Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
VPS13D	55187	broad.mit.edu	37	1	12414081	12414081	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12414081A>G	uc001atv.2	+	47	9623	c.9482A>G	c.(9481-9483)AAC>AGC	p.N3161S	VPS13D_uc001atw.2_Missense_Mutation_p.N3136S|VPS13D_uc001atx.2_Missense_Mutation_p.N2348S	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3160					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		ATGCCCTCAAACATATTTTCT	0.363																0.352941	101.327541	102.947246	30	55	KEEP	---	---	---	---	13	18	28	35	-1	capture	Missense_Mutation	SNP	12414081	12414081	VPS13D	1	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	17074	279
HSPB7	27129	broad.mit.edu	37	1	16342135	16342135	+	Silent	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16342135T>C	uc001axo.2	-	3	1280	c.453A>G	c.(451-453)GCA>GCG	p.A151A	HSPB7_uc001axp.2_Silent_p.A234A|HSPB7_uc001axq.2_Silent_p.A243A|HSPB7_uc001axr.2_Silent_p.A244A|HSPB7_uc001axs.2_Silent_p.A226A	NM_014424	NP_055239	Q9UBY9	HSPB7_HUMAN	cardiovascular heat shock protein	151					regulation of heart contraction|response to heat|response to unfolded protein	Cajal body	protein C-terminus binding				0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGACGCCGTGCCCGGATAG	0.642																0.45	88.626768	88.755837	27	33	KEEP	---	---	---	---	16	15	22	14	-1	capture	Silent	SNP	16342135	16342135	HSPB7	1	T	C	C	C	1	0	0	0	0	0	0	0	1	756	59	3	3	7347	279
EPHA8	2046	broad.mit.edu	37	1	22927421	22927421	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22927421C>T	uc001bfx.1	+	15	2694	c.2569C>T	c.(2569-2571)CTG>TTG	p.L857L		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	857	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGGGTACCGCCTGCCCGCACC	0.697					520											0.238636	52.330079	57.820438	21	67	KEEP	---	---	---	---	7	18	33	42	-1	capture	Silent	SNP	22927421	22927421	EPHA8	1	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	5128	279
PHACTR4	65979	broad.mit.edu	37	1	28818258	28818258	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28818258C>T	uc001bpw.2	+	12	2257	c.1975C>T	c.(1975-1977)CGA>TGA	p.R659*	PHACTR4_uc001bpv.1_RNA|PHACTR4_uc001bpx.2_Nonsense_Mutation_p.R643*|PHACTR4_uc001bpy.2_Nonsense_Mutation_p.R669*|PHACTR4_uc001bpz.2_RNA	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1	659							actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		TTATGACCGGCGAGCCGACAA	0.398																0.044586	-23.480231	11.337962	7	150	KEEP	---	---	---	---	6	3	82	111	-1	capture	Nonsense_Mutation	SNP	28818258	28818258	PHACTR4	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	11715	279
IPP	3652	broad.mit.edu	37	1	46165793	46165793	+	Missense_Mutation	SNP	G	C	C	rs147854966		TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46165793G>C	uc001cou.2	-	9	1867	c.1600C>G	c.(1600-1602)CTT>GTT	p.L534V	IPP_uc001cos.3_Missense_Mutation_p.L534V	NM_005897	NP_005888	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	534						actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					ACATACAGAAGACCATTGACT	0.423																0.485549	280.806725	280.837177	84	89	KEEP	---	---	---	---	52	47	57	46	-1	capture	Missense_Mutation	SNP	46165793	46165793	IPP	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	7723	279
GADD45A	1647	broad.mit.edu	37	1	68152267	68152267	+	Silent	SNP	G	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68152267G>T	uc001ddz.1	+	3	676	c.381G>T	c.(379-381)GTG>GTT	p.V127V	GADD45A_uc009wbb.1_Silent_p.V93V|GADD45A_uc009wbc.1_Intron|GADD45A_uc009wbd.1_Intron	NM_001924	NP_001915	P24522	GA45A_HUMAN	growth arrest and DNA-damage-inducible, alpha	127					apoptosis|cell cycle arrest|cellular response to ionizing radiation|cellular response to mechanical stimulus|DNA repair|positive regulation of reactive oxygen species metabolic process|regulation of cyclin-dependent protein kinase activity|signal transduction in response to DNA damage	nucleus	protein binding			ovary(1)	1						GCGTGCTGGTGACGGTAAGGG	0.706					117											0.62069	50.350542	50.719803	18	11	KEEP	---	---	---	---	8	11	8	3	0.421052631579	capture	Silent	SNP	68152267	68152267	GADD45A	1	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	6123	279
ABCA4	24	broad.mit.edu	37	1	94522271	94522271	+	Silent	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94522271G>A	uc001dqh.2	-	15	2372	c.2268C>T	c.(2266-2268)TCC>TCT	p.S756S	ABCA4_uc010otn.1_Intron	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	756					phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GACTGGCCTTGGAGAAGAAGG	0.542																0.22	25.102699	28.709882	11	39	KEEP	---	---	---	---	4	8	17	25	-1	capture	Silent	SNP	94522271	94522271	ABCA4	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	34	279
CGN	57530	broad.mit.edu	37	1	151491406	151491406	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151491406C>T	uc009wmw.2	+	2	555	c.411C>T	c.(409-411)TCC>TCT	p.S137S		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	131	Interacts with ZO-2.|Head.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			GTTCCCACTCCCAGGCCTCAC	0.592																0.06	-3.616756	6.505634	3	47	KEEP	---	---	---	---	0	3	24	28	-1	capture	Silent	SNP	151491406	151491406	CGN	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	3269	279
S100A14	57402	broad.mit.edu	37	1	153587428	153587428	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153587428C>G	uc001fce.2	-	4	346	c.248G>C	c.(247-249)AGT>ACT	p.S83T	S100A16_uc001fcd.1_5'Flank	NM_020672	NP_065723	Q9HCY8	S10AE_HUMAN	S100 calcium binding protein A14	83	2; high affinity (Potential).				calcium ion homeostasis|defense response to bacterium|positive regulation of granulocyte chemotaxis|positive regulation of monocyte chemotaxis|response to lipopolysaccharide|toll-like receptor 4 signaling pathway	cell junction|microtubule cytoskeleton|perinuclear region of cytoplasm	calcium ion binding|chemokine receptor binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCCCAGAAACTCCTGAACTC	0.557																0.031579	-15.851387	6.950463	3	92	KEEP	---	---	---	---	3	0	53	49	-1	capture	Missense_Mutation	SNP	153587428	153587428	S100A14	1	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	13668	279
NUP210L	91181	broad.mit.edu	37	1	153973356	153973356	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153973356C>A	uc001fdw.2	-	37	5434	c.5362G>T	c.(5362-5364)GCT>TCT	p.A1788S	NUP210L_uc009woq.2_Missense_Mutation_p.A697S|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1788						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TCTTTCATAGCCCTCACTACC	0.363																0.054264	-27.661798	26.377213	14	244	KEEP	---	---	---	---	9	7	153	137	0.4375	capture	Missense_Mutation	SNP	153973356	153973356	NUP210L	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	10668	279
PYHIN1	149628	broad.mit.edu	37	1	158914677	158914677	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158914677A>G	uc001ftb.2	+	7	1449	c.1204A>G	c.(1204-1206)ACA>GCA	p.T402A	PYHIN1_uc001ftc.2_Missense_Mutation_p.T393A|PYHIN1_uc001ftd.2_Missense_Mutation_p.T402A|PYHIN1_uc001fte.2_Missense_Mutation_p.T393A	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	402					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					ACAGAAAAATACAAACCAGAG	0.373																0.291667	44.853687	46.706011	14	34	KEEP	---	---	---	---	8	10	19	16	-1	capture	Missense_Mutation	SNP	158914677	158914677	PYHIN1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	12760	279
C1orf125	126859	broad.mit.edu	37	1	179364322	179364322	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179364322C>T	uc001gmo.2	+	11	1221	c.1094C>T	c.(1093-1095)GCG>GTG	p.A365V	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_Missense_Mutation_p.A153V|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.A365V	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	365	Potential.										0						CTTTTAAATGCGGAAAAGAAT	0.353																0.345404	310.777728	318.360014	124	235	KEEP	---	---	---	---	73	81	158	141	-1	capture	Missense_Mutation	SNP	179364322	179364322	C1orf125	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1975	279
HMCN1	83872	broad.mit.edu	37	1	186134268	186134268	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186134268C>T	uc001grq.1	+	98	15511	c.15282C>T	c.(15280-15282)TCC>TCT	p.S5094S	HMCN1_uc001grs.1_Silent_p.S663S	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	5094					response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AGTGCCCCTCCGGGTTTACCT	0.388																0.554054	126.978143	127.165835	41	33	KEEP	---	---	---	---	29	25	16	21	-1	capture	Silent	SNP	186134268	186134268	HMCN1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7145	279
FCAMR	83953	broad.mit.edu	37	1	207140441	207140441	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207140441G>A	uc001hfa.3	-	3	625	c.125C>T	c.(124-126)GCG>GTG	p.A42V	FCAMR_uc001hfb.2_Missense_Mutation_p.A42V|FCAMR_uc009xca.1_Missense_Mutation_p.A42V|FCAMR_uc001hfc.2_Intron	NM_001122980	NP_001116452	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity isoform 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane|plasma membrane	receptor activity			ovary(1)	1						TTTCCATCCCGCCCTCCTGCT	0.527	Ovarian(199;1883 2142 16966 44409 45154)															0.512821	50.686964	50.692344	20	19	KEEP	---	---	---	---	14	10	15	9	-1	capture	Missense_Mutation	SNP	207140441	207140441	FCAMR	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5718	279
USH2A	7399	broad.mit.edu	37	1	215848243	215848243	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215848243G>A	uc001hku.1	-	63	13397	c.13010C>T	c.(13009-13011)ACG>ATG	p.T4337M		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4337	Fibronectin type-III 28.|Extracellular (Potential).		T -> M (in USH2A).		maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCTCCACTCGTGCAGGCTTG	0.498													HNSCC(13;0.011)			0.4625	98.598602	98.69135	37	43	KEEP	---	---	---	---	22	18	24	23	-1	capture	Missense_Mutation	SNP	215848243	215848243	USH2A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16918	279
USH2A	7399	broad.mit.edu	37	1	216538373	216538373	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216538373G>A	uc001hku.1	-	4	1093	c.706C>T	c.(706-708)CCT>TCT	p.P236S	USH2A_uc001hkv.2_Missense_Mutation_p.P236S	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	236	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCATTGAAAGGTGTATGATCC	0.353													HNSCC(13;0.011)			0.53211	168.916827	169.012017	58	51	KEEP	---	---	---	---	45	19	20	37	-1	capture	Missense_Mutation	SNP	216538373	216538373	USH2A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	16918	279
OR2T33	391195	broad.mit.edu	37	1	248436840	248436840	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248436840C>T	uc010pzi.1	-	1	277	c.277G>A	c.(277-279)GCT>ACT	p.A93T		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCACAGCCAGCGCGGGAGATG	0.577																0.253219	124.525713	137.406416	59	174	KEEP	---	---	---	---	39	36	131	148	-1	capture	Missense_Mutation	SNP	248436840	248436840	OR2T33	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10928	279
GPRIN2	9721	broad.mit.edu	37	10	46999114	46999114	+	Silent	SNP	T	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:46999114T>G	uc001jec.2	+	3	369	c.234T>G	c.(232-234)TCT>TCG	p.S78S	GPRIN2_uc010qfq.1_5'Flank	NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth	78											0						CACGGGCCTCTGGCCCCAAGG	0.706																0.333333	30.313949	31.125796	11	22	KEEP	---	---	---	---	6	6	8	17	-1	capture	Silent	SNP	46999114	46999114	GPRIN2	10	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	6663	279
CPT1A	1374	broad.mit.edu	37	11	68549243	68549243	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68549243C>T	uc001oog.3	-	11	1518	c.1348G>A	c.(1348-1350)GAC>AAC	p.D450N	CPT1A_uc001oof.3_Missense_Mutation_p.D450N|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A liver isoform	450	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)	CGGTACCTGTCGTAACATCGG	0.473																0.456522	173.796003	174.024545	63	75	KEEP	---	---	---	---	31	48	59	37	-1	capture	Missense_Mutation	SNP	68549243	68549243	CPT1A	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3796	279
FAT3	120114	broad.mit.edu	37	11	92539549	92539549	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92539549C>T	uc001pdj.3	+	11	9132	c.9115C>T	c.(9115-9117)CCT>TCT	p.P3039S		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3039	Cadherin 28.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGCATTACTTCCTGAAGACAT	0.358													TCGA Ovarian(4;0.039)			0.166667	5.41248	7.309894	3	15	KEEP	---	---	---	---	3	0	7	10	-1	capture	Missense_Mutation	SNP	92539549	92539549	FAT3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	5637	279
CD163L1	283316	broad.mit.edu	37	12	7559424	7559424	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7559424A>G	uc001qsy.2	-	5	817	c.791T>C	c.(790-792)CTT>CCT	p.L264P	CD163L1_uc010sge.1_Missense_Mutation_p.L274P	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	264	SRCR 3.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						TCCACCTACAAGCCTTAGTTC	0.448																0.826923	161.274102	166.577847	43	9	KEEP	---	---	---	---	23	28	5	4	-1	capture	Missense_Mutation	SNP	7559424	7559424	CD163L1	12	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	2939	279
AICDA	57379	broad.mit.edu	37	12	8759510	8759510	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8759510C>T	uc001qur.2	-	2	186	c.107G>A	c.(106-108)CGT>CAT	p.R36H	AICDA_uc001qup.1_Missense_Mutation_p.R31H|AICDA_uc001quq.1_Missense_Mutation_p.R31H|AICDA_uc009zgd.1_RNA	NM_020661	NP_065712	Q9GZX7	AICDA_HUMAN	activation-induced cytidine deaminase	36					B cell differentiation|DNA demethylation|mRNA processing|negative regulation of methylation-dependent chromatin silencing	cytoplasm	cytidine deaminase activity|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung SC(5;0.184)					AGCACTGTCACGCCTCTTCAC	0.463	GBM(62;896 1067 5527 26594 30137)											Immune_Deficiency_with_Hyper-IgM				0.851852	70.138099	73.34694	23	4	KEEP	---	---	---	---	14	11	3	1	-1	capture	Missense_Mutation	SNP	8759510	8759510	AICDA	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	422	279
SENP1	29843	broad.mit.edu	37	12	48465464	48465464	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48465464C>T	uc001rqx.2	-	9	1427	c.981G>A	c.(979-981)CAG>CAA	p.Q327Q	SENP1_uc001rqw.2_Silent_p.Q327Q|SENP1_uc001rqy.2_Silent_p.Q128Q|SENP1_uc001rqz.2_Silent_p.Q128Q|SENP1_uc009zkx.2_Silent_p.Q327Q	NM_014554	NP_055369	Q9P0U3	SENP1_HUMAN	sentrin/SUMO-specific protease 1	327					activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				GAGTTGGAGTCTGGGAATCTT	0.249																0.333333	24.86499	25.529712	9	18	KEEP	---	---	---	---	8	5	11	11	-1	capture	Silent	SNP	48465464	48465464	SENP1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	13939	279
DGKA	1606	broad.mit.edu	37	12	56336026	56336026	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56336026C>T	uc001sij.2	+	17	1669	c.1405C>T	c.(1405-1407)CGA>TGA	p.R469*	DGKA_uc001sih.1_Nonsense_Mutation_p.R357*|DGKA_uc001sii.1_Nonsense_Mutation_p.R327*|DGKA_uc009zod.1_Nonsense_Mutation_p.R388*|DGKA_uc001sik.2_Nonsense_Mutation_p.R469*|DGKA_uc001sil.2_Nonsense_Mutation_p.R469*|DGKA_uc001sim.2_Nonsense_Mutation_p.R469*|DGKA_uc001sin.2_Nonsense_Mutation_p.R469*|DGKA_uc009zof.2_Nonsense_Mutation_p.R115*|DGKA_uc001sio.2_Nonsense_Mutation_p.R211*	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	469	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	TGATCTGGCTCGATGCCTAAG	0.498																0.378049	83.409663	84.47771	31	51	KEEP	---	---	---	---	17	19	24	37	-1	capture	Nonsense_Mutation	SNP	56336026	56336026	DGKA	12	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4423	279
SSH1	54434	broad.mit.edu	37	12	109194640	109194640	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109194640T>C	uc001tnm.2	-	12	1151	c.1064A>G	c.(1063-1065)TAT>TGT	p.Y355C	SSH1_uc001tnl.2_Missense_Mutation_p.Y43C|SSH1_uc010sxg.1_Missense_Mutation_p.Y366C|SSH1_uc001tnn.3_Missense_Mutation_p.Y355C	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1	355	Tyrosine-protein phosphatase.				actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						GATGTTATGATATGCAAATAA	0.363																0.432836	190.79855	191.326621	58	76	KEEP	---	---	---	---	28	34	37	49	-1	capture	Missense_Mutation	SNP	109194640	109194640	SSH1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	15076	279
VSIG10	54621	broad.mit.edu	37	12	118509166	118509166	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118509166T>G	uc001tws.2	-	6	1662	c.1328A>C	c.(1327-1329)AAA>ACA	p.K443T		NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	443	Cytoplasmic (Potential).					integral to membrane					0						GTCCTTACCTTTCCAGCAGAA	0.532																0.458333	158.100056	158.243933	44	52	KEEP	---	---	---	---	25	24	25	31	-1	capture	Missense_Mutation	SNP	118509166	118509166	VSIG10	12	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	17105	279
PIBF1	10464	broad.mit.edu	37	13	73372127	73372127	+	Nonsense_Mutation	SNP	T	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:73372127T>A	uc001vjc.2	+	5	940	c.635T>A	c.(634-636)TTA>TAA	p.L212*	PIBF1_uc001vja.1_Nonsense_Mutation_p.L212*|PIBF1_uc010aeo.1_RNA|PIBF1_uc001vjb.2_Nonsense_Mutation_p.L212*|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1	212						centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		GCAGAAGAATTAAGTACAAAC	0.373																0.067961	-5.62985	14.242631	7	96	KEEP	---	---	---	---	7	3	53	54	-1	capture	Nonsense_Mutation	SNP	73372127	73372127	PIBF1	13	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	11782	279
MIA2	117153	broad.mit.edu	37	14	39722420	39722420	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:39722420G>T	uc001wux.2	+	6	2126	c.1932G>T	c.(1930-1932)TTG>TTT	p.L644F		NM_054024	NP_473365	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	Error:Variant_position_missing_in_Q96PC5_after_alignment						extracellular region				ovary(1)|breast(1)	2	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		TACCTATTTTGCTAAATATAA	0.289																0.402597	90.019061	90.654699	31	46	KEEP	---	---	---	---	14	22	26	26	0.388888888889	capture	Missense_Mutation	SNP	39722420	39722420	MIA2	14	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	9476	279
FLVCR2	55640	broad.mit.edu	37	14	76107379	76107379	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:76107379C>T	uc001xrs.2	+	7	1693	c.1317C>T	c.(1315-1317)TCC>TCT	p.S439S	FLVCR2_uc010tvd.1_Silent_p.S234S	NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular	439	Helical; (Potential).			S -> F (in Ref. 3; BAA91126).	transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)		GCATCTCCTCCGGCCTCCTCA	0.502																0.451923	132.71183	132.920918	47	57	KEEP	---	---	---	---	32	22	33	41	-1	capture	Silent	SNP	76107379	76107379	FLVCR2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5890	279
ZSCAN29	146050	broad.mit.edu	37	15	43661801	43661801	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43661801C>G	uc001zrk.1	-	1	458	c.311G>C	c.(310-312)AGA>ACA	p.R104T	ZSCAN29_uc001zrj.1_5'Flank|ZSCAN29_uc010bdf.1_Missense_Mutation_p.R103T|ZSCAN29_uc001zrl.1_RNA|ZSCAN29_uc010bdg.1_Missense_Mutation_p.R103T|ZSCAN29_uc001zrm.2_Missense_Mutation_p.R103T|TUBGCP4_uc001zrn.2_5'Flank|TUBGCP4_uc001zro.2_5'Flank	NM_152455	NP_689668	Q8IWY8	ZSC29_HUMAN	zinc finger protein 690	104					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		CACCGAAGATCTAGGTCTTCC	0.468																0.357143	113.60154	115.361435	35	63	KEEP	---	---	---	---	25	18	35	36	-1	capture	Missense_Mutation	SNP	43661801	43661801	ZSCAN29	15	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	18112	279
ONECUT1	3175	broad.mit.edu	37	15	53081863	53081863	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53081863C>T	uc002aci.1	-	1	347	c.219G>A	c.(217-219)CGG>CGA	p.R73R		NM_004498	NP_004489	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	73					endocrine pancreas development	nucleus	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding				0				all cancers(107;0.0708)		GCTCAGGGGCCCGGTGGTGGT	0.711																0.5	34.095911	34.095911	12	12	KEEP	---	---	---	---	7	8	4	9	-1	capture	Silent	SNP	53081863	53081863	ONECUT1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	10772	279
ZNF592	9640	broad.mit.edu	37	15	85326217	85326217	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85326217C>A	uc002bld.2	+	4	647	c.311C>A	c.(310-312)CCC>CAC	p.P104H	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	104					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCTCCAGATCCCCACAACTGT	0.512																0.205882	25.152268	30.580591	14	54	KEEP	---	---	---	---	11	4	34	26	0.266666666667	capture	Missense_Mutation	SNP	85326217	85326217	ZNF592	15	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	17900	279
SLC28A1	9154	broad.mit.edu	37	15	85478601	85478601	+	Missense_Mutation	SNP	C	T	T	rs116070802	by1000genomes	TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85478601C>T	uc002blg.2	+	15	1635	c.1433C>T	c.(1432-1434)GCG>GTG	p.A478V	SLC28A1_uc010bnb.2_Missense_Mutation_p.A478V|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Missense_Mutation_p.A478V|SLC28A1_uc010upg.1_Missense_Mutation_p.A478V	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	478					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ATGGGTGTGGCGTGGGAGGAC	0.597																0.376812	63.522471	64.444925	26	43	KEEP	---	---	---	---	13	16	23	25	-1	capture	Missense_Mutation	SNP	85478601	85478601	SLC28A1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14423	279
CRTC3	64784	broad.mit.edu	37	15	91184403	91184403	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91184403C>T	uc002bpp.2	+	14	1729	c.1623C>T	c.(1621-1623)TGC>TGT	p.C541C	CRTC3_uc002bpo.2_Silent_p.C541C	NM_022769	NP_073606	Q6UUV7	CRTC3_HUMAN	transducer of regulated CREB protein 3 isoform	541					interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			ATTCCAACTGCGGGAGTCTCC	0.507						T	MAML2	salivary gland mucoepidermoid								0.404255	49.519405	49.89453	19	28	KEEP	---	---	---	---	8	16	14	19	-1	capture	Silent	SNP	91184403	91184403	CRTC3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	3866	279
WDR90	197335	broad.mit.edu	37	16	711897	711897	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:711897C>T	uc002cii.1	+	32	3925	c.3871C>T	c.(3871-3873)CGA>TGA	p.R1291*	WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Nonsense_Mutation_p.R818*|WDR90_uc002cil.1_RNA|WDR90_uc002cim.1_Nonsense_Mutation_p.R465*|WDR90_uc002cin.1_5'UTR	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	1291										ovary(1)	1		Hepatocellular(780;0.0218)				CCAGGTGCGTCGAGAGCCAGT	0.637																0.38	145.215724	147.117116	57	93	KEEP	---	---	---	---	37	32	54	59	-1	capture	Nonsense_Mutation	SNP	711897	711897	WDR90	16	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	17218	279
MLST8	64223	broad.mit.edu	37	16	2256621	2256621	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2256621C>T	uc002coz.2	+	4	424	c.305C>T	c.(304-306)ACG>ATG	p.T102M	MLST8_uc002coy.2_Missense_Mutation_p.T102M|MLST8_uc002cpa.2_Translation_Start_Site|MLST8_uc002cpb.2_Missense_Mutation_p.T101M|MLST8_uc010uvx.1_Missense_Mutation_p.T36M|MLST8_uc002cpc.2_Missense_Mutation_p.T102M|MLST8_uc002cpd.2_Missense_Mutation_p.T36M|MLST8_uc002cpe.2_Missense_Mutation_p.T102M|MLST8_uc010uvy.1_Missense_Mutation_p.T102M|MLST8_uc002cpg.2_Missense_Mutation_p.T121M|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Missense_Mutation_p.T102M	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like	102	WD 3.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0						TGGATGTACACGGGCGGCGAG	0.627																0.390071	141.484737	142.9793	55	86	KEEP	---	---	---	---	35	31	48	61	-1	capture	Missense_Mutation	SNP	2256621	2256621	MLST8	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9546	279
CCNF	899	broad.mit.edu	37	16	2506722	2506722	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2506722C>T	uc002cqd.1	+	17	2150	c.2062C>T	c.(2062-2064)CGC>TGC	p.R688C	CCNF_uc002cqe.1_Missense_Mutation_p.R380C	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	688	PEST.				cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				ACCCCTGGTCCGCACCAGCCG	0.662																0.4	43.810884	44.154251	16	24	KEEP	---	---	---	---	8	13	13	13	-1	capture	Missense_Mutation	SNP	2506722	2506722	CCNF	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2893	279
GOT2	2806	broad.mit.edu	37	16	58752174	58752174	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58752174G>A	uc002eof.1	-	6	742	c.628C>T	c.(628-630)CAT>TAT	p.H210Y	GOT2_uc010vim.1_Missense_Mutation_p.H167Y	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	210					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GCGCAGGCATGCAGAAGAAGA	0.498																0.083333	-2.146276	12.690097	7	77	KEEP	---	---	---	---	4	3	40	53	-1	capture	Missense_Mutation	SNP	58752174	58752174	GOT2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	6515	279
CNTNAP4	85445	broad.mit.edu	37	16	76486640	76486640	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:76486640G>A	uc002feu.1	+	10	1692	c.1307G>A	c.(1306-1308)GGA>GAA	p.G436E	CNTNAP4_uc002fev.1_Missense_Mutation_p.G300E|CNTNAP4_uc010chb.1_Missense_Mutation_p.G363E|CNTNAP4_uc002fex.1_Missense_Mutation_p.G439E|CNTNAP4_uc002few.2_Missense_Mutation_p.G411E	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	436	Extracellular (Potential).|Laminin G-like 2.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TACCAGCCAGGAAAATTACCC	0.428																0.5	54.120632	54.120632	19	19	KEEP	---	---	---	---	9	11	11	8	-1	capture	Missense_Mutation	SNP	76486640	76486640	CNTNAP4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3614	279
ZC3H18	124245	broad.mit.edu	37	16	88688687	88688687	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88688687C>T	uc002fky.2	+	9	1758	c.1558C>T	c.(1558-1560)CGC>TGC	p.R520C	ZC3H18_uc010voz.1_Missense_Mutation_p.R544C|ZC3H18_uc010chw.2_RNA	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	520						nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GGACCCTTGGCGCCGATCCAA	0.602	Ovarian(121;375 2276 20373 38669)															0.393939	32.726814	33.031831	13	20	KEEP	---	---	---	---	6	8	16	8	-1	capture	Missense_Mutation	SNP	88688687	88688687	ZC3H18	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17448	279
PITPNM3	83394	broad.mit.edu	37	17	6376097	6376097	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6376097C>T	uc002gdd.3	-	11	1460	c.1309G>A	c.(1309-1311)GCA>ACA	p.A437T	PITPNM3_uc010cln.2_Missense_Mutation_p.A401T|PITPNM3_uc010clm.2_5'UTR|PITPNM3_uc002gdc.3_Missense_Mutation_p.A28T	NM_031220	NP_112497	Q9BZ71	PITM3_HUMAN	PITPNM family member 3 isoform 1	437	DDHD.				phosphatidylinositol metabolic process	endomembrane system|integral to membrane	calcium ion binding|lipid binding|phosphatidylinositol transporter activity|receptor tyrosine kinase binding			ovary(2)|central_nervous_system(2)	4				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GAGGGGTCTGCGCAATGGAAG	0.632																0.866667	73.540609	77.442754	26	4	KEEP	---	---	---	---	17	14	2	2	-1	capture	Missense_Mutation	SNP	6376097	6376097	PITPNM3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11855	279
TP53	7157	broad.mit.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578457C>T	uc002gim.2	-	5	667	c.473G>A	c.(472-474)CGC>CAC	p.R158H	TP53_uc002gig.1_Missense_Mutation_p.R158H|TP53_uc002gih.2_Missense_Mutation_p.R158H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R26H|TP53_uc010cng.1_Missense_Mutation_p.R26H|TP53_uc002gii.1_Missense_Mutation_p.R26H|TP53_uc010cnh.1_Missense_Mutation_p.R158H|TP53_uc010cni.1_Missense_Mutation_p.R158H|TP53_uc002gij.2_Missense_Mutation_p.R158H|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R65H|TP53_uc002gio.2_Missense_Mutation_p.R26H|TP53_uc010vug.1_Missense_Mutation_p.R119H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	158	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R158H(58)|p.R158L(55)|p.R158C(17)|p.R158G(10)|p.R158P(9)|p.0?(7)|p.R158R(6)|p.R158fs*12(5)|p.R158_A159insX(4)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R158fs*11(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R158fs*24(1)|p.R65L(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R158_A159insXX(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.R26L(1)|p.V157fs*21(1)|p.R158fs*8(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCCATGGCGCGGACGCGGGT	0.627	Pancreas(47;798 1329 9957 10801)		111	p.R158H(MOLT16-Tumor)|p.R158L(NCIH747-Tumor)|p.R158P(NCIH2110-Tumor)|p.R158L(NCIH661-Tumor)|p.R158L(NCIH441-Tumor)|p.R158H(ST486-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.865385	132.594381	139.320359	45	7	KEEP	---	---	---	---	29	23	2	6	-1	capture	Missense_Mutation	SNP	7578457	7578457	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16264	279
FSCN2	25794	broad.mit.edu	37	17	79503762	79503762	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79503762C>T	uc010wup.1	+	4	1361	c.1220C>T	c.(1219-1221)TCC>TTC	p.S407F	FSCN2_uc010wuo.1_Missense_Mutation_p.S431F	NM_012418	NP_036550	O14926	FSCN2_HUMAN	fascin 2 isoform 1	407					actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			ACCAACCGCTCCGTCTACGAC	0.701																0.947368	59.63939	62.179917	18	1	KEEP	---	---	---	---	8	11	2	0	-1	capture	Missense_Mutation	SNP	79503762	79503762	FSCN2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6011	279
LAMA3	3909	broad.mit.edu	37	18	21441699	21441699	+	Silent	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:21441699G>A	uc002kuq.2	+	35	4598	c.4512G>A	c.(4510-4512)GCG>GCA	p.A1504A	LAMA3_uc002kur.2_Silent_p.A1504A	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1504	Laminin IV type A.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTATGGTGGCGGATCTCCAGG	0.587																0.26087	29.277207	31.659604	12	34	KEEP	---	---	---	---	6	8	14	23	-1	capture	Silent	SNP	21441699	21441699	LAMA3	18	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8527	279
DPP9	91039	broad.mit.edu	37	19	4704202	4704202	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4704202G>A	uc002mba.2	-	6	799	c.541C>T	c.(541-543)CTC>TTC	p.L181F	DPP9_uc002mbb.2_Missense_Mutation_p.L181F|DPP9_uc002mbc.2_Missense_Mutation_p.L181F	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	152					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		GCCTGGAAGAGGAAGAGGCCA	0.657																0.463768	96.691307	96.770349	32	37	KEEP	---	---	---	---	20	14	21	19	-1	capture	Missense_Mutation	SNP	4704202	4704202	DPP9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4688	279
VAV1	7409	broad.mit.edu	37	19	6828671	6828671	+	Silent	SNP	C	T	T	rs61750002		TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6828671C>T	uc002mfu.1	+	12	1228	c.1131C>T	c.(1129-1131)AAC>AAT	p.N377N	VAV1_uc010xjh.1_Silent_p.N345N|VAV1_uc010dva.1_Silent_p.N377N|VAV1_uc002mfv.1_Silent_p.N322N	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	377					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						AGCGAGACAACGAGACACTGC	0.637					494											0.315217	140.071882	145.667947	58	126	KEEP	---	---	---	---	35	37	78	79	-1	capture	Silent	SNP	6828671	6828671	VAV1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17013	279
IL12RB1	3594	broad.mit.edu	37	19	18174730	18174730	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18174730G>A	uc002nhw.1	-	13	1638	c.1574C>T	c.(1573-1575)GCG>GTG	p.A525V	IL12RB1_uc010xqb.1_Missense_Mutation_p.A525V|IL12RB1_uc002nhx.1_Missense_Mutation_p.A565V	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	525	Extracellular (Potential).|Fibronectin type-III 5.				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						CCTCAGCCACGCTGTGTCTGC	0.632																0.142857	4.981172	8.424511	4	24	KEEP	---	---	---	---	1	3	12	15	-1	capture	Missense_Mutation	SNP	18174730	18174730	IL12RB1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7549	279
POU2F2	5452	broad.mit.edu	37	19	42596307	42596307	+	Silent	SNP	T	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42596307T>G	uc002osp.2	-	13	1381	c.1314A>C	c.(1312-1314)CCA>CCC	p.P438P	POU2F2_uc002osn.2_Silent_p.P422P|POU2F2_uc002oso.2_Silent_p.P211P|POU2F2_uc002osq.2_Intron|POU2F2_uc002osr.1_Silent_p.P438P	NM_002698	NP_002689	P09086	PO2F2_HUMAN	POU domain, class 2, transcription factor 2	438					humoral immune response|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2		Prostate(69;0.059)				TGGCCGGGGGTGGGGGAGTGA	0.567																0.176471	3.056984	6.56077	6	28	KEEP	---	---	---	---	6	2	17	16	-1	capture	Silent	SNP	42596307	42596307	POU2F2	19	T	G	G	G	1	0	0	0	0	0	0	0	1	756	59	4	4	12173	279
IGFL3	388555	broad.mit.edu	37	19	46627409	46627409	+	Silent	SNP	A	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:46627409A>T	uc002pea.1	-	3	109	c.84T>A	c.(82-84)GCT>GCA	p.A28A		NM_207393	NP_997276	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3 precursor	28						extracellular region	protein binding				0		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		AGCCAACAGGAGCGTCTGGGG	0.507																0.051724	-14.547317	10.125223	6	110	KEEP	---	---	---	---	2	4	68	61	-1	capture	Silent	SNP	46627409	46627409	IGFL3	19	A	T	T	T	1	0	0	0	0	0	0	0	1	132	11	4	4	7513	279
SULT2B1	6820	broad.mit.edu	37	19	49090651	49090651	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49090651C>T	uc002pjl.2	+	3	461	c.380C>T	c.(379-381)CCC>CTC	p.P127L	SULT2B1_uc002pjm.2_Missense_Mutation_p.P112L	NM_177973	NP_814444	O00204	ST2B1_HUMAN	sulfotransferase family, cytosolic, 2B, member 1	127					3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	alcohol sulfotransferase activity|protein binding|steroid sulfotransferase activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)		TCCCATCTTCCCATCCAGATC	0.612																0.246575	41.095553	45.387024	18	55	KEEP	---	---	---	---	11	10	40	27	-1	capture	Missense_Mutation	SNP	49090651	49090651	SULT2B1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15270	279
KLK9	284366	broad.mit.edu	37	19	51509764	51509764	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51509764G>A	uc002pux.1	-	3	503	c.416C>T	c.(415-417)CCA>CTA	p.P139L	KLK9_uc002puw.1_RNA|KLK9_uc010eol.1_Missense_Mutation_p.P110L|KLK9_uc002puv.1_5'Flank	NM_012315	NP_036447	Q9UKQ9	KLK9_HUMAN	kallikrein-related peptidase 9 precursor	139	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			central_nervous_system(1)	1		all_neural(266;0.0652)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		CTGCATGCCTGGGGAGACACA	0.512																0.333333	32.254893	33.217877	13	26	KEEP	---	---	---	---	9	5	15	12	-1	capture	Missense_Mutation	SNP	51509764	51509764	KLK9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8331	279
SIGLEC8	27181	broad.mit.edu	37	19	51957534	51957534	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51957534G>T	uc002pwt.2	-	6	1251	c.1184C>A	c.(1183-1185)GCA>GAA	p.A395E	SIGLEC8_uc010yda.1_Missense_Mutation_p.A286E|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Missense_Mutation_p.A302E	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	395	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CACGCCCGCTGCTGGCCTTGC	0.602																0.174603	41.185256	53.76473	22	104	KEEP	---	---	---	---	9	16	52	81	0.36	capture	Missense_Mutation	SNP	51957534	51957534	SIGLEC8	19	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	14207	279
ZNF845	91664	broad.mit.edu	37	19	53854579	53854579	+	Silent	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53854579T>C	uc010ydv.1	+	4	768	c.651T>C	c.(649-651)TGT>TGC	p.C217C	ZNF845_uc010ydw.1_Silent_p.C217C	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	217	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTTTCCAATGTAATGAGAGTG	0.353																0.070922	1.153769	27.898205	10	131	KEEP	---	---	---	---	5	9	70	87	-1	capture	Silent	SNP	53854579	53854579	ZNF845	19	T	C	C	C	1	0	0	0	0	0	0	0	1	738	57	3	3	18067	279
NLRP9	338321	broad.mit.edu	37	19	56241342	56241342	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56241342C>T	uc002qly.2	-	3	1877	c.1849G>A	c.(1849-1851)GTC>ATC	p.V617I		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	617						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CGCCAGTAGACGAGCTTCTCA	0.418																0.45	67.981741	68.116152	27	33	KEEP	---	---	---	---	23	15	30	32	-1	capture	Missense_Mutation	SNP	56241342	56241342	NLRP9	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10391	279
IAH1	285148	broad.mit.edu	37	2	9628296	9628296	+	Silent	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:9628296A>G	uc002qzr.2	+	6	611	c.585A>G	c.(583-585)TCA>TCG	p.S195S	IAH1_uc002qzs.2_Silent_p.S82S|IAH1_uc002qzt.2_Silent_p.S82S|IAH1_uc010yiz.1_RNA	NM_001039613	NP_001034702	Q2TAA2	IAH1_HUMAN	isoamyl acetate-hydrolyzing esterase 1 homolog	195					lipid catabolic process		hydrolase activity, acting on ester bonds				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTTATTTATCAGATGGACTAC	0.318																0.157303	23.094785	33.068903	14	75	KEEP	---	---	---	---	7	9	48	35	-1	capture	Silent	SNP	9628296	9628296	IAH1	2	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	7396	279
COL3A1	1281	broad.mit.edu	37	2	189859008	189859008	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189859008C>T	uc002uqj.1	+	18	1360	c.1243C>T	c.(1243-1245)CCT>TCT	p.P415S	COL3A1_uc010frw.1_RNA	NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	415	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	AGCCCGGGGTCCTCCAGGACC	0.498					1079											0.3	66.445313	69.631657	27	63	KEEP	---	---	---	---	15	14	44	32	-1	capture	Missense_Mutation	SNP	189859008	189859008	COL3A1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	3653	279
TSHZ2	128553	broad.mit.edu	37	20	51870661	51870661	+	Missense_Mutation	SNP	G	A	A	rs141167641	by1000genomes	TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51870661G>A	uc002xwo.2	+	2	1620	c.664G>A	c.(664-666)GCG>ACG	p.A222T		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	222	C2H2-type 1.				multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.A222T(1)		ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			ACAGTGCAGCGCGGCCTATGA	0.562																0.262295	32.564593	35.691592	16	45	KEEP	---	---	---	---	9	9	26	25	-1	capture	Missense_Mutation	SNP	51870661	51870661	TSHZ2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16507	279
PCK1	5105	broad.mit.edu	37	20	56137157	56137157	+	Silent	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:56137157G>A	uc002xyn.3	+	3	418	c.255G>A	c.(253-255)GTG>GTA	p.V85V	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	85					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCAGGGATGTGGCCAGGATCG	0.572																0.209877	34.324594	40.640183	17	64	KEEP	---	---	---	---	10	11	46	30	-1	capture	Silent	SNP	56137157	56137157	PCK1	20	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	11484	279
SYCP2	10388	broad.mit.edu	37	20	58467201	58467201	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:58467201C>T	uc002yaz.2	-	23	2347	c.2208G>A	c.(2206-2208)TCG>TCA	p.S736S		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	736					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TATATATCAGCGATTCTTCAA	0.348																0.277311	72.303429	77.630444	33	86	KEEP	---	---	---	---	15	19	56	42	-1	capture	Silent	SNP	58467201	58467201	SYCP2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15320	279
KRTAP26-1	388818	broad.mit.edu	37	21	31692021	31692021	+	Silent	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31692021G>A	uc002ynw.2	-	1	587	c.333C>T	c.(331-333)TCC>TCT	p.S111S		NM_203405	NP_981950	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	111						intermediate filament				ovary(1)	1						GTGGTCTACAGGATACTGGAA	0.547																0.606452	307.24007	308.769348	94	61	KEEP	---	---	---	---	52	48	30	38	-1	capture	Silent	SNP	31692021	31692021	KRTAP26-1	21	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	8463	279
BPIL2	254240	broad.mit.edu	37	22	32828374	32828374	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32828374C>T	uc003amn.2	-	10	1135	c.1135G>A	c.(1135-1137)GTT>ATT	p.V379I	BPIL2_uc010gwo.2_Intron|BPIL2_uc011amb.1_Missense_Mutation_p.V103I	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing	379						extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						TCCATGGAAACGATGGTTTCA	0.512																0.517647	121.289785	121.312358	44	41	KEEP	---	---	---	---	20	29	16	29	-1	capture	Missense_Mutation	SNP	32828374	32828374	BPIL2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1480	279
NUP210	23225	broad.mit.edu	37	3	13427820	13427820	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13427820A>G	uc003bxv.1	-	6	855	c.772T>C	c.(772-774)TCC>CCC	p.S258P		NM_024923	NP_079199	Q8TEM1	PO210_HUMAN	nucleoporin 210 precursor	258	Lumenal (Probable).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11	all_neural(104;0.187)					TAGTGAATGGAGGTTCCCACC	0.463					587											0.018405	-36.007587	6.538928	3	160	KEEP	---	---	---	---	2	2	102	88	-1	capture	Missense_Mutation	SNP	13427820	13427820	NUP210	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10667	279
ALAS1	211	broad.mit.edu	37	3	52242221	52242221	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52242221G>A	uc003dcy.1	+	9	1625	c.1288G>A	c.(1288-1290)GAT>AAT	p.D430N	ALAS1_uc003dcz.1_Missense_Mutation_p.D430N|ALAS1_uc011bec.1_Missense_Mutation_p.D447N	NM_000688	NP_000679	P13196	HEM1_HUMAN	5-aminolevulinate synthase 1 precursor	430					heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	TGGGGATCGGGATGGAGTCAT	0.483																0.505882	124.821082	124.823612	43	42	KEEP	---	---	---	---	20	30	24	25	-1	capture	Missense_Mutation	SNP	52242221	52242221	ALAS1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	484	279
DNAH1	25981	broad.mit.edu	37	3	52422839	52422839	+	Silent	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52422839G>A	uc011bef.1	+	59	9642	c.9381G>A	c.(9379-9381)TCG>TCA	p.S3127S	DNAH1_uc003ddv.2_5'UTR	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3192	Potential.				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACGGGCTGTCGGATGAGAAGG	0.667																0.409091	24.770347	24.929229	9	13	KEEP	---	---	---	---	5	4	6	11	-1	capture	Silent	SNP	52422839	52422839	DNAH1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	4555	279
SERPINI1	5274	broad.mit.edu	37	3	167525043	167525043	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:167525043A>C	uc003ffa.3	+	6	1091	c.893A>C	c.(892-894)GAA>GCA	p.E298A	SERPINI1_uc003ffb.3_Missense_Mutation_p.E298A	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	298					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						TTCACAGTGGAACAGGAAATT	0.338																0.12037	21.527345	36.765042	13	95	KEEP	---	---	---	---	8	10	51	64	-1	capture	Missense_Mutation	SNP	167525043	167525043	SERPINI1	3	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	14011	279
ATP8A1	10396	broad.mit.edu	37	4	42581956	42581956	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:42581956G>A	uc003gwr.2	-	11	1106	c.874C>T	c.(874-876)CGG>TGG	p.R292W	ATP8A1_uc003gws.2_Missense_Mutation_p.R292W|ATP8A1_uc011byz.1_Missense_Mutation_p.R292W	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),	292	Cytoplasmic (Potential).				ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	TTTGTAATCCGTTCCACATTT	0.343																0.615385	23.501078	23.652366	8	5	KEEP	---	---	---	---	5	4	1	4	-1	capture	Missense_Mutation	SNP	42581956	42581956	ATP8A1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	1183	279
CENPE	1062	broad.mit.edu	37	4	104065619	104065619	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104065619G>A	uc003hxb.1	-	33	5104	c.5014C>T	c.(5014-5016)CAG>TAG	p.Q1672*	CENPE_uc003hxc.1_Nonsense_Mutation_p.Q1647*	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	1672	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGTAGTATCTGAGTCAACCTT	0.393																0.064935	-6.584225	8.562154	5	72	KEEP	---	---	---	---	2	3	47	37	-1	capture	Nonsense_Mutation	SNP	104065619	104065619	CENPE	4	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	3198	279
KIAA1109	84162	broad.mit.edu	37	4	123184110	123184110	+	Silent	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123184110T>C	uc003ieh.2	+	41	6999	c.6954T>C	c.(6952-6954)GCT>GCC	p.A2318A	KIAA1109_uc003iel.1_Silent_p.A253A|KIAA1109_uc003iek.2_Silent_p.A937A	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2318					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						GCAGTGCTGCTGTGAAAAGTA	0.463																0.354839	30.616401	31.191926	11	20	KEEP	---	---	---	---	11	1	10	13	-1	capture	Silent	SNP	123184110	123184110	KIAA1109	4	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	8130	279
KIAA1109	84162	broad.mit.edu	37	4	123192519	123192519	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123192519C>T	uc003ieh.2	+	45	7885	c.7840C>T	c.(7840-7842)CGG>TGG	p.R2614W	KIAA1109_uc003iel.1_Missense_Mutation_p.R549W|KIAA1109_uc003iek.2_Missense_Mutation_p.R1233W	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2614					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CAGAAAACATCGGGACTTTCG	0.403																0.230769	11.443773	13.167321	6	20	KEEP	---	---	---	---	3	3	7	13	-1	capture	Missense_Mutation	SNP	123192519	123192519	KIAA1109	4	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	8130	279
SLC10A7	84068	broad.mit.edu	37	4	147227117	147227117	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:147227117C>T	uc010ioz.2	-	7	770	c.516G>A	c.(514-516)CAG>CAA	p.Q172Q	SLC10A7_uc003ikr.2_Silent_p.Q172Q|SLC10A7_uc010ipa.2_Silent_p.Q159Q|SLC10A7_uc003iks.2_RNA	NM_001029998	NP_001025169	Q0GE19	NTCP7_HUMAN	solute carrier family 10 (sodium/bile acid	172	Helical; (Potential).					integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)					TCATAAAAAGCTGAGAAAAAA	0.338																0.206897	11.893556	14.159989	6	23	KEEP	---	---	---	---	3	3	11	14	-1	capture	Silent	SNP	147227117	147227117	SLC10A7	4	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	14272	279
ADAMTS12	81792	broad.mit.edu	37	5	33881270	33881270	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33881270T>C	uc003jia.1	-	2	606	c.443A>G	c.(442-444)CAG>CGG	p.Q148R	ADAMTS12_uc010iuq.1_Missense_Mutation_p.Q148R|ADAMTS12_uc003jib.1_Missense_Mutation_p.Q148R	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	148					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCTGGTGCCCTGCTGTAGAAC	0.577													HNSCC(64;0.19)			0.403226	70.748427	71.258288	25	37	KEEP	---	---	---	---	12	16	18	23	-1	capture	Missense_Mutation	SNP	33881270	33881270	ADAMTS12	5	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	257	279
GPR98	84059	broad.mit.edu	37	5	90046453	90046453	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90046453G>A	uc003kju.2	+	53	11156	c.11060G>A	c.(11059-11061)CGT>CAT	p.R3687H	GPR98_uc003kjt.2_Missense_Mutation_p.R1393H|GPR98_uc003kjv.2_Missense_Mutation_p.R1287H	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3687	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ACATATGGCCGTATAACCATA	0.343																0.469697	251.841108	252.000239	93	105	KEEP	---	---	---	---	43	64	54	68	-1	capture	Missense_Mutation	SNP	90046453	90046453	GPR98	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6654	279
GPR98	84059	broad.mit.edu	37	5	90144497	90144497	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90144497G>A	uc003kju.2	+	79	17159	c.17063G>A	c.(17062-17064)CGA>CAA	p.R5688Q	GPR98_uc003kjt.2_Missense_Mutation_p.R3394Q|GPR98_uc003kjw.2_Missense_Mutation_p.R1349Q	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	5688	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTTGCCAGCCGAACTCTTTTC	0.313																0.411765	18.020688	18.136483	7	10	KEEP	---	---	---	---	3	4	5	5	-1	capture	Missense_Mutation	SNP	90144497	90144497	GPR98	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6654	279
GPR98	84059	broad.mit.edu	37	5	90159635	90159635	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90159635A>T	uc003kju.2	+	83	17913	c.17817A>T	c.(17815-17817)AAA>AAT	p.K5939N	GPR98_uc003kjt.2_Missense_Mutation_p.K3645N|GPR98_uc003kjw.2_Missense_Mutation_p.K1600N	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	5939	Cytoplasmic (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGCAGCTAAACTTCTGACTC	0.423																0.415584	181.162256	182.121509	64	90	KEEP	---	---	---	---	35	39	63	45	-1	capture	Missense_Mutation	SNP	90159635	90159635	GPR98	5	A	T	T	T	1	0	0	0	0	1	0	0	0	24	2	4	4	6654	279
EPB41L4A	64097	broad.mit.edu	37	5	111540130	111540130	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:111540130G>A	uc003kpv.1	-	15	1592	c.1318C>T	c.(1318-1320)CGT>TGT	p.R440C	EPB41L4A_uc003kpp.1_Missense_Mutation_p.R67C	NM_022140	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte protein band 4.1-like 4	440						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		TTTCGGCGACGCGTGTAAGGG	0.488																0.385714	134.682097	136.259835	54	86	KEEP	---	---	---	---	37	30	58	51	-1	capture	Missense_Mutation	SNP	111540130	111540130	EPB41L4A	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5110	279
PRR16	51334	broad.mit.edu	37	5	120022105	120022105	+	Missense_Mutation	SNP	C	T	T	rs137912065	byFrequency	TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:120022105C>T	uc003ksq.2	+	2	779	c.616C>T	c.(616-618)CGG>TGG	p.R206W	PRR16_uc003ksp.2_Missense_Mutation_p.R183W|PRR16_uc003ksr.2_Missense_Mutation_p.R136W	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	206	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		AGAACGAGTTCGGTTTAATGA	0.473																0.511111	65.223636	65.228475	23	22	KEEP	---	---	---	---	10	17	11	13	-1	capture	Missense_Mutation	SNP	120022105	120022105	PRR16	5	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	12485	279
CSNK1G3	1456	broad.mit.edu	37	5	122893189	122893189	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:122893189G>T	uc003ktm.2	+	4	939	c.220G>T	c.(220-222)GAG>TAG	p.E74*	CSNK1G3_uc003ktl.2_Nonsense_Mutation_p.E74*|CSNK1G3_uc003ktn.2_Nonsense_Mutation_p.E74*|CSNK1G3_uc003kto.2_Nonsense_Mutation_p.E74*|CSNK1G3_uc011cwr.1_5'UTR|CSNK1G3_uc011cws.1_Intron|CSNK1G3_uc010jda.2_Nonsense_Mutation_p.E74*	NM_004384	NP_004375	Q9Y6M4	KC1G3_HUMAN	casein kinase 1, gamma 3 isoform 1	74	Protein kinase.				Wnt receptor signaling pathway	cytoplasm	ATP binding|protein serine/threonine kinase activity				0		all_cancers(142;0.0156)|Prostate(80;0.0322)|Lung NSC(810;0.245)	KIRC - Kidney renal clear cell carcinoma(527;0.165)|Kidney(363;0.229)	OV - Ovarian serous cystadenocarcinoma(64;0.000121)|Epithelial(69;0.000227)|all cancers(49;0.00176)		TTTCAATTAGGAGCCCATGAA	0.299	Pancreas(187;2868 2964 4353 6297)				172											0.384615	50.982081	51.59079	20	32	KEEP	---	---	---	---	11	13	26	13	0.458333333333	capture	Nonsense_Mutation	SNP	122893189	122893189	CSNK1G3	5	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	3921	279
TRPC7	57113	broad.mit.edu	37	5	135693041	135693041	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:135693041C>T	uc003lbn.1	-	1	35	c.32G>A	c.(31-33)CGC>CAC	p.R11H	TRPC7_uc010jef.1_Missense_Mutation_p.R3H|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.R3H|TRPC7_uc010jei.1_Missense_Mutation_p.R3H|TRPC7_uc010jej.1_5'UTR	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	12	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGTGTGCCGGCGCTGCATGTT	0.572																0.546875	96.706905	96.827351	35	29	KEEP	---	---	---	---	17	20	13	17	-1	capture	Missense_Mutation	SNP	135693041	135693041	TRPC7	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16467	279
NDFIP1	80762	broad.mit.edu	37	5	141511419	141511419	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141511419A>G	uc003lmi.3	+	2	326	c.110A>G	c.(109-111)GAT>GGT	p.D37G	NDFIP1_uc003lmj.1_Missense_Mutation_p.D37G	NM_030571	NP_085048	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1	37	Cytoplasmic (Potential).				cellular iron ion homeostasis|negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endosome membrane|extracellular region|Golgi membrane|integral to membrane|perinuclear region of cytoplasm	signal transducer activity				0		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGCAGGTGATGCTCCTCCA	0.408																0.454545	291.682454	292.014582	85	102	KEEP	---	---	---	---	57	45	76	51	-1	capture	Missense_Mutation	SNP	141511419	141511419	NDFIP1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	10152	279
GABRG2	2566	broad.mit.edu	37	5	161530925	161530925	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161530925A>T	uc003lyz.3	+	6	1020	c.662A>T	c.(661-663)CAA>CTA	p.Q221L	GABRG2_uc010jjc.2_Missense_Mutation_p.Q261L|GABRG2_uc003lyy.3_Missense_Mutation_p.Q221L|GABRG2_uc011dej.1_Missense_Mutation_p.Q126L	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	221	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		ATTGTTTATCAATGGAAGCGA	0.388																0.5	63.075031	63.075031	21	21	KEEP	---	---	---	---	9	13	11	13	-1	capture	Missense_Mutation	SNP	161530925	161530925	GABRG2	5	A	T	T	T	1	0	0	0	0	1	0	0	0	65	5	4	4	6114	279
BNIP1	662	broad.mit.edu	37	5	172585746	172585746	+	Splice_Site	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:172585746G>A	uc003mcj.3	+	4	374	c.270_splice	c.e4-1	p.S90_splice	BNIP1_uc003mci.3_Splice_Site_p.S133_splice|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TCCAATTCCAGCAATCAGGCC	0.483																0.428571	35.805364	35.927478	12	16	KEEP	---	---	---	---	6	8	9	11	-1	capture	Splice_Site	SNP	172585746	172585746	BNIP1	5	G	A	A	A	1	0	0	0	0	0	0	1	0	442	34	5	2	1464	279
CDHR2	54825	broad.mit.edu	37	5	176004494	176004494	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176004494A>G	uc003mem.1	+	13	1355	c.1289A>G	c.(1288-1290)CAG>CGG	p.Q430R	CDHR2_uc003men.1_Missense_Mutation_p.Q430R	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	430	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						GCCTCCGTTCAGGTGCTGGTG	0.672																0.1	2.104243	6.898359	3	27	KEEP	---	---	---	---	5	0	15	14	-1	capture	Missense_Mutation	SNP	176004494	176004494	CDHR2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	3090	279
DSP	1832	broad.mit.edu	37	6	7576615	7576615	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7576615C>T	uc003mxp.1	+	19	2998	c.2719C>T	c.(2719-2721)CGC>TGC	p.R907C	DSP_uc003mxq.1_Missense_Mutation_p.R907C	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	907	Globular 1.|Spectrin 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGATGCTAAACGCCGCCAGGA	0.423																0.359375	56.901752	58.0182	23	41	KEEP	---	---	---	---	15	10	19	23	-1	capture	Missense_Mutation	SNP	7576615	7576615	DSP	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4736	279
TAP2	6891	broad.mit.edu	37	6	32798068	32798068	+	Silent	SNP	A	G	G			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32798068A>G	uc003occ.2	-	8	1642	c.1611T>C	c.(1609-1611)TAT>TAC	p.Y537Y	TAP2_uc011dqf.1_Silent_p.Y537Y|TAP2_uc003ocb.1_Silent_p.Y537Y|TAP2_uc003ocd.2_Silent_p.Y537Y	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	537	ABC transporter.|Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						AGCAGTGTTCATACTGTGAGA	0.587																0.424242	124.025582	124.522015	42	57	KEEP	---	---	---	---	32	20	33	40	-1	capture	Silent	SNP	32798068	32798068	TAP2	6	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	15439	279
TREML2	79865	broad.mit.edu	37	6	41166078	41166078	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41166078G>A	uc010jxm.1	-	2	324	c.145C>T	c.(145-147)CGC>TGC	p.R49C		NM_024807	NP_079083	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid	49	Ig-like V-type.|Extracellular (Potential).				T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					CCCTCCACGCGGTTTTTGTAG	0.547																0.453271	280.161948	280.566272	97	117	KEEP	---	---	---	---	67	48	63	80	-1	capture	Missense_Mutation	SNP	41166078	41166078	TREML2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16356	279
ABCC10	89845	broad.mit.edu	37	6	43417751	43417751	+	Silent	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43417751C>T	uc003ouy.1	+	22	4616	c.4401C>T	c.(4399-4401)CGC>CGT	p.R1467R	ABCC10_uc003ouz.1_Silent_p.R1439R|ABCC10_uc010jyo.1_Silent_p.R573R	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	1467	ABC transporter 2.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCACCCTGCGCAACCAGCCCC	0.642																0.4125	85.568596	86.100375	33	47	KEEP	---	---	---	---	15	23	29	22	-1	capture	Silent	SNP	43417751	43417751	ABCC10	6	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	50	279
ZDHHC4	55146	broad.mit.edu	37	7	6628405	6628405	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6628405G>A	uc003sqi.2	+	9	1257	c.899G>A	c.(898-900)CGT>CAT	p.R300H	ZDHHC4_uc003sql.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqh.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqj.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqk.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqm.2_Missense_Mutation_p.R300H|uc011jwy.1_5'Flank|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	300						integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TGGTGCCAGCGTTGTCCCCTT	0.577																0.239726	72.056237	81.085708	35	111	KEEP	---	---	---	---	17	20	59	56	-1	capture	Missense_Mutation	SNP	6628405	6628405	ZDHHC4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17497	279
CALCR	799	broad.mit.edu	37	7	93108737	93108737	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93108737C>T	uc003umv.1	-	4	449	c.188G>A	c.(187-189)CGA>CAA	p.R63Q	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.R45Q|CALCR_uc003umw.2_Missense_Mutation_p.R45Q	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	45	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	CATCTTCTTTCGTCCTACGAC	0.403																0.296804	155.785805	163.875064	65	154	KEEP	---	---	---	---	40	35	88	83	-1	capture	Missense_Mutation	SNP	93108737	93108737	CALCR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2555	279
RBM28	55131	broad.mit.edu	37	7	127979698	127979698	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127979698T>C	uc003vmp.2	-	2	381	c.266A>G	c.(265-267)AAG>AGG	p.K89R	RBM28_uc011koj.1_Intron|RBM28_uc011kok.1_Missense_Mutation_p.K36R	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	89					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						ATTTTTCCCCTTTTCCTTTGT	0.443																0.020619	-41.675907	8.252028	4	190	KEEP	---	---	---	---	4	1	112	108	-1	capture	Missense_Mutation	SNP	127979698	127979698	RBM28	7	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	13023	279
INTS10	55174	broad.mit.edu	37	8	19677962	19677962	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:19677962C>T	uc003wzj.2	+	4	505	c.374C>T	c.(373-375)ACG>ATG	p.T125M		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	125					snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		TGCTTCAACACGTTAGAACGA	0.403																0.333333	48.374917	49.853497	20	40	KEEP	---	---	---	---	13	10	25	21	-1	capture	Missense_Mutation	SNP	19677962	19677962	INTS10	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7699	279
DCAF4L2	138009	broad.mit.edu	37	8	88886278	88886278	+	Translation_Start_Site	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:88886278C>T	uc003ydz.2	-	1	19	c.-78G>A	c.(-80--76)TCGTG>TCATG			NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C											ovary(1)	1						TTTACAAGCACGACTTGGCAC	0.577																0.384615	13.17228	13.323826	5	8	KEEP	---	---	---	---	3	2	7	2	-1	capture	Translation_Start_Site	SNP	88886278	88886278	DCAF4L2	8	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	4231	279
SLC25A32	81034	broad.mit.edu	37	8	104417070	104417070	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104417070A>T	uc003yll.2	-	3	628	c.325T>A	c.(325-327)TAT>AAT	p.Y109N	SLC25A32_uc011lhr.1_Intron	NM_030780	NP_110407	Q9H2D1	MFTC_HUMAN	solute carrier family 25, member 32	109	Solcar 1.				folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	TCTGTTTTATATGACTTGATG	0.353																0.461538	37.09891	37.132158	12	14	KEEP	---	---	---	---	5	9	11	6	-1	capture	Missense_Mutation	SNP	104417070	104417070	SLC25A32	8	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	14388	279
KAL1	3730	broad.mit.edu	37	X	8555862	8555862	+	Silent	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:8555862G>A	uc004csf.2	-	5	849	c.699C>T	c.(697-699)GAC>GAT	p.D233D		NM_000216	NP_000207	P23352	KALM_HUMAN	Kallmann syndrome 1 protein precursor	233	Fibronectin type-III 1.				axon guidance|cell adhesion|cellular component movement	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|serine-type endopeptidase inhibitor activity			ovary(3)|pancreas(1)	4						AGTGAGTGGCGTCATCTTCGC	0.423																0.454545	13.673141	13.692981	5	6	KEEP	---	---	---	---	2	3	4	3	-1	capture	Silent	SNP	8555862	8555862	KAL1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7897	279
BEND2	139105	broad.mit.edu	37	X	18238990	18238990	+	Translation_Start_Site	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18238990G>A	uc004cyj.3	-	1	35	c.-119C>T	c.(-121--117)AACGA>AATGA		BEND2_uc010nfb.2_Translation_Start_Site	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2											ovary(3)|kidney(1)|central_nervous_system(1)	5						GCGTACACTCGTTGTCCGAGG	0.647																0.473684	24.271638	24.283197	9	10	KEEP	---	---	---	---	4	6	5	5	-1	capture	Translation_Start_Site	SNP	18238990	18238990	BEND2	23	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	1387	279
ARHGEF9	23229	broad.mit.edu	37	X	62875413	62875413	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:62875413T>C	uc004dvl.2	-	8	2100	c.1261A>G	c.(1261-1263)AGA>GGA	p.R421G	ARHGEF9_uc004dvj.1_Missense_Mutation_p.R310G|ARHGEF9_uc004dvk.1_Missense_Mutation_p.R239G|ARHGEF9_uc011mos.1_Missense_Mutation_p.R400G|ARHGEF9_uc004dvm.1_Missense_Mutation_p.R400G|ARHGEF9_uc011mot.1_Missense_Mutation_p.R368G|ARHGEF9_uc004dvn.2_Missense_Mutation_p.R428G	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	421	PH.				apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						CTCTCTTCTCTGAAAGCCCTG	0.413																0.384615	211.764682	214.044319	75	120	KEEP	---	---	---	---	46	41	60	72	-1	capture	Missense_Mutation	SNP	62875413	62875413	ARHGEF9	23	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	905	279
LAS1L	81887	broad.mit.edu	37	X	64749656	64749656	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64749656A>T	uc004dwa.1	-	5	689	c.617T>A	c.(616-618)ATA>AAA	p.I206K	LAS1L_uc004dwc.1_Missense_Mutation_p.I206K|LAS1L_uc004dwd.1_Missense_Mutation_p.I164K	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	206						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						CTCTTCCTCTATCCCTTCCCT	0.488																0.417219	186.509276	187.409168	63	88	KEEP	---	---	---	---	34	36	53	48	-1	capture	Missense_Mutation	SNP	64749656	64749656	LAS1L	23	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	8556	279
MED12	9968	broad.mit.edu	37	X	70357763	70357763	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70357763C>A	uc004dyy.2	+	41	6213	c.6014C>A	c.(6013-6015)ACC>AAC	p.T2005N	MED12_uc011mpq.1_Missense_Mutation_p.T1980N|MED12_uc004dyz.2_Missense_Mutation_p.T2004N|MED12_uc004dza.2_Missense_Mutation_p.T1855N|MED12_uc010nla.2_Missense_Mutation_p.T634N	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	2005	Gln-rich.|Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					CAGGCCCCCACCTATGGACAT	0.547																0.271429	47.737678	51.008713	19	51	KEEP	---	---	---	---	11	14	33	26	0.56	capture	Missense_Mutation	SNP	70357763	70357763	MED12	23	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	9341	279
TBX22	50945	broad.mit.edu	37	X	79282236	79282236	+	Silent	SNP	C	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:79282236C>A	uc010nmg.1	+	6	801	c.667C>A	c.(667-669)CGA>AGA	p.R223R	TBX22_uc004edi.1_Silent_p.R103R|TBX22_uc004edj.1_Silent_p.R223R	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	223	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15						GTACAAACCCCGAGTGCACGT	0.453				p.R223R(NCIH647-Tumor)	298											0.090909	1.231556	16.085903	8	80	KEEP	---	---	---	---	3	6	47	48	0.666666666667	capture	Silent	SNP	79282236	79282236	TBX22	23	C	A	A	A	1	0	0	0	0	0	0	0	1	295	23	4	4	15545	279
KLHL4	56062	broad.mit.edu	37	X	86890583	86890583	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:86890583G>A	uc004efb.2	+	9	1915	c.1733G>A	c.(1732-1734)CGT>CAT	p.R578H	KLHL4_uc004efa.2_Missense_Mutation_p.R578H	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	578	Kelch 4.					cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						ATTGGTGGACGTGATGGAAGT	0.393																0.392857	29.01842	29.299824	11	17	KEEP	---	---	---	---	9	4	10	7	-1	capture	Missense_Mutation	SNP	86890583	86890583	KLHL4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8311	279
PCDH11X	27328	broad.mit.edu	37	X	91133806	91133806	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:91133806C>T	uc004efk.1	+	2	3412	c.2567C>T	c.(2566-2568)ACC>ATC	p.T856I	PCDH11X_uc004efl.1_Missense_Mutation_p.T856I|PCDH11X_uc004efo.1_Missense_Mutation_p.T856I|PCDH11X_uc010nmv.1_Missense_Mutation_p.T856I|PCDH11X_uc004efm.1_Missense_Mutation_p.T856I|PCDH11X_uc004efn.1_Missense_Mutation_p.T856I|PCDH11X_uc004efh.1_Missense_Mutation_p.T856I|PCDH11X_uc004efj.1_Missense_Mutation_p.T856I	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	856	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						GAATGGGCTACCCCAAACCCA	0.368	NSCLC(38;925 1092 2571 38200 45895)															0.547368	153.377737	153.560622	52	43	KEEP	---	---	---	---	28	33	23	25	-1	capture	Missense_Mutation	SNP	91133806	91133806	PCDH11X	23	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	11411	279
TAF7L	54457	broad.mit.edu	37	X	100541563	100541563	+	Missense_Mutation	SNP	G	A	A	rs149116664		TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100541563G>A	uc004ehb.2	-	3	415	c.403C>T	c.(403-405)CCT>TCT	p.P135S	TAF7L_uc004eha.2_Missense_Mutation_p.P49S|TAF7L_uc004ehc.1_Missense_Mutation_p.P49S	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	135					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						AACTACTTACGCAATAAGTCA	0.204	Ovarian(104;431 1530 3210 15406 18594)															0.277778	23.634605	25.234438	10	26	KEEP	---	---	---	---	3	7	16	11	-1	capture	Missense_Mutation	SNP	100541563	100541563	TAF7L	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15421	279
ACSL4	2182	broad.mit.edu	37	X	108924259	108924259	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:108924259G>T	uc004eoi.2	-	7	1251	c.746C>A	c.(745-747)TCA>TAA	p.S249*	ACSL4_uc004eoj.2_Nonsense_Mutation_p.S208*|ACSL4_uc004eok.2_Nonsense_Mutation_p.S208*|ACSL4_uc010npp.1_Nonsense_Mutation_p.S249*	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	249	Cytoplasmic (Potential).				fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	CTCTTCTACTGATTGCATGCT	0.333	Pancreas(188;358 2127 38547 41466 45492)															0.327273	87.851777	90.767924	36	74	KEEP	---	---	---	---	20	20	46	34	0.5	capture	Nonsense_Mutation	SNP	108924259	108924259	ACSL4	23	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	179	279
DCAF12L1	139170	broad.mit.edu	37	X	125685564	125685564	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125685564G>A	uc004eul.2	-	1	1279	c.1028C>T	c.(1027-1029)CCC>CTC	p.P343L		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	343										skin(3)|ovary(1)	4						AGAACACAGGGGCCGGATGTT	0.602																0.085714	0.393812	12.577608	6	64	KEEP	---	---	---	---	4	2	37	36	-1	capture	Missense_Mutation	SNP	125685564	125685564	DCAF12L1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4223	279
MST4	51765	broad.mit.edu	37	X	131207025	131207025	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131207025C>T	uc004ewk.1	+	11	1431	c.1130C>T	c.(1129-1131)GCG>GTG	p.A377V	MST4_uc004ewl.1_Missense_Mutation_p.A300V|MST4_uc011mux.1_Missense_Mutation_p.A399V|MST4_uc010nrj.1_Missense_Mutation_p.A353V|MST4_uc004ewm.1_Missense_Mutation_p.A315V	NM_016542	NP_057626	Q9P289	MST4_HUMAN	serine/threonine protein kinase MST4 isoform 1	377					cellular component disassembly involved in apoptosis|regulation of apoptosis	cytosol|Golgi membrane	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(3)|stomach(2)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(192;0.000127)					AGGAATCAGGCGATTGAAGAA	0.358					51											0.53	142.50166	142.584039	53	47	KEEP	---	---	---	---	31	32	32	20	-1	capture	Missense_Mutation	SNP	131207025	131207025	MST4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9802	279
PTEN	5728	broad.mit.edu	37	10	89624265	89624267	+	In_Frame_Del	DEL	AAG	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89624265_89624267delAAG	uc001kfb.2	+	2	1070_1072	c.39_41delAAG	c.(37-42)AAAAGG>AAG	p.R15del	KILLIN_uc009xti.2_5'Flank	NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	15	Phosphatase tensin-type.		R -> S (in glioma).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.?(13)|p.0?(12)|p.R15I(4)|p.R15S(3)|p.R14G(2)|p.R14fs*29(1)|p.R15K(1)|p.R15fs*28(1)|p.I8_R14>LRLICIF(1)|p.R14fs*10(1)|p.R15fs*9(1)|p.K13del(1)|p.N12fs*6(1)|p.R14_D22del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GCAGAAACAAAAGGAGATATCAA	0.488			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.82			61	13		---	---	---	---						capture_indel	In_Frame_Del	DEL	89624265	89624267	PTEN	10	AAG	-	-	-	1	0	1	0	1	0	0	0	0	11	1	5	5	12633	279
RB1	5925	broad.mit.edu	37	13	48941638	48941641	+	Frame_Shift_Del	DEL	TCTT	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48941638_48941641delTCTT	uc001vcb.2	+	10	1114_1117	c.948_951delTCTT	c.(946-951)AATCTTfs	p.N316fs	RB1_uc010act.1_Frame_Shift_Del_p.N17fs	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	316_317					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGGTTGAAAATCTTTCTAAACGAT	0.299			6		568	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.80			45	11		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	48941638	48941641	RB1	13	TCTT	-	-	-	1	0	1	0	1	0	0	0	0	647	50	5	5	12993	279
SPTBN5	51332	broad.mit.edu	37	15	42148626	42148626	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42148626delA	uc001zos.2	-	53	9207	c.8874delT	c.(8872-8874)CTTfs	p.L2958fs		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2993	Spectrin 26.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCTGCAGCAGAAGCCGCCTCC	0.697																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	42148626	42148626	SPTBN5	15	A	-	-	-	1	0	1	0	1	0	0	0	0	106	9	5	5	15014	279
TCF12	6938	broad.mit.edu	37	15	57565229	57565244	+	Frame_Shift_Del	DEL	AGTACTAATGAAGATG	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:57565229_57565244delAGTACTAATGAAGATG	uc002aec.2	+	18	1959_1974	c.1675_1690delAGTACTAATGAAGATG	c.(1675-1692)AGTACTAATGAAGATGAGfs	p.S559fs	TCF12_uc010ugm.1_Frame_Shift_Del_p.S611fs|TCF12_uc010ugn.1_Frame_Shift_Del_p.S579fs|TCF12_uc002aea.2_Frame_Shift_Del_p.S583fs|TCF12_uc010bfs.2_5'UTR|TCF12_uc002aeb.2_Frame_Shift_Del_p.S583fs|TCF12_uc002aed.2_Frame_Shift_Del_p.S559fs|TCF12_uc002aee.2_Frame_Shift_Del_p.S389fs|TCF12_uc010bft.2_Frame_Shift_Del_p.S413fs|TCF12_uc010ugo.1_Frame_Shift_Del_p.S323fs|TCF12_uc010ugp.1_Splice_Site_p.S216_splice|TCF12_uc010ugq.1_Frame_Shift_Del_p.S193fs|TCF12_uc010ugr.1_Frame_Shift_Del_p.S172fs	NM_207038	NP_996921	Q99081	HTF4_HUMAN	transcription factor 12 isoform b	559_564					immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		ATTTTCTAGCAGTACTAATGAAGATGAGGATTTGAA	0.384					335	T	TEC	extraskeletal myxoid chondrosarcoma								0.20			7	28		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	57565229	57565244	TCF12	15	AGTACTAATGAAGATG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	15573	279
MED13	9969	broad.mit.edu	37	17	60072508	60072512	+	Splice_Site	DEL	CTTAC	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:60072508_60072512delCTTAC	uc002izo.2	-	10	2258	c.2181_splice	c.e10+1	p.K727_splice		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						TGTGATTTCTCTTACCTTGTGTTTT	0.346																0.82			33	7		---	---	---	---						capture_indel	Splice_Site	DEL	60072508	60072512	MED13	17	CTTAC	-	-	-	1	0	1	0	1	0	0	1	0	404	32	5	5	9343	279
TTN	7273	broad.mit.edu	37	2	179542390	179542392	+	In_Frame_Del	DEL	CTT	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179542390_179542392delCTT	uc010zfg.1	-	143	30739_30741	c.30515_30517delAAG	c.(30514-30519)GAAGTC>GTC	p.E10172del	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_In_Frame_Del_p.E6833del|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11099							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGAAGGACTTCTTCTTCAGG	0.443				p.E10172del(SKUT1-Tumor)|p.E10172del(HOS-Tumor)|p.E10172del(LP1-Tumor)|p.E10172del(HTK-Tumor)	8722											0.43			28	37		---	---	---	---						capture_indel	In_Frame_Del	DEL	179542390	179542392	TTN	2	CTT	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	16617	279
NKTR	4820	broad.mit.edu	37	3	42678511	42678511	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42678511delA	uc003clo.2	+	13	1462	c.1315delA	c.(1315-1317)AAAfs	p.K439fs	NKTR_uc003clm.1_Frame_Shift_Del_p.K186fs|NKTR_uc003clp.2_Frame_Shift_Del_p.K186fs|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Frame_Shift_Del_p.K329fs|NKTR_uc003clr.1_Frame_Shift_Del_p.K186fs|NKTR_uc003cls.2_Frame_Shift_Del_p.K139fs	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence	439	Arg/Lys-rich (basic).				protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		GGTTAAGCATAAAAAGAAAGG	0.368																0.36			17	30		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	42678511	42678511	NKTR	3	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	10355	279
WWC2	80014	broad.mit.edu	37	4	184201996	184201998	+	In_Frame_Del	DEL	AAG	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:184201996_184201998delAAG	uc010irx.2	+	17	2812_2814	c.2630_2632delAAG	c.(2629-2634)CAAGAA>CAA	p.E882del	WWC2_uc003ivk.3_In_Frame_Del_p.E677del|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_In_Frame_Del_p.E564del|WWC2_uc003ivn.3_In_Frame_Del_p.E397del|WWC2_uc010irz.2_In_Frame_Del_p.E199del|WWC2_uc003ivo.3_5'Flank	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	882	Potential.									ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		gaattagcacaagaagaagaaga	0.340																0.33			2	4		---	---	---	---						capture_indel	In_Frame_Del	DEL	184201996	184201998	WWC2	4	AAG	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	17293	279
ZFR	51663	broad.mit.edu	37	5	32388633	32388636	+	Frame_Shift_Del	DEL	CAGA	-	-			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32388633_32388636delCAGA	uc003jhr.1	-	13	2367_2370	c.2287_2290delTCTG	c.(2287-2292)TCTGAAfs	p.S763fs	ZFR_uc011cny.1_RNA	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	763_764					multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		TTCTCATGTTCAGACAAACTGTCT	0.358																0.30			19	45		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	32388633	32388636	ZFR	5	CAGA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	17539	279
ATG12	9140	broad.mit.edu	37	5	115177086	115177087	+	Splice_Site	INS	-	T	T			TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:115177086_115177087insT	uc003krh.2	-	1	413	c.304_splice	c.e1+1	p.I102_splice	AP3S1_uc003krl.2_5'Flank|AP3S1_uc003krk.2_5'Flank|AP3S1_uc003krm.2_5'Flank|ATG12_uc003kri.2_Splice_Site_p.I102_splice|ATG12_uc003krj.2_RNA	NM_004707	NP_004698	O94817	ATG12_HUMAN	APG12 autophagy 12-like						autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		AATTCAGTTACTTTTTTTCTTG	0.550																0.18			13	59		---	---	---	---						capture_indel	Splice_Site	INS	115177086	115177087	ATG12	5	-	T	T	T	1	0	1	1	0	0	0	1	0	260	20	5	5	1081	279
UPF3B	65109	broad.mit.edu	37	X	118975081	118975084	+	Frame_Shift_Del	DEL	TCTG	-	-	rs142862074	byFrequency	TCGA-76-6283-01	TCGA-76-6283-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118975081_118975084delTCTG	uc004erz.1	-	7	839_842	c.762_765delCAGA	c.(760-765)GACAGAfs	p.D254fs	UPF3B_uc004esa.1_Frame_Shift_Del_p.D254fs	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	254_255	Sufficient for association with EJC core.|Necessary for interaction with UPF2.				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding	p.R255K(1)		ovary(2)|kidney(1)	3						TTTCTGGAATTCTGTCTATCTTCT	0.191																0.24			19	59		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	118975081	118975084	UPF3B	23	TCTG	-	-	-	1	0	1	0	1	0	0	0	0	803	62	5	5	16888	279
