Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
IGSF21	84966	broad.mit.edu	37	1	18618451	18618451	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18618451G>T	uc001bau.1	+	3	658	c.275G>T	c.(274-276)CGA>CTA	p.R92L		NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	92	Ig-like 1.					extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		TACCGCAAGCGAGAGGACCTG	0.617													77	225	---	---	---	---	PASS
RPS6KA1	6195	broad.mit.edu	37	1	26885313	26885313	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26885313C>G	uc001bmr.1	+	14	1263	c.1100C>G	c.(1099-1101)CCC>CGC	p.P367R	RPS6KA1_uc010ofe.1_Missense_Mutation_p.P275R|RPS6KA1_uc010off.1_Missense_Mutation_p.P351R|RPS6KA1_uc001bms.1_Missense_Mutation_p.P376R|RPS6KA1_uc009vsl.1_Missense_Mutation_p.P210R	NM_002953	NP_002944	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	367	AGC-kinase C-terminal.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		CCAGGCATCCCCCCCAGCGCT	0.672													35	127	---	---	---	---	PASS
GNL2	29889	broad.mit.edu	37	1	38058403	38058403	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38058403T>A	uc001cbk.2	-	3	317	c.154A>T	c.(154-156)AGT>TGT	p.S52C	GNL2_uc010oif.1_5'UTR|GNL2_uc009vve.2_Missense_Mutation_p.S52C	NM_013285	NP_037417	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2	52					ribosome biogenesis	nucleolus	GTP binding|GTPase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)				TTACCACGACTGTTCCTAAAT	0.363													86	254	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39798770	39798770	+	Silent	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39798770T>C	uc010oiu.1	+	1	1961	c.1830T>C	c.(1828-1830)TGT>TGC	p.C610C	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2175					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCTTTACATGTCAGAATGAAC	0.393													3	183	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44056824	44056824	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44056824C>T	uc001cjr.2	+	9	1471	c.1131C>T	c.(1129-1131)GGC>GGT	p.G377G	PTPRF_uc001cjs.2_Silent_p.G377G|PTPRF_uc001cju.2_5'UTR|PTPRF_uc009vwt.2_5'UTR|PTPRF_uc001cjv.2_5'UTR	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	377	Extracellular (Potential).|Fibronectin type-III 1.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ACAGCATTGGCGGCCTCAGCC	0.667													4	144	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54605789	54605789	+	Intron	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54605789G>A	uc001cwv.1	-							NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor							extracellular region				ovary(1)	1						CCTGGATGGGGGATGGGGAGG	0.582													23	67	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65845103	65845103	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65845103C>T	uc001dcd.1	+	5	555	c.391C>T	c.(391-393)CCC>TCC	p.P131S	DNAJC6_uc001dcc.1_Missense_Mutation_p.P162S|DNAJC6_uc010opc.1_Missense_Mutation_p.P118S|DNAJC6_uc001dce.1_Missense_Mutation_p.P188S	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	131	Phosphatase tensin-type.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						ATGCAGTTGGCCCATTAGGCA	0.458													6	274	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66036267	66036267	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66036267C>A	uc001dci.2	+	4	354	c.152C>A	c.(151-153)GCT>GAT	p.A51D	LEPR_uc001dcg.2_Missense_Mutation_p.A51D|LEPR_uc001dch.2_Missense_Mutation_p.A51D|LEPR_uc009waq.2_Missense_Mutation_p.A51D|LEPR_uc001dcj.2_Missense_Mutation_p.A51D|LEPR_uc001dck.2_Missense_Mutation_p.A51D	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	51	Extracellular (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CTTTTGCCTGCTGGACTCTCA	0.368													76	202	---	---	---	---	PASS
ACADM	34	broad.mit.edu	37	1	76205738	76205738	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76205738A>G	uc001dgw.3	+	7	972	c.542A>G	c.(541-543)GAT>GGT	p.D181G	ACADM_uc010orc.1_3'UTR|ACADM_uc010ord.1_Missense_Mutation_p.D95G|ACADM_uc009wbp.2_Missense_Mutation_p.D185G|ACADM_uc009wbr.2_Missense_Mutation_p.D214G|ACADM_uc010ore.1_Missense_Mutation_p.D145G|ACADM_uc010orf.1_5'UTR|ACADM_uc001dgx.3_Missense_Mutation_p.D95G|ACADM_uc010org.1_Missense_Mutation_p.D51G	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a	181					carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						AAGAAAGGAGATGAGTATATT	0.333													46	135	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103444940	103444940	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103444940G>T	uc001dul.2	-	32	2926	c.2608C>A	c.(2608-2610)CGG>AGG	p.R870R	COL11A1_uc001duk.2_Silent_p.R66R|COL11A1_uc001dum.2_Silent_p.R882R|COL11A1_uc001dun.2_Silent_p.R831R|COL11A1_uc009weh.2_Silent_p.R754R	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	870	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TATCATACCCGTGCACCTTTC	0.249													9	32	---	---	---	---	PASS
PPM1J	333926	broad.mit.edu	37	1	113253886	113253886	+	Splice_Site	SNP	A	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113253886A>C	uc001ect.1	-	6	1073	c.1046_splice	c.e6+1	p.W349_splice	PPM1J_uc009wgl.1_Splice_Site|PPM1J_uc001ecs.1_Splice_Site_p.W143_splice	NM_005167	NP_005158	Q5JR12	PPM1J_HUMAN	protein phosphatase 1J (PP2C domain containing)											breast(2)|central_nervous_system(1)	3	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGGAAGTGTTACCAGCCGGTC	0.612													6	26	---	---	---	---	PASS
AMPD1	270	broad.mit.edu	37	1	115220031	115220031	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115220031G>T	uc001efe.1	-	10	1413	c.1329C>A	c.(1327-1329)TTC>TTA	p.F443L	AMPD1_uc001eff.1_Missense_Mutation_p.F439L	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	443					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GATTGCAGACGAACCAGGAGG	0.562													12	219	---	---	---	---	PASS
ANKRD34A	284615	broad.mit.edu	37	1	145473835	145473835	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145473835G>A	uc001enq.1	+	4	1800	c.507G>A	c.(505-507)GAG>GAA	p.E169E	NBPF10_uc001emp.3_Intron	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34	169											0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CAGGGGTGGAGGACCCTGCTC	0.617													86	153	---	---	---	---	PASS
RAB13	5872	broad.mit.edu	37	1	153958590	153958590	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153958590G>T	uc001fdt.1	-	1	217	c.123C>A	c.(121-123)ATC>ATA	p.I41I	RAB13_uc001fdu.1_Silent_p.I41I	NM_002870	NP_002861	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family	41	Effector region (By similarity).				cell adhesion|protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	cytoplasmic vesicle membrane|tight junction	GTP binding|GTPase activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CGGGCTCACCGATGGTGGAGA	0.552													20	71	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	153984754	153984754	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153984754G>C	uc001fdw.2	-	34	4818	c.4746C>G	c.(4744-4746)TTC>TTG	p.F1582L	NUP210L_uc009woq.2_Missense_Mutation_p.F491L|NUP210L_uc010peh.1_Missense_Mutation_p.F1582L	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1582						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CAGTGGTGATGAAGAGCTTGA	0.398													86	467	---	---	---	---	PASS
DCST2	127579	broad.mit.edu	37	1	155006038	155006038	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155006038A>C	uc001fgm.2	-	1	220	c.140T>G	c.(139-141)GTG>GGG	p.V47G	DCST2_uc009wpb.2_RNA|DCST1_uc010per.1_5'Flank|DCST1_uc001fgn.1_5'Flank|DCST1_uc010pes.1_5'Flank	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	47	Helical; (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GTGGCCTTCCACCAGTAGCTC	0.627													80	179	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157659687	157659687	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157659687C>A	uc001frb.2	-	10	2003	c.1711G>T	c.(1711-1713)GGC>TGC	p.G571C	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.G571C|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Missense_Mutation_p.G297C|FCRL3_uc001frc.1_Missense_Mutation_p.G571C	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	571	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					GCGGTAAGGCCTGTTCTGTTC	0.557													93	123	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158615155	158615155	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158615155C>G	uc001fst.1	-	29	4216	c.4017G>C	c.(4015-4017)GAG>GAC	p.E1339D		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1339	Spectrin 13.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GAGCCTCTGCCTCCATGTCAG	0.483													106	100	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158623161	158623161	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158623161C>T	uc001fst.1	-	22	3290	c.3091G>A	c.(3091-3093)GTC>ATC	p.V1031I		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1031	SH3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGTCTTCTGACATAGACAGCT	0.547													141	152	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159900969	159900969	+	Silent	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159900969A>G	uc001fur.2	-	13	1794	c.1596T>C	c.(1594-1596)GAT>GAC	p.D532D	IGSF9_uc001fuq.2_Silent_p.D516D|IGSF9_uc001fup.2_5'UTR	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	532	Fibronectin type-III 1.|Extracellular (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GATAACCACCATCAAAGCCAG	0.557													20	92	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169993677	169993677	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169993677T>C	uc001ggv.2	-	9	1173	c.902A>G	c.(901-903)AAC>AGC	p.N301S	KIFAP3_uc010plx.1_Missense_Mutation_p.N3S	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	301					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TATGTTCTTGTTCCTCATTTT	0.343													21	101	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176563866	176563866	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176563866A>T	uc001gkz.2	+	3	2290	c.1126A>T	c.(1126-1128)ATG>TTG	p.M376L	PAPPA2_uc001gky.1_Missense_Mutation_p.M376L|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	376					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TGGACGGCACATGGCCCTGTA	0.582													41	141	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179494492	179494492	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179494492G>A	uc001gmo.2	+	22	2647	c.2520G>A	c.(2518-2520)GAG>GAA	p.E840E	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_RNA	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	840	Glu-rich.										0						AATTCATTGAGCCTGAAATAG	0.289													5	66	---	---	---	---	PASS
EDEM3	80267	broad.mit.edu	37	1	184686663	184686663	+	Intron	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184686663T>C	uc010pok.1	-						EDEM3_uc010pol.1_Intron|EDEM3_uc010pom.1_Intron	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1						AAATGGGGTATATTTTCTTAC	0.343													58	67	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186008977	186008977	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186008977G>A	uc001grq.1	+	39	6375	c.6146G>A	c.(6145-6147)GGG>GAG	p.G2049E		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2049	Ig-like C2-type 18.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TTGAAAGATGGGAGTCCTGTT	0.443													151	166	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390149	197390149	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390149C>T	uc001gtz.2	+	6	1326	c.1191C>T	c.(1189-1191)GAC>GAT	p.D397D	CRB1_uc010poz.1_Silent_p.D328D|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Silent_p.D285D|CRB1_uc010ppb.1_Silent_p.D397D|CRB1_uc010ppc.1_RNA|CRB1_uc010ppd.1_Translation_Start_Site|CRB1_uc001gub.1_Silent_p.D46D	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	397	Extracellular (Potential).|EGF-like 10; calcium-binding (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						GCGAAGAAGACGTCAATGAAT	0.333													88	212	---	---	---	---	PASS
TNNT2	7139	broad.mit.edu	37	1	201332453	201332453	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201332453T>C	uc001gwf.2	-	12	640	c.571A>G	c.(571-573)ATG>GTG	p.M191V	TNNT2_uc009wzn.2_5'Flank|TNNT2_uc009wzo.2_5'Flank|TNNT2_uc009wzp.2_5'Flank|TNNT2_uc001gwg.2_Missense_Mutation_p.M181V|TNNT2_uc001gwh.2_Missense_Mutation_p.M176V|TNNT2_uc001gwi.2_Missense_Mutation_p.M151V|TNNT2_uc009wzr.2_Missense_Mutation_p.M122V|TNNT2_uc001gwj.1_RNA|TNNT2_uc009wzs.1_Missense_Mutation_p.M156V|TNNT2_uc001gwk.1_Missense_Mutation_p.M122V|TNNT2_uc009wzt.1_Missense_Mutation_p.M181V	NM_000364	NP_000355	P45379	TNNT2_HUMAN	troponin T type 2, cardiac isoform 1	191					ATP catabolic process|muscle filament sliding|negative regulation of ATPase activity|positive regulation of ATPase activity|regulation of heart contraction|response to calcium ion|response to calcium ion|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|tropomyosin binding|troponin C binding|troponin I binding				0						AAATGCATCATGTTGGACAAA	0.552													264	450	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201824322	201824322	+	Intron	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201824322A>G	uc001gwz.2	+							NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						TATGTAGTTTATTTGATCTTT	0.358													28	93	---	---	---	---	PASS
NUAK2	81788	broad.mit.edu	37	1	205272861	205272861	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205272861C>G	uc001hce.2	-	7	1731	c.1604G>C	c.(1603-1605)CGG>CCG	p.R535P		NM_030952	NP_112214	Q9H093	NUAK2_HUMAN	NUAK family, SNF1-like kinase, 2	535					actin cytoskeleton organization|apoptosis|cellular response to glucose starvation|negative regulation of apoptosis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)	5	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TCGGCTGGCCCGGGCCAGGGG	0.657													47	69	---	---	---	---	PASS
IKBKE	9641	broad.mit.edu	37	1	206647710	206647710	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206647710A>G	uc001hdz.1	+	4	492	c.124A>G	c.(124-126)ACT>GCT	p.T42A	IKBKE_uc009xbu.1_Missense_Mutation_p.T42A|IKBKE_uc009xbv.1_Missense_Mutation_p.T42A|IKBKE_uc001hea.1_5'UTR	NM_014002	NP_054721	Q14164	IKKE_HUMAN	IKK-related kinase epsilon	42	Protein kinase.				DNA damage response, signal transduction resulting in induction of apoptosis|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane|PML body	ATP binding|IkappaB kinase activity|NF-kappaB-inducing kinase activity|protein binding			ovary(3)|lung(3)|central_nervous_system(1)|skin(1)	8	Breast(84;0.137)					GGTCTTCAACACTACCAGCTA	0.577													31	130	---	---	---	---	PASS
RASSF5	83593	broad.mit.edu	37	1	206730910	206730910	+	Intron	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206730910G>T	uc001hed.2	+						RASSF5_uc001hec.1_Intron|RASSF5_uc001hee.2_Intron|RASSF5_uc001hef.2_Silent_p.V3V	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			AGATGACCGTGGACAGCAGCA	0.632													38	82	---	---	---	---	PASS
ITPKB	3707	broad.mit.edu	37	1	226924704	226924704	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226924704C>T	uc010pvo.1	-	2	796	c.456G>A	c.(454-456)GCG>GCA	p.A152A	ITPKB_uc001hqh.2_Silent_p.A152A	NM_002221	NP_002212	P27987	IP3KB_HUMAN	1D-myo-inositol-trisphosphate 3-kinase B	152							ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity			ovary(4)|central_nervous_system(1)	5		Prostate(94;0.0773)				CCTGGATGTGCGCCTCAAACA	0.667													6	324	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229633923	229633923	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229633923G>A	uc001htn.2	-	6	871	c.779C>T	c.(778-780)TCT>TTT	p.S260F		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	260					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				AAAAAGAGAAGAAACTTTTCG	0.353													12	150	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237753084	237753084	+	Intron	SNP	T	C	C	rs11331089		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237753084T>C	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATTTTTTTTTTCTTCCCAGGA	0.393													6	67	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247464543	247464543	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247464543C>G	uc001ico.2	-	9	1507	c.1042G>C	c.(1042-1044)GAT>CAT	p.D348H	ZNF496_uc009xgv.2_Missense_Mutation_p.D384H|ZNF496_uc001icp.2_Missense_Mutation_p.D348H	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	348					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			ACTTCTTCATCCAGGCTGTTC	0.607													31	134	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248039798	248039798	+	3'UTR	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248039798G>T	uc001ido.2	+	6					OR2W3_uc001idp.1_Intron	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58							intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CTAAAATTCTGTTCCCAAGAT	0.438													39	117	---	---	---	---	PASS
CMPK2	129607	broad.mit.edu	37	2	7005270	7005270	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7005270C>A	uc002qyo.2	-	1	667	c.558G>T	c.(556-558)CAG>CAT	p.Q186H	CMPK2_uc010yis.1_Missense_Mutation_p.Q186H|CMPK2_uc010ewv.2_Missense_Mutation_p.Q186H	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor	186					dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CGCAGCCCACCTGCAGCCGCC	0.736													2	1	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37241027	37241027	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37241027G>A	uc002rpp.1	-	27	4337	c.4241C>T	c.(4240-4242)GCC>GTC	p.A1414V	HEATR5B_uc010ezy.1_5'UTR|HEATR5B_uc002rpq.3_5'UTR	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1414							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				CATGGTCGTGGCACTCTCTCG	0.443													5	324	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43927291	43927291	+	Silent	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43927291A>T	uc010yny.1	+	8	1277	c.1194A>T	c.(1192-1194)TCA>TCT	p.S398S	PLEKHH2_uc002rte.3_Silent_p.S398S|PLEKHH2_uc002rtf.3_Silent_p.S397S	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	398	Poly-Ser.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCGATTATTCATCTTCATCGA	0.403													57	152	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44078792	44078792	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44078792A>T	uc002rtq.2	+	4	482	c.392A>T	c.(391-393)CAG>CTG	p.Q131L	ABCG8_uc010yoa.1_Missense_Mutation_p.Q131L	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	131	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AAGTCAGGCCAGATCTGGATC	0.602													19	71	---	---	---	---	PASS
SMYD1	150572	broad.mit.edu	37	2	88407904	88407904	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88407904C>A	uc002ssr.2	+	9	1162	c.1160C>A	c.(1159-1161)CCC>CAC	p.P387H	SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_Missense_Mutation_p.P83H	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	387					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						CTCTACCACCCCAACAATGCC	0.478													30	119	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98928346	98928346	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98928346G>T	uc002syo.2	+	27	3850	c.3586G>T	c.(3586-3588)GAT>TAT	p.D1196Y	VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.D853Y|VWA3B_uc002syp.1_Missense_Mutation_p.D588Y|VWA3B_uc002syq.1_Missense_Mutation_p.D472Y|VWA3B_uc002syr.1_Missense_Mutation_p.D513Y|VWA3B_uc002sys.2_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1196										ovary(3)|large_intestine(2)|skin(1)	6						GGACACGCAGGATTCCAGAGA	0.602													3	11	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125521710	125521710	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125521710G>C	uc002tno.2	+	16	2880	c.2516G>C	c.(2515-2517)CGA>CCA	p.R839P	CNTNAP5_uc010flu.2_Missense_Mutation_p.R840P	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	839	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GACTTCATTCGACTCGAAATA	0.289													29	118	---	---	---	---	PASS
GPR39	2863	broad.mit.edu	37	2	133402883	133402883	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133402883G>A	uc002ttl.2	+	2	1535	c.1066G>A	c.(1066-1068)GTG>ATG	p.V356M	LYPD1_uc002ttm.3_3'UTR|LYPD1_uc002ttn.2_3'UTR|LYPD1_uc002tto.2_3'UTR	NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39	356	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						GCGGGTGTTCGTGCAGGTGCT	0.627													17	49	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152382499	152382499	+	Silent	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152382499G>C	uc010fnx.2	-	122	17222	c.17031C>G	c.(17029-17031)GTC>GTG	p.V5677V	NEB_uc002txr.2_Silent_p.V2100V|NEB_uc002txt.3_Silent_p.V182V	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	5677	Nebulin 155.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCACTTCCTTGACGTGAACAG	0.483													174	528	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166895938	166895938	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166895938G>A	uc010zcz.1	-	14	2569	c.2551C>T	c.(2551-2553)CGA>TGA	p.R851*	SCN1A_uc002udo.3_Nonsense_Mutation_p.R731*|SCN1A_uc010fpk.2_Nonsense_Mutation_p.R703*	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	862	Helical; Voltage-sensor; Name=S4 of repeat II; (By similarity).|II.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TTTACCAATCGAAATGAACGG	0.378													33	71	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168107591	168107591	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107591G>C	uc002udx.2	+	8	9707	c.9689G>C	c.(9688-9690)CGT>CCT	p.R3230P	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.R3055P|XIRP2_uc010fpq.2_Missense_Mutation_p.R3008P|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3055					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATAGAAACTCGTGGTAGGGAC	0.448													56	150	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098960	178098960	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098960C>T	uc002ulh.3	-	2	640	c.85G>A	c.(85-87)GAT>AAT	p.D29N	NFE2L2_uc002ulg.3_Missense_Mutation_p.D13N|NFE2L2_uc010zfa.1_Missense_Mutation_p.D13N|NFE2L2_uc002uli.3_Missense_Mutation_p.D13N|NFE2L2_uc010fra.2_Missense_Mutation_p.D13N|NFE2L2_uc010frb.2_Missense_Mutation_p.D13N	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	29					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTCCAAGATCTATATCTTGC	0.363			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			18	85	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179404238	179404238	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179404238C>T	uc010zfg.1	-	301	91074	c.90850G>A	c.(90850-90852)GGT>AGT	p.G30284S	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G23979S|TTN_uc010zfi.1_Missense_Mutation_p.G23912S|TTN_uc010zfj.1_Missense_Mutation_p.G23787S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31211							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAGATGTACCTCGGACTCTG	0.468													104	315	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179417151	179417151	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179417151G>C	uc010zfg.1	-	284	82996	c.82772C>G	c.(82771-82773)CCC>CGC	p.P27591R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P21286R|TTN_uc010zfi.1_Missense_Mutation_p.P21219R|TTN_uc010zfj.1_Missense_Mutation_p.P21094R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28518							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGATGGTTTGGGTTTTCCCTT	0.398													35	66	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179593713	179593713	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179593713A>C	uc010zfg.1	-	62	15544	c.15320T>G	c.(15319-15321)ATC>AGC	p.I5107S	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.I1768S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6034							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACACTTCTGATTTGAAGTGT	0.398													10	29	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179640118	179640118	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179640118C>A	uc010zfg.1	-	28	6697	c.6473G>T	c.(6472-6474)GGA>GTA	p.G2158V	TTN_uc010zfh.1_Missense_Mutation_p.G2112V|TTN_uc010zfi.1_Missense_Mutation_p.G2112V|TTN_uc010zfj.1_Missense_Mutation_p.G2112V|TTN_uc002unb.2_Missense_Mutation_p.G2158V|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2158							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGAGGTTTCTCCAGCTATGTT	0.428													54	131	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179664351	179664351	+	Silent	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179664351C>A	uc002und.2	-	6	1002	c.777G>T	c.(775-777)CCG>CCT	p.P259P	TTN_uc010zfg.1_Silent_p.P259P|TTN_uc010zfh.1_Silent_p.P259P|TTN_uc010zfi.1_Silent_p.P259P|TTN_uc010zfj.1_Silent_p.P259P|TTN_uc002unb.2_Silent_p.P259P			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	259							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.R256_K260>K(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTTGGCTTCGGAGGAATCC	0.552													33	102	---	---	---	---	PASS
IDH1	3417	broad.mit.edu	37	2	209108339	209108339	+	Intron	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209108339G>T	uc002vcs.2	-						IDH1_uc002vct.2_Intron|IDH1_uc002vcu.2_Intron	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble						2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity			central_nervous_system(2156)|haematopoietic_and_lymphoid_tissue(606)|bone(74)|thyroid(22)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2868				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		CTGTAGAGGAGAAGCCAGTGA	0.413			Mis		gliobastoma 								7	57	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212812269	212812269	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212812269G>A	uc002veg.1	-	3	405	c.307C>T	c.(307-309)CGC>TGC	p.R103C	ERBB4_uc002veh.1_Missense_Mutation_p.R103C|ERBB4_uc010zji.1_Missense_Mutation_p.R103C|ERBB4_uc010zjj.1_Missense_Mutation_p.R103C|ERBB4_uc010fut.1_Missense_Mutation_p.R103C	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	103	Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CGAATAATGCGTAAATTCTCC	0.398										TSP Lung(8;0.080)			17	70	---	---	---	---	PASS
IKZF2	22807	broad.mit.edu	37	2	213921707	213921707	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213921707C>T	uc002vem.2	-	4	425	c.256G>A	c.(256-258)GAG>AAG	p.E86K	IKZF2_uc010fuu.2_Intron|IKZF2_uc002vej.2_Missense_Mutation_p.E33K|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Missense_Mutation_p.E86K|IKZF2_uc002vel.2_Missense_Mutation_p.E33K|IKZF2_uc010fuw.2_5'UTR|IKZF2_uc010fux.2_Intron|IKZF2_uc010fuy.2_Missense_Mutation_p.E86K|IKZF2_uc002ven.2_Missense_Mutation_p.E86K	NM_016260	NP_057344	Q9UKS7	IKZF2_HUMAN	helios isoform 1	86					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		TCGCTGCTCTCAATTAGGGGT	0.522													65	193	---	---	---	---	PASS
VWC2L	402117	broad.mit.edu	37	2	215301452	215301452	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215301452C>G	uc002vet.2	+	3	620	c.490C>G	c.(490-492)CCA>GCA	p.P164A	VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain-containing	164	VWFC 2.					extracellular region					0						AGTCTATGAACCAGAACAATG	0.463													20	110	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220167082	220167082	+	Silent	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220167082A>G	uc002vkz.2	-	6	860	c.771T>C	c.(769-771)CCT>CCC	p.P257P	PTPRN_uc010zlc.1_Silent_p.P167P|PTPRN_uc002vla.2_Silent_p.P257P	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	257	Extracellular (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		AGGAGTGGCCAGGGTGGTCCC	0.637													13	27	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220312995	220312995	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220312995G>T	uc010fwg.2	+	4	1115	c.1115G>T	c.(1114-1116)CGA>CTA	p.R372L	SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_5'UTR|SPEG_uc002vln.1_5'UTR|SPEG_uc002vlp.1_5'Flank	NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	372					muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GCGGAATCCCGACCCCAGACG	0.697													13	33	---	---	---	---	PASS
GMPPA	29926	broad.mit.edu	37	2	220371037	220371037	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220371037G>T	uc002vlr.2	+	12	1123	c.1055G>T	c.(1054-1056)CGC>CTC	p.R352L	GMPPA_uc002vls.2_Missense_Mutation_p.R352L|GMPPA_uc002vlt.2_Missense_Mutation_p.R405L|GMPPA_uc002vlu.2_Missense_Mutation_p.R405L|GMPPA_uc002vlv.2_Missense_Mutation_p.R352L|GMPPA_uc002vlw.2_RNA|GMPPA_uc002vlx.2_Missense_Mutation_p.R352L	NM_013335	NP_037467	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	352					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine		GTP binding|mannose-1-phosphate guanylyltransferase activity				0		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		CGCTGGGCCCGCGTGGAGGGT	0.627													49	133	---	---	---	---	PASS
C2orf57	165100	broad.mit.edu	37	2	232458559	232458559	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232458559C>T	uc002vrz.2	+	1	948	c.897C>T	c.(895-897)ACC>ACT	p.T299T		NM_152614	NP_689827	Q53QW1	CB057_HUMAN	hypothetical protein LOC165100	299										ovary(1)	1		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		GGTCCGAGACCACCATGGGCA	0.647													33	154	---	---	---	---	PASS
KLHL18	23276	broad.mit.edu	37	3	47378109	47378109	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47378109G>C	uc003crd.2	+	7	1109	c.983G>C	c.(982-984)CGC>CCC	p.R328P	KLHL18_uc003crc.2_Missense_Mutation_p.R328P|KLHL18_uc011bav.1_Missense_Mutation_p.R216P|KLHL18_uc010hjq.1_Missense_Mutation_p.R184P	NM_025010	NP_079286	O94889	KLH18_HUMAN	kelch-like 18	328	Kelch 1.										0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		GCCCGCAGCCGCGTTGGCGTG	0.572													24	42	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48604596	48604596	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48604596C>A	uc003ctz.2	-	109	8075	c.8074G>T	c.(8074-8076)GGC>TGC	p.G2692C		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2692	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCCTTGGGGCCTGGCTGCCCG	0.597													46	110	---	---	---	---	PASS
ACOX2	8309	broad.mit.edu	37	3	58494613	58494613	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58494613C>T	uc003dkl.2	-							NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		GTGTTCCACTCAACTACCTGA	0.418													55	89	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100645170	100645170	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100645170C>T	uc003dun.2	-	2	341	c.256G>A	c.(256-258)GGG>AGG	p.G86R	ABI3BP_uc003duo.2_Missense_Mutation_p.G79R|ABI3BP_uc003dup.3_Missense_Mutation_p.G79R	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	86						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						GTGAATTTCCCTTCAGCGGGA	0.478													133	77	---	---	---	---	PASS
BBX	56987	broad.mit.edu	37	3	107447803	107447803	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107447803G>T	uc010hpr.2	+	6	924	c.597G>T	c.(595-597)ATG>ATT	p.M199I	BBX_uc003dwk.3_Missense_Mutation_p.M199I|BBX_uc003dwl.3_Missense_Mutation_p.M199I|BBX_uc010hps.1_Missense_Mutation_p.M220I|BBX_uc003dwm.3_Missense_Mutation_p.M199I	NM_001142568	NP_001136040	Q8WY36	BBX_HUMAN	HMG-BOX transcription factor BBX isoform 1	199					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ACTTTGGAATGGCTGGTGAGT	0.443													120	698	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122634307	122634307	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122634307G>A	uc003efz.1	-	14	2272	c.1968C>T	c.(1966-1968)ATC>ATT	p.I656I	SEMA5B_uc011bju.1_Silent_p.I598I|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Silent_p.I656I|SEMA5B_uc010hro.1_Silent_p.I598I	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	656	Extracellular (Potential).				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		TGGCGATGTGGATGGCTGGCC	0.607													54	191	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123471267	123471267	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123471267G>T	uc003ego.2	-	5	566	c.284C>A	c.(283-285)GCT>GAT	p.A95D	MYLK_uc011bjw.1_Missense_Mutation_p.A95D|MYLK_uc003egp.2_Missense_Mutation_p.A95D|MYLK_uc003egq.2_Missense_Mutation_p.A95D|MYLK_uc003egr.2_Missense_Mutation_p.A95D|MYLK_uc003egs.2_Intron|MYLK_uc010hrs.1_Missense_Mutation_p.A95D|MYLK_uc003egu.1_Missense_Mutation_p.A105D	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	95	Ig-like C2-type 1.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CTCATGGACAGCATGAATCAC	0.587													5	312	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124153219	124153219	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124153219C>T	uc003ehg.2	+	17	3016	c.2889C>T	c.(2887-2889)GCC>GCT	p.A963A	KALRN_uc010hrv.1_Silent_p.A954A|KALRN_uc003ehf.1_Silent_p.A963A|KALRN_uc011bjy.1_Silent_p.A954A|KALRN_uc003ehh.1_Silent_p.A309A	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	963	Spectrin 4.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AGCAGAAAGCCGAGGTGCTGC	0.597													35	87	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129290099	129290099	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129290099C>T	uc003emx.2	-	18	3484	c.3384G>A	c.(3382-3384)GGG>GGA	p.G1128G		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1128	Extracellular (Potential).|IPT/TIG 3.				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGCTCAGGGCCCCGGGGGACG	0.657													149	80	---	---	---	---	PASS
NCK1	4690	broad.mit.edu	37	3	136646961	136646961	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136646961C>T	uc003erh.2	+	2	225	c.118C>T	c.(118-120)CGA>TGA	p.R40*	NCK1_uc011bme.1_5'Flank	NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1	40	SH3 1.				axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						GTCCTGGTGGCGAGTTCGAAA	0.398													148	421	---	---	---	---	PASS
CHST2	9435	broad.mit.edu	37	3	142840260	142840260	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142840260G>T	uc003evm.2	+	2	1491	c.602G>T	c.(601-603)TGG>TTG	p.W201L		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	201	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3						TGGCATGTATGGCAAAAACTG	0.572													117	428	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147130463	147130463	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147130463A>G	uc003ewe.2	+	2	1860	c.1141A>G	c.(1141-1143)ATG>GTG	p.M381V		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	381	C2H2-type 5.				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GCGCAAACACATGAAGGTAAT	0.617													41	343	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147131289	147131289	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147131289C>G	uc003ewe.2	+	3	2014	c.1295C>G	c.(1294-1296)ACA>AGA	p.T432R		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	432	Ser-rich.				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GTCCACCACACAGCCGGCCAC	0.507													7	428	---	---	---	---	PASS
OTOL1	131149	broad.mit.edu	37	3	161221516	161221516	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161221516C>T	uc011bpb.1	+	4	1220	c.1220C>T	c.(1219-1221)GCC>GTC	p.A407V		NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor	407	C1q.					collagen					0						AGTCTGGTGGCCCAGAATAAG	0.473													28	149	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180377270	180377270	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180377270C>T	uc010hxe.2	-	6	823	c.708G>A	c.(706-708)AAG>AAA	p.K236K	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	236	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTCCATCCCTCTTCTGCATCT	0.348													168	121	---	---	---	---	PASS
FXR1	8087	broad.mit.edu	37	3	180667070	180667070	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180667070G>T	uc003fkq.2	+	7	591	c.569G>T	c.(568-570)CGA>CTA	p.R190L	FXR1_uc003fkp.2_Missense_Mutation_p.R105L|FXR1_uc003fkr.2_Missense_Mutation_p.R190L|FXR1_uc011bqj.1_Missense_Mutation_p.R104L|FXR1_uc003fks.2_Missense_Mutation_p.R104L|FXR1_uc011bqk.1_Missense_Mutation_p.R141L|FXR1_uc011bql.1_Missense_Mutation_p.R177L	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1	190					apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			ATGCATTTGCGAAGTATTCGT	0.368													204	552	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186980499	186980499	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186980499C>G	uc003frh.1	-	3	579	c.247G>C	c.(247-249)GAG>CAG	p.E83Q	MASP1_uc003fri.2_Missense_Mutation_p.E83Q|MASP1_uc003frj.2_Missense_Mutation_p.E52Q|MASP1_uc003frk.1_Missense_Mutation_p.E83Q|MASP1_uc011bse.1_Missense_Mutation_p.E57Q	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	83	Interaction with FCN2.|Interaction with MBL2.|Homodimerization (By similarity).|CUB 1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ACCTGGTCCTCAGTTTCTACC	0.532													54	193	---	---	---	---	PASS
FGFRL1	53834	broad.mit.edu	37	4	1018453	1018453	+	Splice_Site	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1018453G>A	uc003gce.2	+	6	1233	c.1072_splice	c.e6+1	p.D358_splice	FGFRL1_uc003gcf.2_Splice_Site_p.D358_splice|FGFRL1_uc003gcg.2_Splice_Site_p.D358_splice|FGFRL1_uc010ibo.2_Splice_Site_p.D358_splice	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1						regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTGCTGCCAGGTGCGCGGCTG	0.726													5	3	---	---	---	---	PASS
QDPR	5860	broad.mit.edu	37	4	17513587	17513587	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17513587G>T	uc003gpd.2	-	1	271	c.91C>A	c.(91-93)CGG>AGG	p.R31R	QDPR_uc003gpe.2_Silent_p.R31R|QDPR_uc003gpf.2_RNA	NM_000320	NP_000311	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	31	NADP.				dihydrobiopterin metabolic process|L-phenylalanine catabolic process|tetrahydrobiopterin biosynthetic process	cytosol	6,7-dihydropteridine reductase activity|binding|electron carrier activity			ovary(1)	1					NADH(DB00157)	TTGCGGGCCCGAAAAGCCTGC	0.731													4	10	---	---	---	---	PASS
GABRA2	2555	broad.mit.edu	37	4	46264131	46264131	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46264131G>C	uc003gxc.3	-	8	1544	c.871C>G	c.(871-873)CTA>GTA	p.L291V	GABRA2_uc010igc.2_Missense_Mutation_p.L291V|GABRA2_uc011bzc.1_Missense_Mutation_p.L236V|GABRA2_uc003gxe.2_Missense_Mutation_p.L291V	NM_001114175	NP_001107647	P47869	GBRA2_HUMAN	gamma-aminobutyric acid A receptor, alpha 2	291	Helical; (Probable).				gamma-aminobutyric acid signaling pathway|neurotransmitter transport|regulation of neurotransmitter levels	cell junction|chloride channel complex|integral to synaptic vesicle membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|skin(2)	4					Alprazolam(DB00404)|Bromazepam(DB01558)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Fludiazepam(DB01567)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GTCATTGTTAGGACAGTTGTT	0.433													8	144	---	---	---	---	PASS
TEC	7006	broad.mit.edu	37	4	48172291	48172291	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48172291C>A	uc003gxz.2	-	5	519	c.428G>T	c.(427-429)TGT>TTT	p.C143F		NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase	143	Btk-type.	Zinc (By similarity).			intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						GTATTTTTCACATCCGGGTGC	0.289													30	63	---	---	---	---	PASS
LRRC66	339977	broad.mit.edu	37	4	52861814	52861814	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52861814G>C	uc003gzi.2	-	4	1387	c.1374C>G	c.(1372-1374)TTC>TTG	p.F458L		NM_001024611	NP_001019782	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	458						integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3						GTGTCACCCAGAAAGGGGTCT	0.562													55	148	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52936033	52936033	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52936033G>A	uc003gzl.2	+	5	747	c.469G>A	c.(469-471)GCC>ACC	p.A157T	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Intron|SPATA18_uc003gzk.1_Missense_Mutation_p.A157T	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	157	Potential.				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			GAACAGATCGGCCATATCCCT	0.294													11	24	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52944901	52944901	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52944901G>A	uc003gzl.2	+	8	1299	c.1021G>A	c.(1021-1023)GAG>AAG	p.E341K	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.E309K|SPATA18_uc003gzk.1_Missense_Mutation_p.E341K	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	341					mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TTATGTGCAGGAGGCATTCCA	0.393													66	184	---	---	---	---	PASS
SULT1B1	27284	broad.mit.edu	37	4	70596284	70596284	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70596284A>G	uc003hen.2	-	7	1011	c.713T>C	c.(712-714)TTG>TCG	p.L238S		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	238					3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						ATAATTTACCAAAGGATTGTC	0.363													41	119	---	---	---	---	PASS
HTN1	3346	broad.mit.edu	37	4	70921229	70921229	+	Silent	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70921229A>T	uc003hex.2	+	5	184	c.117A>T	c.(115-117)TCA>TCT	p.S39S		NM_002159	NP_002150	P15515	HIS1_HUMAN	histatin 1 precursor	39					biomineral tissue development|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			skin(1)	1						AGCATCATTCACATCGAGAAT	0.348													17	87	---	---	---	---	PASS
GC	2638	broad.mit.edu	37	4	72635072	72635072	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72635072A>T	uc003hge.2	-	2	257	c.104T>A	c.(103-105)CTG>CAG	p.L35Q	GC_uc003hgd.2_5'UTR|GC_uc010iie.2_Missense_Mutation_p.L35Q|GC_uc010iif.2_Missense_Mutation_p.L54Q	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	35	Albumin 1.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	CTCCTTTCCCAGATGGGAGAA	0.408													11	56	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106155322	106155322	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106155322A>T	uc003hxk.2	+	3	609	c.223A>T	c.(223-225)AGT>TGT	p.S75C	TET2_uc011cez.1_Missense_Mutation_p.S96C|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.S75C|TET2_uc003hxi.1_Missense_Mutation_p.S75C	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	75					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TAGTCGTGTGAGTCCTGACTT	0.428			Mis N|F		MDS								66	211	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114251538	114251538	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114251538A>T	uc003ibe.3	+	27	3137	c.3037A>T	c.(3037-3039)AGA>TGA	p.R1013*	ANK2_uc003ibd.3_Nonsense_Mutation_p.R1004*|ANK2_uc003ibf.3_Nonsense_Mutation_p.R1013*|ANK2_uc011cgc.1_Nonsense_Mutation_p.R222*|ANK2_uc003ibg.3_Nonsense_Mutation_p.R41*|ANK2_uc003ibc.2_Nonsense_Mutation_p.R989*|ANK2_uc011cgb.1_Nonsense_Mutation_p.R1028*	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1013	ZU5.|Interaction with SPTBN1.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CAAGCGCCACAGACTGGCAAC	0.547													23	89	---	---	---	---	PASS
ZNF330	27309	broad.mit.edu	37	4	142155097	142155097	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142155097G>T	uc003iiq.3	+	10	1137	c.917G>T	c.(916-918)AGG>ATG	p.R306M	ZNF330_uc011chl.1_Missense_Mutation_p.R246M	NM_014487	NP_055302	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	306						chromosome, centromeric region|midbody|nucleolus	protein binding|zinc ion binding				0	all_hematologic(180;0.162)					AATTTAGGAAGGACCTATGCT	0.363													60	207	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155156611	155156611	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155156611C>T	uc003inw.2	-	25	7828	c.7828G>A	c.(7828-7830)GTG>ATG	p.V2610M		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2610					homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GTGGCATCCACAGGGACCACC	0.483													71	226	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155253955	155253955	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155253955G>A	uc003inw.2	-	9	1908	c.1908C>T	c.(1906-1908)ATC>ATT	p.I636I	DCHS2_uc003inx.2_Silent_p.I1135I	NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	636	Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGTAAGGGCGGATTCCAAACA	0.522													34	85	---	---	---	---	PASS
NAF1	92345	broad.mit.edu	37	4	164054361	164054361	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164054361C>T	uc003iqj.2	-	7	1172	c.978G>A	c.(976-978)AGG>AGA	p.R326R	NAF1_uc010iqw.1_Silent_p.R326R	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	326					rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)				GAGATTTTTTCCTCTGTTTGG	0.323													35	102	---	---	---	---	PASS
CLDN22	53842	broad.mit.edu	37	4	184241242	184241242	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184241242C>A	uc010isa.1	-	1	686	c.130G>T	c.(130-132)GAA>TAA	p.E44*	WWC2_uc010irx.2_3'UTR|WWC2_uc003ivk.3_3'UTR|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_3'UTR|WWC2_uc003ivn.3_3'UTR|WWC2_uc010irz.2_3'UTR|WWC2_uc003ivo.3_3'UTR	NM_001111319	NP_001104789	Q8N7P3	CLD22_HUMAN	claudin 22	44	Extracellular (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.0172)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|Esophageal squamous(56;0.176)		all cancers(43;4.1e-26)|Epithelial(43;6.45e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|Colorectal(24;5.87e-06)|GBM - Glioblastoma multiforme(59;6.5e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GTCCAGTTTTCCATTTCATTT	0.468													95	259	---	---	---	---	PASS
SLC25A4	291	broad.mit.edu	37	4	186066998	186066998	+	Silent	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186066998C>A	uc003ixd.2	+	3	813	c.684C>A	c.(682-684)TCC>TCA	p.S228S	SLC25A4_uc003ixe.2_RNA	NM_001151	NP_001142	P12235	ADT1_HUMAN	adenine nucleotide translocator 1	228	Helical; Name=5; (By similarity).|Solcar 3.				energy reserve metabolic process|interspecies interaction between organisms|mitochondrial genome maintenance|negative regulation of necrotic cell death|regulation of insulin secretion|viral reproduction	integral to plasma membrane|mitochondrial inner membrane	adenine transmembrane transporter activity|protein binding			ovary(1)	1		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	GGCTGGTGTCCTACCCCTTTG	0.542													4	96	---	---	---	---	PASS
LPCAT1	79888	broad.mit.edu	37	5	1489888	1489888	+	Silent	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1489888C>A	uc003jcm.2	-	4	696	c.579G>T	c.(577-579)CGG>CGT	p.R193R		NM_024830	NP_079106	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	193	Lumenal (Potential).				phospholipid biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity|1-alkylglycerophosphocholine O-acetyltransferase activity|calcium ion binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TGGACTGCGCCCGTCTCTTGA	0.512													115	261	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38957742	38957742	+	Intron	SNP	A	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38957742A>C	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CTTTATTCAAATAAGAAGTTA	0.289													33	98	---	---	---	---	PASS
FYB	2533	broad.mit.edu	37	5	39135117	39135117	+	Splice_Site	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39135117C>T	uc003jls.2	-	7	1583	c.1516_splice	c.e7-1	p.L506_splice	FYB_uc003jlt.2_Splice_Site_p.L506_splice|FYB_uc003jlu.2_Splice_Site_p.L506_splice|FYB_uc011cpl.1_Splice_Site_p.L516_splice	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2						cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			GGCCTGTTAGCTGCAAAGAGA	0.338													43	146	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43547830	43547830	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43547830C>A	uc003job.2	-	3	868	c.621G>T	c.(619-621)CAG>CAT	p.Q207H	PAIP1_uc003joa.2_Missense_Mutation_p.Q128H|PAIP1_uc010ivp.2_Missense_Mutation_p.Q128H|PAIP1_uc010ivo.2_RNA|PAIP1_uc003joc.2_Missense_Mutation_p.Q95H	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	207	MIF4G.				mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					GCCAACATACCTGTTGATAGA	0.443													54	122	---	---	---	---	PASS
CDK7	1022	broad.mit.edu	37	5	68568823	68568823	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68568823A>C	uc003jvs.3	+	10	1000	c.819A>C	c.(817-819)CAA>CAC	p.Q273H	CDK7_uc003jvt.3_Missense_Mutation_p.Q232H|CDK7_uc003jvu.3_Missense_Mutation_p.Q180H	NM_001799	NP_001790	P50613	CDK7_HUMAN	cyclin-dependent kinase 7	273	Protein kinase.				androgen receptor signaling pathway|cell division|cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex|mitochondrion	androgen receptor binding|ATP binding|cyclin-dependent protein kinase activity|DNA-dependent ATPase activity|protein C-terminus binding|RNA polymerase II carboxy-terminal domain kinase activity|transcription coactivator activity			lung(1)	1		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		ATCTCATACAAGGCTTATTCT	0.358								NER					49	118	---	---	---	---	PASS
COL4A3BP	10087	broad.mit.edu	37	5	74676909	74676909	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74676909A>T	uc011csu.1	-	16	2157	c.1735T>A	c.(1735-1737)TAT>AAT	p.Y579N	COL4A3BP_uc003kds.2_Missense_Mutation_p.Y553N|COL4A3BP_uc003kdt.2_Missense_Mutation_p.Y707N|COL4A3BP_uc003kdu.2_Missense_Mutation_p.Y579N	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform	579	START.				ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		TTAGCTACATATGTAATCTTG	0.363													104	271	---	---	---	---	PASS
DMGDH	29958	broad.mit.edu	37	5	78322340	78322340	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78322340C>T	uc003kfs.2	-	13	2103	c.2097G>A	c.(2095-2097)ATG>ATA	p.M699I	DMGDH_uc011cte.1_Missense_Mutation_p.M549I|DMGDH_uc011ctf.1_Missense_Mutation_p.M498I|DMGDH_uc011ctg.1_Missense_Mutation_p.M319I	NM_013391	NP_037523	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase precursor	699					choline metabolic process|glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|dimethylglycine dehydrogenase activity|electron carrier activity			ovary(2)|liver(1)|skin(1)	4		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		GGCCTGCATTCATGATAGCGT	0.512													66	166	---	---	---	---	PASS
AFF4	27125	broad.mit.edu	37	5	132233979	132233979	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132233979A>C	uc003kyd.2	-	10	1740	c.1332T>G	c.(1330-1332)AGT>AGG	p.S444R	AFF4_uc011cxk.1_Missense_Mutation_p.S122R|AFF4_uc003kye.1_Missense_Mutation_p.S444R	NM_014423	NP_055238	Q9UHB7	AFF4_HUMAN	ALL1 fused gene from 5q31	444	Ser-rich.				transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AACTACTTTCACTCTCTGAGT	0.522													57	205	---	---	---	---	PASS
PCDHGA11	56105	broad.mit.edu	37	5	140801374	140801374	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140801374G>T	uc003lkq.1	+	1	838	c.580G>T	c.(580-582)GAG>TAG	p.E194*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Nonsense_Mutation_p.E194*|PCDHGA11_uc003lkp.1_Nonsense_Mutation_p.E194*	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	194	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGAATCCAGAGCTAGTACT	0.562													18	72	---	---	---	---	PASS
RELL2	285613	broad.mit.edu	37	5	141019704	141019704	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141019704G>T	uc003lli.2	+	6	1569	c.721G>T	c.(721-723)GGA>TGA	p.G241*	RELL2_uc003llh.2_Nonsense_Mutation_p.G241*|RELL2_uc003llg.2_Nonsense_Mutation_p.G175*|RELL2_uc010jgf.2_Nonsense_Mutation_p.G175*|FCHSD1_uc010jgg.2_3'UTR|FCHSD1_uc003llj.2_RNA|FCHSD1_uc003llk.2_3'UTR	NM_001130029	NP_001123501	Q8NC24	RELL2_HUMAN	RELT-like 2	241						integral to membrane|plasma membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAATGGAGGACTCAGGGA	0.667													4	82	---	---	---	---	PASS
CSF1R	1436	broad.mit.edu	37	5	149441342	149441342	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149441342G>A	uc003lrl.2	-	11	1892	c.1697C>T	c.(1696-1698)CCC>CTC	p.P566L	CSF1R_uc011dcd.1_Missense_Mutation_p.P418L|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Missense_Mutation_p.P566L	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	566	Cytoplasmic (Potential).				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CAGCTGCGTGGGGTCGATGAA	0.552													91	216	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156593032	156593032	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156593032T>A	uc003lwn.2	-	1	248	c.148A>T	c.(148-150)AAT>TAT	p.N50Y		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	50						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGAATAAAATTACTCTCGAAC	0.458													96	310	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169230202	169230202	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169230202C>A	uc003maf.2	+	26	2775	c.2695C>A	c.(2695-2697)CAG>AAG	p.Q899K	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.Q391K	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	899					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTTAGCTACCAGGATGCGGT	0.478													70	112	---	---	---	---	PASS
RASGEF1C	255426	broad.mit.edu	37	5	179528493	179528493	+	3'UTR	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179528493C>T	uc003mlq.2	-	13					RASGEF1C_uc003mlr.2_3'UTR|RASGEF1C_uc003mlp.3_3'UTR	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCCTCAGCTCAGCGCTTTCA	0.587													23	34	---	---	---	---	PASS
DUSP22	56940	broad.mit.edu	37	6	348265	348265	+	Missense_Mutation	SNP	G	T	T	rs143018862		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:348265G>T	uc003msx.2	+	6	865	c.426G>T	c.(424-426)GAG>GAT	p.E142D	DUSP22_uc011dhn.1_Missense_Mutation_p.E142D|DUSP22_uc003msy.1_Missense_Mutation_p.E99D	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	142					apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		AGAAGCATGAGGTCCATCAGG	0.582													25	303	---	---	---	---	PASS
OR11A1	26531	broad.mit.edu	37	6	29395006	29395006	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29395006C>A	uc003nmg.2	-	1	504	c.413G>T	c.(412-414)GGG>GTG	p.G138V		NM_013937	NP_039225	Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A,	138	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						CCGTCTGGGCCCCATCAGGAG	0.577													69	59	---	---	---	---	PASS
NFKBIL1	4795	broad.mit.edu	37	6	31526324	31526324	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31526324G>T	uc003nub.2	+	4	1201	c.1082G>T	c.(1081-1083)CGT>CTT	p.R361L	NFKBIL1_uc011dnr.1_Missense_Mutation_p.R323L|NFKBIL1_uc011dns.1_Missense_Mutation_p.R338L|NFKBIL1_uc011dnt.1_RNA|NFKBIL1_uc003nuc.2_Missense_Mutation_p.R346L	NM_005007	NP_004998	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene	361					cytoplasmic sequestering of transcription factor		protein binding				0						GAGCTGGGCCGTGTGATGGGA	0.617													7	3	---	---	---	---	PASS
WDR46	9277	broad.mit.edu	37	6	33256237	33256237	+	Missense_Mutation	SNP	G	A	A	rs34704405		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33256237G>A	uc003ods.2	-	4	415	c.371C>T	c.(370-372)TCT>TTT	p.S124F	WDR46_uc011dra.1_Missense_Mutation_p.S70F|WDR46_uc010juo.1_RNA|PFDN6_uc003odt.1_5'Flank|PFDN6_uc010jup.1_5'Flank	NM_005452	NP_005443	O15213	WDR46_HUMAN	WD repeat domain 46 isoform 1	124											0						TTTGGCTTTAGAATGTGGTAG	0.512													230	188	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50696583	50696583	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50696583G>T	uc003paf.2	+	4	1125	c.613G>T	c.(613-615)GTC>TTC	p.V205F	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	205							DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					CACCTGTGTGGTCAACCCCAC	0.438													147	132	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51947969	51947969	+	Intron	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51947969A>T	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GTAAAACCCCAACCTACCATC	0.408													93	101	---	---	---	---	PASS
ANKRD6	22881	broad.mit.edu	37	6	90323537	90323537	+	Silent	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90323537T>A	uc003pni.3	+	7	884	c.543T>A	c.(541-543)GCT>GCA	p.A181A	ANKRD6_uc003pne.3_Silent_p.A181A|ANKRD6_uc003pnf.3_Silent_p.A181A|ANKRD6_uc011dzy.1_Silent_p.A181A|ANKRD6_uc010kcd.2_Silent_p.A148A|LYRM2_uc010kce.1_Intron|LYRM2_uc003png.2_Intron|ANKRD6_uc003pnh.3_5'UTR	NM_014942	NP_055757	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	181	ANK 6.						protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		TGCACGTTGCTGCGCGCTATA	0.433													26	43	---	---	---	---	PASS
MOXD1	26002	broad.mit.edu	37	6	132649614	132649614	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132649614G>C	uc003qdf.2	-	5	882	c.783C>G	c.(781-783)AAC>AAG	p.N261K	MOXD1_uc003qde.2_Missense_Mutation_p.N193K	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	261	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		CATCGGGCATGTTGGGGTGAT	0.502													42	88	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	149983278	149983278	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149983278C>T	uc003qmu.1	-	8	3528	c.2980G>A	c.(2980-2982)GAT>AAT	p.D994N	LATS1_uc010kif.1_Missense_Mutation_p.D889N	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	994	Protein kinase.				cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		CCTAAGCGATCTTCGGGTCCT	0.403													6	287	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152770762	152770762	+	Nonsense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152770762G>C	uc010kiw.2	-	28	4012	c.3410C>G	c.(3409-3411)TCA>TGA	p.S1137*	SYNE1_uc003qot.3_Nonsense_Mutation_p.S1144*|SYNE1_uc003qou.3_Nonsense_Mutation_p.S1137*|SYNE1_uc010kjb.1_Nonsense_Mutation_p.S1120*|SYNE1_uc003qow.2_Nonsense_Mutation_p.S432*|SYNE1_uc003qox.1_Nonsense_Mutation_p.S653*	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1137	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TATCCAAGATGAGAACTCAGA	0.383										HNSCC(10;0.0054)			6	135	---	---	---	---	PASS
MTRF1L	54516	broad.mit.edu	37	6	153316259	153316259	+	Intron	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153316259T>C	uc003qpi.3	-						MTRF1L_uc003qpl.3_Intron|MTRF1L_uc011efa.1_Intron|MTRF1L_uc003qpj.3_Intron|MTRF1L_uc003qpk.3_Intron	NM_019041	NP_061914	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor							mitochondrion	translation release factor activity, codon specific				0		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		ACAAAATGAATAGTTTACTGA	0.338													21	23	---	---	---	---	PASS
PRR18	285800	broad.mit.edu	37	6	166720810	166720810	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166720810T>A	uc003quw.1	-	1	1062	c.821A>T	c.(820-822)GAG>GTG	p.E274V		NM_175922	NP_787118	Q8N4B5	PRR18_HUMAN	proline rich region 18	274						endoplasmic reticulum					0		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		agccgcggACTCCACGCCGCG	0.582													4	7	---	---	---	---	PASS
CALN1	83698	broad.mit.edu	37	7	71743773	71743773	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71743773C>A	uc003twa.3	-	2	543	c.16G>T	c.(16-18)GTG>TTG	p.V6L	CALN1_uc003twb.3_Missense_Mutation_p.V48L|CALN1_uc003twc.3_Missense_Mutation_p.V6L	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	6	Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				CCGGCGGTCACATGGTGGAAC	0.507													16	78	---	---	---	---	PASS
ADAM22	53616	broad.mit.edu	37	7	87792420	87792420	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87792420G>T	uc003ujn.2	+	23	2080	c.2001G>T	c.(1999-2001)AGG>AGT	p.R667S	ADAM22_uc003ujk.1_Missense_Mutation_p.R667S|ADAM22_uc003ujl.1_Missense_Mutation_p.R667S|ADAM22_uc003ujm.2_Missense_Mutation_p.R667S|ADAM22_uc003ujo.2_Missense_Mutation_p.R667S|ADAM22_uc003ujp.1_Missense_Mutation_p.R719S	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	667	Cys-rich.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			TAGAACACAGGTGTCTTCCTG	0.428													83	262	---	---	---	---	PASS
ASNS	440	broad.mit.edu	37	7	97486048	97486048	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97486048T>C	uc003uot.3	-	8	1490	c.984A>G	c.(982-984)ATA>ATG	p.I328M	ASNS_uc011kin.1_Missense_Mutation_p.I245M|ASNS_uc003uou.3_Missense_Mutation_p.I328M|ASNS_uc003uov.3_Missense_Mutation_p.I328M|ASNS_uc011kio.1_Missense_Mutation_p.I307M|ASNS_uc003uow.3_Missense_Mutation_p.I307M|ASNS_uc003uox.3_Missense_Mutation_p.I245M	NM_133436	NP_597680	P08243	ASNS_HUMAN	asparagine synthetase	328	Asparagine synthetase.				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	CCAAGGAAAATATGACTTCAT	0.308													51	174	---	---	---	---	PASS
LRCH4	4034	broad.mit.edu	37	7	100183504	100183504	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100183504C>T	uc003uvj.2	-	1	273	c.220G>A	c.(220-222)GAC>AAC	p.D74N	LRCH4_uc003uvi.2_5'Flank|LRCH4_uc011kjx.1_RNA|FBXO24_uc010lha.1_5'Flank|FBXO24_uc003uvl.1_5'Flank|FBXO24_uc003uvm.1_5'Flank|FBXO24_uc003uvn.1_5'Flank	NM_002319	NP_002310	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH)	74	LRR 2.				nervous system development	PML body	protein binding			large_intestine(1)|ovary(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTGCACTCACCAGCCTGGGTG	0.552													3	60	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100349596	100349596	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100349596C>G	uc003uwj.2	+	14	2033	c.1868C>G	c.(1867-1869)TCA>TGA	p.S623*	ZAN_uc003uwk.2_Nonsense_Mutation_p.S623*|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	623	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACCATTCCCTCAGAAAAACCC	0.478													37	111	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126544029	126544029	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126544029C>G	uc003vlr.2	-	4	1326	c.1015G>C	c.(1015-1017)GAT>CAT	p.D339H	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.D339H|GRM8_uc010lkz.1_RNA|GRM8_uc003vlu.1_Missense_Mutation_p.D60H	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	339	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TTCTTACCATCAATTGATGCT	0.408										HNSCC(24;0.065)			55	315	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133884059	133884059	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133884059C>T	uc003vrm.1	+	14	1649	c.1633C>T	c.(1633-1635)CGG>TGG	p.R545W		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	545	Guanylate kinase-like.						ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						GGGATATTTGCGGAGAAAAGG	0.358													6	425	---	---	---	---	PASS
OR2F2	135948	broad.mit.edu	37	7	143632899	143632899	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143632899A>G	uc011ktv.1	+	1	574	c.574A>G	c.(574-576)ACC>GCC	p.T192A		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	192	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					TTGTGTGGACACCTCCTCCAA	0.493													26	89	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701878	143701878	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701878C>G	uc003wdt.1	+	1	789	c.789C>G	c.(787-789)ATC>ATG	p.I263M		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					CTCGAGTTATCCATGCCTTCA	0.428													81	240	---	---	---	---	PASS
RGS20	8601	broad.mit.edu	37	8	54791911	54791911	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54791911T>A	uc003xrp.2	+	2	351	c.259T>A	c.(259-261)TCT>ACT	p.S87T	RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrr.2_5'Flank|RGS20_uc003xrs.2_5'Flank|RGS20_uc003xrt.2_5'Flank	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a	87					negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			AAGGTTCTTCTCTCACCTTCT	0.711													93	299	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68184115	68184115	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68184115T>C	uc003xxo.1	-	10	1784	c.1394A>G	c.(1393-1395)CAG>CGG	p.Q465R		NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	465					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCCTGCATTCTGCAGAATGGA	0.358													30	81	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69017537	69017537	+	Intron	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69017537C>A	uc003xxv.1	+						PREX2_uc003xxu.1_Missense_Mutation_p.H960Q|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GAAGACAGCACTGCATTCCTG	0.498													52	151	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71069128	71069128	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71069128C>T	uc003xyn.1	-	11	1634	c.1472G>A	c.(1471-1473)CGC>CAC	p.R491H		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	491					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AGGGCTCATGCGATGCCTTGG	0.567			T	RUNXBP2	AML								42	117	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77764395	77764395	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764395G>A	uc003yav.2	+	10	5490	c.5103G>A	c.(5101-5103)ACG>ACA	p.T1701T	ZFHX4_uc003yau.1_Silent_p.T1746T|ZFHX4_uc003yaw.1_Silent_p.T1701T	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1701	Gln-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACCTGGGACGGAGTTCAGCT	0.507										HNSCC(33;0.089)			32	74	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113347704	113347704	+	Splice_Site	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113347704C>T	uc003ynu.2	-	45	7179	c.7020_splice	c.e45-1	p.W2340_splice	CSMD3_uc003yns.2_Splice_Site_p.W1542_splice|CSMD3_uc003ynt.2_Splice_Site_p.W2300_splice|CSMD3_uc011lhx.1_Splice_Site_p.W2236_splice|CSMD3_uc003ynw.1_Splice_Site_p.W51_splice	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGGTCCATCCCTATGAGACAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			33	87	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113529362	113529362	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113529362G>A	uc003ynu.2	-	28	4816	c.4657C>T	c.(4657-4659)CAA>TAA	p.Q1553*	CSMD3_uc003yns.2_Nonsense_Mutation_p.Q825*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.Q1513*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.Q1449*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1553	Extracellular (Potential).|Sushi 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGGTCACATTGAAAAACAACA	0.498										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			41	137	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133150232	133150232	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133150232A>T	uc003ytj.2	-	12	1825	c.1600T>A	c.(1600-1602)TTC>ATC	p.F534I	KCNQ3_uc010mdt.2_Missense_Mutation_p.F534I	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	534					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GTCTCCTTGAATTTTTTTTTA	0.453													54	169	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133948102	133948102	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133948102G>C	uc003ytw.2	+	25	5075	c.5034G>C	c.(5032-5034)TTG>TTC	p.L1678F	TG_uc010mdw.2_Missense_Mutation_p.L437F|TG_uc011ljb.1_Missense_Mutation_p.L111F	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	1678	Type IIIA.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CTGTGTATTTGAAAAAGGGTA	0.547													24	59	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139255189	139255189	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139255189G>T	uc003yuy.2	-	7	836	c.665C>A	c.(664-666)TCA>TAA	p.S222*	FAM135B_uc003yux.2_Nonsense_Mutation_p.S123*|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	222										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CCTTACCTCTGAGGAAGTCGG	0.463										HNSCC(54;0.14)			22	120	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139606452	139606452	+	Intron	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139606452A>G	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTGTAAAGTAGAAAAAGAGA	0.537										HNSCC(7;0.00092)			27	63	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143614677	143614677	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143614677C>T	uc003ywm.2	+	24	3603	c.3420C>T	c.(3418-3420)TGC>TGT	p.C1140C		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1140	Helical; Name=6; (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GGAGCTCCTGCGTGGTGCTGC	0.701													4	3	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143960554	143960554	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143960554C>A	uc003yxi.2	-	2	296	c.289G>T	c.(289-291)GTG>TTG	p.V97L	CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.V97L|CYP11B1_uc010mey.2_Missense_Mutation_p.V142L	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	97					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	AGCTTCTCCACGTCCTCCGGC	0.622									Familial_Hyperaldosteronism_type_I				39	103	---	---	---	---	PASS
ZNF696	79943	broad.mit.edu	37	8	144378669	144378669	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144378669G>T	uc003yxy.3	+	3	1233	c.824G>T	c.(823-825)AGC>ATC	p.S275I		NM_030895	NP_112157	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	275	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CAGGCCTTCAGCCAGAGCTCC	0.711													6	18	---	---	---	---	PASS
SLC39A4	55630	broad.mit.edu	37	8	145640097	145640097	+	Intron	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145640097G>A	uc003zcq.2	-						SLC39A4_uc003zcm.1_5'Flank|SLC39A4_uc003zcn.2_5'Flank|SLC39A4_uc003zco.2_Intron|SLC39A4_uc003zcp.2_Intron	NM_130849	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter),							cytoplasmic membrane-bounded vesicle|integral to membrane|recycling endosome membrane	zinc ion transmembrane transporter activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			CAATGTCGGCGTGGGCACTCA	0.642													19	62	---	---	---	---	PASS
DMRT3	58524	broad.mit.edu	37	9	990423	990423	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:990423G>A	uc003zgw.1	+	2	875	c.837G>A	c.(835-837)GTG>GTA	p.V279V		NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor	279					cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		GGGACCTGGTGAGCGCCGTGG	0.572													50	54	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32633641	32633641	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32633641G>T	uc003zrg.1	-	1	2027	c.1937C>A	c.(1936-1938)GCA>GAA	p.A646E	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	646					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTGAGAGAGTGCACCAAATGA	0.507													130	110	---	---	---	---	PASS
TMC1	117531	broad.mit.edu	37	9	75403364	75403364	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75403364G>T	uc004aiz.1	+	14	1534	c.994G>T	c.(994-996)GAC>TAC	p.D332Y	TMC1_uc010moz.1_Missense_Mutation_p.D290Y|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.D186Y|TMC1_uc010mpa.1_Missense_Mutation_p.D186Y	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	332	Cytoplasmic (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						TGAAACAGCAGACAACAAATT	0.398													95	76	---	---	---	---	PASS
UBQLN1	29979	broad.mit.edu	37	9	86278932	86278932	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86278932C>T	uc004amv.2	-	10	2049	c.1475G>A	c.(1474-1476)GGA>GAA	p.G492E	UBQLN1_uc004amw.2_Missense_Mutation_p.G464E	NM_013438	NP_038466	Q9UMX0	UBQL1_HUMAN	ubiquilin 1 isoform 1	492					apoptosis|regulation of protein ubiquitination|response to hypoxia	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm|proteasome complex	kinase binding				0						TCCAGTGCTTCCTAATGCCCC	0.468													75	200	---	---	---	---	PASS
C9orf89	84270	broad.mit.edu	37	9	95872921	95872921	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95872921G>A	uc004atd.2	+	3	400	c.222G>A	c.(220-222)GAG>GAA	p.E74E	C9orf89_uc004ate.2_RNA|C9orf89_uc004atf.2_RNA	NM_032310	NP_115686	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	74	CARD.				negative regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|nucleus	CARD domain binding				0						GGAGCGGTGAGCGGGACTGCC	0.502													73	85	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116269689	116269689	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116269689C>T	uc004bhq.2	+	14	1417	c.1208C>T	c.(1207-1209)CCC>CTC	p.P403L	RGS3_uc004bhr.2_Missense_Mutation_p.P291L|RGS3_uc004bhs.2_Missense_Mutation_p.P293L|RGS3_uc004bht.2_Missense_Mutation_p.P122L|RGS3_uc010muy.2_Missense_Mutation_p.P122L|RGS3_uc004bhu.2_Missense_Mutation_p.P29L	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	403					inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CAGTCACCCCCCAACAAACGG	0.647													14	80	---	---	---	---	PASS
WDR34	89891	broad.mit.edu	37	9	131396147	131396147	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131396147T>C	uc004bvq.1	-	9	1611	c.1487A>G	c.(1486-1488)CAG>CGG	p.Q496R	WDR34_uc004bvs.1_Missense_Mutation_p.Q487R|WDR34_uc004bvr.1_Missense_Mutation_p.Q468R	NM_052844	NP_443076	Q96EX3	WDR34_HUMAN	WD repeat domain 34	496	WD 5.					cytoplasm				central_nervous_system(2)|skin(1)	3						AGCCAAGAGCTGAGTCTGCTG	0.562													4	128	---	---	---	---	PASS
PFKP	5214	broad.mit.edu	37	10	3147652	3147652	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3147652G>C	uc001igp.2	+	7	769	c.733G>C	c.(733-735)GAG>CAG	p.E245Q	PFKP_uc001igq.2_Missense_Mutation_p.E237Q|PFKP_uc009xhr.2_Missense_Mutation_p.E207Q|PFKP_uc009xhs.1_Missense_Mutation_p.E29Q|PFKP_uc009xht.2_5'Flank	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet	245					glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		ATCTCCACCAGAGGAAGGCTG	0.582													69	204	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8100379	8100379	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100379C>T	uc001ika.2	+	3	910	c.353C>T	c.(352-354)TCC>TTC	p.S118F	GATA3_uc001ijz.2_Missense_Mutation_p.S118F	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	118					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						AGCCCCTTCTCCAAGACGTCC	0.706			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						34	152	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15688891	15688891	+	Silent	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15688891A>G	uc001ioc.1	-	12	1161	c.1161T>C	c.(1159-1161)GGT>GGC	p.G387G	ITGA8_uc010qcb.1_Silent_p.G372G	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	387	Extracellular (Potential).|FG-GAP 6.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						CCATAGCACTACCGAATCTCC	0.473													28	71	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18270417	18270417	+	Intron	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18270417G>T	uc001ipo.2	+						SLC39A12_uc001ipn.2_Intron|SLC39A12_uc001ipp.2_Intron|SLC39A12_uc010qck.1_Intron	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						TGGAGAGTAAGTTCTGGATCT	0.388													18	48	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28274056	28274056	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28274056T>A	uc009xky.2	-	4	565	c.467A>T	c.(466-468)AAA>ATA	p.K156I	ARMC4_uc010qdt.1_5'Flank|ARMC4_uc001itz.2_Missense_Mutation_p.K156I	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	156							binding			ovary(4)|skin(2)	6						TCTGGTAATTTTGCCAAGAAT	0.338													10	25	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43316087	43316087	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43316087G>A	uc001jaj.2	+	17	3259	c.2901G>A	c.(2899-2901)AGG>AGA	p.R967R		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	967					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						GAAGACAAAGGCTTCTAAAGT	0.428													47	154	---	---	---	---	PASS
GPRIN2	9721	broad.mit.edu	37	10	46999128	46999128	+	Missense_Mutation	SNP	G	C	C	rs149580948		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46999128G>C	uc001jec.2	+	3	383	c.248G>C	c.(247-249)CGA>CCA	p.R83P	GPRIN2_uc010qfq.1_5'Flank	NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth	83											0						CCCAAGGCGCGACCCAGTGCT	0.697													8	74	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50946033	50946033	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50946033T>A	uc001jie.2	-	19	2619	c.2477A>T	c.(2476-2478)CAC>CTC	p.H826L	OGDHL_uc009xog.2_Missense_Mutation_p.H853L|OGDHL_uc010qgt.1_Missense_Mutation_p.H769L|OGDHL_uc010qgu.1_Missense_Mutation_p.H617L	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	826					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						GCGCAGCACGTGGAAGTAGTT	0.642													119	308	---	---	---	---	PASS
TTC18	118491	broad.mit.edu	37	10	75113480	75113480	+	Silent	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75113480A>G	uc009xrc.2	-	3	205	c.84T>C	c.(82-84)ACT>ACC	p.T28T	TTC18_uc001jty.2_Silent_p.T28T|TTC18_uc009xrd.1_5'UTR	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18	28							binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					AGGTAACTGGAGTATCTCCTT	0.363													26	105	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89717708	89717708	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89717708C>T	uc001kfb.2	+	8	1764	c.733C>T	c.(733-735)CAG>TAG	p.Q245*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	245	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Q245*(6)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.F243fs*9(1)|p.Q245fs*20(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGAGTTCCCTCAGCCGTTACC	0.418		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			63	103	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104176796	104176796	+	5'UTR	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104176796G>T	uc001kvg.1	-	2					PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_5'UTR|PSD_uc001kvi.1_5'UTR|FBXL15_uc001kvj.1_5'Flank|FBXL15_uc001kvk.2_5'Flank|FBXL15_uc001kvl.1_5'Flank	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing						regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCTGGGCCATGCTGGGGCCGG	0.701													3	6	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106907400	106907400	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106907400A>G	uc001kyi.1	+	9	1555	c.1328A>G	c.(1327-1329)GAG>GGG	p.E443G		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	443	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		AGTACAGACGAGAACCAAGTA	0.478													38	94	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	106976840	106976840	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106976840C>A	uc001kyi.1	+	19	2921	c.2694C>A	c.(2692-2694)AAC>AAA	p.N898K	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	898	PKD.|Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CAGAGAACAACCTTGGCTCAG	0.527													49	117	---	---	---	---	PASS
IGF2AS	51214	broad.mit.edu	37	11	2167571	2167571	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2167571C>T	uc010qxi.1	+	2	538	c.401C>T	c.(400-402)CCG>CTG	p.P134L	IGF2_uc001lvh.2_Intron|INS-IGF2_uc001lvi.2_Intron|IGF2AS_uc001lvk.1_RNA|IGF2AS_uc001lvl.1_Intron	NM_016412	NP_057496			RecName: Full=Putative insulin-like growth factor 2 antisense gene protein;          Short=IGF2-AS; AltName: Full=PEG8/IGF2AS protein;												0		all_epithelial(84;0.00018)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.00388)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		AGCGCCCCTCCGTCACCCCCT	0.687													73	151	---	---	---	---	PASS
OR52N2	390077	broad.mit.edu	37	11	5841948	5841948	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5841948T>C	uc010qzp.1	+	1	383	c.383T>C	c.(382-384)ATC>ACC	p.I128T	TRIM5_uc001mbq.1_Intron	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TATGTGGCCATCTGCTACCCC	0.542													65	150	---	---	---	---	PASS
ZNF215	7762	broad.mit.edu	37	11	6964374	6964374	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6964374G>T	uc001mey.2	+	5	1132	c.544G>T	c.(544-546)GAC>TAC	p.D182Y	ZNF215_uc010raw.1_Intron|ZNF215_uc010rax.1_Intron|ZNF215_uc001mez.1_Missense_Mutation_p.D182Y	NM_013250	NP_037382	Q9UL58	ZN215_HUMAN	zinc finger protein 215	182	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		GGGGCAACTGGACTCTGCTGT	0.403													97	298	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15260621	15260621	+	Splice_Site	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15260621G>C	uc001mly.2	+	11	1580	c.1534_splice	c.e11+1	p.C512_splice	INSC_uc001mlz.2_Splice_Site_p.C465_splice|INSC_uc001mma.2_Splice_Site_p.C465_splice|INSC_uc010rcs.1_Splice_Site_p.C500_splice|INSC_uc001mmb.2_Splice_Site_p.C465_splice|INSC_uc001mmc.2_Splice_Site_p.C423_splice	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						CGGCTCAGCTGTGAGTGGTGC	0.617													23	77	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43423094	43423094	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43423094G>A	uc001mxi.2	+	10	1332	c.1318G>A	c.(1318-1320)GTG>ATG	p.V440M	TTC17_uc001mxh.2_Missense_Mutation_p.V440M|TTC17_uc010rfj.1_Missense_Mutation_p.V383M|TTC17_uc001mxj.2_Missense_Mutation_p.V210M	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	440							binding			ovary(5)	5						CTTTGAAAATGTGGACTATGT	0.373													13	46	---	---	---	---	PASS
EXT2	2132	broad.mit.edu	37	11	44255735	44255735	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44255735G>T	uc001mxz.2	+	12	2211	c.1877G>T	c.(1876-1878)TGT>TTT	p.C626F	EXT2_uc010rfo.1_Missense_Mutation_p.C654F|EXT2_uc001mxy.2_Missense_Mutation_p.C639F|EXT2_uc009ykt.2_Missense_Mutation_p.C636F|EXT2_uc001mya.2_Missense_Mutation_p.C659F	NM_207122	NP_997005	Q93063	EXT2_HUMAN	exostosin 2 isoform 2	626	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction	Golgi membrane|integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity			lung(2)|breast(2)|skin(1)	5						CATATGAACTGTGAAGATATT	0.333			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses				26	105	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47857309	47857309	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47857309T>A	uc001ngm.2	-	7	1080	c.995A>T	c.(994-996)AAA>ATA	p.K332I	NUP160_uc009ylw.2_RNA	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	332					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						CCGAAGGTCTTTCTTCACAGG	0.458													106	229	---	---	---	---	PASS
OR4A47	403253	broad.mit.edu	37	11	48511193	48511193	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48511193A>T	uc010rhx.1	+	1	849	c.849A>T	c.(847-849)TTA>TTT	p.L283F		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGAACCCCTTAATCTACACTC	0.408													151	438	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433289	55433289	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433289A>T	uc001nht.3	+	3	912	c.647A>T	c.(646-648)TAC>TTC	p.Y216F	OR4C6_uc010rik.1_Missense_Mutation_p.Y216F	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	216	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						ATTGCGTCCTACACGGTCATC	0.512													91	232	---	---	---	---	PASS
OR8K5	219453	broad.mit.edu	37	11	55927467	55927467	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55927467G>T	uc010rja.1	-	1	327	c.327C>A	c.(325-327)ATC>ATA	p.I109I		NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				AAAATTCACTGATAATGAACA	0.418													80	228	---	---	---	---	PASS
GLYATL1	92292	broad.mit.edu	37	11	58711127	58711127	+	5'UTR	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58711127C>T	uc001nnf.2	+	3					uc001nng.1_Intron|GLYATL1_uc001nnh.1_Silent_p.L46L|GLYATL1_uc001nni.1_5'UTR|GLYATL1_uc001nnj.1_5'UTR			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;							mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	ctcagagtggctgaggataat	0.000													34	83	---	---	---	---	PASS
DTX4	23220	broad.mit.edu	37	11	58956628	58956628	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58956628C>T	uc001nns.2	+						DTX4_uc001nnr.2_Intron	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN	deltex 4 homolog						Notch signaling pathway	cytoplasm	zinc ion binding			lung(2)|central_nervous_system(1)	3		all_epithelial(135;0.125)				TGCCCTGCCCCTTCCAGGAAT	0.557													11	47	---	---	---	---	PASS
MS4A2	2206	broad.mit.edu	37	11	59860957	59860957	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59860957A>T	uc001nop.2	+	5	565	c.463A>T	c.(463-465)AGC>TGC	p.S155C	MS4A2_uc009ymu.2_Missense_Mutation_p.S155C	NM_000139	NP_000130	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member	155	Extracellular (Potential).				cell proliferation|humoral immune response	integral to plasma membrane	calcium channel activity			ovary(1)	1		all_epithelial(135;0.245)			Omalizumab(DB00043)	CCTGAAGAAGAGCTTGGCCTA	0.443													85	226	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62290332	62290332	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62290332C>T	uc001ntl.2	-	5	11857	c.11557G>A	c.(11557-11559)GAG>AAG	p.E3853K	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	3853					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AACTTTCCCTCTGGGCCTTCG	0.493													237	524	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68337285	68337285	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68337285C>T	uc001onw.2	+	11	1465	c.1198C>T	c.(1198-1200)CTT>TTT	p.L400F	SAPS3_uc001onv.2_Missense_Mutation_p.L400F|SAPS3_uc001ony.3_Missense_Mutation_p.L400F|SAPS3_uc001onx.2_Missense_Mutation_p.L400F|SAPS3_uc009ysh.2_Missense_Mutation_p.L349F|SAPS3_uc001onu.2_Missense_Mutation_p.L349F|SAPS3_uc010rqc.1_Missense_Mutation_p.L168F|SAPS3_uc010rqd.1_Missense_Mutation_p.L112F	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	400					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			TGCACTGATTCTTGCAAGTCC	0.328													96	258	---	---	---	---	PASS
GAB2	9846	broad.mit.edu	37	11	77936216	77936216	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77936216G>C	uc001ozh.2	-	5	1240	c.1240C>G	c.(1240-1242)CGT>GGT	p.R414G	GAB2_uc001ozg.2_Missense_Mutation_p.R376G	NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a	414					osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			TCTCCACCACGCTGTGGGTAC	0.532													21	95	---	---	---	---	PASS
C11orf54	28970	broad.mit.edu	37	11	93494771	93494771	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93494771G>A	uc009ywi.2	+	10	1196	c.865G>A	c.(865-867)GAA>AAA	p.E289K	C11orf54_uc001pef.2_Missense_Mutation_p.E239K|C11orf54_uc001peg.2_Missense_Mutation_p.E289K|C11orf54_uc001peh.2_Missense_Mutation_p.E289K|C11orf54_uc001pei.2_Missense_Mutation_p.E270K|C11orf54_uc001pej.2_Missense_Mutation_p.E270K|C11orf54_uc001pek.2_Missense_Mutation_p.E178K	NM_014039	NP_054758	Q9H0W9	CK054_HUMAN	hypothetical protein LOC28970	289						nucleus	hydrolase activity, acting on ester bonds|protein binding|zinc ion binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AGATATAGTGGAATATCTTGG	0.398													15	268	---	---	---	---	PASS
AASDHPPT	60496	broad.mit.edu	37	11	105962125	105962125	+	Nonsense_Mutation	SNP	T	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105962125T>G	uc001pjc.1	+	4	760	c.614T>G	c.(613-615)TTA>TGA	p.L205*	AASDHPPT_uc010rvn.1_RNA|AASDHPPT_uc001pjd.1_Nonsense_Mutation_p.L58*	NM_015423	NP_056238	Q9NRN7	ADPPT_HUMAN	aminoadipate-semialdehyde	205					macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)		CTATCTCCATTAAACTTGGAT	0.363													64	229	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124253009	124253009	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124253009G>T	uc010sai.1	-	1	231	c.231C>A	c.(229-231)TTC>TTA	p.F77L	OR8B2_uc001qab.3_RNA	NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	77	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		TTTTGGGAGTGAAAACAGAGG	0.388													82	289	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134038017	134038017	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134038017G>A	uc001qhd.1	-	27	4053	c.3447C>T	c.(3445-3447)CTC>CTT	p.L1149L	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA|NCAPD3_uc001qhc.1_Silent_p.L99L	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1149					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CCTTTGAGCTGAGGACCTCAA	0.488													71	188	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2774864	2774864	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2774864C>T	uc009zdu.1	+	38	4973	c.4660C>T	c.(4660-4662)CCT>TCT	p.P1554S	CACNA1C_uc009zdv.1_Missense_Mutation_p.P1503S|CACNA1C_uc001qkb.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qkc.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qke.2_Missense_Mutation_p.P1495S|CACNA1C_uc001qkf.2_Missense_Mutation_p.P1495S|CACNA1C_uc001qjz.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qkd.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qkg.2_Missense_Mutation_p.P1493S|CACNA1C_uc009zdw.1_Missense_Mutation_p.P1528S|CACNA1C_uc001qkh.2_Missense_Mutation_p.P1495S|CACNA1C_uc001qkl.2_Missense_Mutation_p.P1554S|CACNA1C_uc001qkn.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qko.2_Missense_Mutation_p.P1526S|CACNA1C_uc001qkp.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qkr.2_Missense_Mutation_p.P1523S|CACNA1C_uc001qku.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qkq.2_Missense_Mutation_p.P1534S|CACNA1C_uc001qks.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qkt.2_Missense_Mutation_p.P1506S|CACNA1C_uc001qki.1_Missense_Mutation_p.P1242S|CACNA1C_uc001qkj.1_Missense_Mutation_p.P1242S|CACNA1C_uc001qkk.1_Missense_Mutation_p.P1242S|CACNA1C_uc001qkm.1_Missense_Mutation_p.P1231S|CACNA1C_uc010sea.1_Missense_Mutation_p.P197S	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1554	Cytoplasmic (Potential).|By similarity.				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	AGAGTATGACCCTGAAGCCAA	0.517													17	64	---	---	---	---	PASS
KCNA6	3742	broad.mit.edu	37	12	4920492	4920492	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4920492T>A	uc001qng.2	+	1	2151	c.1285T>A	c.(1285-1287)TAC>AAC	p.Y429N		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	429						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						CGGGGACATGTACCCCATGAC	0.582										HNSCC(72;0.22)			59	149	---	---	---	---	PASS
MANSC1	54682	broad.mit.edu	37	12	12483728	12483728	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12483728C>T	uc001rai.1	-	4	787	c.529G>A	c.(529-531)GGA>AGA	p.G177R	MANSC1_uc010shm.1_Missense_Mutation_p.G111R|MANSC1_uc001raj.1_Missense_Mutation_p.G143R|MANSC1_uc009zht.1_Missense_Mutation_p.G96R	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor	177	Extracellular (Potential).					integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		TCTGAGGATCCAAACTTCTGA	0.433													54	162	---	---	---	---	PASS
SENP1	29843	broad.mit.edu	37	12	48458880	48458880	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48458880C>G	uc001rqx.2	-	12	1689	c.1243G>C	c.(1243-1245)GAT>CAT	p.D415H	SENP1_uc001rqw.2_Missense_Mutation_p.D415H|SENP1_uc001rqy.2_Missense_Mutation_p.D216H|SENP1_uc001rqz.2_Missense_Mutation_p.D216H|SENP1_uc009zkx.2_Missense_Mutation_p.D415H	NM_014554	NP_055369	Q9P0U3	SENP1_HUMAN	sentrin/SUMO-specific protease 1	415					activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TCTTCACTATCAGTTAATTTA	0.333													15	53	---	---	---	---	PASS
KCNH3	23416	broad.mit.edu	37	12	49948271	49948271	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49948271G>T	uc001ruh.1	+	11	2330	c.2070G>T	c.(2068-2070)CCG>CCT	p.P690P	KCNH3_uc010smj.1_Silent_p.P630P	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H	690	cNMP.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0						AGTTTGCCCCGCGCTTCAGTC	0.642													52	164	---	---	---	---	PASS
NEUROD4	58158	broad.mit.edu	37	12	55421134	55421134	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55421134G>A	uc001sgp.3	+	2	1289	c.911G>A	c.(910-912)CGT>CAT	p.R304H		NM_021191	NP_067014	Q9HD90	NDF4_HUMAN	neurogenic differentiation 4	304					amacrine cell differentiation|positive regulation of cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4						GGTACCCCCCGTTATGATGTT	0.458													249	666	---	---	---	---	PASS
LRRC10	376132	broad.mit.edu	37	12	70004126	70004126	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70004126G>A	uc001svc.2	-	1	817	c.493C>T	c.(493-495)CGC>TGC	p.R165C		NM_201550	NP_963844	Q5BKY1	LRC10_HUMAN	leucine rich repeat containing 10	165	LRR 5.					nucleus					0	all_cancers(2;2.83e-105)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;1.98e-18)|GBM - Glioblastoma multiforme(2;7.43e-12)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TCCTGGAGGCGCCGGAGCTGG	0.612													28	86	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78511952	78511952	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78511952C>A	uc001syp.2	+	14	3088	c.2915C>A	c.(2914-2916)CCC>CAC	p.P972H	NAV3_uc001syo.2_Missense_Mutation_p.P972H|NAV3_uc010sub.1_Missense_Mutation_p.P472H|NAV3_uc009zsf.2_5'UTR	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	972						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						CCTGAAGACCCCGAGAAGGCA	0.532										HNSCC(70;0.22)			71	284	---	---	---	---	PASS
SYT1	6857	broad.mit.edu	37	12	79747301	79747301	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79747301T>C	uc001sys.2	+	10	1501	c.830T>C	c.(829-831)ATC>ACC	p.I277T	SYT1_uc001syt.2_Missense_Mutation_p.I277T|SYT1_uc001syu.2_Missense_Mutation_p.I274T|SYT1_uc001syv.2_Missense_Mutation_p.I277T	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I	277	Cytoplasmic (Potential).|Phospholipid binding (Probable).				detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						TTGGGTGATATCTGCTTCTCC	0.373													116	320	---	---	---	---	PASS
DCN	1634	broad.mit.edu	37	12	91550874	91550874	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91550874G>T	uc001tbs.2	-	4	724	c.630C>A	c.(628-630)ACC>ACA	p.T210T	DCN_uc001tbo.2_Silent_p.T101T|DCN_uc001tbp.2_Intron|DCN_uc001tbq.2_Intron|DCN_uc001tbr.2_Intron|DCN_uc001tbt.2_Silent_p.T210T|DCN_uc001tbu.2_Silent_p.T210T	NM_133503	NP_598010	P07585	PGS2_HUMAN	decorin isoform a preproprotein	210	LRR 6.				organ morphogenesis	extracellular space				central_nervous_system(2)|ovary(1)|lung(1)	4						TGGTGATATTGGTATCAGCAA	0.373													5	309	---	---	---	---	PASS
METAP2	10988	broad.mit.edu	37	12	95907432	95907432	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95907432C>T	uc001tec.2	+	11	1323	c.1189C>T	c.(1189-1191)CCA>TCA	p.P397S	METAP2_uc010suv.1_Missense_Mutation_p.P374S|METAP2_uc009ztd.2_Missense_Mutation_p.P361S|METAP2_uc001ted.2_Missense_Mutation_p.P396S|METAP2_uc001tef.2_Missense_Mutation_p.P374S|METAP2_uc001tee.2_RNA	NM_006838	NP_006829	P50579	AMPM2_HUMAN	methionyl aminopeptidase 2	397					N-terminal protein amino acid modification|peptidyl-methionine modification|protein processing|proteolysis	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0					L-Methionine(DB00134)	TCTTAGGCTTCCAAGAACAAA	0.408													56	169	---	---	---	---	PASS
NTN4	59277	broad.mit.edu	37	12	96076537	96076537	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96076537C>T	uc001tei.2	-	7	1905	c.1456G>A	c.(1456-1458)GAA>AAA	p.E486K	NTN4_uc009ztf.2_Missense_Mutation_p.E486K|NTN4_uc009ztg.2_Missense_Mutation_p.E449K	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	486					axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CAGGCTGGTTCGCTCTTATTG	0.458													56	109	---	---	---	---	PASS
GAS2L3	283431	broad.mit.edu	37	12	101005805	101005805	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101005805A>T	uc001thu.2	+	6	557	c.331A>T	c.(331-333)AAG>TAG	p.K111*	GAS2L3_uc009zty.2_Nonsense_Mutation_p.K111*|GAS2L3_uc001thv.2_Nonsense_Mutation_p.K7*	NM_174942	NP_777602	Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	111	CH.				cell cycle arrest					skin(1)	1						AGTGCCCTGTAAGAAAGATGC	0.363													62	189	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133372541	133372541	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133372541T>G	uc001ukz.1	-	11	2925	c.2366A>C	c.(2365-2367)AAG>ACG	p.K789T	GOLGA3_uc001ula.1_Missense_Mutation_p.K789T|GOLGA3_uc001ulb.2_Missense_Mutation_p.K789T	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	789	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		AAGCTCCTCCTTGCCACTCTT	0.552													53	144	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19753473	19753473	+	Intron	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19753473G>T	uc009zzj.2	-							NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CAGGACCCGAGCACCTACCGA	0.577													52	73	---	---	---	---	PASS
RB1	5925	broad.mit.edu	37	13	48953728	48953728	+	Splice_Site	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48953728A>G	uc001vcb.2	+	14	1499	c.1333_splice	c.e14-2	p.R445_splice		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GTTTGTTTGTAGCGATACAAA	0.204		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			10	23	---	---	---	---	PASS
INTS6	26512	broad.mit.edu	37	13	52026102	52026102	+	Intron	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52026102G>C	uc001vfk.2	-						INTS6_uc001vfj.2_Intron|INTS6_uc001vfl.2_Intron|INTS6_uc001vfm.2_Intron|uc001vfn.2_5'Flank	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a						snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		gggggagggcgaggGCTGTTA	0.313													22	27	---	---	---	---	PASS
KLF5	688	broad.mit.edu	37	13	73649905	73649905	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73649905G>C	uc001vje.2	+	4	1579	c.1255G>C	c.(1255-1257)GAG>CAG	p.E419Q	KLF5_uc001vjd.2_Missense_Mutation_p.E328Q	NM_001730	NP_001721	Q13887	KLF5_HUMAN	Kruppel-like factor 5	419	C2H2-type 2.				transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|pancreas(1)	3		Prostate(6;0.00187)|Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.0011)		GCGATCGGATGAGCTGACCCG	0.592													38	54	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101726913	101726913	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101726913G>T	uc001vox.1	-	36	4244	c.4055C>A	c.(4054-4056)GCT>GAT	p.A1352D		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1352	Helical; Name=S5 of repeat IV; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AACAACTCCAGCAAAAGCGTA	0.378													49	80	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861232	108861232	+	Silent	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861232C>A	uc001vqn.2	-	2	2658	c.2385G>T	c.(2383-2385)CTG>CTT	p.L795L	LIG4_uc001vqo.2_Silent_p.L795L|LIG4_uc010agg.1_Silent_p.L728L|LIG4_uc010agf.2_Silent_p.L795L|LIG4_uc001vqp.2_Silent_p.L795L	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	795					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					AATCAGCAATCAGAGAAGCCA	0.393								NHEJ					65	57	---	---	---	---	PASS
MCF2L	23263	broad.mit.edu	37	13	113724362	113724362	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113724362C>T	uc001vsu.2	+						MCF2L_uc001vsq.2_Intron|MCF2L_uc010tjr.1_Intron|MCF2L_uc001vsr.2_Intron|MCF2L_uc001vss.3_Intron|MCF2L_uc010tjs.1_Intron|MCF2L_uc001vst.1_Intron	NM_001112732	NP_001106203	O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				TCAACTCCTCCTCTTTCCCAG	0.627													83	70	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23886840	23886840	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23886840C>T	uc001wjx.2	-	31	4331	c.4225G>A	c.(4225-4227)GCC>ACC	p.A1409T		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1409	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GAGCACTTGGCATTAACAGCC	0.622													25	78	---	---	---	---	PASS
DHRS4L1	728635	broad.mit.edu	37	14	24517986	24517986	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24517986C>A	uc010alc.2	+	8	641	c.641C>A	c.(640-642)GCA>GAA	p.A214E	DHRS4L1_uc010tnu.1_RNA	NM_001082488	NP_001075957	P0CG22	DR4L1_HUMAN	dehydrogenase/reductase (SDR family) member 4	214							binding|oxidoreductase activity				0						AACTGCCTAGCACCTGGACTT	0.527													5	472	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55642126	55642126	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55642126G>A	uc001xbs.2	-	10	1456	c.1239C>T	c.(1237-1239)GTC>GTT	p.V413V	DLGAP5_uc001xbt.2_Silent_p.V413V	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	413					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						CAAGTGATGGGACTTCTTTTA	0.303													11	43	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59105230	59105230	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59105230T>A	uc001xdw.2	+	1	474	c.310T>A	c.(310-312)TTG>ATG	p.L104M	DACT1_uc010trv.1_Intron|DACT1_uc001xdx.2_Missense_Mutation_p.L104M|DACT1_uc010trw.1_5'Flank	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	104	Potential.				multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						GGAGAAGTTCTTGGAGGAGAA	0.483													14	31	---	---	---	---	PASS
SERPINA11	256394	broad.mit.edu	37	14	94909437	94909437	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94909437T>A	uc001ydd.1	-	4	1103	c.1043A>T	c.(1042-1044)CAG>CTG	p.Q348L		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	348					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		TTTGTTGAGCTGCCCAGTGAC	0.448													90	306	---	---	---	---	PASS
SERPINA4	5267	broad.mit.edu	37	14	95033547	95033547	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95033547T>C	uc001ydk.2	+	3	956	c.890T>C	c.(889-891)ATG>ACG	p.M297T	SERPINA4_uc010avd.2_Missense_Mutation_p.M334T|SERPINA4_uc001ydl.2_Missense_Mutation_p.M297T	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	297					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		ACTCCAGAGATGCTAATGAGG	0.438													47	115	---	---	---	---	PASS
BTBD6	90135	broad.mit.edu	37	14	105716320	105716320	+	Missense_Mutation	SNP	G	A	A	rs140283852		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105716320G>A	uc010tyq.1	+	5	877	c.769G>A	c.(769-771)GAG>AAG	p.E257K	BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc001yql.2_5'Flank|BRF1_uc001yqo.2_5'Flank|BRF1_uc010axg.1_Intron|BRF1_uc001yqp.2_Intron|BRF1_uc001yqn.2_5'Flank|BRF1_uc010axh.1_5'Flank|BRF1_uc010axj.1_5'Flank	NM_033271	NP_150374	Q96KE9	BTBD6_HUMAN	BTB domain protein BDPL	257						cytoplasmic mRNA processing body					0		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		GAACTGGGCCGAGGCGGAGTG	0.597													21	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20644850	20644850	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20644850G>A	uc001ytg.2	-	21	3117	c.2408C>T	c.(2407-2409)GCG>GTG	p.A803V	uc010tyx.1_RNA|uc001yth.3_Missense_Mutation_p.A803V|uc010tyy.1_Missense_Mutation_p.A803V					RecName: Full=Putative HERC2-like protein 3;																		CATGTCCCTCGCCCTTTCGGT	0.463													4	133	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31294626	31294626	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31294626G>T	uc001zfm.2	-	27	4339	c.4211C>A	c.(4210-4212)ACG>AAG	p.T1404K	TRPM1_uc010azy.2_Missense_Mutation_p.T1311K|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1404	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TATATTTGTCGTTTCCACTGT	0.363													198	171	---	---	---	---	PASS
C15orf54	400360	broad.mit.edu	37	15	39544396	39544396	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39544396G>A	uc001zkg.2	+	2	428	c.60G>A	c.(58-60)CCG>CCA	p.P20P		NM_207445	NP_997328	Q8N8G6	CO054_HUMAN	hypothetical protein LOC400360	20											0		all_cancers(109;5.39e-14)|all_epithelial(112;3.14e-12)|Lung NSC(122;9.74e-10)|all_lung(180;2.23e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)		GBM - Glioblastoma multiforme(113;1.19e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0706)		GGGCTGAGCCGCAAAGAATTT	0.468													7	864	---	---	---	---	PASS
PLA2G4F	255189	broad.mit.edu	37	15	42445844	42445844	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42445844C>T	uc001zoz.2	-	5	528	c.465G>A	c.(463-465)CTG>CTA	p.L155L	PLA2G4F_uc010bcr.2_5'UTR|PLA2G4F_uc001zpa.2_5'UTR|PLA2G4F_uc010bcs.2_5'UTR	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	155					phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		ATTCCACCTGCAGCTCTTGTG	0.552													33	96	---	---	---	---	PASS
EPB42	2038	broad.mit.edu	37	15	43494124	43494124	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43494124G>A	uc001zra.3	-	12	2131	c.1831C>T	c.(1831-1833)CAG>TAG	p.Q611*	EPB42_uc001zqz.3_Nonsense_Mutation_p.Q278*|EPB42_uc010bde.2_Missense_Mutation_p.P402L|EPB42_uc001zrb.3_Nonsense_Mutation_p.Q641*|EPB42_uc010udm.1_Nonsense_Mutation_p.Q533*	NM_001114134	NP_001107606	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2 isoform 2	611					erythrocyte maturation|peptide cross-linking|regulation of cell shape	cytoplasm|cytoskeleton|plasma membrane	ATP binding|protein binding|protein-glutamine gamma-glutamyltransferase activity|structural constituent of cytoskeleton			ovary(2)	2		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		AGGGAGTTCTGGAGGCTGACT	0.562													83	219	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55838815	55838815	+	Silent	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55838815A>G	uc010bfl.1	-	3	722	c.666T>C	c.(664-666)TTT>TTC	p.F222F	PYGO1_uc002adf.1_Silent_p.F222F	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	222	Asn-rich.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GGGGAGGAATAAAAGAATGAT	0.383													99	297	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2811974	2811974	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2811974G>T	uc002crk.2	+	11	1994	c.1445G>T	c.(1444-1446)GGG>GTG	p.G482V	SRRM2_uc002crj.1_Missense_Mutation_p.G386V|SRRM2_uc002crl.1_Missense_Mutation_p.G482V|SRRM2_uc010bsu.1_Missense_Mutation_p.G386V	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	482	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CGTAGGATGGGGAGGTCCCGT	0.562													37	119	---	---	---	---	PASS
CLEC16A	23274	broad.mit.edu	37	16	11056372	11056372	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11056372C>T	uc002dao.2	+	3	500	c.270C>T	c.(268-270)GGC>GGT	p.G90G	CLEC16A_uc002dan.3_Silent_p.G90G	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A	90										ovary(1)|central_nervous_system(1)	2						AAAAGTCGGGCCGTTACGTGT	0.473													96	253	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30978880	30978880	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30978880C>T	uc002ead.1	+	10	3427	c.2741C>T	c.(2740-2742)CCC>CTC	p.P914L		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	914	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						AGGCCTCGTCCCTCCACTCCT	0.557													39	61	---	---	---	---	PASS
ITGAX	3687	broad.mit.edu	37	16	31391090	31391090	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31391090G>T	uc002ebu.1	+	25	2948	c.2881G>T	c.(2881-2883)GGA>TGA	p.G961*	ITGAX_uc002ebt.2_Nonsense_Mutation_p.G961*	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	961	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CAATAACCTGGGACAGAGGGA	0.632													25	54	---	---	---	---	PASS
SHCBP1	79801	broad.mit.edu	37	16	46638350	46638350	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46638350C>G	uc002eec.3	-	6	753	c.713G>C	c.(712-714)CGA>CCA	p.R238P		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	238										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				TGATGGAACTCGGTCTTCAAG	0.383													64	251	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46962845	46962845	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46962845A>T	uc002eel.2	+	12	1602	c.1508A>T	c.(1507-1509)AAG>ATG	p.K503M	GPT2_uc002eem.2_Missense_Mutation_p.K403M|GPT2_uc002een.2_Missense_Mutation_p.K146M	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	503					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CCAGTGGAGAAGCTGAAAACG	0.562													27	81	---	---	---	---	PASS
ABCC12	94160	broad.mit.edu	37	16	48130667	48130667	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48130667T>C	uc002efc.1	-	22	3531	c.3185A>G	c.(3184-3186)TAC>TGC	p.Y1062C	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	1062	ABC transmembrane type-1 2.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)				CTGGATGATGTATGACAATGA	0.398													145	391	---	---	---	---	PASS
BRD7	29117	broad.mit.edu	37	16	50357560	50357560	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50357560C>G	uc002egf.1	-	13	1448	c.1381G>C	c.(1381-1383)GAT>CAT	p.D461H	BRD7_uc002ege.1_Missense_Mutation_p.D461H	NM_013263	NP_037395	Q9NPI1	BRD7_HUMAN	bromodomain containing 7	461					cell cycle|negative regulation of cell proliferation|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of histone acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleus	histone acetyl-lysine binding|p53 binding|transcription coactivator activity|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding				0		all_cancers(37;0.0127)				AGTAAACTATCTGCCATGACA	0.413													31	81	---	---	---	---	PASS
SLC12A3	6559	broad.mit.edu	37	16	56947293	56947293	+	Silent	SNP	C	T	T	rs149767532	byFrequency	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56947293C>T	uc010ccm.2	+	26	3071	c.3042C>T	c.(3040-3042)AAC>AAT	p.N1014N	SLC12A3_uc002ekd.3_Silent_p.N1023N|SLC12A3_uc010ccn.2_Silent_p.N1022N	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	1014	Cytoplasmic (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	ACCAGGAAAACGTGCTCACCT	0.552													48	209	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	64981585	64981585	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64981585T>C	uc002eoi.2	-	13	2746	c.2312A>G	c.(2311-2313)TAT>TGT	p.Y771C	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_3'UTR|CDH11_uc010vin.1_Missense_Mutation_p.Y645C	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	771	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GTTCTGTAGATAATCATAGTC	0.453			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			62	191	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66430103	66430103	+	Silent	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66430103T>A	uc002eom.3	+	8	1515	c.1359T>A	c.(1357-1359)ACT>ACA	p.T453T		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	453	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		TGGATTCCACTGGTGAGTGGC	0.453													33	96	---	---	---	---	PASS
ZFP90	146198	broad.mit.edu	37	16	68591960	68591960	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68591960C>T	uc010cff.2	+	3	385	c.93C>T	c.(91-93)GTC>GTT	p.V31V	ZFP90_uc002ewb.2_5'UTR|ZFP90_uc002ewc.2_5'UTR|ZFP90_uc002ewd.2_Silent_p.V31V|ZFP90_uc002ewe.2_Silent_p.V31V	NM_133458	NP_597715	Q8TF47	ZFP90_HUMAN	zinc finger protein 90	31	KRAB.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		GGTACCATGTCGACCCTGCTC	0.478													78	278	---	---	---	---	PASS
FBXO31	79791	broad.mit.edu	37	16	87367769	87367769	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87367769G>A	uc002fjw.2	-	8	1164	c.1120C>T	c.(1120-1122)CGC>TGC	p.R374C	FBXO31_uc010vot.1_Missense_Mutation_p.R202C|FBXO31_uc002fjv.2_Missense_Mutation_p.R266C	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31	374					cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		ACCCTCTCGCGCACCTCCAGG	0.697													4	105	---	---	---	---	PASS
KLHDC4	54758	broad.mit.edu	37	16	87748109	87748109	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87748109C>A	uc002fki.2	-	8	876	c.830G>T	c.(829-831)AGA>ATA	p.R277I	KLHDC4_uc010cht.1_Missense_Mutation_p.R96I|KLHDC4_uc002fkj.2_Missense_Mutation_p.R246I|KLHDC4_uc002fkk.2_Missense_Mutation_p.R96I|KLHDC4_uc002fkl.2_Missense_Mutation_p.R220I|KLHDC4_uc010chu.1_Missense_Mutation_p.R96I	NM_017566	NP_060036	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	277	Kelch 4.									pancreas(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0283)		TCTACCTTCTCTTCCGTCCTC	0.592													85	249	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7574035	7574035	+	Splice_Site	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7574035T>C	uc002gim.2	-	10	1188	c.994_splice	c.e10-1	p.I332_splice	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_Splice_Site|TP53_uc010cng.1_Splice_Site|TP53_uc002gii.1_Splice_Site_p.I200_splice|TP53_uc010cnh.1_Splice_Site|TP53_uc010cni.1_Splice_Site|TP53_uc002gij.2_Splice_Site_p.I332_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.?(6)|p.I332fs*49(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCCACGGATCTGCAGCAACAG	0.398		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	22	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11784584	11784584	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11784584C>G	uc002gne.2	+	55	10728	c.10660C>G	c.(10660-10662)CAC>GAC	p.H3554D	DNAH9_uc010coo.2_Missense_Mutation_p.H2848D|DNAH9_uc002gnf.2_5'Flank	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3554	AAA 5 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCTCATCCTCCACACCAAGCT	0.512													71	105	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18035764	18035764	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18035764C>T	uc010vxh.1	+							NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV						sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					ACCCACTCTACAGGCCAAAAA	0.577													36	60	---	---	---	---	PASS
ACCN1	40	broad.mit.edu	37	17	32483483	32483483	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32483483G>T	uc002hhu.2	-	1	343	c.69C>A	c.(67-69)ACC>ACA	p.T23T		NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	23	Cytoplasmic (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GGAGGGTGGAGGTGTTGGCAA	0.622													23	63	---	---	---	---	PASS
PLEKHH3	79990	broad.mit.edu	37	17	40823051	40823051	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40823051C>T	uc002iau.2	-	9	1849	c.1382G>A	c.(1381-1383)GGG>GAG	p.G461E	PLEKHH3_uc010cyl.1_Intron|PLEKHH3_uc002iat.1_RNA|PLEKHH3_uc002iav.2_RNA|PLEKHH3_uc010cym.1_Intron|PLEKHH3_uc002iaw.2_Missense_Mutation_p.G461E	NM_024927	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H	461	FERM.				signal transduction	cytoskeleton				large_intestine(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GAGGGTCCCCCCAGCCAGGGC	0.652													57	120	---	---	---	---	PASS
BRIP1	83990	broad.mit.edu	37	17	59885947	59885947	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59885947C>T	uc002izk.1	-	7	940	c.799G>A	c.(799-801)GCA>ACA	p.A267T		NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	267	Helicase ATP-binding.				DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						CCTGAATATGCCGTCCTCCGG	0.443			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	299	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61615851	61615851	+	Silent	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61615851T>C	uc002jay.2	+	8	1862	c.1782T>C	c.(1780-1782)GCT>GCC	p.A594A	KCNH6_uc010wpl.1_Silent_p.A471A|KCNH6_uc010wpm.1_Silent_p.A594A|KCNH6_uc002jaz.1_Silent_p.A541A	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	594	cNMP.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	ACTGCCCAGCTTTCAGCGGCG	0.701													4	10	---	---	---	---	PASS
COG1	9382	broad.mit.edu	37	17	71189200	71189200	+	5'UTR	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71189200G>T	uc002jjg.2	+	1					COG1_uc002jjh.2_5'UTR|COG1_uc002jjf.1_5'UTR	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1						Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			GGGGGCTGACGAGTGCACCAT	0.682													6	30	---	---	---	---	PASS
OTOP2	92736	broad.mit.edu	37	17	72923807	72923807	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72923807C>T	uc010wrp.1	+	6	646	c.557C>T	c.(556-558)GCG>GTG	p.A186V	OTOP2_uc002jmf.1_3'UTR	NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	186						integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					ATCTGGATGGCGGCCGTGGTG	0.577													24	87	---	---	---	---	PASS
UNK	85451	broad.mit.edu	37	17	73814897	73814897	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73814897G>A	uc002jpm.2	+	12	1774	c.1774G>A	c.(1774-1776)GAG>AAG	p.E592K		NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	516							nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GTCAGTCATAGGTAACTAGGC	0.582													14	122	---	---	---	---	PASS
RNF157	114804	broad.mit.edu	37	17	74154524	74154524	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74154524C>A	uc002jqz.2	-	13	1432	c.1363G>T	c.(1363-1365)GAG>TAG	p.E455*	RNF157_uc002jra.2_Nonsense_Mutation_p.E455*	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	455	Ser-rich.						zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			GTCTCCGACTCGCTGCAGGAA	0.512													4	411	---	---	---	---	PASS
CBX8	57332	broad.mit.edu	37	17	77768705	77768705	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77768705A>G	uc002jxd.1	-	5	992	c.899T>C	c.(898-900)CTA>CCA	p.L300P		NM_020649	NP_065700	Q9HC52	CBX8_HUMAN	chromobox homolog 8	300					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear chromatin|PcG protein complex	methylated histone residue binding				0			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			ATTGGGATCTAGGGCACCCTG	0.687													5	24	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19995852	19995852	+	Silent	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19995852A>G	uc002ktv.1	-	1	2027	c.1923T>C	c.(1921-1923)AAT>AAC	p.N641N		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	641						integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GCACCTTTAAATTACCAAGAT	0.408													151	393	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21478818	21478818	+	Intron	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21478818G>A	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AAAAGGTAATGTGTTAGGTCC	0.313													43	114	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32407610	32407610	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32407610C>A	uc010dmn.1	+	10	1065	c.1064C>A	c.(1063-1065)CCC>CAC	p.P355H	DTNA_uc002kxu.2_Missense_Mutation_p.P355H|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Missense_Mutation_p.P355H|DTNA_uc002kxw.2_Missense_Mutation_p.P355H|DTNA_uc002kxx.2_Missense_Mutation_p.P352H|DTNA_uc010dmj.2_Missense_Mutation_p.P352H|DTNA_uc002kxz.2_Missense_Mutation_p.P352H|DTNA_uc002kxy.2_Missense_Mutation_p.P352H|DTNA_uc010dmk.1_RNA|DTNA_uc010dml.2_Missense_Mutation_p.P352H|DTNA_uc002kyb.3_Missense_Mutation_p.P352H|DTNA_uc010dmm.2_Missense_Mutation_p.P355H|DTNA_uc010xby.1_Missense_Mutation_p.P102H|DTNA_uc010dmo.2_Missense_Mutation_p.P34H|DTNA_uc002kyd.3_Missense_Mutation_p.P34H|DTNA_uc010xbz.1_Missense_Mutation_p.P34H|DTNA_uc010xca.1_Missense_Mutation_p.P34H|DTNA_uc002kye.2_Missense_Mutation_p.P34H	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1	355					neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						CACTCTGTTCCCTCCTCAGGA	0.413													6	375	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43519604	43519604	+	Silent	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43519604C>A	uc002lbm.2	-	10	2161	c.2061G>T	c.(2059-2061)CTG>CTT	p.L687L	KIAA1632_uc002lbo.1_Silent_p.L687L	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	687					autophagy						0						CCCTCAAAAACAGTTCATCAA	0.428													53	159	---	---	---	---	PASS
CNDP1	84735	broad.mit.edu	37	18	72228155	72228155	+	Missense_Mutation	SNP	C	T	T	rs139749526	byFrequency	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72228155C>T	uc002llq.2	+	4	579	c.368C>T	c.(367-369)ACG>ATG	p.T123M	uc002llr.2_5'Flank	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	123					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		AGCGATCCCACGAAAGGCACC	0.577													108	295	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2217885	2217885	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2217885A>T	uc002lvb.3	+	22	2695	c.2659A>T	c.(2659-2661)AGC>TGC	p.S887C	DOT1L_uc002lvc.1_Missense_Mutation_p.S181C|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_Missense_Mutation_p.S181C	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	887						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCCTGGCCAGCGTGGTGCT	0.682													7	31	---	---	---	---	PASS
NCLN	56926	broad.mit.edu	37	19	3193290	3193290	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3193290G>A	uc002lxi.2	+	3	538	c.384G>A	c.(382-384)ATG>ATA	p.M128I	NCLN_uc002lxh.1_RNA	NM_020170	NP_064555	Q969V3	NCLN_HUMAN	nicalin precursor	128	Lumenal (Potential).				proteolysis|regulation of signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	peptidase activity|protein binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCAATTCATGGAGATCGAGC	0.632													26	71	---	---	---	---	PASS
FUT3	2525	broad.mit.edu	37	19	5844460	5844460	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5844460G>C	uc002mdk.2	-	2	488	c.391C>G	c.(391-393)CGC>GGC	p.R131G	FUT3_uc002mdm.2_Missense_Mutation_p.R131G|FUT3_uc002mdj.2_Missense_Mutation_p.R131G|FUT3_uc002mdl.2_Missense_Mutation_p.R131G	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	131	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						CAGATCCAGCGCTGCCCCTGC	0.592													40	141	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8181629	8181629	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8181629T>C	uc002mjf.2	-	28	3662	c.3641A>G	c.(3640-3642)AAC>AGC	p.N1214S		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1214	EGF-like 17.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CCCTGGCATGTTGGTGCAGTG	0.622													50	98	---	---	---	---	PASS
MARCH2	51257	broad.mit.edu	37	19	8503280	8503280	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8503280C>T	uc002mjv.2	+	6	1032	c.591C>T	c.(589-591)TTC>TTT	p.F197F	MARCH2_uc002mjw.2_Silent_p.F197F|MARCH2_uc002mjx.2_Silent_p.F127F	NM_016496	NP_057580	Q9P0N8	MARH2_HUMAN	membrane-associated ring finger (C3HC4) 2	197					endocytosis	cytoplasmic vesicle|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						AGGTCTCCTTCCGCTACCACT	0.637													4	134	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9024157	9024157	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9024157G>T	uc002mkp.2	-	18	37319	c.37115C>A	c.(37114-37116)CCA>CAA	p.P12372Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12374	Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAGGGAGGATGGAGTCCCTGA	0.453													13	55	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9056705	9056705	+	Silent	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056705T>A	uc002mkp.2	-	3	30945	c.30741A>T	c.(30739-30741)CCA>CCT	p.P10247P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10249	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ACCTGGATTCTGGGAAGGAGG	0.458													40	121	---	---	---	---	PASS
ZNF317	57693	broad.mit.edu	37	19	9272044	9272044	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9272044A>G	uc002mku.2	+	7	1998	c.1723A>G	c.(1723-1725)AGC>GGC	p.S575G	ZNF317_uc002mkv.2_Missense_Mutation_p.S434G|ZNF317_uc002mkw.2_Missense_Mutation_p.S543G|ZNF317_uc002mkx.2_Missense_Mutation_p.S490G|ZNF317_uc002mky.2_Missense_Mutation_p.S458G	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	575	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATCCCTCAGGAGCCACGTGAA	0.567													3	188	---	---	---	---	PASS
SLC44A2	57153	broad.mit.edu	37	19	10745908	10745908	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10745908C>T	uc002mpf.2	+	13	1264	c.1125C>T	c.(1123-1125)ATC>ATT	p.I375I	SLC44A2_uc002mpe.3_Silent_p.I373I|SLC44A2_uc002mpg.1_Silent_p.I95I|SLC44A2_uc002mph.2_5'Flank	NM_020428	NP_065161	Q8IWA5	CTL2_HUMAN	solute carrier family 44, member 2 isoform 1	375	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	choline transmembrane transporter activity|signal transducer activity			ovary(1)	1			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	GCCTCTGCATCGCCTACTGGG	0.567													83	182	---	---	---	---	PASS
ZNF700	90592	broad.mit.edu	37	19	12059437	12059437	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12059437G>T	uc002msu.2	+	4	724	c.598G>T	c.(598-600)GGA>TGA	p.G200*	ZNF700_uc010xme.1_Nonsense_Mutation_p.G218*|ZNF763_uc010xmf.1_Intron	NM_144566	NP_653167	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	200	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAAAGTCTGTGGAAAAACCTT	0.393													76	191	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	15990150	15990150	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15990150C>T	uc002nbs.1	-						CYP4F2_uc010xot.1_Intron	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						CACAGGCCGCCCTTACCTGGG	0.572													102	254	---	---	---	---	PASS
SF4	57794	broad.mit.edu	37	19	19390148	19390148	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19390148T>A	uc002nmh.2	-	10	1404	c.1402A>T	c.(1402-1404)ATG>TTG	p.M468L	SF4_uc002nmf.2_Missense_Mutation_p.M18L|SF4_uc002nmg.2_Missense_Mutation_p.M18L|SF4_uc002nmi.2_Missense_Mutation_p.M258L|SF4_uc002nmj.2_Missense_Mutation_p.M258L|SF4_uc002nme.2_Missense_Mutation_p.M18L	NM_172231	NP_757386	Q8IWZ8	SUGP1_HUMAN	splicing factor 4	468	Gln/Met-rich.				nuclear mRNA splicing, via spliceosome	nucleoplasm|spliceosomal complex	RNA binding				0						AGCAGCTGCATGTCCTGCATG	0.627													11	47	---	---	---	---	PASS
ZNF93	81931	broad.mit.edu	37	19	20044956	20044956	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20044956A>G	uc002non.2	+	4	1303	c.1192A>G	c.(1192-1194)AAA>GAA	p.K398E		NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	398	C2H2-type 10.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						GAAGCCCTACAAATGTGAAGA	0.408													66	134	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33639783	33639783	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33639783G>C	uc002nui.2	+	5	724	c.646G>C	c.(646-648)GCC>CCC	p.A216P		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	216	WD 3.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					CATAATGGACGCCGAGAACAT	0.502													76	230	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38858205	38858205	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38858205C>G	uc002oih.3	+	24	2914	c.2827C>G	c.(2827-2829)CAG>GAG	p.Q943E	CATSPERG_uc002oig.3_Missense_Mutation_p.Q903E|CATSPERG_uc002oif.3_Missense_Mutation_p.Q583E|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	943	Extracellular (Potential).			Q -> R (in Ref. 3; BAC87333).	cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						CGGCAGTTTCCAGGGCAGGTA	0.547													246	622	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41630712	41630712	+	Silent	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41630712G>C	uc002opu.1	+	8	1109	c.1053G>C	c.(1051-1053)GCG>GCC	p.A351A	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_3'UTR|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	351					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						ACACAGACGCGGTGATCCACG	0.657													10	28	---	---	---	---	PASS
CBLC	23624	broad.mit.edu	37	19	45293357	45293357	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45293357C>T	uc002ozs.2	+						CBLC_uc010ejt.2_Intron	NM_012116	NP_036248	Q9ULV8	CBLC_HUMAN	Cas-Br-M (murine) ecotropic retroviral						cell surface receptor linked signaling pathway|negative regulation of epidermal growth factor receptor activity|negative regulation of MAP kinase activity|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	calcium ion binding|epidermal growth factor receptor binding|phosphotyrosine binding|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|skin(1)	6	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				AGGTGAGACCCGCACCTGCAC	0.473			M		AML								57	176	---	---	---	---	PASS
TRPM4	54795	broad.mit.edu	37	19	49692200	49692200	+	Intron	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49692200C>T	uc002pmw.2	+						TRPM4_uc010emu.2_Intron|TRPM4_uc010yak.1_Intron|TRPM4_uc002pmx.2_Intron|TRPM4_uc010emv.2_Intron|TRPM4_uc010yal.1_Intron|TRPM4_uc002pmy.2_5'UTR	NM_017636	NP_060106	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel,						dendritic cell chemotaxis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|protein sumoylation|regulation of T cell cytokine production	endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	ATP binding|calcium activated cation channel activity|calmodulin binding			ovary(1)|central_nervous_system(1)	2		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		TCCTCTGCCCCAGACCTCTTT	0.602													166	540	---	---	---	---	PASS
CEACAM18	729767	broad.mit.edu	37	19	51984759	51984759	+	Silent	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51984759T>C	uc002pwv.1	+	4	696	c.696T>C	c.(694-696)AAT>AAC	p.N232N		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	232						integral to membrane				skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGTATGTGAATGATGTGCCTA	0.522													36	88	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54387495	54387495	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54387495G>T	uc002qcq.1	+	3	565	c.283G>T	c.(283-285)GAC>TAC	p.D95Y	PRKCG_uc010eqz.1_Missense_Mutation_p.D95Y|PRKCG_uc010yef.1_Missense_Mutation_p.D95Y|PRKCG_uc010yeg.1_Missense_Mutation_p.D95Y|PRKCG_uc010yeh.1_Missense_Mutation_p.G19V	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	95					activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		CCCCCAGACGGACGTGAGTGC	0.582													33	109	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54394922	54394922	+	Intron	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54394922G>A	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		CTCACTCCCCGTTTAGTTGGC	0.507													76	247	---	---	---	---	PASS
SBK2	646643	broad.mit.edu	37	19	56047510	56047510	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56047510T>C	uc010ygc.1	-	1	152	c.152A>G	c.(151-153)CAG>CGG	p.Q51R		NM_001101401	NP_001094871	P0C263	SBK2_HUMAN	SH3-binding domain kinase family, member 2	51							ATP binding|protein serine/threonine kinase activity				0						GACCAGGGTCTGAGCACTCAG	0.652													24	31	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56382266	56382266	+	Missense_Mutation	SNP	C	G	G	rs143466082		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56382266C>G	uc002qmd.3	+	7	2850	c.2428C>G	c.(2428-2430)CGC>GGC	p.R810G	NLRP4_uc002qmf.2_Missense_Mutation_p.R735G|NLRP4_uc010etf.2_Missense_Mutation_p.R585G	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	810	LRR 5.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CAAGAGCGTGCGCTATCTAGA	0.517													51	158	---	---	---	---	PASS
ZNF835	90485	broad.mit.edu	37	19	57176503	57176503	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57176503C>T	uc010ygo.1	-	2	130	c.130G>A	c.(130-132)GGC>AGC	p.G44S	ZNF835_uc010ygn.1_Missense_Mutation_p.G22S	NM_001005850	NP_001005850			zinc finger protein 835											pancreas(3)|skin(1)	4						TCAACCTGGCCCTCGTGTTTC	0.602													42	107	---	---	---	---	PASS
ZNF304	57343	broad.mit.edu	37	19	57867632	57867632	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57867632T>G	uc010ygw.1	+	3	783	c.395T>G	c.(394-396)TTT>TGT	p.F132C	ZNF304_uc010etw.2_Missense_Mutation_p.F179C|ZNF304_uc010etx.2_Missense_Mutation_p.F90C	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN	zinc finger protein 304	132	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		AGTGCAAACTTTTACCAGCAC	0.478													30	91	---	---	---	---	PASS
C20orf96	140680	broad.mit.edu	37	20	258973	258973	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:258973C>A	uc002wde.1	-	6	702	c.563G>T	c.(562-564)AGC>ATC	p.S188I	C20orf96_uc002wdc.2_Missense_Mutation_p.S135I|C20orf96_uc002wdd.2_Missense_Mutation_p.S153I|C20orf96_uc010zpi.1_Missense_Mutation_p.S135I|C20orf96_uc010zpj.1_Missense_Mutation_p.S153I|C20orf96_uc010zpk.1_Missense_Mutation_p.S126I	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680	188	Potential.										0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			ATTCTTACAGCTCATCTTGCA	0.488													95	621	---	---	---	---	PASS
ZCCHC3	85364	broad.mit.edu	37	20	278756	278756	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:278756G>C	uc002wdf.2	+	2	550	c.526G>C	c.(526-528)GGC>CGC	p.G176R	ZCCHC3_uc002wdg.2_Intron	NM_033089	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	177							nucleic acid binding|zinc ion binding				0		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GGGAGACGAGGGCGCCTGCCC	0.577													4	24	---	---	---	---	PASS
PAK7	57144	broad.mit.edu	37	20	9624982	9624982	+	5'UTR	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9624982C>T	uc002wnl.2	-	4					PAK7_uc002wnk.2_5'UTR|PAK7_uc002wnj.2_5'UTR|PAK7_uc010gby.1_5'UTR	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7								ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			AACATGATGCCAAAACCTGGG	0.403													41	169	---	---	---	---	PASS
MACROD2	140733	broad.mit.edu	37	20	15967727	15967727	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15967727A>T	uc002wou.2	+	15	1341	c.1077A>T	c.(1075-1077)CAA>CAT	p.Q359H	MACROD2_uc002wot.2_Missense_Mutation_p.Q359H|MACROD2_uc002woz.2_Missense_Mutation_p.Q124H|MACROD2_uc002wpb.2_Missense_Mutation_p.Q124H|MACROD2_uc002wpd.2_Missense_Mutation_p.Q10H	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1	359	Glu-rich.										0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CATCAAACCAAGAAGATGCCG	0.383													49	242	---	---	---	---	PASS
SEC23B	10483	broad.mit.edu	37	20	18511331	18511331	+	Missense_Mutation	SNP	A	G	G	rs17849992		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18511331A>G	uc002wqz.1	+	10	1560	c.1117A>G	c.(1117-1119)ATG>GTG	p.M373V	SEC23B_uc002wra.1_Missense_Mutation_p.M373V|SEC23B_uc002wrb.1_Missense_Mutation_p.M373V|SEC23B_uc010zsb.1_Missense_Mutation_p.M355V|SEC23B_uc002wrc.1_Missense_Mutation_p.M373V	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	373					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						TAGAGGCTACATGGTAATGGG	0.333													62	246	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20066128	20066128	+	Intron	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20066128G>C	uc002wru.2	+						C20orf26_uc010gcw.1_Intron|C20orf26_uc010zse.1_Intron|C20orf26_uc010zsf.1_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		AGCCTCTTCAGAACTCCAAGA	0.383													56	192	---	---	---	---	PASS
NKX2-2	4821	broad.mit.edu	37	20	21492667	21492667	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21492667G>T	uc002wsi.2	-	2	1073	c.716C>A	c.(715-717)GCG>GAG	p.A239E		NM_002509	NP_002500	O95096	NKX22_HUMAN	NK2 transcription factor related, locus 2	239					brain development|positive regulation of sequence-specific DNA binding transcription factor activity	nucleus	chromatin binding|core promoter proximal region DNA binding|transcription coactivator activity			pancreas(1)|skin(1)	2						CAGCGACTGCGCGCTGTAGGC	0.652													32	126	---	---	---	---	PASS
GGT7	2686	broad.mit.edu	37	20	33447370	33447370	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33447370C>T	uc002xay.2	-	7	933	c.890G>A	c.(889-891)CGC>CAC	p.R297H	GGT7_uc002xaz.1_Missense_Mutation_p.R314H|GGT7_uc002xba.1_3'UTR	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	297	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						TAGTGGCGGGCGGCCCGATGG	0.687													5	12	---	---	---	---	PASS
FAM83D	81610	broad.mit.edu	37	20	37580780	37580780	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37580780A>G	uc002xjg.2	+	4	1506	c.1465A>G	c.(1465-1467)ACA>GCA	p.T489A		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	459	Ser-rich.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				AACTCAATCTACAGAAGGGTC	0.483													63	169	---	---	---	---	PASS
SNX21	90203	broad.mit.edu	37	20	44463643	44463643	+	Missense_Mutation	SNP	C	T	T	rs141041804	byFrequency	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44463643C>T	uc002xpv.1	+	3	424	c.335C>T	c.(334-336)GCG>GTG	p.A112V	SNX21_uc002xps.1_Missense_Mutation_p.A112V|SNX21_uc002xpt.1_Missense_Mutation_p.A112V|SNX21_uc002xpu.1_Missense_Mutation_p.A112V|SNX21_uc002xpw.1_5'UTR|SNX21_uc002xpx.2_Missense_Mutation_p.A102V|SNX21_uc010zxd.1_Missense_Mutation_p.A103V|SNX21_uc002xpy.1_5'UTR	NM_033421	NP_219489	Q969T3	SNX21_HUMAN	sorting nexin 21 isoform a	112					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding			breast(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)				CAGCTCCTGGCGCGGCAGCTG	0.617													5	255	---	---	---	---	PASS
ZGPAT	84619	broad.mit.edu	37	20	62339934	62339934	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62339934T>A	uc002ygk.2	+	2	180	c.2T>A	c.(1-3)ATG>AAG	p.M1K	ARFRP1_uc002yga.2_5'Flank|ARFRP1_uc002ygc.2_5'Flank|ARFRP1_uc002ygh.3_5'Flank|ARFRP1_uc011abf.1_5'Flank|ARFRP1_uc011abg.1_5'Flank|ARFRP1_uc002yge.2_5'Flank|ARFRP1_uc002ygd.2_5'Flank|ARFRP1_uc002ygf.2_5'Flank|ARFRP1_uc002ygg.2_5'Flank|ARFRP1_uc011abh.1_5'Flank|ZGPAT_uc002ygi.2_Missense_Mutation_p.M1K|ZGPAT_uc002ygj.2_Missense_Mutation_p.M1K|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Missense_Mutation_p.M1K|ZGPAT_uc002ygm.2_Missense_Mutation_p.M1K|ZGPAT_uc002ygn.3_RNA	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	1					negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					TCTCTCAGCATGGACGAGGAG	0.687													22	63	---	---	---	---	PASS
ZGPAT	84619	broad.mit.edu	37	20	62339951	62339951	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62339951G>A	uc002ygk.2	+	2	197	c.19G>A	c.(19-21)GAG>AAG	p.E7K	ARFRP1_uc002yga.2_5'Flank|ARFRP1_uc002ygc.2_5'Flank|ARFRP1_uc002ygh.3_5'Flank|ARFRP1_uc011abf.1_5'Flank|ARFRP1_uc011abg.1_5'Flank|ARFRP1_uc002yge.2_5'Flank|ARFRP1_uc002ygd.2_5'Flank|ARFRP1_uc002ygf.2_5'Flank|ARFRP1_uc002ygg.2_5'Flank|ARFRP1_uc011abh.1_5'Flank|ZGPAT_uc002ygi.2_Missense_Mutation_p.E7K|ZGPAT_uc002ygj.2_Missense_Mutation_p.E7K|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Missense_Mutation_p.E7K|ZGPAT_uc002ygm.2_Missense_Mutation_p.E7K|ZGPAT_uc002ygn.3_RNA	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	7					negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GGAGAGCCTGGAGTCGGCCTT	0.677													24	70	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10970050	10970050	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10970050A>T	uc002yip.1	-	6	446	c.78T>A	c.(76-78)AGT>AGA	p.S26R	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.S26R|TPTE_uc002yir.1_Missense_Mutation_p.S26R|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	26					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTTTAAATTCACTTGTCTGTG	0.383													90	133	---	---	---	---	PASS
AIRE	326	broad.mit.edu	37	21	45713059	45713059	+	Splice_Site	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45713059G>T	uc002zei.2	+	10	1405	c.1278_splice	c.e10+1	p.Q426_splice	AIRE_uc010gpq.2_Splice_Site|AIRE_uc002zej.2_Splice_Site_p.Q229_splice|AIRE_uc010gpr.2_Splice_Site_p.Q229_splice	NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)		GGGTCAGCAGGTGAGCGGGGA	0.667									Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				3	7	---	---	---	---	PASS
EIF4ENIF1	56478	broad.mit.edu	37	22	31851891	31851891	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31851891C>A	uc003akz.1	-	8	1210	c.1046G>T	c.(1045-1047)AGC>ATC	p.S349I	EIF4ENIF1_uc003akx.1_Missense_Mutation_p.S28I|EIF4ENIF1_uc003aky.1_Missense_Mutation_p.S28I|EIF4ENIF1_uc003ala.1_Missense_Mutation_p.S349I|EIF4ENIF1_uc003alb.1_Missense_Mutation_p.S186I	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E	349						nucleus	protein binding|protein transporter activity			ovary(1)	1						GCTGGATCGGCTTCCTGATCT	0.468											OREG0003517	type=REGULATORY REGION|Gene=LOC486366|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	135	134	---	---	---	---	PASS
RFPL2	10739	broad.mit.edu	37	22	32587176	32587176	+	Silent	SNP	G	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32587176G>A	uc003amg.3	-	5	1656	c.720C>T	c.(718-720)CGC>CGT	p.R240R	RFPL2_uc003ame.3_Silent_p.R179R|RFPL2_uc003amf.3_Silent_p.R150R|RFPL2_uc003amh.3_Silent_p.R150R	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	240	B30.2/SPRY.						zinc ion binding			skin(1)	1						CCCAGCAGTGGCGGCCACAGG	0.592													146	138	---	---	---	---	PASS
TNRC6B	23112	broad.mit.edu	37	22	40681639	40681639	+	Intron	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40681639C>G	uc011aor.1	+						TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Intron|TNRC6B_uc003ayo.2_Intron	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						TGCTGCTTTTCTGTTTACAGG	0.448													32	208	---	---	---	---	PASS
ASMTL	8623	broad.mit.edu	37	X	1522275	1522275	+	Silent	SNP	G	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1522275G>T	uc004cpx.1	-	13	1864	c.1753C>A	c.(1753-1755)CGG>AGG	p.R585R	NCRNA00105_uc004cpv.2_Intron|NCRNA00105_uc004cpw.2_Intron|ASMTL_uc011mhe.1_Silent_p.R509R|ASMTL_uc004cpy.1_Silent_p.R569R|ASMTL_uc011mhf.1_Silent_p.R527R	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	585	ASMT-like.				melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCCAGGCTCCGCTCCTTGCCT	0.627													54	118	---	---	---	---	PASS
SH3KBP1	30011	broad.mit.edu	37	X	19564056	19564056	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19564056G>C	uc004czm.2	-	15	1923	c.1607C>G	c.(1606-1608)ACT>AGT	p.T536S	SH3KBP1_uc011mje.1_Missense_Mutation_p.T275S|SH3KBP1_uc011mjf.1_Missense_Mutation_p.T298S|SH3KBP1_uc004czl.2_Missense_Mutation_p.T499S|SH3KBP1_uc010nfm.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a	536					apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						TATGGTAACAGTCTTGGAAGT	0.473													42	33	---	---	---	---	PASS
PDK3	5165	broad.mit.edu	37	X	24549766	24549766	+	Intron	SNP	C	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24549766C>G	uc004dbg.2	+						PDK3_uc004dbh.2_Intron	NM_005391	NP_005382	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase 3 isoform 2						glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|protein binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6						ATTTTCTTTTCTCAATAGGCT	0.343													75	144	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37029201	37029201	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37029201G>C	uc004ddl.1	+	1	2732	c.2718G>C	c.(2716-2718)ATG>ATC	p.M906I		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	906										ovary(3)	3						TAGACGAAATGGATGAGGTCA	0.453													94	73	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63411391	63411391	+	Silent	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63411391C>T	uc004dvo.2	-	2	2049	c.1776G>A	c.(1774-1776)GAG>GAA	p.E592E		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	592					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						TGGCGTGGGCCTCCCTGGCAT	0.617													34	34	---	---	---	---	PASS
PDZD11	51248	broad.mit.edu	37	X	69507655	69507655	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69507655C>A	uc004dyd.1	-	5	356	c.254G>T	c.(253-255)AGA>ATA	p.R85I	KIF4A_uc004dyg.2_5'Flank|KIF4A_uc010nkw.2_5'Flank|PDZD11_uc004dye.1_Missense_Mutation_p.R117I|KIF4A_uc004dyf.1_5'Flank	NM_016484	NP_057568	Q5EBL8	PDZ11_HUMAN	PDZ domain containing 11	85	PDZ.					basolateral plasma membrane|cytosol|extracellular region	protein C-terminus binding				0						CAGTCCTGCTCTATGTGCATC	0.458													4	169	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99661771	99661771	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99661771C>T	uc010nmz.2	-	1	3501	c.1825G>A	c.(1825-1827)GAG>AAG	p.E609K	PCDH19_uc004efw.3_Missense_Mutation_p.E609K|PCDH19_uc004efx.3_Missense_Mutation_p.E609K	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	609	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						CGGTCGCCCTCGGTCATGTCG	0.552													48	30	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109694197	109694197	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109694197A>T	uc004eor.1	+	3	598	c.352A>T	c.(352-354)ATG>TTG	p.M118L	RGAG1_uc011msr.1_Missense_Mutation_p.M118L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	118										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						CCCATTGCTAATGCCAGCCTT	0.522													136	116	---	---	---	---	PASS
SPRY3	10251	broad.mit.edu	37	X	155003879	155003879	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155003879C>T	uc004fnq.1	+	2	800	c.346C>T	c.(346-348)CAA>TAA	p.Q116*	SPRY3_uc010nvl.1_Intron	NM_005840	NP_005831	O43610	SPY3_HUMAN	sprouty homolog 3	116					multicellular organismal development|regulation of signal transduction	cytoplasm|membrane					0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CATCCGAACCCAACCTGGAGC	0.552													54	73	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	5369195	5369195	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:5369195C>A	uc004fqo.2	+	3	3961	c.3227C>A	c.(3226-3228)ACA>AAA	p.T1076K		NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	1076	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						CTTACCAGCACATCCCATGGC	0.567													71	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	10977845	10977846	+	IGR	INS	-	AAAATTGTCAAC	AAAATTGTCAAC	rs144185712	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10977845_10977846insAAAATTGTCAAC								CASZ1 (121138 upstream) : C1orf127 (28687 downstream)																							aagaaagaaagaaaATTGTCAA	0.228													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39789731	39789731	+	Intron	DEL	G	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39789731delG	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc009vvq.1_Intron|MACF1_uc001cdb.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATTATACTTGGGGTTATTTT	0.348													7	5	---	---	---	---	
RIMS3	9783	broad.mit.edu	37	1	41107770	41107770	+	Intron	DEL	A	-	-	rs144454369		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41107770delA	uc001cfu.1	-						RIMS3_uc001cfv.1_Intron	NM_014747	NP_055562	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3						neurotransmitter transport	cell junction|synapse					0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			AACAAATGTCAAGAGCATGCA	0.219													2	4	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487406	67487407	+	Intron	DEL	AG	-	-	rs71711790		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487406_67487407delAG	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acacagacacagacacacacac	0.248													16	7	---	---	---	---	
SYCP1	6847	broad.mit.edu	37	1	115399757	115399758	+	Intron	INS	-	A	A	rs71582509		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115399757_115399758insA	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ctctctctctcaaaaaaaaaaa	0.084													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161716320	161716321	+	IGR	INS	-	TTCCTTCCTTCC	TTCCTTCCTTCC			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716320_161716321insTTCCTTCCTTCC								FCRLB (18388 upstream) : DUSP12 (3260 downstream)																							tctctctctctttccttccttc	0.035													8	4	---	---	---	---	
PLA2G4A	5321	broad.mit.edu	37	1	186925032	186925033	+	Intron	INS	-	T	T	rs111599167		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186925032_186925033insT	uc001gsc.2	+						PLA2G4A_uc010pos.1_Intron	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA						phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	tgaccagctaattttttttttt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	199130136	199130137	+	IGR	INS	-	G	G	rs142603788	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199130136_199130137insG								MIR181A1 (301854 upstream) : NR5A2 (866633 downstream)																							gaaggaaggaagaaggaaggaa	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224262210	224262211	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs143257946	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224262210_224262211insTTCCTTCC								TP53BP2 (228536 upstream) : FBXO28 (39580 downstream)																							ATATGACTTATttccttccttc	0.178													3	3	---	---	---	---	
OBSCN	84033	broad.mit.edu	37	1	228526743	228526744	+	Intron	DEL	CA	-	-	rs34417336		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228526743_228526744delCA	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsr.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				TGGGTGGGGCcacacacacaca	0.545													4	3	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43808704	43808704	+	Intron	DEL	A	-	-	rs74506936		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43808704delA	uc002rsw.3	-						THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc002rsz.2_Intron|THADA_uc002rta.2_Intron|THADA_uc002rtb.1_Intron|THADA_uc002rtc.3_Intron|THADA_uc002rtd.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				aaaagaaaagaaaaaaaaaaa	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106566595	106566602	+	IGR	DEL	AGGAAGGA	-	-	rs72456657		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106566595_106566602delAGGAAGGA								NCK2 (55869 upstream) : C2orf40 (115511 downstream)																							ggagggagggaggaaggaaggaaggaag	0.058													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103847	113103848	+	IGR	INS	-	CAT	CAT			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103847_113103848insCAT								ZC3H6 (6207 upstream) : RGPD8 (22118 downstream)																							caccatcacaccaccaccatca	0.114													4	2	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	133010779	133010779	+	Intron	DEL	G	-	-	rs111517614		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133010779delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						AAGTGCATTCGAAGAGTCGAT	0.537													5	3	---	---	---	---	
STK17B	9262	broad.mit.edu	37	2	197008112	197008113	+	Intron	INS	-	CAATA	CAATA	rs142415504	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197008112_197008113insCAATA	uc002utk.2	-						STK17B_uc010fsh.2_Intron	NM_004226	NP_004217	O94768	ST17B_HUMAN	serine/threonine kinase 17B						apoptosis|induction of apoptosis|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity			lung(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.141)			ATACTTTTATTCATTTCATTTA	0.282													6	3	---	---	---	---	
CTDSP1	58190	broad.mit.edu	37	2	219268782	219268783	+	Intron	INS	-	A	A			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219268782_219268783insA	uc002vhy.2	+						CTDSP1_uc002vhx.2_Intron|CTDSP1_uc002vhz.2_Intron	NM_021198	NP_067021	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,						protein dephosphorylation|regulation of transcription from RNA polymerase II promoter	nucleus	CTD phosphatase activity|metal ion binding|protein binding			ovary(1)	1		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		gaccctgcctcaaaaaaaaaaa	0.045													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239667252	239667253	+	IGR	INS	-	CTTC	CTTC	rs13009592		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239667252_239667253insCTTC								ASB1 (306362 upstream) : TWIST2 (89420 downstream)																							tttctttctttcttccttcctt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	23767978	23767979	+	IGR	INS	-	AAGAAAGA	AAGAAAGA	rs7641286		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23767978_23767979insAAGAAAGA								UBE2E2 (135682 upstream) : UBE2E1 (79460 downstream)																							aggaaggaaggaagaaagaaag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75703798	75703798	+	IGR	DEL	G	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75703798delG								MIR1324 (23789 upstream) : ZNF717 (54996 downstream)																							AGTGAATTTTGGGGGATTATT	0.338													4	2	---	---	---	---	
CEP63	80254	broad.mit.edu	37	3	134229815	134229816	+	Intron	INS	-	T	T	rs113047401		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134229815_134229816insT	uc003eqo.1	+						CEP63_uc003eql.1_Intron|CEP63_uc003eqm.2_Intron|CEP63_uc003eqn.1_Intron	NM_025180	NP_079456	Q96MT8	CEP63_HUMAN	centrosomal protein 63 isoform a						cell division|DNA damage checkpoint|G2/M transition of mitotic cell cycle|mitosis|signal transduction in response to DNA damage|spindle assembly	centrosome|cytosol|spindle pole	protein binding			ovary(1)	1						TCCACCTTTGATTTTTTTTTTT	0.470													7	6	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167615310	167615317	+	Intron	DEL	GAAGGAAG	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167615310_167615317delGAAGGAAG	uc003ffc.2	+						uc003ffd.2_Intron					Homo sapiens cDNA FLJ36036 fis, clone TESTI2017125.																		AAAGGCAAAAgaaggaaggaaggaagga	0.077													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	168269864	168269865	+	IGR	INS	-	A	A	rs139746804		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168269864_168269865insA								MIR551B (127 upstream) : C3orf50 (257719 downstream)																							CCAATGGGATTAAAAAAAAAAA	0.277													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	170032807	170032810	+	IGR	DEL	GTGT	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170032807_170032810delGTGT								PRKCI (9037 upstream) : SKIL (42663 downstream)																							atctctcacagtgtgtgtgtgtgt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180626274	180626275	+	IGR	DEL	AC	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180626274_180626275delAC								CCDC39 (170612 upstream) : FXR1 (4177 downstream)																							AAacatacatacacacacacac	0.000													3	4	---	---	---	---	
MIR1269	100302177	broad.mit.edu	37	4	67142230	67142231	+	5'Flank	INS	-	TAGA	TAGA	rs143986407	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67142230_67142231insTAGA	hsa-mir-1269|MI0006406	+																							0						taaggaatacttagctggaaaa	0.054													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	78964940	78964947	+	IGR	DEL	CTTTCTTT	-	-	rs58709113		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78964940_78964947delCTTTCTTT								MRPL1 (90996 upstream) : FRAS1 (13777 downstream)																							tccttccttcctttctttctttctttct	0.082													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	105918246	105918247	+	IGR	INS	-	T	T	rs145057012		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105918246_105918247insT								CXXC4 (502188 upstream) : TET2 (149696 downstream)																							tttttttttccttttttttttt	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	120022622	120022623	+	IGR	DEL	AG	-	-	rs147028694	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120022622_120022623delAG								SYNPO2 (40229 upstream) : MYOZ2 (34316 downstream)																							aaagaaagaaagagaaagaaag	0.079													6	3	---	---	---	---	
ZNF827	152485	broad.mit.edu	37	4	146753454	146753457	+	Intron	DEL	CACA	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146753454_146753457delCACA	uc003ikn.2	-						ZNF827_uc003ikm.2_Intron|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					aaaacaaaaCcacacacacacaca	0.123													5	3	---	---	---	---	
KLHL2	11275	broad.mit.edu	37	4	166198901	166198902	+	Intron	DEL	AC	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166198901_166198902delAC	uc003irb.2	+						KLHL2_uc011cjm.1_Intron|KLHL2_uc003irc.2_Intron|KLHL2_uc010ira.2_Intron	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1						intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		GATGTTAAAAacacacacacac	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190394003	190394003	+	IGR	DEL	T	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190394003delT								None (None upstream) : FRG1 (467971 downstream)																							gattgttttcttgatttcttt	0.090													4	2	---	---	---	---	
HEATR7B2	133558	broad.mit.edu	37	5	41000798	41000798	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41000798delG	uc003jmj.3	-	38	4822	c.4332delC	c.(4330-4332)CCCfs	p.P1444fs	HEATR7B2_uc003jmi.3_Frame_Shift_Del_p.P999fs	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1444							binding			ovary(6)|central_nervous_system(2)	8						TCTTGGGGTTGGGATCCCAAA	0.488													47	23	---	---	---	---	
RGS7BP	401190	broad.mit.edu	37	5	63799453	63799454	+	5'Flank	INS	-	AAGG	AAGG	rs72300220		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63799453_63799454insAAGG	uc003jtj.2	+							NM_001029875	NP_001025046	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane					0		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		aggaaggaaaaaaggaaggaag	0.079													4	2	---	---	---	---	
PPARGC1B	133522	broad.mit.edu	37	5	149174115	149174118	+	Intron	DEL	ACAT	-	-	rs144723867		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149174115_149174118delACAT	uc003lrc.2	+						PPARGC1B_uc003lrb.1_Intron|PPARGC1B_uc003lrd.2_Intron	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			acacacacacacaTTCAAGCAAAA	0.348													3	7	---	---	---	---	
SSR1	6745	broad.mit.edu	37	6	7310457	7310458	+	Intron	INS	-	T	T	rs10633004		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7310457_7310458insT	uc003mxf.3	-						SSR1_uc003mxg.3_Intron|SSR1_uc010jny.2_Intron	NM_003144	NP_003135	P43307	SSRA_HUMAN	signal sequence receptor, alpha precursor						cotranslational protein targeting to membrane|positive regulation of cell proliferation	endoplasmic reticulum membrane|integral to membrane	signal sequence binding				0	Ovarian(93;0.0398)					CTGCATATCAAttttttttttt	0.168													4	3	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38952247	38952250	+	Intron	DEL	CACA	-	-	rs34819199		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38952247_38952250delCACA	uc003ooe.1	+						DNAH8_uc003oog.1_3'UTR	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						cacacacatgcacacacacacaca	0.201													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	40315113	40315118	+	Intron	DEL	CGCGCA	-	-	rs113359584		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40315113_40315118delCGCGCA	uc003opf.1	-											Homo sapiens cDNA FLJ41649 fis, clone FEBRA2024343.																		TGTGTATGGGCGCGcacacacacaca	0.442													4	2	---	---	---	---	
LMBRD1	55788	broad.mit.edu	37	6	70484880	70484903	+	Intron	DEL	AGGGAGGGAGGGAGGGAGGGAGGG	-	-	rs71996428		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70484880_70484903delAGGGAGGGAGGGAGGGAGGGAGGG	uc003pfa.2	-						LMBRD1_uc003pez.2_Intron|LMBRD1_uc010kal.2_Intron|LMBRD1_uc003pfb.2_Intron	NM_018368	NP_060838	Q9NUN5	LMBD1_HUMAN	liver regeneration p-53 related protein						interspecies interaction between organisms|transport	integral to membrane|lysosomal membrane	cobalamin binding			ovary(1)	1						gaaggaaggaagggagggagggagggagggagggagggagggag	0.107													3	3	---	---	---	---	
COL19A1	1310	broad.mit.edu	37	6	70854795	70854795	+	Intron	DEL	C	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70854795delC	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						AAGAATCTTACCTTGTTTTCT	0.488													9	10	---	---	---	---	
ZNF292	23036	broad.mit.edu	37	6	87971652	87971653	+	3'UTR	INS	-	A	A	rs145710137	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87971652_87971653insA	uc003plm.3	+	8						NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AAACAAAAAAGAAAAAAAAAAC	0.287													6	4	---	---	---	---	
SYNJ2	8871	broad.mit.edu	37	6	158502667	158502668	+	Intron	DEL	TC	-	-	rs149018292	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158502667_158502668delTC	uc003qqx.1	+						SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc003qqz.1_Intron|SYNJ2_uc003qra.1_Intron	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		tttttttttttctctgagacaa	0.188													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	170760025	170760026	+	IGR	INS	-	TG	TG	rs139935137	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170760025_170760026insTG								FAM120B (45789 upstream) : PSMB1 (20081 downstream)																							GGGTCTCATTTtgtgtgtgtgt	0.347													2	4	---	---	---	---	
PDCD2	5134	broad.mit.edu	37	6	170888220	170888221	+	Intron	INS	-	T	T	rs137946575	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170888220_170888221insT	uc003qxw.2	-						PDCD2_uc003qxv.2_Intron|PDCD2_uc003qxx.1_Intron	NM_002598	NP_002589	Q16342	PDCD2_HUMAN	programmed cell death 2 isoform 1						apoptosis	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding				0		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		CAGTGTGCCACTAATGCCTTCT	0.431													4	2	---	---	---	---	
DAGLB	221955	broad.mit.edu	37	7	6469934	6469935	+	Intron	DEL	GA	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6469934_6469935delGA	uc003sqa.2	-						DAGLB_uc011jwt.1_Intron|DAGLB_uc011jwu.1_Intron|DAGLB_uc003sqb.2_Intron|DAGLB_uc003sqc.2_Intron|DAGLB_uc011jwv.1_Intron|DAGLB_uc003sqd.3_Intron|DAGLB_uc011jww.1_Intron	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GGGAGGGAGGGAGAGAGagaga	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	33712063	33712074	+	IGR	DEL	CTTCCCTTCCTC	-	-	rs67988530		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33712063_33712074delCTTCCCTTCCTC								BBS9 (66383 upstream) : BMPER (233038 downstream)																							ttccttccttcttcccttcctcccttcttccc	0.132													4	2	---	---	---	---	
LAMB4	22798	broad.mit.edu	37	7	107744735	107744736	+	Intron	INS	-	A	A	rs151026650	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107744735_107744736insA	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						CATTTTTAAAGTTAAACTTAAT	0.431													4	2	---	---	---	---	
DNAJB6	10049	broad.mit.edu	37	7	157177943	157177950	+	Intron	DEL	TAAAATGG	-	-	rs112549325		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157177943_157177950delTAAAATGG	uc003wnk.2	+						DNAJB6_uc003wnj.2_Intron|DNAJB6_uc003wnl.2_Intron|DNAJB6_uc011kvy.1_Intron|DNAJB6_uc011kvz.1_Intron|DNAJB6_uc010lqt.2_Intron	NM_058246	NP_490647	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization|negative regulation of caspase activity|protein folding|response to unfolded protein	nucleus|perinuclear region of cytoplasm	ATPase activator activity|chaperone binding|heat shock protein binding|unfolded protein binding			ovary(2)	2	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GCAGCATTGTTAAAATGGTAAAATGGAA	0.288													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50103352	50103355	+	IGR	DEL	CCTC	-	-	rs77568781		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50103352_50103355delCCTC								C8orf22 (114711 upstream) : SNTG1 (718994 downstream)																							ttctttccttcctccctccctccc	0.098													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50220212	50220213	+	IGR	INS	-	GT	GT	rs112899801		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50220212_50220213insGT								C8orf22 (231571 upstream) : SNTG1 (602136 downstream)																							AAAGTGAATGAgtgtgtgtgtg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	116686698	116686699	+	IGR	INS	-	CCTC	CCTC	rs142743732	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116686698_116686699insCCTC								TRPS1 (5470 upstream) : EIF3H (970357 downstream)																							cttccttccttcctccctccct	0.124													8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90730494	90730494	+	IGR	DEL	A	-	-	rs80082517	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90730494delA								CDK20 (140827 upstream) : SPIN1 (272346 downstream)																							TCTGGGGGCCAGGAAGGGGGA	0.587													4	2	---	---	---	---	
PTGR1	22949	broad.mit.edu	37	9	114338448	114338448	+	Intron	DEL	A	-	-	rs35670507		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114338448delA	uc004bfh.2	-						ZNF483_uc004bfg.2_Intron|PTGR1_uc011lwr.1_Intron|PTGR1_uc004bfi.3_Intron|PTGR1_uc004bfj.3_Intron|PTGR1_uc010mue.2_Intron	NM_012212	NP_036344	Q14914	PTGR1_HUMAN	prostaglandin reductase 1 isoform 1						leukotriene metabolic process	cytoplasm	15-oxoprostaglandin 13-oxidase activity|2-alkenal reductase activity|alcohol dehydrogenase (NAD) activity|zinc ion binding				0						actgagtctcaaaaaaaaaaa	0.020													4	2	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123924715	123924715	+	Intron	DEL	T	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123924715delT	uc004bkx.1	+						CEP110_uc004blb.1_Intron|CEP110_uc010mvp.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TCCTTCTAGCTTTTTTTTTTT	0.209													4	2	---	---	---	---	
CCBL1	883	broad.mit.edu	37	9	131598582	131598582	+	Intron	DEL	T	-	-	rs71497420		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131598582delT	uc004bwh.2	-						CCBL1_uc004bwf.2_Intron|CCBL1_uc004bwg.2_Intron|CCBL1_uc010myn.2_Intron|CCBL1_uc004bwj.2_Intron|CCBL1_uc011mbl.1_Intron|CCBL1_uc004bwi.2_Intron|CCBL1_uc010myo.2_Intron	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a						kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	tctttctttgttttttttttt	0.090													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	11696232	11696233	+	IGR	INS	-	AGGAAGGAAGGA	AGGAAGGAAGGA			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11696232_11696233insAGGAAGGAAGGA								USP6NL (42553 upstream) : ECHDC3 (88123 downstream)																							AGGaggaggagaggaaggaagg	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30960829	30960830	+	IGR	DEL	AC	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30960829_30960830delAC								LYZL2 (42182 upstream) : ZNF438 (172737 downstream)																							GGGATCAGCAACACACACACAC	0.426													4	2	---	---	---	---	
C10orf11	83938	broad.mit.edu	37	10	78138920	78138921	+	Intron	DEL	TG	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78138920_78138921delTG	uc001jxi.2	+							NM_032024	NP_114413	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)					tggccTTCTTtgtgtgtgtgtg	0.005													5	3	---	---	---	---	
SORCS3	22986	broad.mit.edu	37	10	106636518	106636519	+	Intron	INS	-	CTTC	CTTC	rs35909126		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106636518_106636519insCTTC	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		tctttctttctcttccttcctt	0.104													3	3	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26584942	26584943	+	Intron	INS	-	TGTG	TGTG	rs150672240	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26584942_26584943insTGTG	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Intron|MUC15_uc001mqx.2_Intron|MUC15_uc001mqy.2_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTTTCTCTCTCtgtgtgtgtgt	0.233													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	30746635	30746642	+	IGR	DEL	AAGAAAGG	-	-	rs59564646	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30746635_30746642delAAGAAAGG								MPPED2 (138705 upstream) : DCDC1 (218107 downstream)																							gaaagaaagaaagaaagggggagggaag	0.019													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	43198739	43198740	+	IGR	DEL	TG	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43198739_43198740delTG								None (None upstream) : API5 (134765 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.139													4	5	---	---	---	---	
TRIM48	79097	broad.mit.edu	37	11	55033274	55033274	+	Intron	DEL	A	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55033274delA	uc010rid.1	+							NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48							intracellular	zinc ion binding				0						TCTGGGAGTCAAAAAAAAAAA	0.343													9	4	---	---	---	---	
PAAF1	80227	broad.mit.edu	37	11	73611047	73611047	+	Intron	DEL	T	-	-	rs34058264		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73611047delT	uc001ouk.1	+						PAAF1_uc001oul.1_Intron|PAAF1_uc009ytx.1_Intron|PAAF1_uc001oum.1_Intron	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1						interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					CATGGAATTCTTTTTTTTTTT	0.378													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	52501561	52501562	+	RNA	INS	-	TT	TT	rs145272216	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52501561_52501562insTT	uc009zme.1	+	3		c.960_961insTT								Homo sapiens olfactory receptor, family 7, subfamily E, member 47 pseudogene, mRNA (cDNA clone IMAGE:5590288).																		GTTTTGCTGTCTTTTTTTTTTC	0.436													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53280185	53280186	+	IGR	INS	-	T	T	rs34054821		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53280185_53280186insT								KRT78 (37407 upstream) : KRT8 (10785 downstream)																							GTCCACCATAAttttttttttt	0.188													4	2	---	---	---	---	
CPM	1368	broad.mit.edu	37	12	69252527	69252527	+	Intron	DEL	C	-	-	rs72162014		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69252527delC	uc001sup.2	-						CPM_uc001sur.2_Intron|CPM_uc001suq.2_Intron	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			TTTTTTTTTTCATATAATTTC	0.318													4	2	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	71031025	71031025	+	Intron	DEL	G	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71031025delG	uc001swc.3	-						PTPRB_uc001swa.3_Intron|PTPRB_uc001swd.3_Intron|PTPRB_uc009zrr.1_Intron|PTPRB_uc001swe.2_Intron	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATGGAGACCTGGCCCCTTCTA	0.463													7	4	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													7	4	---	---	---	---	
STAB2	55576	broad.mit.edu	37	12	104131353	104131354	+	Intron	DEL	TC	-	-	rs141425461		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104131353_104131354delTC	uc001tjw.2	+						STAB2_uc009zug.2_Intron	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						ATTGACTGTTtctctctctctc	0.322													22	14	---	---	---	---	
USP30	84749	broad.mit.edu	37	12	109519423	109519424	+	Intron	INS	-	GC	GC			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109519423_109519424insGC	uc010sxi.1	+						USP30_uc001tnu.3_Intron|USP30_uc001tnw.3_5'Flank	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						cacgcacgcatgcgcgcacaca	0.252													7	5	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124252687	124252694	+	Intron	DEL	TCCTTTTT	-	-	rs71088958		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124252687_124252694delTCCTTTTT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ctcctcctcctcctttttttttgagaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128681061	128681062	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs145694873	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128681061_128681062insGTGTGTGTGT								None (None upstream) : TMEM132C (218229 downstream)																							TCTTGCTGATCgtgtgtgtgtg	0.183													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	51110371	51110372	+	Intron	DEL	TG	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51110371_51110372delTG	uc001vet.1	+											Homo sapiens mRNA for B-cell neoplasia associated transcript, (BCMS gene), splice variant D, non coding transcript.																		ttactttttctgtgtgtgtgtg	0.000													3	3	---	---	---	---	
FARP1	10160	broad.mit.edu	37	13	99056267	99056268	+	Intron	INS	-	CACCAT	CACCAT	rs116910146	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99056267_99056268insCACCAT	uc001vnj.2	+						FARP1_uc001vnh.2_Intron|uc001vnl.2_RNA	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			accaccaccaccaccatcacca	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87132434	87132437	+	IGR	DEL	AAAA	-	-	rs76785276		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87132434_87132437delAAAA								None (None upstream) : None (None downstream)																							ggaaggaaggaaAAAAAAAACAAA	0.010													4	3	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92537088	92537089	+	Intron	INS	-	T	T			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92537088_92537089insT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		ccacatctagcTTTTTTTTTTT	0.139													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97532348	97532350	+	IGR	DEL	CTT	-	-	rs12891049		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97532348_97532350delCTT								VRK1 (184398 upstream) : C14orf64 (859597 downstream)																							tccctccctccttcctccctccc	0.227													4	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106770438	106770439	+	Splice_Site	INS	-	CT	CT			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106770438_106770439insCT	uc010tyt.1	-	442		c.15776_splice	c.e442-1							Parts of antibodies, mostly variable regions.												0						CCTGGCCCAGCCTCTCTTGGCT	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56038833	56038833	+	IGR	DEL	G	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56038833delG								PRTG (3656 upstream) : NEDD4 (80298 downstream)																							aaaaaaaaaagaaGCTCCTGG	0.279													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10612763	10612766	+	IGR	DEL	TCCC	-	-	rs36095074		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10612763_10612766delTCCC								ATF7IP2 (35269 upstream) : EMP2 (9514 downstream)																							catccctccttccctccctccctc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	23287459	23287475	+	IGR	DEL	TTCCTTCCTTCCTTTCT	-	-	rs141194756	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23287459_23287475delTTCCTTCCTTCCTTTCT								SCNN1G (59259 upstream) : SCNN1B (26116 downstream)																							ccttccttccttccttccttcctttctttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80197673	80197674	+	IGR	INS	-	AA	AA	rs149618453	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80197673_80197674insAA								MAF (563051 upstream) : DYNLRB2 (377180 downstream)																							ACATCTGTGAGAacacacacac	0.386													4	2	---	---	---	---	
PKD1L2	114780	broad.mit.edu	37	16	81146182	81146183	+	Intron	INS	-	GAG	GAG			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81146182_81146183insGAG	uc002fgh.1	-						PKD1L2_uc002fgf.1_Intron|PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						atgatgatgatgatgaggggga	0.183													4	2	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81533877	81533878	+	Intron	INS	-	TCCT	TCCT	rs143054986	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81533877_81533878insTCCT	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						ccttccttccgtccttccttcc	0.134													5	3	---	---	---	---	
CWC25	54883	broad.mit.edu	37	17	36970998	36970999	+	Intron	INS	-	AA	AA	rs72370833		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36970998_36970999insAA	uc002hqu.2	-						CWC25_uc010wdv.1_Intron|CWC25_uc010wdw.1_Intron|CWC25_uc010wdx.1_Intron	NM_017748	NP_060218	Q9NXE8	CWC25_HUMAN	coiled-coil domain containing 49												0						gactccgtctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
TNS4	84951	broad.mit.edu	37	17	38638837	38638838	+	Intron	INS	-	AC	AC			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38638837_38638838insAC	uc010cxb.2	-						TNS4_uc002huu.3_5'Flank	NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor						apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			ctctactaaagacacacacaca	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	71732323	71732324	+	IGR	DEL	TG	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71732323_71732324delTG								SDK2 (92096 upstream) : C17orf54 (13085 downstream)																							ACTCTCTCTCtgtgtgtgtgtg	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14868025	14868025	+	IGR	DEL	G	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14868025delG								ANKRD30B (15288 upstream) : LOC644669 (445530 downstream)																							ctatggttgtggcagccatgg	0.000													25	14	---	---	---	---	
SBNO2	22904	broad.mit.edu	37	19	1164488	1164488	+	Intron	DEL	A	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1164488delA	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cccagatgccaggggcagtgg	0.109													5	3	---	---	---	---	
IDH3B	3420	broad.mit.edu	37	20	2643833	2643834	+	Intron	INS	-	AAATGCAAT	AAATGCAAT	rs149453784	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2643833_2643834insAAATGCAAT	uc002wgp.2	-						IDH3B_uc002wgq.2_Intron|IDH3B_uc002wgr.2_Intron|IDH3B_uc010zpz.1_Intron	NM_006899	NP_008830	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3, beta subunit isoform						isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	electron carrier activity|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	TGGTATTCCAGAAATGCAATGA	0.267													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4758243	4758244	+	IGR	INS	-	AC	AC	rs61343089		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4758243_4758244insAC								PRNT (36929 upstream) : RASSF2 (2426 downstream)																							cacacacacatacacacacaca	0.000													3	3	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60973165	60973166	+	Intron	INS	-	TGGTGA	TGGTGA	rs143962806	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973165_60973166insTGGTGA	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ggtggtgatggtggtggtggtg	0.000													6	3	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45666582	45666582	+	Intron	DEL	C	-	-	rs72021582		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666582delC	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GTGCCTAAGACCCCCCCCCCG	0.672													6	6	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						ATGATGAAATACTAACTGTTTTAC	0.402													6	3	---	---	---	---	
CCDC117	150275	broad.mit.edu	37	22	29181913	29181913	+	Intron	DEL	A	-	-	rs35631283		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29181913delA	uc003aeb.2	+						CCDC117_uc011aki.1_Intron|CCDC117_uc011akj.1_Intron|CCDC117_uc011akk.1_Intron	NM_173510	NP_775781	Q8IWD4	CC117_HUMAN	coiled-coil domain containing 117											breast(1)	1						cccatctcttaaaaaaaaaaa	0.139													11	6	---	---	---	---	
APOL5	80831	broad.mit.edu	37	22	36113785	36113786	+	5'Flank	INS	-	AA	AA	rs71322979		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36113785_36113786insAA	uc003aof.2	+							NM_030642	NP_085145	Q9BWW9	APOL5_HUMAN	apolipoprotein L5						lipid metabolic process|lipid transport|lipoprotein metabolic process	cytoplasm|extracellular region	high-density lipoprotein particle binding|lipid binding|protein binding				0						agctccatcgcaaaaaaaaaaa	0.139													13	6	---	---	---	---	
TRIOBP	11078	broad.mit.edu	37	22	38142222	38142223	+	Intron	INS	-	AAA	AAA			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38142222_38142223insAAA	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atv.2_5'Flank|TRIOBP_uc003atw.2_5'Flank	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					CAGGAAGTTTGAAAAAAAAAAA	0.391													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42544516	42544517	+	IGR	DEL	AC	-	-	rs140105017		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42544516_42544517delAC								CYP2D7P1 (3941 upstream) : TCF20 (11502 downstream)																							tctcaagaaaacacacacacac	0.139													3	3	---	---	---	---	
SAPS2	9701	broad.mit.edu	37	22	50836075	50836076	+	Intron	INS	-	CC	CC	rs144243064	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50836075_50836076insCC	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		AGCCTTGTCATCTCTGAGCTTT	0.584													6	3	---	---	---	---	
SAPS2	9701	broad.mit.edu	37	22	50836289	50836290	+	Intron	INS	-	CC	CC	rs139970798	by1000genomes	TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50836289_50836290insCC	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		AGCCTTGTCATCTCTGAGCTTT	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	284658	284659	+	IGR	INS	-	G	G			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:284658_284659insG								NCRNA00107 (2606 upstream) : PPP2R3B (10313 downstream)																							CTCAGGGACGTtgtgtgtgtgt	0.480													5	4	---	---	---	---	
GYG2	8908	broad.mit.edu	37	X	2774790	2774793	+	Intron	DEL	TATG	-	-	rs151089910		TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2774790_2774793delTATG	uc004cqs.1	+						GYG2_uc004cqt.1_Intron|GYG2_uc004cqu.1_Intron|GYG2_uc004cqv.1_Intron|GYG2_uc004cqw.1_Intron|GYG2_uc004cqx.1_Intron|GYG2_uc010ndc.1_Intron	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				tctatctatctatgtatctatcta	0.230													6	17	---	---	---	---	
ARSH	347527	broad.mit.edu	37	X	2942330	2942330	+	Intron	DEL	A	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2942330delA	uc011mhj.1	+							NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H							integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGCTAGACCGAAAAAAAAAAA	0.373													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	136030245	136030245	+	Intron	DEL	T	-	-			TCGA-66-2783-01A-01D-1267-08	TCGA-66-2783-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136030245delT	uc004fai.1	+											Homo sapiens cDNA FLJ31132 fis, clone IMR322000953.																		GAGAACCTGCTTTTTTTTTTT	0.438													4	2	---	---	---	---	
