Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MEGF6	1953	broad.mit.edu	37	1	3425698	3425698	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3425698A>G	uc001akl.2	-	12	1696	c.1469T>C	c.(1468-1470)GTC>GCC	p.V490A	MEGF6_uc001akk.2_Missense_Mutation_p.V385A	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	490						extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		ATCGGCCCCGACGTCGTCATC	0.682	Ovarian(73;978 3658)															0.153846	5.042062	6.530664	2	11	KEEP	---	---	---	---	0	4	5	15	-1	capture	Missense_Mutation	SNP	3425698	3425698	MEGF6	1	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	9375	271
SNX7	51375	broad.mit.edu	37	1	99203845	99203845	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:99203845C>T	uc010ouc.1	+	8	1230	c.1178C>T	c.(1177-1179)GCC>GTC	p.A393V	SNX7_uc001dsa.2_Intron|SNX7_uc010oud.1_Missense_Mutation_p.A338V	NM_015976	NP_057060	Q9UNH6	SNX7_HUMAN	sorting nexin 7 isoform a	329					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		GCTAATAATGCCCTGAAAGCA	0.348																0.022222	-38.926108	6.890658	4	176	KEEP	---	---	---	---	3	1	88	101	-1	capture	Missense_Mutation	SNP	99203845	99203845	SNX7	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14799	271
AMPD2	271	broad.mit.edu	37	1	110172108	110172108	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110172108C>T	uc009wfh.1	+	15	2562	c.2020C>T	c.(2020-2022)CGC>TGC	p.R674C	AMPD2_uc009wfg.1_RNA|AMPD2_uc001dyb.1_Missense_Mutation_p.R593C|AMPD2_uc001dyc.1_Missense_Mutation_p.R674C|AMPD2_uc010ovr.1_Missense_Mutation_p.R599C|AMPD2_uc001dyd.1_Missense_Mutation_p.R555C|AMPD2_uc001dye.1_5'UTR	NM_004037	NP_004028	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2 (isoform L)	674					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|breast(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		GAACCACCTGCGCAGGTGCCT	0.602																0.032397	-83.606603	26.957791	15	448	KEEP	---	---	---	---	8	8	215	284	-1	capture	Missense_Mutation	SNP	110172108	110172108	AMPD2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	586	271
FLG	2312	broad.mit.edu	37	1	152281686	152281686	+	Silent	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152281686G>A	uc001ezu.1	-	3	5712	c.5676C>T	c.(5674-5676)GCC>GCT	p.A1892A		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1892	Ser-rich.|Filaggrin 11.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGAGCTGTCGGCCCGAGAGG	0.572												Ichthyosis				0.20922	422.87682	489.04128	177	669	KEEP	---	---	---	---	106	100	373	420	-1	capture	Silent	SNP	152281686	152281686	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5867	271
LELP1	149018	broad.mit.edu	37	1	153177307	153177307	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153177307C>T	uc001fbl.2	+	2	234	c.124C>T	c.(124-126)CGC>TGC	p.R42C		NM_001010857	NP_001010857	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	42	Cys/Pro-rich.									ovary(1)	1	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGCTGCAACGCTGTTTCGA	0.552																0.594595	554.13917	556.452877	176	120	KEEP	---	---	---	---	82	107	55	83	-1	capture	Missense_Mutation	SNP	153177307	153177307	LELP1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8638	271
NUP210L	91181	broad.mit.edu	37	1	154067448	154067448	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154067448T>C	uc001fdw.2	-	15	2222	c.2150A>G	c.(2149-2151)TAC>TGC	p.Y717C	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Missense_Mutation_p.Y717C	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	717						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCGGTAGATGTACTGGTTCTG	0.398																0.551181	256.771522	257.062882	70	57	KEEP	---	---	---	---	33	47	40	22	-1	capture	Missense_Mutation	SNP	154067448	154067448	NUP210L	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10668	271
ANGEL2	90806	broad.mit.edu	37	1	213181756	213181756	+	Silent	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:213181756C>T	uc001hjz.2	-	3	593	c.438G>A	c.(436-438)ACG>ACA	p.T146T	ANGEL2_uc010pto.1_Silent_p.T20T|ANGEL2_uc010ptp.1_Silent_p.T20T|ANGEL2_uc001hka.2_5'UTR|ANGEL2_uc010ptq.1_RNA|ANGEL2_uc001hkb.2_Silent_p.T124T	NM_144567	NP_653168	Q5VTE6	ANGE2_HUMAN	LOC90806 protein	146											0				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		CTAGGATCTTCGTTTTTTCTT	0.323																0.591549	411.182225	412.741261	126	87	KEEP	---	---	---	---	60	74	47	46	-1	capture	Silent	SNP	213181756	213181756	ANGEL2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	606	271
OBSCN	84033	broad.mit.edu	37	1	228557749	228557749	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228557749G>A	uc009xez.1	+	91	20118	c.20074G>A	c.(20074-20076)GAA>AAA	p.E6692K	OBSCN_uc001hsr.1_Missense_Mutation_p.E1321K	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	6692	Protein kinase 1.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CCACCTCAGCGAAGACGCCAA	0.667					4006											0.293839	167.780148	175.798883	62	149	KEEP	---	---	---	---	35	34	81	76	-1	capture	Missense_Mutation	SNP	228557749	228557749	OBSCN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10717	271
SIPA1L2	57568	broad.mit.edu	37	1	232649623	232649623	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232649623C>T	uc001hvg.2	-	1	1621	c.1463G>A	c.(1462-1464)CGC>CAC	p.R488H		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	488					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GAAGAATTTGCGGTAATAATA	0.453																0.012245	-126.412767	7.083315	6	484	KEEP	---	---	---	---	2	6	265	305	-1	capture	Missense_Mutation	SNP	232649623	232649623	SIPA1L2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14223	271
OR4C16	219428	broad.mit.edu	37	11	55340484	55340484	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55340484G>A	uc010rih.1	+	1	881	c.881G>A	c.(880-882)AGT>AAT	p.S294N		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	294	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				GAAGTGAAAAGTGCCATGAGG	0.368																0.469136	115.941147	116.008534	38	43	KEEP	---	---	---	---	16	23	15	29	-1	capture	Missense_Mutation	SNP	55340484	55340484	OR4C16	11	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10953	271
OR8H1	219469	broad.mit.edu	37	11	56058035	56058035	+	Silent	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56058035G>A	uc010rje.1	-	1	504	c.504C>T	c.(502-504)TGC>TGT	p.C168C		NM_001005199	NP_001005199	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	Esophageal squamous(21;0.00448)					CATTTGAGTCGCAGAAATGCA	0.433																0.393103	162.755396	164.201563	57	88	KEEP	---	---	---	---	21	39	47	50	-1	capture	Silent	SNP	56058035	56058035	OR8H1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	11141	271
OSBP	5007	broad.mit.edu	37	11	59368009	59368009	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59368009T>C	uc001noc.1	-	7	1751	c.1271A>G	c.(1270-1272)AAG>AGG	p.K424R	OSBP_uc009ymr.1_RNA	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	424	Sterol binding (By similarity).				lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		AATGCAGTTCTTCATGATGCT	0.468																0.43346	420.020096	421.034073	114	149	KEEP	---	---	---	---	60	70	77	95	-1	capture	Missense_Mutation	SNP	59368009	59368009	OSBP	11	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11177	271
NAALAD2	10003	broad.mit.edu	37	11	89882229	89882229	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89882229A>G	uc001pdf.3	+	4	546	c.437A>G	c.(436-438)AAT>AGT	p.N146S	NAALAD2_uc009yvx.2_Missense_Mutation_p.N146S|NAALAD2_uc009yvy.2_Missense_Mutation_p.N146S|NAALAD2_uc001pdd.2_Missense_Mutation_p.N146S|NAALAD2_uc001pde.2_Missense_Mutation_p.N146S	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	146	Extracellular (Potential).				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				AATGTTACAAATATTGTGCCA	0.328																0.393103	404.398893	407.296985	114	176	KEEP	---	---	---	---	72	67	114	117	-1	capture	Missense_Mutation	SNP	89882229	89882229	NAALAD2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	10038	271
CLSTN3	9746	broad.mit.edu	37	12	7310162	7310162	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7310162C>T	uc001qsr.2	+	17	2883	c.2605C>T	c.(2605-2607)CGC>TGC	p.R869C	CLSTN3_uc001qss.2_Missense_Mutation_p.R881C|CLSTN3_uc001qst.2_Missense_Mutation_p.R277C	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor	869	Cytoplasmic (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						GGGCCTGGTGCGCATCCATTC	0.657																0.432432	43.994837	44.141659	16	21	KEEP	---	---	---	---	12	6	14	9	-1	capture	Missense_Mutation	SNP	7310162	7310162	CLSTN3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3528	271
PPFIBP1	8496	broad.mit.edu	37	12	27841316	27841316	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:27841316C>T	uc001ric.1	+	25	2851	c.2474C>T	c.(2473-2475)GCG>GTG	p.A825V	PPFIBP1_uc010sjr.1_Missense_Mutation_p.A656V|PPFIBP1_uc001rib.1_Missense_Mutation_p.A819V|PPFIBP1_uc001ria.2_Missense_Mutation_p.A794V|PPFIBP1_uc001rid.1_Missense_Mutation_p.A672V|PPFIBP1_uc001rif.1_Missense_Mutation_p.A332V	NM_003622	NP_003613	Q86W92	LIPB1_HUMAN	PTPRF interacting protein binding protein 1	825	SAM 3.				cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)					GCAGAATATGCGCCCAATCTC	0.473																0.011278	-136.704141	9.114456	6	526	KEEP	---	---	---	---	2	5	267	332	-1	capture	Missense_Mutation	SNP	27841316	27841316	PPFIBP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12214	271
SLC38A4	55089	broad.mit.edu	37	12	47163175	47163175	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:47163175G>A	uc001rpi.2	-	15	1735	c.1336C>T	c.(1336-1338)CGA>TGA	p.R446*	SLC38A4_uc001rpj.2_Nonsense_Mutation_p.R446*	NM_018018	NP_060488	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	446	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Lung SC(27;0.192)|Renal(347;0.236)					CTGAAGGGTCGTTTGGGAAAT	0.363																0.418502	288.784916	290.101151	95	132	KEEP	---	---	---	---	50	59	86	66	-1	capture	Nonsense_Mutation	SNP	47163175	47163175	SLC38A4	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	14498	271
DNAJC22	79962	broad.mit.edu	37	12	49745175	49745175	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49745175C>T	uc001rua.2	+	3	1317	c.916C>T	c.(916-918)CCA>TCA	p.P306S	DNAJC22_uc001rub.2_Missense_Mutation_p.P306S	NM_024902	NP_079178	Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	306	J.				protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			ovary(1)	1						GGTCTGGCACCCAGACCACAA	0.522																0.038095	-17.997711	6.34492	4	101	KEEP	---	---	---	---	2	2	50	58	-1	capture	Missense_Mutation	SNP	49745175	49745175	DNAJC22	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	4597	271
TARBP2	6895	broad.mit.edu	37	12	53895818	53895818	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53895818G>A	uc001sdo.2	+	2	561	c.73G>A	c.(73-75)GCC>ACC	p.A25T	MAP3K12_uc001sdm.1_5'Flank|MAP3K12_uc001sdn.1_5'Flank|TARBP2_uc009znb.2_Missense_Mutation_p.A25T|TARBP2_uc001sdp.2_Missense_Mutation_p.A4T|TARBP2_uc001sdq.2_Intron|TARBP2_uc001sdr.2_5'UTR|TARBP2_uc001sds.2_Missense_Mutation_p.A25T|TARBP2_uc001sdt.2_Missense_Mutation_p.A4T|TARBP2_uc001sdu.2_5'UTR|TARBP2_uc001sdv.2_RNA	NM_134323	NP_599150	Q15633	TRBP2_HUMAN	TAR RNA binding protein 2 isoform a	25	Sufficient for interaction with PRKRA.				miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding			central_nervous_system(1)	1						AATGCTGGCCGCCAACCCAGG	0.592																0.020619	-43.576535	6.363297	4	190	KEEP	---	---	---	---	2	3	110	109	-1	capture	Missense_Mutation	SNP	53895818	53895818	TARBP2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15444	271
CCDC63	160762	broad.mit.edu	37	12	111322003	111322003	+	Silent	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111322003G>A	uc001trv.1	+	8	1218	c.1023G>A	c.(1021-1023)ACG>ACA	p.T341T	CCDC63_uc010sye.1_Silent_p.T301T|CCDC63_uc001trw.1_Silent_p.T256T	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	341	Potential.									skin(6)|ovary(1)|pancreas(1)	8						CGTATGTCACGGAGCTCAACA	0.552																0.380531	137.500277	138.914321	43	70	KEEP	---	---	---	---	24	22	38	36	-1	capture	Silent	SNP	111322003	111322003	CCDC63	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	2808	271
OASL	8638	broad.mit.edu	37	12	121469372	121469372	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121469372A>G	uc001tzj.1	-	3	536	c.530T>C	c.(529-531)CTG>CCG	p.L177P	OASL_uc001tzk.1_Missense_Mutation_p.L177P	NM_003733	NP_003724	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like isoform a	177					interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity			skin(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGCCTTGATCAGGCTCACATA	0.552	Colon(192;517 2041 31392 31913 39966)															0.025641	-30.441913	8.434569	4	152	KEEP	---	---	---	---	1	4	91	83	-1	capture	Missense_Mutation	SNP	121469372	121469372	OASL	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	10707	271
RIMBP2	23504	broad.mit.edu	37	12	130934752	130934752	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130934752G>A	uc001uil.2	-	6	687	c.523C>T	c.(523-525)CGC>TGC	p.R175C	RIMBP2_uc001uim.2_Missense_Mutation_p.R83C	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	175	SH3 1.					cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TACCTATAGCGGGCAACACAG	0.552																0.404762	50.972214	51.303445	17	25	KEEP	---	---	---	---	6	14	18	15	-1	capture	Missense_Mutation	SNP	130934752	130934752	RIMBP2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13255	271
USPL1	10208	broad.mit.edu	37	13	31232152	31232152	+	Silent	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:31232152A>G	uc001utc.2	+	9	2370	c.1938A>G	c.(1936-1938)CAA>CAG	p.Q646Q	USPL1_uc001utd.2_Silent_p.Q317Q|USPL1_uc001ute.1_Silent_p.Q317Q	NM_005800	NP_005791	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	646					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			pancreas(2)|skin(1)	3		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		AGCTTATTCAAGACCAATTTG	0.343	Ovarian(60;318 1180 1554 28110 31601)															0.365079	155.410891	157.430346	46	80	KEEP	---	---	---	---	18	29	34	49	-1	capture	Silent	SNP	31232152	31232152	USPL1	13	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	16974	271
THSD1	55901	broad.mit.edu	37	13	52951899	52951899	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:52951899T>C	uc001vgo.2	-	5	2751	c.2206A>G	c.(2206-2208)AGG>GGG	p.R736G	THSD1_uc001vgp.2_Missense_Mutation_p.R683G|THSD1_uc010tgz.1_Missense_Mutation_p.R357G|THSD1_uc010aea.2_Missense_Mutation_p.R197G	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	736	Cytoplasmic (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		TCTGGTTTCCTCAAGGGCTGC	0.552																0.015291	-76.927268	10.260534	5	322	KEEP	---	---	---	---	4	1	176	176	-1	capture	Missense_Mutation	SNP	52951899	52951899	THSD1	13	T	C	C	C	1	0	0	0	0	1	0	0	0	700	54	3	3	15762	271
EDDM3A	10876	broad.mit.edu	37	14	21216002	21216002	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21216002G>A	uc001vyb.2	+	2	330	c.263G>A	c.(262-264)CGA>CAA	p.R88Q	EDDM3A_uc001vyc.2_Missense_Mutation_p.R88Q	NM_006683	NP_006674	Q14507	EP3A_HUMAN	human epididymis-specific 3 alpha precursor	88					sperm displacement	extracellular space					0						GGGAGCGACCGATATAGAAAT	0.453																0.446809	130.946617	131.176785	42	52	KEEP	---	---	---	---	24	20	26	29	-1	capture	Missense_Mutation	SNP	21216002	21216002	EDDM3A	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4864	271
MKRN3	7681	broad.mit.edu	37	15	23811039	23811039	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23811039C>A	uc001ywh.3	+	1	586	c.110C>A	c.(109-111)CCC>CAC	p.P37H	MKRN3_uc001ywi.2_Missense_Mutation_p.P37H|MKRN3_uc010ayi.1_Missense_Mutation_p.P37H	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	37						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GTCTGTGAGCCCTCCGGGGAA	0.687					79											0.39	106.389525	107.453196	39	61	KEEP	---	---	---	---	18	23	31	38	0.560975609756	capture	Missense_Mutation	SNP	23811039	23811039	MKRN3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	9520	271
TMOD2	29767	broad.mit.edu	37	15	52075020	52075020	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52075020G>C	uc002abk.2	+	7	948	c.727G>C	c.(727-729)GCC>CCC	p.A243P	TMOD2_uc002abl.3_Intron|TMOD2_uc010bfb.2_Missense_Mutation_p.A199P	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	243					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		TGACCCTGTGGCCATTGTGAG	0.398																0.427313	351.146579	352.191618	97	130	KEEP	---	---	---	---	44	59	72	76	-1	capture	Missense_Mutation	SNP	52075020	52075020	TMOD2	15	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	16117	271
FSD2	123722	broad.mit.edu	37	15	83455346	83455346	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:83455346T>C	uc002bjd.2	-	3	819	c.652A>G	c.(652-654)AAA>GAA	p.K218E	FSD2_uc010uol.1_Missense_Mutation_p.K218E|FSD2_uc010uom.1_Missense_Mutation_p.K218E	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing	218	Potential.									central_nervous_system(1)	1						TACATGTTTTTGTGAATTTCA	0.363																0.45	90.218451	90.349007	27	33	KEEP	---	---	---	---	10	18	20	15	-1	capture	Missense_Mutation	SNP	83455346	83455346	FSD2	15	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	6014	271
PDE8A	5151	broad.mit.edu	37	15	85664158	85664158	+	Missense_Mutation	SNP	C	G	G	rs144501404	byFrequency	TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85664158C>G	uc002blh.2	+	18	2054	c.1865C>G	c.(1864-1866)ACT>AGT	p.T622S	PDE8A_uc002bli.2_Missense_Mutation_p.T576S|PDE8A_uc010bnc.2_Missense_Mutation_p.T375S|PDE8A_uc010bnd.2_Missense_Mutation_p.T375S|PDE8A_uc002blj.2_Missense_Mutation_p.T242S|PDE8A_uc002blk.2_Missense_Mutation_p.T242S|PDE8A_uc002bll.2_5'UTR	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	622	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			TACAATGACACTGCTGTGCTG	0.483																0.022901	-26.797778	6.426929	3	128	KEEP	---	---	---	---	1	2	68	70	-1	capture	Missense_Mutation	SNP	85664158	85664158	PDE8A	15	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	11556	271
PCSK6	5046	broad.mit.edu	37	15	101853660	101853660	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101853660C>T	uc002bwy.2	-	21	2934	c.2620G>A	c.(2620-2622)GAC>AAC	p.D874N	PCSK6_uc010bpd.2_Missense_Mutation_p.D670N|PCSK6_uc010bpe.2_Missense_Mutation_p.D861N|PCSK6_uc002bxa.2_Missense_Mutation_p.D874N|PCSK6_uc002bxb.2_Missense_Mutation_p.D861N	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	874	CRM (Cys-rich motif).				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CACTTCCAGTCGTGGAAGTGG	0.567																0.401869	126.405018	127.305303	43	64	KEEP	---	---	---	---	19	39	29	47	-1	capture	Missense_Mutation	SNP	101853660	101853660	PCSK6	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11507	271
CNTNAP4	85445	broad.mit.edu	37	16	76461484	76461484	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:76461484G>A	uc002feu.1	+	6	911	c.526G>A	c.(526-528)GGA>AGA	p.G176R	CNTNAP4_uc002fev.1_Missense_Mutation_p.G88R|CNTNAP4_uc010chb.1_Missense_Mutation_p.G151R|CNTNAP4_uc002fex.1_Missense_Mutation_p.G179R|CNTNAP4_uc002few.2_Missense_Mutation_p.G151R	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	176	Extracellular (Potential).|F5/8 type C.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						CGAAGTGTTCGGATGTGCATA	0.398																0.482759	190.995234	191.02527	56	60	KEEP	---	---	---	---	21	36	30	30	-1	capture	Missense_Mutation	SNP	76461484	76461484	CNTNAP4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3614	271
ADAMTS18	170692	broad.mit.edu	37	16	77389861	77389861	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:77389861C>T	uc002ffc.3	-	9	1855	c.1436G>A	c.(1435-1437)CGC>CAC	p.R479H	ADAMTS18_uc010chc.1_Missense_Mutation_p.R67H|ADAMTS18_uc002ffe.1_Missense_Mutation_p.R175H|ADAMTS18_uc010vni.1_RNA	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	479	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						GAGATACTGGCGGCTGCAGGA	0.488					1451											0.022727	-37.755591	6.930102	4	172	KEEP	---	---	---	---	2	2	110	128	-1	capture	Missense_Mutation	SNP	77389861	77389861	ADAMTS18	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	263	271
KRT38	8687	broad.mit.edu	37	17	39593695	39593695	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39593695C>T	uc002hwq.1	-	7	1763	c.1340G>A	c.(1339-1341)TGT>TAT	p.C447Y		NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38	447	Tail.					intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)				GCTGGCTCCACAGGTGGGCCC	0.612																0.1	1.910023	6.698903	3	27	KEEP	---	---	---	---	3	0	12	18	-1	capture	Missense_Mutation	SNP	39593695	39593695	KRT38	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8395	271
DNM2	1785	broad.mit.edu	37	19	10887808	10887808	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10887808G>A	uc002mps.1	+	5	768	c.604G>A	c.(604-606)GGT>AGT	p.G202S	DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Missense_Mutation_p.G202S|DNM2_uc002mpv.1_Missense_Mutation_p.G202S|DNM2_uc002mpu.1_Missense_Mutation_p.G202S|DNM2_uc010dxl.1_Missense_Mutation_p.G202S	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2	202					G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			ACGGACCATCGGTGTCATCAC	0.458																0.030303	-23.300517	8.62875	4	128	KEEP	---	---	---	---	0	5	65	79	-1	capture	Missense_Mutation	SNP	10887808	10887808	DNM2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4628	271
CILP2	148113	broad.mit.edu	37	19	19654993	19654993	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19654993G>A	uc002nmv.3	+	8	1724	c.1639G>A	c.(1639-1641)GTG>ATG	p.V547M	CILP2_uc002nmw.3_Missense_Mutation_p.V553M	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	547						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						AGGTGCCGGCGTGTACCACGA	0.622																0.410405	207.69397	208.906359	71	102	KEEP	---	---	---	---	36	37	53	56	-1	capture	Missense_Mutation	SNP	19654993	19654993	CILP2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3395	271
ZNF701	55762	broad.mit.edu	37	19	53085986	53085986	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53085986A>G	uc002pzs.1	+	4	801	c.674A>G	c.(673-675)AAT>AGT	p.N225S	ZNF701_uc010ydn.1_Missense_Mutation_p.N291S	NM_018260	NP_060730	Q9NV72	ZN701_HUMAN	zinc finger protein 701	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		AAAGCCTTTAATGGTAGCTCA	0.368	NSCLC(89;451 1475 9611 20673 52284)															0.330357	123.631528	126.491004	37	75	KEEP	---	---	---	---	17	20	45	34	-1	capture	Missense_Mutation	SNP	53085986	53085986	ZNF701	19	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17983	271
LILRB2	10288	broad.mit.edu	37	19	54782295	54782295	+	Silent	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54782295C>T	uc002qfb.2	-	7	1343	c.1077G>A	c.(1075-1077)GCG>GCA	p.A359A	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Silent_p.A359A|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Silent_p.A359A|LILRB2_uc010yet.1_Silent_p.A243A|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	359	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGCTGCTCCCGCCTTGGTCA	0.572																0.388889	158.859987	160.419357	56	88	KEEP	---	---	---	---	31	30	56	41	-1	capture	Silent	SNP	54782295	54782295	LILRB2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8711	271
ZSCAN18	65982	broad.mit.edu	37	19	58601319	58601319	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58601319G>A	uc002qri.2	-	2	625	c.316C>T	c.(316-318)CGG>TGG	p.R106W	ZSCAN18_uc002qrj.3_Missense_Mutation_p.R106W|ZSCAN18_uc010yhs.1_Intron|ZSCAN18_uc002qrh.2_Missense_Mutation_p.R106W|ZSCAN18_uc010yht.1_Missense_Mutation_p.R162W|ZSCAN18_uc002qrk.1_Missense_Mutation_p.R106W|ZSCAN18_uc002qrl.2_Missense_Mutation_p.R106W	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	106	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		ACCCAGGGCCGGACCTTATCA	0.647																0.033898	-33.432833	8.579493	6	171	KEEP	---	---	---	---	4	2	94	98	-1	capture	Missense_Mutation	SNP	58601319	58601319	ZSCAN18	19	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	18106	271
MFSD9	84804	broad.mit.edu	37	2	103335600	103335600	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103335600C>T	uc002tcb.2	-	6	772	c.704G>A	c.(703-705)CGA>CAA	p.R235Q	MFSD9_uc010fja.2_RNA	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing	235					transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						ATGGGTCTTTCGCAATGGCAG	0.567																0.433333	354.114943	355.142541	117	153	KEEP	---	---	---	---	75	57	65	118	-1	capture	Missense_Mutation	SNP	103335600	103335600	MFSD9	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9451	271
SLC5A7	60482	broad.mit.edu	37	2	108626880	108626880	+	Missense_Mutation	SNP	G	A	A	rs148535388	byFrequency	TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108626880G>A	uc002tdv.2	+	9	1582	c.1306G>A	c.(1306-1308)GTG>ATG	p.V436M	SLC5A7_uc010ywm.1_Missense_Mutation_p.V189M|SLC5A7_uc010fjj.2_Missense_Mutation_p.V436M|SLC5A7_uc010ywn.1_Missense_Mutation_p.V323M	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	436	Helical; (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	CTATGGGGCCGTGGCAGGTTA	0.488																0.427746	221.322071	222.109741	74	99	KEEP	---	---	---	---	33	49	60	51	-1	capture	Missense_Mutation	SNP	108626880	108626880	SLC5A7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14562	271
ZRANB3	84083	broad.mit.edu	37	2	135958008	135958008	+	Silent	SNP	T	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135958008T>C	uc002tum.2	-	21	3261	c.3144A>G	c.(3142-3144)AGA>AGG	p.R1048R	ZRANB3_uc002tuk.2_Silent_p.R591R|ZRANB3_uc002tul.2_Silent_p.R1046R	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	1048						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		GTCTGGCAGTTCTCTAAAAGT	0.363																0.482759	47.118287	47.126909	14	15	KEEP	---	---	---	---	7	9	11	6	-1	capture	Silent	SNP	135958008	135958008	ZRANB3	2	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	18100	271
CWC22	57703	broad.mit.edu	37	2	180810270	180810270	+	Silent	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:180810270A>G	uc010frh.1	-	20	2613	c.2313T>C	c.(2311-2313)AAT>AAC	p.N771N	CWC22_uc002uno.2_Silent_p.N293N|CWC22_uc002unp.2_Silent_p.N771N	NM_020943	NP_065994	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein homolog	771						catalytic step 2 spliceosome	protein binding|RNA binding				0						AACCACTTGAATTTTGATCTC	0.378																0.372937	394.509495	398.802072	113	190	KEEP	---	---	---	---	74	55	101	112	-1	capture	Silent	SNP	180810270	180810270	CWC22	2	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	4028	271
FAM134A	79137	broad.mit.edu	37	2	220046109	220046109	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220046109C>T	uc002vjw.3	+	7	939	c.803C>T	c.(802-804)GCA>GTA	p.A268V	FAM134A_uc010fwc.2_Missense_Mutation_p.A61V|FAM134A_uc002vjx.2_Missense_Mutation_p.A61V	NM_024293	NP_077269	Q8NC44	F134A_HUMAN	hypothetical protein LOC79137	268						endoplasmic reticulum|integral to membrane				ovary(1)|central_nervous_system(1)	2		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGAAGAATGCACCCCCAGGA	0.547																0.028777	-27.482632	6.449888	4	135	KEEP	---	---	---	---	3	2	71	84	-1	capture	Missense_Mutation	SNP	220046109	220046109	FAM134A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	5399	271
PAX3	5077	broad.mit.edu	37	2	223161799	223161799	+	Silent	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223161799C>T	uc010fwo.2	-	2	585	c.219G>A	c.(217-219)TCG>TCA	p.S73S	PAX3_uc002vmt.1_Silent_p.S73S|PAX3_uc002vmy.1_Silent_p.S73S|PAX3_uc002vmv.1_Silent_p.S73S|PAX3_uc002vmw.1_Silent_p.S73S|PAX3_uc002vmx.1_Silent_p.S73S|PAX3_uc002vmz.1_Silent_p.S73S|PAX3_uc002vna.1_Silent_p.S73S|CCDC140_uc002vnb.1_5'Flank	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	73	Paired.		S -> L (in WS1).		apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCAGCTGGCGCGAGATGACGC	0.647					141	T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						0.421053	48.896983	49.102748	16	22	KEEP	---	---	---	---	10	10	13	14	-1	capture	Silent	SNP	223161799	223161799	PAX3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11383	271
COL4A4	1286	broad.mit.edu	37	2	227922184	227922184	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227922184G>A	uc010zlt.1	-	29	3170	c.2516C>T	c.(2515-2517)CCG>CTG	p.P839L		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	839	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		AGGGAGTCCCGGTTGCCCTGG	0.433																0.205128	17.88172	21.025163	8	31	KEEP	---	---	---	---	4	5	15	18	-1	capture	Missense_Mutation	SNP	227922184	227922184	COL4A4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3658	271
MATN4	8785	broad.mit.edu	37	20	43933173	43933173	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43933173G>A	uc002xnn.2	-	3	525	c.338C>T	c.(337-339)ACG>ATG	p.T113M	MATN4_uc002xno.2_Missense_Mutation_p.T113M|MATN4_uc002xnp.2_Missense_Mutation_p.T113M|MATN4_uc010zwr.1_Missense_Mutation_p.T61M|MATN4_uc002xnr.1_Missense_Mutation_p.T113M|RBPJL_uc002xns.2_5'Flank|RBPJL_uc002xnt.2_5'Flank	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	113	VWFA 1.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)				TGCCAGTCCCGTCATGGTGCC	0.667																0.361111	37.967032	38.577454	13	23	KEEP	---	---	---	---	5	8	11	15	-1	capture	Missense_Mutation	SNP	43933173	43933173	MATN4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9249	271
MC3R	4159	broad.mit.edu	37	20	54824649	54824649	+	Silent	SNP	G	C	C	rs139424256		TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54824649G>C	uc002xxb.2	+	1	862	c.750G>C	c.(748-750)GTG>GTC	p.V250V		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	287	Helical; Name=6; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			TCCTGGGCGTGTTCATCTTCT	0.597																0.022556	-27.200809	6.60637	3	130	KEEP	---	---	---	---	3	0	75	62	-1	capture	Silent	SNP	54824649	54824649	MC3R	20	G	C	C	C	1	0	0	0	0	0	0	0	1	613	48	4	4	9278	271
C20orf43	51507	broad.mit.edu	37	20	55093243	55093243	+	Silent	SNP	C	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:55093243C>G	uc002xxt.2	+	9	950	c.843C>G	c.(841-843)CTC>CTG	p.L281L	C20orf43_uc010zzf.1_Silent_p.L311L|C20orf43_uc002xxu.2_Silent_p.L280L|C20orf43_uc002xxv.2_3'UTR|GCNT7_uc010zzg.1_Intron	NM_016407	NP_057491	Q9BY42	CT043_HUMAN	hypothetical protein LOC51507	281										ovary(1)	1			Colorectal(105;0.202)			ACAAGTCCCTCTTTACCACTC	0.577																0.388128	294.498191	296.908021	85	134	KEEP	---	---	---	---	37	51	74	78	-1	capture	Silent	SNP	55093243	55093243	C20orf43	20	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	2093	271
IFNAR2	3455	broad.mit.edu	37	21	34625094	34625094	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34625094C>T	uc002yrd.2	+	7	996	c.668C>T	c.(667-669)TCT>TTT	p.S223F	IFNAR2_uc002yrb.2_Missense_Mutation_p.S223F|IFNAR2_uc002yrc.2_Missense_Mutation_p.S223F|IFNAR2_uc002yre.2_Missense_Mutation_p.S223F|IFNAR2_uc002yrf.2_Missense_Mutation_p.S223F|IFNAR2_uc002yrg.2_Missense_Mutation_p.S92F|IL10RB_uc002yrh.1_Missense_Mutation_p.S73F|IL10RB_uc002yri.1_5'UTR	NM_207585	NP_997468	P48551	INAR2_HUMAN	interferon alpha/beta receptor 2 isoform a	223	Extracellular (Potential).				JAK-STAT cascade|regulation of type I interferon-mediated signaling pathway|response to interferon-alpha|response to virus|type I interferon-mediated signaling pathway	extracellular region|extracellular space|integral to plasma membrane	protein kinase binding|type I interferon binding|type I interferon receptor activity				0					Interferon Alfa-2a, Recombinant(DB00034)|Interferon Alfa-2b, Recombinant(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)	GTAATAAAGTCTCCCTTAAAA	0.373																0.356589	141.016035	143.352308	46	83	KEEP	---	---	---	---	20	32	48	43	-1	capture	Missense_Mutation	SNP	34625094	34625094	IFNAR2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	7470	271
TRPM2	7226	broad.mit.edu	37	21	45859043	45859043	+	Missense_Mutation	SNP	G	A	A	rs142254503	byFrequency	TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45859043G>A	uc002zet.1	+	31	4474	c.4261G>A	c.(4261-4263)GGC>AGC	p.G1421S	TRPM2_uc002zeu.1_Missense_Mutation_p.G1421S|TRPM2_uc002zew.1_Missense_Mutation_p.G1421S|TRPM2_uc010gpt.1_Missense_Mutation_p.G1471S|TRPM2_uc002zex.1_Missense_Mutation_p.G1207S|TRPM2_uc002zey.1_Missense_Mutation_p.G900S|TRPM2_uc011aff.1_Missense_Mutation_p.G102S	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	1421	Nudix hydrolase.|Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GCTGAAGTGCGGCATGGAGGT	0.602																0.341176	88.35326	90.24615	29	56	KEEP	---	---	---	---	18	12	27	32	-1	capture	Missense_Mutation	SNP	45859043	45859043	TRPM2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16469	271
C21orf29	54084	broad.mit.edu	37	21	45948411	45948411	+	Silent	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45948411G>A	uc002zfe.1	-	6	912	c.846C>T	c.(844-846)GAC>GAT	p.D282D	C21orf29_uc010gpv.1_Silent_p.D214D	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	282					cell adhesion	extracellular region	structural molecule activity				0						AGAACTGGGCGTCTTCCACCT	0.607																0.398693	165.039072	166.410989	61	92	KEEP	---	---	---	---	26	36	44	56	-1	capture	Silent	SNP	45948411	45948411	C21orf29	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	2105	271
ZNF280B	140883	broad.mit.edu	37	22	22842526	22842526	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22842526C>T	uc002zwc.1	-	4	1974	c.1198G>A	c.(1198-1200)GAA>AAA	p.E400K	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	400					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TAGGGCATTTCGCCAGGCTTA	0.433																0.414545	343.320581	345.068101	114	161	KEEP	---	---	---	---	60	60	81	91	-1	capture	Missense_Mutation	SNP	22842526	22842526	ZNF280B	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17695	271
MOV10L1	54456	broad.mit.edu	37	22	50596602	50596602	+	Silent	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50596602C>T	uc003bjj.2	+	23	3266	c.3183C>T	c.(3181-3183)AGC>AGT	p.S1061S	MOV10L1_uc003bjk.3_Silent_p.S1061S|MOV10L1_uc011arp.1_Silent_p.S1041S|MOV10L1_uc003bjl.2_Silent_p.S188S|MOV10L1_uc003bjm.1_Silent_p.S104S	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	1061					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TGTCTGCCAGCGACATTGGCG	0.652																0.396947	152.474623	153.691103	52	79	KEEP	---	---	---	---	28	29	37	53	-1	capture	Silent	SNP	50596602	50596602	MOV10L1	22	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	9631	271
CNTN4	152330	broad.mit.edu	37	3	2787313	2787313	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:2787313C>T	uc003bpc.2	+	5	511	c.290C>T	c.(289-291)ACG>ATG	p.T97M	CNTN4_uc003bpb.1_Translation_Start_Site|CNTN4_uc003bpd.1_Missense_Mutation_p.T97M	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	97	Ig-like C2-type 1.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GATGCTGGAACGTACCAGTGC	0.408																0.40113	211.982246	213.496954	71	106	KEEP	---	---	---	---	37	39	52	60	-1	capture	Missense_Mutation	SNP	2787313	2787313	CNTN4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3608	271
CHST13	166012	broad.mit.edu	37	3	126260762	126260762	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:126260762G>A	uc003eja.2	+	3	367	c.367G>A	c.(367-369)GTG>ATG	p.V123M		NM_152889	NP_690849	Q8NET6	CHSTD_HUMAN	carbohydrate sulfotransferase 13	123	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.151)		CTGGAAGCGCGTGCTGCTGGC	0.716																0.5	23.999339	23.999339	8	8	KEEP	---	---	---	---	4	7	9	0	-1	capture	Missense_Mutation	SNP	126260762	126260762	CHST13	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3366	271
ECE2	9718	broad.mit.edu	37	3	184009860	184009860	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184009860C>T	uc003fni.3	+	19	2524	c.2486C>T	c.(2485-2487)TCG>TTG	p.S829L	ECE2_uc003fnl.3_Missense_Mutation_p.S757L|ECE2_uc003fnm.3_Missense_Mutation_p.S711L|ECE2_uc003fnk.3_Missense_Mutation_p.S682L	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	829	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTGTGGTGCTCGGTCCGCACA	0.647																0.55414	272.543052	272.945157	87	70	KEEP	---	---	---	---	40	64	44	36	-1	capture	Missense_Mutation	SNP	184009860	184009860	ECE2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4845	271
PDE6B	5158	broad.mit.edu	37	4	619767	619767	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:619767G>A	uc003gap.2	+	1	405	c.352G>A	c.(352-354)GTC>ATC	p.V118I	PDE6B_uc003gao.3_Missense_Mutation_p.V118I	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1	118	GAF 1.				cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						GCCGGACAGCGTCCTGGAGGA	0.657	GBM(71;463 1194 9848 25922 46834)															0.583333	21.826364	21.899051	7	5	KEEP	---	---	---	---	3	6	4	2	-1	capture	Missense_Mutation	SNP	619767	619767	PDE6B	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11549	271
AASDH	132949	broad.mit.edu	37	4	57237647	57237647	+	Silent	SNP	G	C	C			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57237647G>C	uc003hbn.2	-	5	984	c.831C>G	c.(829-831)CTC>CTG	p.L277L	AASDH_uc010ihb.2_5'UTR|AASDH_uc011caa.1_Silent_p.L124L|AASDH_uc003hbo.2_Silent_p.L177L|AASDH_uc011cab.1_5'UTR|AASDH_uc010ihc.2_Silent_p.L277L|AASDH_uc003hbp.2_Silent_p.L277L	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	277					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GATGGGAAAAGAGAACGCTGG	0.353																0.201681	70.029372	79.870679	24	95	KEEP	---	---	---	---	16	14	54	63	-1	capture	Silent	SNP	57237647	57237647	AASDH	4	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	22	271
FRG1	2483	broad.mit.edu	37	4	190876274	190876274	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:190876274C>A	uc003izs.2	+	5	591	c.400C>A	c.(400-402)CCA>ACA	p.P134T		NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	134					rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TGCAATTGGACCAAGAGAACA	0.358																0.043307	-33.805241	22.994906	11	243	KEEP	---	---	---	---	6	12	200	227	0.666666666667	capture	Missense_Mutation	SNP	190876274	190876274	FRG1	4	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	5989	271
PRDM9	56979	broad.mit.edu	37	5	23527430	23527430	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23527430G>T	uc003jgo.2	+	11	2415	c.2233G>T	c.(2233-2235)GAG>TAG	p.E745*		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	745					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						ACACACAGGGGAGAAGCCCTA	0.582													HNSCC(3;0.000094)			0.313187	127.447488	133.137919	57	125	KEEP	---	---	---	---	41	52	118	136	0.440860215054	capture	Nonsense_Mutation	SNP	23527430	23527430	PRDM9	5	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	12359	271
TNFAIP8	25816	broad.mit.edu	37	5	118728680	118728680	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:118728680G>T	uc003ksh.2	+	3	889	c.201G>T	c.(199-201)GAG>GAT	p.E67D	TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Missense_Mutation_p.E57D|TNFAIP8_uc011cwf.1_Missense_Mutation_p.E61D|TNFAIP8_uc003ksi.2_Missense_Mutation_p.E67D	NM_014350	NP_055165	O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	67	Potential.				anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		ACAAGAAGGAGGCAGAGAAGA	0.443																0.45	52.243139	52.330496	18	22	KEEP	---	---	---	---	9	11	13	12	0.45	capture	Missense_Mutation	SNP	118728680	118728680	TNFAIP8	5	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	16159	271
PCDHA1	56147	broad.mit.edu	37	5	140167119	140167119	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167119G>A	uc003lhb.2	+	1	1244	c.1244G>A	c.(1243-1245)CGC>CAC	p.R415H	PCDHA1_uc003lha.2_Missense_Mutation_p.R415H|PCDHA1_uc003lgz.2_Missense_Mutation_p.R415H	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	415	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCTGGATCGCGAGAGCCTG	0.637																0.409962	306.331584	308.162005	107	154	KEEP	---	---	---	---	68	60	99	76	-1	capture	Missense_Mutation	SNP	140167119	140167119	PCDHA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11422	271
PCDHGA2	56113	broad.mit.edu	37	5	140719024	140719024	+	Silent	SNP	A	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140719024A>G	uc003ljk.1	+	1	671	c.486A>G	c.(484-486)GTA>GTG	p.V162V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Silent_p.V162V	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	162	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGCAGACGTAGGTGAGAACG	0.522																0.013274	-54.677685	6.41001	3	223	KEEP	---	---	---	---	1	2	113	135	-1	capture	Silent	SNP	140719024	140719024	PCDHGA2	5	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	11457	271
MGAT4B	11282	broad.mit.edu	37	5	179225986	179225986	+	Missense_Mutation	SNP	T	G	G			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179225986T>G	uc003mks.2	-	11	1654	c.1285A>C	c.(1285-1287)ACC>CCC	p.T429P	MGAT4B_uc003mkp.2_Missense_Mutation_p.T283P|MGAT4B_uc003mkq.2_Missense_Mutation_p.H204P|MGAT4B_uc003mkr.2_Missense_Mutation_p.T444P|MIR1229_hsa-mir-1229|MI0006319_5'Flank	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	alpha-1,3-mannosyl-glycoprotein	429	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding				0	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCGGCAGGGGTGAAGGCCCAG	0.627	GBM(13;414 434 4098 22176 23230)															0.062176	-33.047877	7.201698	12	181	KEEP	---	---	---	---	12	24	114	89	-1	capture	Missense_Mutation	SNP	179225986	179225986	MGAT4B	5	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	9458	271
DEFB110	245913	broad.mit.edu	37	6	49976857	49976857	+	Silent	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49976857G>A	uc011dwr.1	-	2	229	c.183C>T	c.(181-183)TGC>TGT	p.C61C		NM_001037728	NP_001032817	Q30KQ9	DB110_HUMAN	beta-defensin 110 isoform b	64					defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					GAGTTTATACGCAGCACTGAC	0.343																0.434109	171.983619	172.471293	56	73	KEEP	---	---	---	---	29	30	41	41	-1	capture	Silent	SNP	49976857	49976857	DEFB110	6	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	4358	271
SFRS13B	135295	broad.mit.edu	37	6	89808574	89808574	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:89808574G>A	uc003pmy.3	-	5	703	c.509C>T	c.(508-510)CCA>CTA	p.P170L		NM_080743	NP_542781	Q8WXF0	SRS12_HUMAN	serine-arginine repressor protein	170	Arg/Ser-rich (RS domain).				assembly of spliceosomal tri-snRNP|cytoplasmic transport|negative regulation of nuclear mRNA splicing, via spliceosome|nuclear mRNA 5'-splice site recognition|regulation of alternative nuclear mRNA splicing, via spliceosome	nucleoplasm	nucleotide binding|RNA binding|RS domain binding|unfolded protein binding				0						ATTCCTTCTTGGAGTTCTTGA	0.453																0.429577	795.317997	797.773819	244	324	KEEP	---	---	---	---	125	139	200	179	-1	capture	Missense_Mutation	SNP	89808574	89808574	SFRS13B	6	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	14062	271
KIAA1244	57221	broad.mit.edu	37	6	138599742	138599742	+	Silent	SNP	G	A	A	rs111857517	by1000genomes	TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138599742G>A	uc003qhu.2	+	13	2283	c.2283G>A	c.(2281-2283)GCG>GCA	p.A761A		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	761	SEC7.				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CGACCCTGGCGCCAGGCGTGA	0.612																0.491071	157.622412	157.629958	55	57	KEEP	---	---	---	---	31	31	30	33	-1	capture	Silent	SNP	138599742	138599742	KIAA1244	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8139	271
IGFBP3	3486	broad.mit.edu	37	7	45956872	45956872	+	Silent	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45956872G>A	uc003tns.2	-	2	702	c.570C>T	c.(568-570)TAC>TAT	p.Y190Y	IGFBP3_uc003tnq.2_RNA|IGFBP3_uc003tnr.2_Silent_p.Y196Y|IGFBP3_uc003tnt.2_Silent_p.Y93Y	NM_000598	NP_000589	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	190					negative regulation of protein phosphorylation|negative regulation of signal transduction|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of apoptosis|positive regulation of myoblast differentiation|protein phosphorylation|regulation of cell growth	nucleus	insulin-like growth factor I binding|metal ion binding|protein tyrosine phosphatase activator activity			large_intestine(2)|lung(1)	3					Mecasermin(DB01277)	TCTGAGACTCGTAGTCAACTT	0.502														OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.325183	370.334571	381.425614	133	276	KEEP	---	---	---	---	80	68	151	167	-1	capture	Silent	SNP	45956872	45956872	IGFBP3	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7505	271
TFPI2	7980	broad.mit.edu	37	7	93519456	93519456	+	Silent	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93519456C>T	uc003umy.1	-	2	339	c.264G>A	c.(262-264)AGG>AGA	p.R88R	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Silent_p.R88R|TFPI2_uc003una.1_Silent_p.R77R|TFPI2_uc003unb.1_Silent_p.R88R|TFPI2_uc010lfg.1_Intron	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	88					blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			TACTTTCTATCCTCCAGCAAG	0.617																0.305556	88.028997	91.674399	33	75	KEEP	---	---	---	---	18	16	39	46	-1	capture	Silent	SNP	93519456	93519456	TFPI2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	15694	271
PEG10	23089	broad.mit.edu	37	7	94293373	94293373	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94293373C>T	uc011kie.1	+	2	950	c.733C>T	c.(733-735)CGC>TGC	p.R245C		NM_001040152	NP_001035242	Q86TG7	PEG10_HUMAN	paternally expressed 10 isoform RF1	169	Necessary for interaction with ALK1.				apoptosis|cell differentiation|negative regulation of transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GGTTGCCAAACGCAAGATCAG	0.537																0.274611	410.687387	437.173103	159	420	KEEP	---	---	---	---	87	86	220	244	-1	capture	Missense_Mutation	SNP	94293373	94293373	PEG10	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11622	271
ZYX	7791	broad.mit.edu	37	7	143080252	143080252	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143080252G>A	uc003wcw.2	+	5	1015	c.860G>A	c.(859-861)GGA>GAA	p.G287E	ZYX_uc011ktd.1_Missense_Mutation_p.G130E|ZYX_uc003wcx.2_Missense_Mutation_p.G287E|ZYX_uc011kte.1_Missense_Mutation_p.G256E|ZYX_uc011ktf.1_Missense_Mutation_p.G130E	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN	zyxin	287					cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding				0	Melanoma(164;0.205)					GCCCCAGGTGGATCTGGGTCA	0.577																0.324952	461.466912	475.50155	168	349	KEEP	---	---	---	---	83	98	187	192	-1	capture	Missense_Mutation	SNP	143080252	143080252	ZYX	7	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	18130	271
EPHA1	2041	broad.mit.edu	37	7	143095154	143095154	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143095154G>A	uc003wcz.2	-	8	1561	c.1474C>T	c.(1474-1476)CGG>TGG	p.R492W		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	492	Extracellular (Potential).|Fibronectin type-III 2.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				ATCTGGTACCGTTCTTCATCC	0.572				p.R492W(HEC151-Tumor)	379											0.25	90.625963	99.022282	37	111	KEEP	---	---	---	---	21	19	60	59	-1	capture	Missense_Mutation	SNP	143095154	143095154	EPHA1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5120	271
ASB10	136371	broad.mit.edu	37	7	150878355	150878355	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150878355G>A	uc003wjm.1	-	3	1036	c.910C>T	c.(910-912)CGC>TGC	p.R304C	ASB10_uc003wjl.1_Missense_Mutation_p.R304C|ASB10_uc003wjn.1_Missense_Mutation_p.R244C	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10	259	ANK 5.				intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACTGGCAGCGGACGTCACAG	0.647																0.22449	27.850579	31.232429	11	38	KEEP	---	---	---	---	8	8	31	31	-1	capture	Missense_Mutation	SNP	150878355	150878355	ASB10	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1005	271
DOCK5	80005	broad.mit.edu	37	8	25250313	25250313	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25250313C>T	uc003xeg.2	+	44	4579	c.4442C>T	c.(4441-4443)ACG>ATG	p.T1481M	PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xei.2_Missense_Mutation_p.T1051M|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1481	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TGCCACCAGACGATGTGGATT	0.428	Pancreas(145;34 1887 3271 10937 30165)															0.4375	41.845532	41.954438	14	18	KEEP	---	---	---	---	7	9	12	8	-1	capture	Missense_Mutation	SNP	25250313	25250313	DOCK5	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4646	271
CPSF1	29894	broad.mit.edu	37	8	145622709	145622709	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145622709G>A	uc003zcj.2	-	22	2453	c.2378C>T	c.(2377-2379)ACC>ATC	p.T793I		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	793					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TACCTCCATGGTGCCATTCTC	0.672	NSCLC(133;1088 1848 27708 34777 35269)															0.4	49.192093	49.541914	16	24	KEEP	---	---	---	---	6	10	11	14	-1	capture	Missense_Mutation	SNP	145622709	145622709	CPSF1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	3789	271
NPR2	4882	broad.mit.edu	37	9	35808664	35808664	+	Silent	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35808664C>T	uc003zyd.2	+	19	2871	c.2871C>T	c.(2869-2871)CGC>CGT	p.R957R	NPR2_uc010mlb.2_Silent_p.R933R|SPAG8_uc003zye.2_Intron	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	957	Guanylate cyclase.|Cytoplasmic (Potential).		R -> C (in AMDM).		intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TGAGGCTACGCATAGGGGTCC	0.542					170											0.35443	148.544887	151.499822	56	102	KEEP	---	---	---	---	35	28	53	61	-1	capture	Silent	SNP	35808664	35808664	NPR2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	10502	271
GLRA2	2742	broad.mit.edu	37	X	14599498	14599498	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:14599498C>T	uc010nep.2	+	5	796	c.464C>T	c.(463-465)TCG>TTG	p.S155L	GLRA2_uc010neq.2_Missense_Mutation_p.S155L|GLRA2_uc004cwe.3_Missense_Mutation_p.S155L|GLRA2_uc011mio.1_Missense_Mutation_p.S66L|GLRA2_uc011mip.1_Missense_Mutation_p.S133L	NM_001118885	NP_001112357	P23416	GLRA2_HUMAN	glycine receptor, alpha 2 isoform A	155	Extracellular (Probable).				neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)	CTACGGATTTCGAAAAATGGC	0.453																0.420455	222.722729	223.693719	74	102	KEEP	---	---	---	---	33	46	45	68	-1	capture	Missense_Mutation	SNP	14599498	14599498	GLRA2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6391	271
LANCL3	347404	broad.mit.edu	37	X	37431325	37431325	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37431325G>A	uc011mkd.1	+	1	504	c.202G>A	c.(202-204)GGC>AGC	p.G68S	LANCL3_uc004ddp.1_Missense_Mutation_p.G68S	NM_198511	NP_940913	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3	68							catalytic activity				0						GCTTTATGGCGGCGTGGCCGG	0.711																0.3	7.521087	7.87854	3	7	KEEP	---	---	---	---	1	5	3	8	-1	capture	Missense_Mutation	SNP	37431325	37431325	LANCL3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8542	271
MORC4	79710	broad.mit.edu	37	X	106221358	106221358	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:106221358A>T	uc004emu.3	-	8	1251	c.1008T>A	c.(1006-1008)CAT>CAA	p.H336Q	MORC4_uc004emp.3_Intron|MORC4_uc004emv.3_Missense_Mutation_p.H336Q|MORC4_uc004emw.3_Missense_Mutation_p.H84Q	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN	zinc finger, CW type with coiled-coil domain 2	336							ATP binding|zinc ion binding			ovary(1)	1						GTCGGTTGTTATGATACATCA	0.393																0.430288	572.485134	574.241571	179	237	KEEP	---	---	---	---	99	95	127	128	-1	capture	Missense_Mutation	SNP	106221358	106221358	MORC4	23	A	T	T	T	1	0	0	0	0	1	0	0	0	206	16	4	4	9616	271
THOC2	57187	broad.mit.edu	37	X	122756613	122756613	+	Missense_Mutation	SNP	T	A	A			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122756613T>A	uc004etu.2	-	30	3813	c.3781A>T	c.(3781-3783)AAC>TAC	p.N1261Y	THOC2_uc010nqt.1_5'Flank|THOC2_uc004etw.1_Missense_Mutation_p.N82Y	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1261					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						TCCTACCTGTTAGAGCCACTA	0.284																0.413534	158.214881	159.078843	55	78	KEEP	---	---	---	---	36	30	41	47	-1	capture	Missense_Mutation	SNP	122756613	122756613	THOC2	23	T	A	A	A	1	0	0	0	0	1	0	0	0	793	61	4	4	15750	271
ACTN3	89	broad.mit.edu	37	11	66328735	66328737	+	In_Frame_Del	DEL	AGG	-	-			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66328735_66328737delAGG	uc001oio.1	+	17	1916_1918	c.1898_1900delAGG	c.(1897-1902)CAGGAG>CAG	p.E635del	ACTN3_uc010rpi.1_RNA	NM_001104	NP_001095	Q08043	ACTN3_HUMAN	actinin, alpha 3	635					focal adhesion assembly|muscle filament sliding|regulation of apoptosis	actin filament|cytosol|focal adhesion|pseudopodium	actin binding|calcium ion binding|integrin binding|protein homodimerization activity|structural constituent of muscle				0						CAGACACTGCAGGAGGAGCTGGC	0.621																0.27			11	30		---	---	---	---						capture_indel	In_Frame_Del	DEL	66328735	66328737	ACTN3	11	AGG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	206	271
SRCAP	10847	broad.mit.edu	37	16	30748891	30748894	+	Frame_Shift_Del	DEL	TCAT	-	-			TCGA-76-4932-01	TCGA-76-4932-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30748891_30748894delTCAT	uc002dze.1	+	34	7915_7918	c.7530_7533delTCAT	c.(7528-7533)GCTCATfs	p.A2510fs	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Frame_Shift_Del_p.A2305fs	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2510_2511	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			ctccaccagctcatacaccgcctc	0.270																0.38			53	88		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	30748891	30748894	SRCAP	16	TCAT	-	-	-	1	0	1	0	1	0	0	0	0	691	54	5	5	15027	271
