G>C	c.(409-411)GGG>GCG	p.G137A	MBD2_uc002lfh.1_Missense_Mutation_p.G137A|SNORA37_uc002lfi.1_5'Flank	NM_003927	NP_003918	Q9UBB5	MBD2_HUMAN	methyl-CpG binding domain protein 2 isoform 1	137	Gly-rich.				transcription, DNA-dependent		C2H2 zinc finger domain binding|methyl-CpG binding|satellite DNA binding				0				Colorectal(16;0.0212)|READ - Rectum adenocarcinoma(32;0.188)	Hexobarbital(DB01355)	TCCCCTGGGCCCCGGCCCCGC	0.537													5	16	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55024483	55024483	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55024483C>T	uc002lgn.2	+	3	999	c.642C>T	c.(640-642)ATC>ATT	p.I214I		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	214	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		ACCCCAGCATCCTGGAAAAAT	0.408													20	118	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7141735	7141735	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7141735C>A	uc002mgd.1	-	13	2744	c.2635G>T	c.(2635-2637)GGT>TGT	p.G879C	INSR_uc002mge.1_Missense_Mutation_p.G867C	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	879	Fibronectin type-III 3.|Extracellular (Potential).				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ACGATCAGACCATTGGGCTCC	0.498													21	34	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9015394	9015394	+	Intron	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9015394G>T	uc002mkp.2	-						MUC16_uc010xki.1_5'Flank	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGCTGTGGAGGAGGGAGAGAG	0.557													24	65	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9084880	9084880	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9084880G>T	uc002mkp.2	-	1	7139	c.6935C>A	c.(6934-6936)ACA>AAA	p.T2312K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2312	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTCTCCCAGTGTAATGGAGGG	0.488													11	33	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10071348	10071348	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10071348G>T	uc002mmq.1	-	66	5156	c.5070C>A	c.(5068-5070)AGC>AGA	p.S1690R		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	1690	Fibrillar collagen NC1.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			CCTGGGGGACGCTGACAGTGG	0.632													31	68	---	---	---	---	PASS
PGLYRP2	114770	broad.mit.edu	37	19	15580462	15580462	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15580462G>T	uc002nbf.3	-	4	1755	c.1622C>A	c.(1621-1623)ACC>AAC	p.T541N	PGLYRP2_uc002nbg.3_Missense_Mutation_p.T541N	NM_052890	NP_443122	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2 precursor	541					defense response to Gram-positive bacterium|detection of bacterium|innate immune response|peptide amidation|peptidoglycan catabolic process	extracellular region|intracellular|membrane	N-acetylmuramoyl-L-alanine amidase activity|peptidoglycan receptor activity|zinc ion binding			ovary(3)	3						GTGCGGCCAGGTGCGCAGCAG	0.731													4	3	---	---	---	---	PASS
CHERP	10523	broad.mit.edu	37	19	16640580	16640580	+	Silent	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16640580T>C	uc002nei.1	-	8	1082	c.1008A>G	c.(1006-1008)CAA>CAG	p.Q336Q	MED26_uc002nee.2_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	336	Gln-rich.				cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						gctgctgctgttgctgctgct	0.547													2	5	---	---	---	---	PASS
UPF1	5976	broad.mit.edu	37	19	18971733	18971733	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18971733G>A	uc002nkg.2	+	17	2707	c.2432G>A	c.(2431-2433)CGC>CAC	p.R811H	UPF1_uc002nkf.2_Missense_Mutation_p.R800H|UPF1_uc002nkh.2_Missense_Mutation_p.R55H	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	811					cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GAGGGCCAGCGCTCCTACCTG	0.632													5	10	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21606630	21606630	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21606630C>T	uc002npx.2	+	2	1065	c.785C>T	c.(784-786)TCA>TTA	p.S262L	ZNF493_uc002npw.2_Missense_Mutation_p.S390L|ZNF493_uc002npy.2_Missense_Mutation_p.S262L	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	262	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGTATTTTCTCAACCCTTACT	0.373													19	99	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33628618	33628618	+	Silent	SNP	T	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33628618T>A	uc002nui.2	+	2	390	c.312T>A	c.(310-312)GCT>GCA	p.A104A		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	104	WD 1.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					ACGAGCACGCTGTGAGCACCT	0.428													33	71	---	---	---	---	PASS
ZNF585A	199704	broad.mit.edu	37	19	37644202	37644202	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37644202G>T	uc002ofo.1	-	5	830	c.599C>A	c.(598-600)TCC>TAC	p.S200Y	ZNF585A_uc002ofm.1_Missense_Mutation_p.S145Y|ZNF585A_uc002ofn.1_Missense_Mutation_p.S145Y	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	200	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTGAAGAGGGACGACACTTG	0.393													30	272	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38689102	38689102	+	Silent	SNP	G	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38689102G>A	uc002ohk.2	+	19	5423	c.4914G>A	c.(4912-4914)CTG>CTA	p.L1638L		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	1638					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACCCTGGGCTGATGCCCCTGC	0.687													32	204	---	---	---	---	PASS
PRKD2	25865	broad.mit.edu	37	19	47181865	47181865	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47181865C>T	uc002pfh.2	-	17	2468	c.2126G>A	c.(2125-2127)CGC>CAC	p.R709H	PRKD2_uc002pfd.2_Missense_Mutation_p.R83H|PRKD2_uc010eks.2_Missense_Mutation_p.R112H|PRKD2_uc010ekt.2_5'UTR|PRKD2_uc002pfe.2_Missense_Mutation_p.R229H|PRKD2_uc002pff.2_Missense_Mutation_p.R229H|PRKD2_uc002pfg.2_Missense_Mutation_p.R552H|PRKD2_uc002pfi.2_Missense_Mutation_p.R709H|PRKD2_uc002pfj.2_Missense_Mutation_p.R709H|PRKD2_uc010xye.1_Missense_Mutation_p.R709H|PRKD2_uc002pfk.2_Missense_Mutation_p.R552H	NM_001079881	NP_001073350	Q9BZL6	KPCD2_HUMAN	protein kinase D2 isoform A	709	Protein kinase.				cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CACCACTGAGCGGCGGAACGA	0.627													14	52	---	---	---	---	PASS
GYS1	2997	broad.mit.edu	37	19	49477995	49477995	+	Intron	SNP	A	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49477995A>G	uc002plp.2	-						GYS1_uc010xzy.1_Intron|GYS1_uc010emm.2_Intron|GYS1_uc010xzz.1_Intron|GYS1_uc010yaa.1_Intron	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1						glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CTGCCGCTGCAGGAGCCACAA	0.582													4	11	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50462151	50462151	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50462151T>C	uc010ybh.1	-	7	1203	c.1112A>G	c.(1111-1113)GAA>GGA	p.E371G	SIGLEC11_uc010ybi.1_Missense_Mutation_p.E371G	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1	371	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CCCGAGGTTTTCCAGGACTAG	0.657													8	84	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50730233	50730233	+	Intron	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50730233C>G	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGTATCCTCTCACAGCCCATG	0.567													4	51	---	---	---	---	PASS
SIGLEC8	27181	broad.mit.edu	37	19	51955814	51955814	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51955814C>A	uc002pwt.2	-	7	1386	c.1319G>T	c.(1318-1320)GGG>GTG	p.G440V	SIGLEC8_uc010yda.1_Missense_Mutation_p.G331V|SIGLEC8_uc002pwu.2_Intron|SIGLEC8_uc010eox.2_Missense_Mutation_p.G347V	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	440	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TCCTTCCTCCCCTGACGAGGG	0.577													34	108	---	---	---	---	PASS
VSTM1	284415	broad.mit.edu	37	19	54567014	54567014	+	Silent	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54567014G>C	uc002qcw.3	-	1	194	c.18C>G	c.(16-18)CTC>CTG	p.L6L	VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Silent_p.L6L	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	6						integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		AAAGCAGGGAGAGGAATTCTG	0.607													23	252	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55176586	55176586	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55176586C>A	uc002qgp.2	+	6	1074	c.712C>A	c.(712-714)CCT>ACT	p.P238T	LILRB4_uc002qgq.2_Missense_Mutation_p.P238T|LILRB4_uc010ers.1_3'UTR|LILRB4_uc002qgr.2_Missense_Mutation_p.P279T|LILRB4_uc010ert.2_Missense_Mutation_p.P279T|LILRB4_uc010eru.2_Missense_Mutation_p.P267T	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	238	Extracellular (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		CCCAGCAGGCCCTGAGGACCA	0.488													6	19	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55693178	55693178	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55693178C>T	uc002qjq.2	-	20	3365	c.3292G>A	c.(3292-3294)GAA>AAA	p.E1098K	PTPRH_uc010esv.2_Missense_Mutation_p.E920K|SYT5_uc002qjm.1_5'Flank|SYT5_uc002qjp.2_5'Flank|SYT5_uc002qjn.1_5'Flank|SYT5_uc002qjo.1_5'Flank	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	1098	Cytoplasmic (Potential).				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		ATGAGGTTTTCGACATCCTCA	0.592													22	201	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56424006	56424006	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56424006C>A	uc010ygg.1	-	5	1202	c.1177G>T	c.(1177-1179)GTA>TTA	p.V393L		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	393	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ATGAAATATACCCGTAGGTCG	0.433													63	196	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56424007	56424007	+	Silent	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56424007C>A	uc010ygg.1	-	5	1201	c.1176G>T	c.(1174-1176)CGG>CGT	p.R392R		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	392	NACHT.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TGAAATATACCCGTAGGTCGT	0.433													63	197	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56466738	56466738	+	Missense_Mutation	SNP	A	T	T	rs138591327	byFrequency	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56466738A>T	uc002qmh.2	+	3	1385	c.1314A>T	c.(1312-1314)AGA>AGT	p.R438S	NLRP8_uc010etg.2_Missense_Mutation_p.R438S	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	438	NACHT.					cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TTCCCACCAGAGCTGAGAACT	0.478													51	144	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286858	57286858	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286858T>C	uc002qnr.2	-	11	1164	c.782A>G	c.(781-783)AAC>AGC	p.N261S	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.N57S|ZIM2_uc010ygr.1_Missense_Mutation_p.N57S|ZIM2_uc002qnq.2_Missense_Mutation_p.N261S|ZIM2_uc010etp.2_Missense_Mutation_p.N261S|ZIM2_uc010ygs.1_Missense_Mutation_p.N261S	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	261					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TTTCTCTTGGTTGCCCTGGTG	0.458													50	122	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328312	57328312	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328312C>A	uc002qnu.2	-	7	1849	c.1498G>T	c.(1498-1500)GTT>TTT	p.V500F	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.V471F|PEG3_uc002qnv.2_Missense_Mutation_p.V500F|PEG3_uc002qnw.2_Missense_Mutation_p.V376F|PEG3_uc002qnx.2_Missense_Mutation_p.V374F|PEG3_uc010etr.2_Missense_Mutation_p.V500F	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	500					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTCCCTCCAACCTGACTTTTC	0.443													64	216	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328313	57328313	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328313C>A	uc002qnu.2	-	7	1848	c.1497G>T	c.(1495-1497)CAG>CAT	p.Q499H	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.Q470H|PEG3_uc002qnv.2_Missense_Mutation_p.Q499H|PEG3_uc002qnw.2_Missense_Mutation_p.Q375H|PEG3_uc002qnx.2_Missense_Mutation_p.Q373H|PEG3_uc010etr.2_Missense_Mutation_p.Q499H	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	499					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TCCCTCCAACCTGACTTTTCT	0.443													65	215	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2384303	2384303	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2384303C>A	uc002wfy.1	+	9	1231	c.1170C>A	c.(1168-1170)TTC>TTA	p.F390L	TGM6_uc010gal.1_Missense_Mutation_p.F390L	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	390					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	ATGGCCCCTTCGTGTTTGCGG	0.617													45	83	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	14665530	14665530	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14665530G>T	uc002wou.2	+	5	607	c.343G>T	c.(343-345)GCT>TCT	p.A115S	MACROD2_uc002wot.2_Missense_Mutation_p.A115S|MACROD2_uc002wox.2_RNA	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	115	Macro.										0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CTGTTTGCTAGCTGAATGTCG	0.408													57	226	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33328762	33328762	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33328762C>T	uc002xav.2	-	12	7869	c.5298G>A	c.(5296-5298)TTG>TTA	p.L1766L	NCOA6_uc002xaw.2_Silent_p.L1766L	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1766	EP300/CRSP3-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						CATCTGGATTCAATTCTTTCA	0.507													19	88	---	---	---	---	PASS
NCOA6	23054	broad.mit.edu	37	20	33370155	33370155	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33370155C>T	uc002xav.2	-	4	2575	c.4G>A	c.(4-6)GTT>ATT	p.V2I	NCOA6_uc002xaw.2_Missense_Mutation_p.V2I|NCOA6_uc010gew.1_Missense_Mutation_p.V2I	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	2	TBP/GTF2A-binding region.|NCOA1-binding region.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7						TCATCCAAAACCATGGTGAAT	0.363													33	84	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37536831	37536831	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37536831G>T	uc002xje.2	+	10	1378	c.1189G>T	c.(1189-1191)GAC>TAC	p.D397Y	PPP1R16B_uc010ggc.2_Missense_Mutation_p.D355Y	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	397					regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				AGAGAATAAGGACCCTGTGAG	0.612													20	45	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47266097	47266097	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47266097A>T	uc002xtw.1	-	25	3069	c.3046T>A	c.(3046-3048)TCG>ACG	p.S1016T	PREX1_uc002xtv.1_Missense_Mutation_p.S313T	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1016					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGGGTGTACGACATGGGGTTC	0.587													4	22	---	---	---	---	PASS
APCDD1L	164284	broad.mit.edu	37	20	57042215	57042215	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57042215C>T	uc002xze.1	-	3	874	c.688G>A	c.(688-690)GAG>AAG	p.E230K	APCDD1L_uc010zzp.1_Missense_Mutation_p.E241K	NM_153360	NP_699191	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated	230						integral to membrane				ovary(1)	1	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			TGCCGCCTCTCCGCCGGGTCG	0.736													12	21	---	---	---	---	PASS
CDH26	60437	broad.mit.edu	37	20	58570880	58570880	+	Intron	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58570880C>A	uc002ybe.2	+						CDH26_uc002ybf.1_Intron|CDH26_uc010zzy.1_Intron|CDH26_uc002ybg.2_Intron|CDH26_uc002ybh.2_5'Flank|CDH26_uc002ybi.2_5'Flank	NM_177980	NP_817089	Q8IXH8	CAD26_HUMAN	cadherin-like 26 isoform a						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|central_nervous_system(1)	4	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			TTCTTTTTCCCTTTGCAGGTC	0.458													3	74	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22656553	22656553	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22656553A>T	uc002yld.1	+	3	419	c.170A>T	c.(169-171)CAA>CTA	p.Q57L	NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Missense_Mutation_p.Q82L	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	57	Ig-like C2-type 1.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TATAATCCTCAAGGAGAGAAG	0.358													27	72	---	---	---	---	PASS
FTCD	10841	broad.mit.edu	37	21	47557212	47557212	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47557212C>T	uc002zif.2	-	13	1524	c.1480G>A	c.(1480-1482)GCA>ACA	p.A494T	FTCD_uc002zie.2_RNA|FTCD_uc002zig.2_Missense_Mutation_p.A494T|FTCD_uc002zih.2_Missense_Mutation_p.A494T|FTCD_uc010gqf.2_Missense_Mutation_p.R479H|FTCD_uc010gqg.1_Missense_Mutation_p.A363T	NM_006657	NP_006648	O95954	FTCD_HUMAN	formiminotransferase cyclodeaminase	494	Cyclodeaminase/cyclohydrolase (By similarity).				folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity			pancreas(1)|skin(1)	2	Breast(49;0.214)			Colorectal(79;0.235)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	TTGAAATATGCGCCAAACACG	0.607													4	144	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47777037	47777037	+	Silent	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47777037A>T	uc002zji.3	+	13	2192	c.2085A>T	c.(2083-2085)CTA>CTT	p.L695L	PCNT_uc002zjj.2_Silent_p.L577L	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	695	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					TTGAACTCCTAAAAATAGAAA	0.483													57	96	---	---	---	---	PASS
IGLL1	3543	broad.mit.edu	37	22	23917219	23917219	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23917219C>A	uc002zxd.2	-	2	375	c.257G>T	c.(256-258)GGG>GTG	p.G86V	IGLL1_uc002zxe.2_Intron	NM_020070	NP_064455	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1 isoform	86					immune response	extracellular region|membrane					0						GGATTGAAACCCCCGGGGCCA	0.617													9	77	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26164642	26164642	+	Silent	SNP	G	C	C			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26164642G>C	uc003abz.1	+	4	1009	c.759G>C	c.(757-759)CTG>CTC	p.L253L	MYO18B_uc003aca.1_Silent_p.L134L|MYO18B_uc010guy.1_Silent_p.L134L|MYO18B_uc010guz.1_Silent_p.L134L|MYO18B_uc011aka.1_5'UTR|MYO18B_uc011akb.1_5'Flank	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	253						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CCACAGAGCTGAAAGAGGCTG	0.637													3	13	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32205622	32205622	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32205622G>T	uc003als.2	+	19	1455	c.1313G>T	c.(1312-1314)GGC>GTC	p.G438V	DEPDC5_uc011als.1_Missense_Mutation_p.G438V|DEPDC5_uc011alu.1_Missense_Mutation_p.G438V|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.G438V|DEPDC5_uc003alr.1_Missense_Mutation_p.G438V|DEPDC5_uc011alt.1_Missense_Mutation_p.G410V	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	438					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						GCAAAAAATGGCCGTGATACA	0.274													20	90	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32482219	32482219	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32482219G>T	uc003amc.2	+	10	1266	c.1034G>T	c.(1033-1035)TGT>TTT	p.C345F	SLC5A1_uc011alz.1_Missense_Mutation_p.C218F	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	345	Extracellular (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						AAAATTGCCTGTGTCGTCCCT	0.418													53	180	---	---	---	---	PASS
SH3BP1	23616	broad.mit.edu	37	22	38039103	38039103	+	Splice_Site	SNP	A	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38039103A>T	uc003ati.2	+	6	508	c.397_splice	c.e6-2	p.E133_splice	SH3BP1_uc003atg.1_Splice_Site|SH3BP1_uc011anl.1_Splice_Site_p.E133_splice|SH3BP1_uc003ath.1_Splice_Site_p.E133_splice|SH3BP1_uc003atj.1_Splice_Site_p.E69_splice|SH3BP1_uc003atk.1_Splice_Site_p.E47_splice|uc003atl.1_Intron	NM_018957	NP_061830	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1						signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GCCCATCCCCAGGAGGAGCTG	0.637											OREG0026546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	9	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7223133	7223133	+	Silent	SNP	C	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7223133C>T	uc004cry.3	+	7	1250	c.1005C>T	c.(1003-1005)ACC>ACT	p.T335T		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	335	Lumenal.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	CTAATGATACCCTCATCTACT	0.413									Ichthyosis				25	48	---	---	---	---	PASS
MSL3	10943	broad.mit.edu	37	X	11786713	11786713	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11786713C>A	uc004cuw.2	+	10	1298	c.1193C>A	c.(1192-1194)TCA>TAA	p.S398*	MSL3_uc004cux.2_Nonsense_Mutation_p.S339*|MSL3_uc011mig.1_Nonsense_Mutation_p.S249*|MSL3_uc011mih.1_Nonsense_Mutation_p.S386*|MSL3_uc004cuy.2_Nonsense_Mutation_p.S232*	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a	398					histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CATAGCAGATCATCTTCACCT	0.398													28	55	---	---	---	---	PASS
SCML2	10389	broad.mit.edu	37	X	18323182	18323182	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18323182C>G	uc004cyl.2	-	7	797	c.640G>C	c.(640-642)GAT>CAT	p.D214H	SCML2_uc004cyk.3_RNA|SCML2_uc010nfd.1_Missense_Mutation_p.D214H|SCML2_uc011miz.1_Missense_Mutation_p.D148H	NM_006089	NP_006080	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2	214	MBT 2.				anatomical structure morphogenesis	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(33;0.183)					CACCAGTAATCAAAAGCTCCA	0.438													56	152	---	---	---	---	PASS
FAM47B	170062	broad.mit.edu	37	X	34962134	34962134	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34962134C>A	uc004ddi.1	+	1	1204	c.1186C>A	c.(1186-1188)CAT>AAT	p.H396N		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	396										ovary(3)|breast(1)	4						TCGGATGCCCCATCTCCGCCT	0.572													11	25	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40511138	40511138	+	Intron	SNP	C	G	G			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40511138C>G	uc004dex.3	-							NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						TCACCTGCAACAGAGAAAAAT	0.388													6	14	---	---	---	---	PASS
PHF8	23133	broad.mit.edu	37	X	54049215	54049215	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54049215C>A	uc004dsu.2	-	3	341	c.268G>T	c.(268-270)GAA>TAA	p.E90*	PHF8_uc004dst.2_Nonsense_Mutation_p.E54*|PHF8_uc004dsw.2_Nonsense_Mutation_p.E54*|PHF8_uc004dsy.2_Nonsense_Mutation_p.E54*	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	90	PHD-type.				brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						TGCAAGACTTCACAGTTGGGG	0.438													14	18	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54949443	54949443	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54949443G>T	uc004dtq.2	+	3	585	c.478G>T	c.(478-480)GAG>TAG	p.E160*	TRO_uc011moj.1_Nonsense_Mutation_p.E103*|TRO_uc004dts.2_Nonsense_Mutation_p.E160*|TRO_uc004dtr.2_Nonsense_Mutation_p.E160*|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Intron|TRO_uc004dtx.2_5'Flank	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	160					embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						AACTGGCCATGAGGGTGGCAC	0.507													11	18	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75649297	75649297	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75649297G>T	uc004ecm.1	+	1	1181	c.974G>T	c.(973-975)GGT>GTT	p.G325V		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	325	Pro-rich.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						CCCACCCCTGGTGGGGGACTG	0.701													8	11	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133883	91133883	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133883C>A	uc004efk.1	+	2	3489	c.2644C>A	c.(2644-2646)CTG>ATG	p.L882M	PCDH11X_uc004efl.1_Missense_Mutation_p.L882M|PCDH11X_uc004efo.1_Missense_Mutation_p.L882M|PCDH11X_uc010nmv.1_Missense_Mutation_p.L882M|PCDH11X_uc004efm.1_Missense_Mutation_p.L882M|PCDH11X_uc004efn.1_Missense_Mutation_p.L882M|PCDH11X_uc004efh.1_Missense_Mutation_p.L882M|PCDH11X_uc004efj.1_Missense_Mutation_p.L882M	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	882	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TAAGAACTTGCTGCTTAATTT	0.358													35	44	---	---	---	---	PASS
DCX	1641	broad.mit.edu	37	X	110644366	110644366	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110644366C>A	uc004epd.2	-	3	972	c.800G>T	c.(799-801)CGC>CTC	p.R267L	DCX_uc011msv.1_Missense_Mutation_p.R267L|DCX_uc004epe.2_Missense_Mutation_p.R186L|DCX_uc004epf.2_Missense_Mutation_p.R186L|DCX_uc004epg.2_Missense_Mutation_p.R186L	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	267	Doublecortin 2.		R -> C (in SBHX).		axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						CACCCCACTGCGGATGATGGT	0.537													71	62	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135430658	135430658	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135430658G>T	uc004ezu.1	+	6	5084	c.4793G>T	c.(4792-4794)AGG>ATG	p.R1598M	GPR112_uc010nsb.1_Missense_Mutation_p.R1393M|GPR112_uc010nsc.1_Missense_Mutation_p.R1365M	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1598	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					GTTACCCCCAGGACTACTATG	0.408													96	127	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135430659	135430659	+	Silent	SNP	G	A	A	rs149903703	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135430659G>A	uc004ezu.1	+	6	5085	c.4794G>A	c.(4792-4794)AGG>AGA	p.R1598R	GPR112_uc010nsb.1_Silent_p.R1393R|GPR112_uc010nsc.1_Silent_p.R1365R	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1598	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TTACCCCCAGGACTACTATGA	0.413													95	127	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994850	140994850	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994850C>A	uc004fbt.2	+	4	1946	c.1660C>A	c.(1660-1662)CAG>AAG	p.Q554K	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	554							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCCTCCTCAGGGGGAGGA	0.567										HNSCC(15;0.026)			211	245	---	---	---	---	PASS
SPANXN3	139067	broad.mit.edu	37	X	142596756	142596756	+	Missense_Mutation	SNP	C	A	A	rs113043096		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142596756C>A	uc004fbw.2	-	2	402	c.314G>T	c.(313-315)TGT>TTT	p.C105F		NM_001009609	NP_001009609	Q5MJ09	SPXN3_HUMAN	SPANX-N3 protein	105										ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					AGGTCCTTCACATGGGCCTAG	0.468													91	100	---	---	---	---	PASS
LZIC	84328	broad.mit.edu	37	1	9992157	9992159	+	Intron	DEL	CGT	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9992157_9992159delCGT	uc001aqm.2	-						LZIC_uc001aqn.2_Intron|LZIC_uc001aqo.2_Intron|LZIC_uc009vmr.2_Intron|LZIC_uc010oah.1_Intron	NM_032368	NP_115744	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing								beta-catenin binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		ctttgggaggcgtgggggggggg	0.108													4	2	---	---	---	---	
NBPF3	84224	broad.mit.edu	37	1	21807368	21807368	+	Intron	DEL	A	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21807368delA	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GTGGACTGTTAATGGGTGTAG	0.478													3	3	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39545374	39545381	+	5'Flank	DEL	TTCCTTCC	-	-	rs112113087		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39545374_39545381delTTCCTTCC	uc010ois.1	+						MACF1_uc010oir.1_5'Flank	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAAATTTCTTttccttccttccttcctt	0.183													6	3	---	---	---	---	
C1orf177	163747	broad.mit.edu	37	1	55279346	55279352	+	Intron	DEL	CCGGCCT	-	-	rs67384270		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55279346_55279352delCCGGCCT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2												0						TGAGGCTGGCCCGGCCTCCGGCCTCCG	0.604													5	7	---	---	---	---	
ARHGAP29	9411	broad.mit.edu	37	1	94669701	94669701	+	Intron	DEL	T	-	-	rs77020055		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94669701delT	uc001dqj.3	-						ARHGAP29_uc009wdq.1_Intron|ARHGAP29_uc001dql.2_Intron	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1						Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TCTTTCTTCCttttttttttt	0.149													4	4	---	---	---	---	
MAGI3	260425	broad.mit.edu	37	1	113992209	113992210	+	Intron	INS	-	T	T	rs140998878	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113992209_113992210insT	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCAAGTGCATTTTTTTTTCC	0.351													3	8	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109312	145109313	+	Intron	INS	-	A	A	rs142440425		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109312_145109313insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						aaaccaaaaacaaaAAAAAAAG	0.163													9	4	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148015979	148015980	+	Intron	INS	-	ACAC	ACAC			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148015979_148015980insACAC	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						AAAGATGAAAGacacacacaca	0.337													4	3	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153982269	153982269	+	Intron	DEL	A	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153982269delA	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			acccagtctcaaaaaaaaaaa	0.129													8	4	---	---	---	---	
CNTN2	6900	broad.mit.edu	37	1	205036040	205036041	+	Intron	INS	-	G	G	rs151113569	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205036040_205036041insG	uc001hbr.2	+						CNTN2_uc001hbq.1_Intron|CNTN2_uc001hbs.2_Intron	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor						axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CACACAGCATTGCAGAGGCACC	0.317													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	239215857	239215858	+	IGR	INS	-	T	T	rs35410036		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239215857_239215858insT								LOC339535 (566540 upstream) : CHRM3 (334007 downstream)																							GATAAATTGCCTTTTTTTTTTT	0.351													4	3	---	---	---	---	
DDX1	1653	broad.mit.edu	37	2	15739606	15739606	+	Intron	DEL	T	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15739606delT	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		aatttttgtattttttttttt	0.000													7	4	---	---	---	---	
TRMT61B	55006	broad.mit.edu	37	2	29088130	29088132	+	Intron	DEL	TGA	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29088130_29088132delTGA	uc002rmm.2	-						TRMT61B_uc002rmn.2_Intron|TRMT61B_uc010ezk.2_Intron	NM_017910	NP_060380	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B								tRNA (adenine-N1-)-methyltransferase activity				0						ATATTTCACTTGATGAAATAAAA	0.365													6	3	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133010779	133010779	+	Intron	DEL	G	-	-	rs111517614		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133010779delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						AAGTGCATTCGAAGAGTCGAT	0.537													4	2	---	---	---	---	
RBM45	129831	broad.mit.edu	37	2	178986131	178986134	+	Intron	DEL	ACAC	-	-	rs11895951		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178986131_178986134delACAC	uc002ulv.2	+							NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45						cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			atgtatatatacacacacacacac	0.225													8	4	---	---	---	---	
CCDC36	339834	broad.mit.edu	37	3	49278972	49278973	+	Intron	DEL	AC	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49278972_49278973delAC	uc003cwk.2	+						CCDC36_uc003cwl.3_Intron|CCDC36_uc011bck.1_Intron	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36											ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		acacacacatacacacacacac	0.079													3	3	---	---	---	---	
ILDR1	286676	broad.mit.edu	37	3	121720858	121720866	+	Intron	DEL	GTGCCTATA	-	-	rs74268689		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121720858_121720866delGTGCCTATA	uc003ees.2	-						ILDR1_uc003eeq.2_Intron|ILDR1_uc003eer.2_Intron|ILDR1_uc010hrg.2_Intron	NM_175924	NP_787120	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor							cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)		atggtggcatgtgcctatagtcccagctt	0.067													4	8	---	---	---	---	
JAKMIP1	152789	broad.mit.edu	37	4	6172159	6172161	+	Intron	DEL	GTC	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6172159_6172161delGTC	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						catcaccatagtcaccaccacct	0.000													4	3	---	---	---	---	
ATP10D	57205	broad.mit.edu	37	4	47537334	47537335	+	Intron	INS	-	A	A			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47537334_47537335insA	uc003gxk.1	+						ATP10D_uc003gxl.1_5'Flank|ATP10D_uc003gxj.3_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D						ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						cctaaaagtctaaaaaaaaaaa	0.149													4	2	---	---	---	---	
EGFLAM	133584	broad.mit.edu	37	5	38370347	38370347	+	Intron	DEL	C	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38370347delC	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					AGCTTCCCTTCCCTCTGGTAT	0.388													54	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	105880160	105880160	+	IGR	DEL	G	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105880160delG								None (None upstream) : EFNA5 (832431 downstream)																							CAGTGGAGACGGGAACTGGGC	0.403													3	3	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866031	162866031	+	Intron	DEL	A	-	-	rs72299838		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866031delA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		actccttctcaaaaaaaaaaa	0.169													3	3	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170351727	170351727	+	Intron	DEL	T	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170351727delT	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGTTGGTTGATTTTTTTTTTT	0.303			T	TRD@	ALL								6	3	---	---	---	---	
DST	667	broad.mit.edu	37	6	56426562	56426562	+	Intron	DEL	G	-	-	rs111627792		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56426562delG	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATAACAAGTGAAATAAAAAA	0.264													4	2	---	---	---	---	
RSPH4A	345895	broad.mit.edu	37	6	116938675	116938676	+	Intron	INS	-	TT	TT	rs61166013		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116938675_116938676insTT	uc003pxe.2	+						RSPH4A_uc010kee.2_Intron	NM_001010892	NP_001010892	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A isoform 1						cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton|radial spoke					0						TTTTCTTAACCTTTTTTTTTTT	0.277									Kartagener_syndrome				4	2	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	5968265	5968266	+	Intron	INS	-	T	T	rs71547799		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5968265_5968266insT	uc003sph.1	-						RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Intron|RSPH10B2_uc011jwk.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						tttcttttttgttttttttttt	0.252													10	6	---	---	---	---	
C7orf46	340277	broad.mit.edu	37	7	23730802	23730803	+	Intron	INS	-	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23730802_23730803insT	uc003swo.3	+						C7orf46_uc003swq.3_Intron|C7orf46_uc003swr.3_Intron|C7orf46_uc003swp.3_Intron|C7orf46_uc010kup.2_Intron	NM_199136	NP_954587	A4D161	CG046_HUMAN	hypothetical protein LOC340277 isoform 1												0						GTGTTTTGCAGTTTTTTTTTTT	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																							CATGTTTTTTGTGTTTTTCTT	0.353													8	4	---	---	---	---	
SLC26A5	375611	broad.mit.edu	37	7	103019931	103019931	+	Intron	DEL	A	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103019931delA	uc003vbz.2	-						SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Intron|SLC26A5_uc003vby.2_Intron|SLC26A5_uc010liy.2_Intron	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a						regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						CACACAGACCAaaaaaaaaaa	0.348													6	3	---	---	---	---	
C7orf45	136263	broad.mit.edu	37	7	129853550	129853551	+	Intron	INS	-	G	G	rs113909675		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129853550_129853551insG	uc003vpp.2	+							NM_145268	NP_660311	Q8WWF3	CG045_HUMAN	hypothetical protein LOC136263							integral to membrane					0	Melanoma(18;0.0435)					aaaaaaaaaaaaaaagaaaaga	0.089													6	5	---	---	---	---	
SLC18A1	6570	broad.mit.edu	37	8	20007084	20007087	+	Intron	DEL	TCTC	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20007084_20007087delTCTC	uc011kyq.1	-						SLC18A1_uc003wzl.2_Intron|SLC18A1_uc003wzm.2_Intron|SLC18A1_uc011kyr.1_Intron|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_Intron|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		TCTGTGtctttctctctctctctc	0.265													7	5	---	---	---	---	
DERL1	79139	broad.mit.edu	37	8	124034655	124034657	+	Intron	DEL	CTT	-	-	rs143530722		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124034655_124034657delCTT	uc003ypl.2	-						DERL1_uc003ypm.2_Intron|DERL1_uc011lif.1_Intron|DERL1_uc003ypn.2_Intron	NM_024295	NP_077271	Q9BUN8	DERL1_HUMAN	Der1-like domain family, member 1 isoform a						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|intracellular transport of viral proteins in host cell|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	MHC class I protein binding|receptor activity				0	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GTTATCTCTCCTTCTCTCTAACA	0.448											OREG0018957	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	5	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317202	126317203	+	Intron	INS	-	AAG	AAG	rs35212928		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317202_126317203insAAG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			aggaaggaagaaagaaagaaaa	0.054													4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	129112411	129112412	+	Intron	INS	-	CCTC	CCTC	rs145126693	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129112411_129112412insCCTC	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						cttccttctttcctccctccct	0.089													5	3	---	---	---	---	
SEMA4D	10507	broad.mit.edu	37	9	91986867	91986868	+	Intron	INS	-	GT	GT			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91986867_91986868insGT	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqm.2_5'Flank	NM_001142287	NP_001135759	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						gtgtgtgtggggtgtggtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	99068839	99068840	+	IGR	INS	-	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99068839_99068840insT								ARHGAP19 (16426 upstream) : FRAT1 (10182 downstream)																							AAAAAAGTTTGTTTTTTTTTTT	0.173													8	5	---	---	---	---	
PAOX	196743	broad.mit.edu	37	10	135197124	135197124	+	Intron	DEL	G	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135197124delG	uc001lmv.2	+						PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_Intron|PAOX_uc001lna.2_Intron|PAOX_uc001lnb.2_Intron|PAOX_uc001lnc.2_Intron	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1						polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		aaaaaaaaaagaaaacccaaa	0.065													3	3	---	---	---	---	
POLR2L	5441	broad.mit.edu	37	11	840579	840579	+	Intron	DEL	C	-	-	rs34627090		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:840579delC	uc001lsc.2	-						TSPAN4_uc001lsd.1_5'Flank|TSPAN4_uc001lse.1_5'Flank|TSPAN4_uc001lsf.1_5'Flank|TSPAN4_uc001lsg.1_5'Flank|TSPAN4_uc001lsh.1_5'Flank	NM_021128	NP_066951	P62875	RPAB5_HUMAN	DNA directed RNA polymerase II polypeptide L						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;4.1e-25)|Epithelial(43;3.15e-24)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGCCTCACCCCCCCCGCC	0.607													10	5	---	---	---	---	
ADIPOR2	79602	broad.mit.edu	37	12	1805565	1805565	+	Intron	DEL	T	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1805565delT	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			tttttccttcttttttttttt	0.204													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9122131	9122131	+	IGR	DEL	A	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9122131delA								M6PR (19879 upstream) : KLRG1 (20090 downstream)																							TATTTTAGTTaaaaaaaaaag	0.249													4	2	---	---	---	---	
KIAA0528	9847	broad.mit.edu	37	12	22637469	22637469	+	Intron	DEL	T	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22637469delT	uc001rfq.2	-						KIAA0528_uc010sir.1_Intron|KIAA0528_uc010sis.1_Intron|KIAA0528_uc010sit.1_Intron|KIAA0528_uc010siu.1_Intron|KIAA0528_uc001rfr.2_Intron|KIAA0528_uc009ziy.1_Intron	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847								protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						ACACAGAGGGTTTTTTTTTTA	0.308													7	4	---	---	---	---	
LASS5	91012	broad.mit.edu	37	12	50528077	50528078	+	Intron	INS	-	CTT	CTT	rs72518097		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50528077_50528078insCTT	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron	NM_147190	NP_671723	Q8N5B7	CERS5_HUMAN	LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0						tgggagaatccaagcccaggtg	0.025													6	3	---	---	---	---	
DCN	1634	broad.mit.edu	37	12	91571927	91571928	+	Intron	DEL	GA	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91571927_91571928delGA	uc001tbs.2	-						DCN_uc001tbo.2_Intron|DCN_uc001tbp.2_Intron|DCN_uc001tbq.2_Intron|DCN_uc001tbr.2_Intron|DCN_uc001tbt.2_Intron|DCN_uc001tbu.2_Intron	NM_133503	NP_598010	P07585	PGS2_HUMAN	decorin isoform a preproprotein						organ morphogenesis	extracellular space				central_nervous_system(2)|ovary(1)|lung(1)	4						gacagagagggagagagagaga	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34669524	34669525	+	IGR	INS	-	GGAAGGAAGGAA	GGAAGGAAGGAA	rs60602289		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669524_34669525insGGAAGGAAGGAA								EGLN3 (249237 upstream) : C14orf147 (232620 downstream)																							gatggatggatggaaggaagga	0.000													8	5	---	---	---	---	
FAM177A1	283635	broad.mit.edu	37	14	35546674	35546674	+	Intron	DEL	C	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35546674delC	uc001wsp.2	+						FAM177A1_uc001wsq.2_Intron	NM_001079519	NP_001072987	Q8N128	F177A_HUMAN	hypothetical protein LOC283635 isoform 2												0						TTTTCAAGttctttttttttt	0.129													4	2	---	---	---	---	
RNF111	54778	broad.mit.edu	37	15	59341944	59341945	+	Intron	INS	-	TT	TT	rs60727965		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59341944_59341945insTT	uc002afv.2	+						RNF111_uc002afs.2_Intron|RNF111_uc002aft.2_Intron|RNF111_uc002afu.2_Intron|RNF111_uc002afw.2_Intron	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		ttctttctttcttttttttttt	0.168													4	2	---	---	---	---	
NR2F2	7026	broad.mit.edu	37	15	96881005	96881005	+	3'UTR	DEL	A	-	-	rs34678417		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96881005delA	uc010uri.1	+	3					NR2F2_uc002btp.2_3'UTR|NR2F2_uc010urj.1_3'UTR|NR2F2_uc010urk.1_3'UTR	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2						lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			TGTGAATTTCAAAAAAAAAAA	0.289													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102292971	102292974	+	Intron	DEL	CTCA	-	-	rs75843814		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102292971_102292974delCTCA	uc010usj.1	+						uc002bxo.2_5'Flank|uc002bxp.3_RNA|uc002bxq.2_3'UTR|uc002bxt.2_5'Flank|uc002bxz.3_5'Flank|uc002byd.2_5'Flank|uc002bye.2_5'Flank|uc002byf.1_5'Flank|uc002byg.2_5'Flank|uc002byi.2_5'Flank|uc002byk.2_5'Flank|uc002bym.2_5'Flank|uc002byn.2_5'Flank|uc010usm.1_5'Flank|uc002byr.2_5'Flank					RecName: Full=Uncharacterized protein C15orf51.; Flags: Fragment;																		GATGCTGCTTCTCAGAGCTGCTGT	0.583													4	2	---	---	---	---	
MLST8	64223	broad.mit.edu	37	16	2255805	2255805	+	Intron	DEL	G	-	-	rs3214648		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2255805delG	uc002coz.2	+						MLST8_uc002coy.2_Intron|MLST8_uc002cpa.2_Intron|MLST8_uc002cpb.2_Intron|MLST8_uc010uvx.1_Intron|MLST8_uc002cpc.2_Intron|MLST8_uc002cpd.2_Intron|MLST8_uc002cpe.2_5'UTR|MLST8_uc010uvy.1_5'UTR|MLST8_uc002cpg.2_5'UTR|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_5'UTR	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						CTGCGGAGGTGGGGGGGGGAC	0.512													9	6	---	---	---	---	
PPL	5493	broad.mit.edu	37	16	4952694	4952694	+	Intron	DEL	T	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4952694delT	uc002cyd.1	-							NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin						keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						TCCCATGCACttttttttttt	0.299													5	4	---	---	---	---	
GDPD3	79153	broad.mit.edu	37	16	30119362	30119363	+	Intron	DEL	GT	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30119362_30119363delGT	uc002dwp.2	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|GDPD3_uc002dwq.2_Intron	NM_024307	NP_077283	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0						gtgtgtgttcgtgtgtgtgtgt	0.020													4	2	---	---	---	---	
NUP88	4927	broad.mit.edu	37	17	5320152	5320153	+	Intron	INS	-	T	T	rs11391160		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5320152_5320153insT	uc002gbo.1	-						NUP88_uc010vsx.1_Intron|NUP88_uc010cle.1_Intron|NUP88_uc010vsy.1_Intron|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1						TAACTCACAAAttttttttttt	0.158													4	2	---	---	---	---	
PFAS	5198	broad.mit.edu	37	17	8171691	8171691	+	Intron	DEL	A	-	-	rs76845148		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8171691delA	uc002gkr.2	+						PFAS_uc010vuv.1_Intron|PFAS_uc002gks.2_Intron	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase						'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	attccatctcaaaaaaaaaaa	0.065													4	2	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10253819	10253819	+	Intron	DEL	C	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10253819delC	uc002gmk.1	-						MYH13_uc010vvf.1_Intron	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CACGGCCTCGCCCGCACATGA	0.502													57	33	---	---	---	---	
CCDC144C	348254	broad.mit.edu	37	17	20266461	20266462	+	Intron	INS	-	AC	AC			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20266461_20266462insAC	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						ATTTTTGAACTacacacacaca	0.248													6	3	---	---	---	---	
KRT40	125115	broad.mit.edu	37	17	39138900	39138901	+	Intron	DEL	TG	-	-	rs5820382		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39138900_39138901delTG	uc010cxh.1	-						KRT40_uc002hvq.1_Intron	NM_182497	NP_872303	Q6A162	K1C40_HUMAN	type I hair keratin KA36							intermediate filament	structural molecule activity				0		Breast(137;0.00043)				AGAGAATATTtgtgtgtgtgtg	0.198													3	3	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	50234899	50234899	+	Intron	DEL	G	-	-	rs67822192		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50234899delG	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			ACCCCCCCCCGCAAAACACAC	0.522													7	5	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	63747018	63747018	+	Intron	DEL	A	-	-	rs75469128		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63747018delA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			CTTAAAAAGCAAAAAAAAAAA	0.343													11	5	---	---	---	---	
ST8SIA3	51046	broad.mit.edu	37	18	55021998	55021998	+	Intron	DEL	A	-	-	rs35003371		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55021998delA	uc002lgn.2	+							NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide						glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		TTTGAATAGCAAAAAAAAAAA	0.378													3	3	---	---	---	---	
C19orf66	55337	broad.mit.edu	37	19	10197480	10197480	+	Intron	DEL	G	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10197480delG	uc002mmu.3	+						C19orf66_uc002mmt.2_Intron|C19orf66_uc002mmv.3_Intron|C19orf66_uc002mmw.3_5'Flank	NM_018381	NP_060851	Q9NUL5	CS066_HUMAN	hypothetical protein LOC55337												0						GATGAAAGGCGGGGGGGGGGC	0.647													4	2	---	---	---	---	
ZNF333	84449	broad.mit.edu	37	19	14810278	14810278	+	Intron	DEL	T	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14810278delT	uc002mzn.2	+						ZNF333_uc010dzq.2_Intron|ZNF333_uc002mzk.3_Intron|ZNF333_uc002mzl.3_Intron|ZNF333_uc002mzm.2_Intron|ZNF333_uc010dzr.1_Intron	NM_032433	NP_115809	Q96JL9	ZN333_HUMAN	zinc finger protein 333						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TGCTCAAGACttttttttttt	0.254													4	2	---	---	---	---	
NOTCH3	4854	broad.mit.edu	37	19	15277765	15277766	+	Intron	INS	-	G	G	rs141898965	by1000genomes	TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15277765_15277766insG	uc002nan.2	-							NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor						Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ctgagacttttctggagcatta	0.089													3	4	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49318110	49318110	+	Intron	DEL	G	-	-	rs80266311		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49318110delG	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		aaaaaaaaaagaaaagaaaag	0.214													4	2	---	---	---	---	
SMOX	54498	broad.mit.edu	37	20	4155522	4155524	+	Intron	DEL	TCT	-	-	rs151198960		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4155522_4155524delTCT	uc002wkm.1	+						SMOX_uc002wkk.1_Intron|SMOX_uc002wkl.1_Intron|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Intron|SMOX_uc010zqo.1_Intron|SMOX_uc002wko.1_Intron	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1						polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)	TGGAGGTGGCTCTTCTTGTCCAG	0.409													5	6	---	---	---	---	
SLC12A5	57468	broad.mit.edu	37	20	44669802	44669803	+	Intron	INS	-	A	A	rs11460894		TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44669802_44669803insA	uc010zxl.1	+						SLC12A5_uc010zxm.1_Intron|SLC12A5_uc002xrb.2_Intron	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	gggagcttaagaaaaaaaaaaa	0.153													2	4	---	---	---	---	
TRIOBP	11078	broad.mit.edu	37	22	38164814	38164814	+	Intron	DEL	A	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38164814delA	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atw.2_Intron|TRIOBP_uc003atx.1_Intron|TRIOBP_uc010gxh.2_Intron	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					gactccatctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
GRIA3	2892	broad.mit.edu	37	X	122460220	122460220	+	Intron	DEL	G	-	-			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122460220delG	uc004etq.3	+						GRIA3_uc004etr.3_Intron|GRIA3_uc004ets.3_Intron|GRIA3_uc011muf.1_Intron	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform						glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	AGTGGCTGCAGaaaaaaaaaa	0.308													4	2	---	---	---	---	
AFF2	2334	broad.mit.edu	37	X	147925053	147925054	+	Intron	INS	-	T	T			TCGA-66-2782-01A-01D-1522-08	TCGA-66-2782-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147925053_147925054insT	uc004fcp.2	+						AFF2_uc004fco.2_Intron|AFF2_uc004fcq.2_Intron|AFF2_uc004fcr.2_Intron|AFF2_uc011mxb.1_Intron|AFF2_uc004fcs.2_Intron|AFF2_uc011mxc.1_Intron	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCTGCTCCTTGAAACTATG	0.356													28	23	---	---	---	---	
