Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	i_ACHILLES_Top_Genes	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	t_alt_count	t_ref_count	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	i_t_ALT_F1R2	i_t_ALT_F2R1	i_t_REF_F1R2	i_t_REF_F2R1	i_t_Foxog	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF11	440560	broad.mit.edu	37	1	12887475	12887475	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12887475G>T	uc001auk.2	-	3	578	c.382C>A	c.(382-384)CTT>ATT	p.L128I		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	128											0						ACCCATAGAAGGAGGCAGGTG	0.468																0.345656	475.691979	487.103117	187	354	KEEP	---	---	---	---	97	105	203	194	0.480198019802	capture	Missense_Mutation	SNP	12887475	12887475	PRAMEF11	1	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	12328	288
B4GALT2	8704	broad.mit.edu	37	1	44446914	44446914	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44446914G>A	uc001clg.2	+	2	452	c.82G>A	c.(82-84)GTC>ATC	p.V28I	B4GALT2_uc001clh.2_5'UTR|B4GALT2_uc010okl.1_Missense_Mutation_p.V57I|B4GALT2_uc001cli.2_Missense_Mutation_p.V28I	NM_003780	NP_003771	O60909	B4GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	28	Helical; Signal-anchor for type II membrane protein; (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|lactose synthase activity|metal ion binding|N-acetyllactosamine synthase activity			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			N-Acetyl-D-glucosamine(DB00141)	CCTCGTGGCCGTCATCCTCTA	0.637																0.393939	104.206688	105.179995	39	60	KEEP	---	---	---	---	20	22	45	22	-1	capture	Missense_Mutation	SNP	44446914	44446914	B4GALT2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1260	288
PPM1J	333926	broad.mit.edu	37	1	113255057	113255057	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:113255057C>T	uc001ect.1	-	4	779	c.752G>A	c.(751-753)CGG>CAG	p.R251Q	PPM1J_uc009wgl.1_RNA|PPM1J_uc001ecs.1_Missense_Mutation_p.R45Q	NM_005167	NP_005158	Q5JR12	PPM1J_HUMAN	protein phosphatase 1J (PP2C domain containing)	251	PP2C-like.									breast(2)|central_nervous_system(1)	3	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGGCCACGCCGCTCCCGGGC	0.617																0.266667	16.673971	18.160436	8	22	KEEP	---	---	---	---	5	5	15	16	-1	capture	Missense_Mutation	SNP	113255057	113255057	PPM1J	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12243	288
PTEN	5728	broad.mit.edu	37	10	89692768	89692768	+	Splice_Site	SNP	A	C	C			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692768A>C	uc001kfb.2	+	6	1285	c.254_splice	c.e6-2	p.V85_splice		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.C71fs*6(2)|p.Y27fs*1(2)|p.N82_P95del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTTTTACCACAGTTGCACAAT	0.328			31		264	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			0.408163	66.594664	66.954675	20	29	KEEP	---	---	---	---	11	12	12	19	-1	capture	Splice_Site	SNP	89692768	89692768	PTEN	10	A	C	C	C	1	0	0	0	0	0	0	1	0	91	7	5	4	12633	288
FAM181B	220382	broad.mit.edu	37	11	82443599	82443599	+	Silent	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82443599C>T	uc001ozp.2	-	1	1308	c.1173G>A	c.(1171-1173)GTG>GTA	p.V391V		NM_175885	NP_787081	A6NEQ2	F181B_HUMAN	hypothetical protein LOC220382	391										large_intestine(1)	1						AATCGTAGGACACCTGATGGG	0.706																0.411765	17.520711	17.636446	7	10	KEEP	---	---	---	---	4	3	5	6	-1	capture	Silent	SNP	82443599	82443599	FAM181B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	5461	288
NOX4	50507	broad.mit.edu	37	11	89073229	89073229	+	Splice_Site	SNP	A	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89073229A>T	uc001pct.2	-	15	1685	c.1446_splice	c.e15+1	p.K482_splice	NOX4_uc009yvr.2_Splice_Site_p.K457_splice|NOX4_uc001pcu.2_Splice_Site_p.K408_splice|NOX4_uc001pcw.2_Splice_Site_p.K175_splice|NOX4_uc001pcx.2_Splice_Site_p.K135_splice|NOX4_uc001pcv.2_Splice_Site_p.K442_splice|NOX4_uc009yvo.2_Splice_Site|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Splice_Site_p.K246_splice|NOX4_uc010rtv.1_Splice_Site_p.K418_splice|NOX4_uc009yvq.2_Splice_Site_p.K458_splice	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CCCTAATGTTACCTTGTTATG	0.318																0.294118	102.385313	107.522549	40	96	KEEP	---	---	---	---	15	31	58	52	-1	capture	Splice_Site	SNP	89073229	89073229	NOX4	11	A	T	T	T	1	0	0	0	0	0	0	1	0	182	14	5	4	10465	288
ANGPTL5	253935	broad.mit.edu	37	11	101762058	101762058	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:101762058T>A	uc001pgl.2	-	9	1715	c.1119A>T	c.(1117-1119)AAA>AAT	p.K373N		NM_178127	NP_835228	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5 precursor	373	Fibrinogen C-terminal.				signal transduction	extracellular space	receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		TTGAAACAGATTTAATCTTGA	0.303																0.33	97.047566	99.605748	33	67	KEEP	---	---	---	---	22	20	43	29	-1	capture	Missense_Mutation	SNP	101762058	101762058	ANGPTL5	11	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	614	288
MMP1	4312	broad.mit.edu	37	11	102663372	102663372	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102663372C>T	uc001phi.2	-	7	1140	c.997G>A	c.(997-999)GAA>AAA	p.E333K	uc001phh.1_Intron|MMP1_uc010ruv.1_Missense_Mutation_p.E267K	NM_002421	NP_002412	P03956	MMP1_HUMAN	matrix metalloproteinase 1 isoform 1	333	Hemopexin-like 2.				blood coagulation|collagen catabolic process|interspecies interaction between organisms|leukocyte migration|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)|lung(1)	4	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)		TCGGCAAATTCGTAAGCAGCT	0.403					227											0.264706	65.380628	70.484358	27	75	KEEP	---	---	---	---	16	16	49	35	-1	capture	Missense_Mutation	SNP	102663372	102663372	MMP1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9560	288
IPO8	10526	broad.mit.edu	37	12	30809654	30809654	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:30809654G>A	uc001rjd.2	-	17	2082	c.1912C>T	c.(1912-1914)CGG>TGG	p.R638W	IPO8_uc001rje.1_Missense_Mutation_p.R127W|IPO8_uc010sjt.1_Missense_Mutation_p.R433W	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	638					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCAATGATCCGTAGACAGATA	0.199																0.5625	26.37538	26.429642	9	7	KEEP	---	---	---	---	7	5	5	3	-1	capture	Missense_Mutation	SNP	30809654	30809654	IPO8	12	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	7721	288
ZBTB39	9880	broad.mit.edu	37	12	57396685	57396685	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57396685G>T	uc001sml.1	-	2	2103	c.2017C>A	c.(2017-2019)CTT>ATT	p.L673I	RDH16_uc010sqx.1_RNA	NM_014830	NP_055645	O15060	ZBT39_HUMAN	zinc finger and BTB domain containing 39	673	C2H2-type 8; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						ATGAGGTTAAGGGTGGAACTG	0.542																0.042553	-14.786932	6.339426	4	90	KEEP	---	---	---	---	1	4	50	53	0.2	capture	Missense_Mutation	SNP	57396685	57396685	ZBTB39	12	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	17420	288
STARD13	90627	broad.mit.edu	37	13	33685935	33685935	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:33685935C>A	uc001uuw.2	-	10	2713	c.2587G>T	c.(2587-2589)GAA>TAA	p.E863*	STARD13_uc001uuu.2_Nonsense_Mutation_p.E855*|STARD13_uc001uuv.2_Nonsense_Mutation_p.E745*|STARD13_uc001uux.2_Nonsense_Mutation_p.E828*|STARD13_uc010tec.1_RNA	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	863	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CTGTCGCATTCCATGATCATG	0.478																0.326087	36.005156	37.241579	15	31	KEEP	---	---	---	---	10	6	16	18	0.375	capture	Nonsense_Mutation	SNP	33685935	33685935	STARD13	13	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	15146	288
SLC15A1	6564	broad.mit.edu	37	13	99337143	99337143	+	Silent	SNP	C	T	T	rs143994270	by1000genomes	TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99337143C>T	uc001vno.2	-	23	2039	c.1962G>A	c.(1960-1962)GCG>GCA	p.A654A		NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	654	Helical; (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	CCAGAAGCAACGCGGCAAATA	0.418																0.375	31.892546	32.331217	12	20	KEEP	---	---	---	---	4	9	9	14	-1	capture	Silent	SNP	99337143	99337143	SLC15A1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	14291	288
ASB2	51676	broad.mit.edu	37	14	94419793	94419793	+	Missense_Mutation	SNP	G	A	A	rs113529772		TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94419793G>A	uc001ycc.1	-	3	884	c.395C>T	c.(394-396)ACG>ATG	p.T132M	ASB2_uc001ycd.2_Missense_Mutation_p.T180M|ASB2_uc001yce.1_Missense_Mutation_p.T78M	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	132	ANK 3.				intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GCCCCTGCACGTTGCCAAGTA	0.587																0.423077	58.73713	59.006308	22	30	KEEP	---	---	---	---	11	11	17	13	-1	capture	Missense_Mutation	SNP	94419793	94419793	ASB2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1014	288
JAG2	3714	broad.mit.edu	37	14	105622189	105622189	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105622189C>T	uc001yqg.2	-	4	1017	c.613G>A	c.(613-615)GCC>ACC	p.A205T	JAG2_uc001yqh.2_Missense_Mutation_p.A205T	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	205	DSL.|Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		TTGCAAGTGGCGCTGTAGTAG	0.627					501											0.25	10.970618	12.103706	5	15	KEEP	---	---	---	---	3	4	7	11	-1	capture	Missense_Mutation	SNP	105622189	105622189	JAG2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7858	288
AQR	9716	broad.mit.edu	37	15	35193048	35193048	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35193048A>G	uc001ziv.2	-	20	2199	c.2018T>C	c.(2017-2019)ATT>ACT	p.I673T		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	673						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CAGGTTCCGAATAGTCTCCAG	0.448																0.306667	73.904391	76.399735	23	52	KEEP	---	---	---	---	15	10	26	35	-1	capture	Missense_Mutation	SNP	35193048	35193048	AQR	15	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	828	288
THBS1	7057	broad.mit.edu	37	15	39879564	39879564	+	Silent	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:39879564C>T	uc001zkh.2	+	8	1316	c.1137C>T	c.(1135-1137)GAC>GAT	p.D379D	THBS1_uc010bbi.2_5'Flank	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	379	TSP type-1 1.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	ACTCTGCGGACGATGGCTGGT	0.567																0.333333	34.734417	35.768436	14	28	KEEP	---	---	---	---	12	3	17	14	-1	capture	Silent	SNP	39879564	39879564	THBS1	15	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15738	288
ITFG3	83986	broad.mit.edu	37	16	315018	315018	+	Silent	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:315018G>A	uc002cgf.2	+	13	1851	c.1656G>A	c.(1654-1656)GCG>GCA	p.A552A	ITFG3_uc002cgg.2_Intron|ITFG3_uc010uud.1_Intron|ITFG3_uc002cgh.2_Silent_p.A552A	NM_032039	NP_114428	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	552	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				AGAGTGAGGCGTAGAGGCACG	0.647																0.348837	35.494274	36.369097	15	28	KEEP	---	---	---	---	9	9	15	16	-1	capture	Silent	SNP	315018	315018	ITFG3	16	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	7794	288
PTX4	390667	broad.mit.edu	37	16	1537647	1537647	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1537647G>A	uc010uvf.1	-	2	451	c.451C>T	c.(451-453)CGC>TGC	p.R151C		NM_001013658	NP_001013680	Q96A99	PTX4_HUMAN	neuronal pentraxin II-like	156						extracellular region	metal ion binding				0						CCCTCCAGGCGTGCCAGTGAG	0.741																0.285714	19.396614	20.545624	8	20	KEEP	---	---	---	---	4	4	15	7	-1	capture	Missense_Mutation	SNP	1537647	1537647	PTX4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12718	288
CIITA	4261	broad.mit.edu	37	16	10997663	10997663	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10997663G>A	uc002dai.3	+	9	981	c.848G>A	c.(847-849)CGG>CAG	p.R283Q	CIITA_uc002daj.3_Missense_Mutation_p.R284Q|CIITA_uc002dak.3_Missense_Mutation_p.R234Q|CIITA_uc002dag.2_Missense_Mutation_p.R283Q|CIITA_uc002dah.2_Missense_Mutation_p.R235Q|CIITA_uc010bup.1_Missense_Mutation_p.R283Q	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	283					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						TCTCCAGACCGGCCAGGCTCC	0.627					532	T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								0.057692	-10.68985	10.616914	6	98	KEEP	---	---	---	---	4	3	34	68	-1	capture	Missense_Mutation	SNP	10997663	10997663	CIITA	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3393	288
ERN2	10595	broad.mit.edu	37	16	23718095	23718095	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23718095C>T	uc002dma.3	-	6	780	c.611G>A	c.(610-612)CGC>CAC	p.R204H	ERN2_uc010bxp.2_Missense_Mutation_p.R204H|ERN2_uc010bxq.1_Missense_Mutation_p.R12H	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	156	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		AATGTAGAGGCGGGGGGTGGA	0.607					225											0.304348	49.248811	51.606204	21	48	KEEP	---	---	---	---	13	14	37	33	-1	capture	Missense_Mutation	SNP	23718095	23718095	ERN2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5193	288
PHF23	79142	broad.mit.edu	37	17	7139423	7139423	+	Silent	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7139423G>A	uc002gfa.2	-	4	1050	c.823C>T	c.(823-825)CTG>TTG	p.L275L	DVL2_uc002gez.1_5'Flank|DVL2_uc010vtr.1_5'Flank|DVL2_uc010clz.1_5'Flank|PHF23_uc010vtt.1_Silent_p.L208L|PHF23_uc010cma.2_Silent_p.L145L	NM_024297	NP_077273	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	275							zinc ion binding				0						GGTGTTGGCAGCACAGGGACT	0.488																0.03252	-23.00398	6.36509	4	119	KEEP	---	---	---	---	3	1	67	62	-1	capture	Silent	SNP	7139423	7139423	PHF23	17	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	11738	288
TP53	7157	broad.mit.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	A	A	rs121912651		TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577539G>A	uc002gim.2	-	7	936	c.742C>T	c.(742-744)CGG>TGG	p.R248W	TP53_uc002gig.1_Missense_Mutation_p.R248W|TP53_uc002gih.2_Missense_Mutation_p.R248W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116W|TP53_uc010cng.1_Missense_Mutation_p.R116W|TP53_uc002gii.1_Missense_Mutation_p.R116W|TP53_uc010cnh.1_Missense_Mutation_p.R248W|TP53_uc010cni.1_Missense_Mutation_p.R248W|TP53_uc002gij.2_Missense_Mutation_p.R248W|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155W|TP53_uc002gio.2_Missense_Mutation_p.R116W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(516)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGGGCCTCCGGTTCATGCCG	0.577	Pancreas(47;798 1329 9957 10801)	R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO680N_OESOPHAGUS)|R248W(SW837_LARGE_INTESTINE)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(RD_SOFT_TISSUE)|R248W(VCAP_PROSTATE)|R248W(JIMT1_BREAST)|R248W(GCT_SOFT_TISSUE)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(786O_KIDNEY)|R248W(COLO320_LARGE_INTESTINE)|R248W(LXF289_LUNG)|R248W(LUDLU1_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(HCC2157_BREAST)	111	p.R248W(SW837-Tumor)|p.R248W(786O-Tumor)|p.R248W(LUDLU1-Tumor)|p.R248W(VCAP-Tumor)|p.R248*(DB-Tumor)|p.R248W(MIAPACA2-Tumor)|p.R248W(HCC2157-Tumor)|p.R248W(LXF289-Tumor)|p.R248G(8505C-Tumor)|p.R248A(SF126-Tumor)|p.R248W(SET2-Tumor)|p.R248W(KO52-Tumor)|p.R248W(SNU1040-Tumor)|p.R248W(GCT-Tumor)|p.R248W(JIMT1-Tumor)|p.R248W(COLO320-Tumor)|p.R248W(CAS1-Tumor)|p.R248W(NCIH2106-Tumor)|p.R248W(SNUC5-Tumor)|p.R248W(COLO680N-Tumor)|p.R248W(RD-Tumor)	690	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.352941	63.267678	64.569352	24	44	KEEP	---	---	---	---	13	14	19	30	-1	capture	Missense_Mutation	SNP	7577539	7577539	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	288
MYH1	4619	broad.mit.edu	37	17	10398535	10398535	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10398535C>G	uc002gmo.2	-	36	5363	c.5269G>C	c.(5269-5271)GAG>CAG	p.E1757Q	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1757	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TTGGCCTTCTCTTCTGCATTG	0.473					585											0.298429	182.820071	189.744736	57	134	KEEP	---	---	---	---	28	38	77	78	-1	capture	Missense_Mutation	SNP	10398535	10398535	MYH1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	9939	288
KRT14	3861	broad.mit.edu	37	17	39742796	39742796	+	Silent	SNP	A	C	C			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39742796A>C	uc002hxf.1	-	1	352	c.291T>G	c.(289-291)GGT>GGG	p.G97G	JUP_uc010wfs.1_Intron|KRT14_uc010cxp.1_Silent_p.G97G	NM_000526	NP_000517	P02533	K1C14_HUMAN	keratin 14	97	Head.				epidermis development|hemidesmosome assembly|intermediate filament bundle assembly	cytosol|keratin filament|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.000307)				caaagccaccacccaagccag	0.353																0.190476	3.293421	7.366118	8	34	KEEP	---	---	---	---	14	16	18	25	-1	capture	Silent	SNP	39742796	39742796	KRT14	17	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	8371	288
SLC25A10	1468	broad.mit.edu	37	17	79687107	79687107	+	Nonstop_Mutation	SNP	A	C	C			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79687107A>C	uc002kbi.2	+	11	950	c.864A>C	c.(862-864)TGA>TGC	p.*288C	SLC25A10_uc010wut.1_Nonstop_Mutation_p.*443C|SLC25A10_uc010dif.2_Nonstop_Mutation_p.*297C|SLC25A10_uc010wuu.1_Nonstop_Mutation_p.*242C	NM_012140	NP_036272	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier;	288					gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	TGCCATCCTGACCAGCCGTGG	0.607																0.153846	3.710541	8.246352	6	33	KEEP	---	---	---	---	4	7	18	20	-1	capture	Nonstop_Mutation	SNP	79687107	79687107	SLC25A10	17	A	C	C	C	1	0	0	0	0	0	0	0	0	130	10	5	4	14364	288
MIER2	54531	broad.mit.edu	37	19	313632	313632	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:313632C>T	uc002lok.1	-	8	676	c.667G>A	c.(667-669)GAA>AAA	p.E223K		NM_017550	NP_060020	Q8N344	MIER2_HUMAN	mesoderm induction early response 1, family	223	ELM2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCTGGTCTTCGTTCTCGTAG	0.622																0.183486	35.837959	46.087454	20	89	KEEP	---	---	---	---	14	7	45	57	-1	capture	Missense_Mutation	SNP	313632	313632	MIER2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9493	288
TUBB4	10382	broad.mit.edu	37	19	6495601	6495601	+	Silent	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6495601G>A	uc002mfg.1	-	4	1016	c.909C>T	c.(907-909)TGC>TGT	p.C303C	TUBB4_uc002mff.1_Silent_p.C231C|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	303					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		GGCGCGGGTCGCACGCCGCCA	0.677																0.296875	129.725151	136.797109	57	135	KEEP	---	---	---	---	37	25	83	65	-1	capture	Silent	SNP	6495601	6495601	TUBB4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	16640	288
MUC16	94025	broad.mit.edu	37	19	9089511	9089511	+	Silent	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9089511G>A	uc002mkp.2	-	1	2508	c.2304C>T	c.(2302-2304)GCC>GCT	p.A768A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	768	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGGAAAGAACGGCTGAGCTGG	0.483																0.225092	139.523566	158.354352	61	210	KEEP	---	---	---	---	32	38	116	118	-1	capture	Silent	SNP	9089511	9089511	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9883	288
DCAF15	90379	broad.mit.edu	37	19	14071180	14071180	+	Silent	SNP	G	C	C			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14071180G>C	uc002mxt.2	+	11	1614	c.1608G>C	c.(1606-1608)CTG>CTC	p.L536L	DCAF15_uc002mxu.2_RNA	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	536										central_nervous_system(1)	1						TAGGCGACCTGACTGAGGTCA	0.637														OREG0025301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.285714	72.344395	75.821142	24	60	KEEP	---	---	---	---	17	9	31	31	-1	capture	Silent	SNP	14071180	14071180	DCAF15	19	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	4226	288
KCNK3	3777	broad.mit.edu	37	2	26950539	26950539	+	Silent	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26950539C>T	uc002rhn.2	+	2	451	c.288C>T	c.(286-288)TAC>TAT	p.Y96Y		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	96					synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCCAGGCTACGGGCACGCGG	0.632	GBM(80;1457 1631 27100 45946)															0.347222	192.1522	196.605823	75	141	KEEP	---	---	---	---	40	48	69	102	-1	capture	Silent	SNP	26950539	26950539	KCNK3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7989	288
DDX18	8886	broad.mit.edu	37	2	118587017	118587017	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:118587017C>A	uc002tlh.1	+	13	1944	c.1845C>A	c.(1843-1845)TTC>TTA	p.F615L		NM_006773	NP_006764	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	615							ATP binding|ATP-dependent RNA helicase activity|RNA binding			breast(2)|ovary(1)|lung(1)	4						CATTTGGTTTCAAGGTGCCTC	0.398																0.322368	125.012096	129.276061	49	103	KEEP	---	---	---	---	34	22	61	59	0.392857142857	capture	Missense_Mutation	SNP	118587017	118587017	DDX18	2	C	A	A	A	1	0	0	0	0	1	0	0	0	376	29	4	4	4303	288
XRN2	22803	broad.mit.edu	37	20	21367621	21367621	+	Silent	SNP	C	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:21367621C>A	uc002wsf.1	+	29	2859	c.2764C>A	c.(2764-2766)CGA>AGA	p.R922R	XRN2_uc002wsg.1_Silent_p.R846R|XRN2_uc010zsk.1_Silent_p.R868R|XRN2_uc002wsh.1_Silent_p.R60R	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	922					cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						TCCACCCAGACGAGATGATCG	0.502																0.290909	87.052995	91.363736	32	78	KEEP	---	---	---	---	22	15	38	50	0.405405405405	capture	Silent	SNP	21367621	21367621	XRN2	20	C	A	A	A	1	0	0	0	0	0	0	0	1	243	19	4	4	17341	288
MMP9	4318	broad.mit.edu	37	20	44639885	44639885	+	Silent	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44639885C>T	uc002xqz.2	+	5	772	c.753C>T	c.(751-753)GAC>GAT	p.D251D		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	251	Fibronectin type-II 1.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	GTCGCTCCGACGGCTTGCCCT	0.657					462											0.294118	93.947403	99.107174	40	96	KEEP	---	---	---	---	18	23	51	52	-1	capture	Silent	SNP	44639885	44639885	MMP9	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	9581	288
ARFGEF2	10564	broad.mit.edu	37	20	47639713	47639713	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47639713G>A	uc002xtx.3	+	35	4902	c.4750G>A	c.(4750-4752)GCC>ACC	p.A1584T	ARFGEF2_uc010zyf.1_Missense_Mutation_p.A877T	NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	1584					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			CATGGTTGCCGCCCAGGTAAG	0.413	Esophageal Squamous(176;1738 1974 26285 33069 35354)															0.283582	44.292823	47.113916	19	48	KEEP	---	---	---	---	12	11	25	26	-1	capture	Missense_Mutation	SNP	47639713	47639713	ARFGEF2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	846	288
HRH3	11255	broad.mit.edu	37	20	60791534	60791534	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60791534G>A	uc002ycf.2	-	3	1163	c.866C>T	c.(865-867)GCG>GTG	p.A289V	HRH3_uc002ycg.2_Intron|HRH3_uc002ych.2_Intron|HRH3_uc002yci.2_Missense_Mutation_p.A289V	NM_007232	NP_009163	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	289	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Histamine Phosphate(DB00667)	CCCGAGGGTCGCCTCCCCGGC	0.736																0.5	7.121921	7.121921	3	3	KEEP	---	---	---	---	1	2	4	2	-1	capture	Missense_Mutation	SNP	60791534	60791534	HRH3	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7282	288
TMPRSS15	5651	broad.mit.edu	37	21	19642347	19642347	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:19642347C>T	uc002ykw.2	-	25	3030	c.2999G>A	c.(2998-3000)CGC>CAC	p.R1000H		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	1000	Extracellular (Potential).|Peptidase S1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						CACTCCGGGGCGATTAGGCAG	0.448																0.271186	33.177598	35.964315	16	43	KEEP	---	---	---	---	10	7	17	29	-1	capture	Missense_Mutation	SNP	19642347	19642347	TMPRSS15	21	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16129	288
AIFM3	150209	broad.mit.edu	37	22	21332217	21332217	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21332217A>T	uc002ztj.2	+	16	1618	c.1400A>T	c.(1399-1401)GAT>GTT	p.D467V	AIFM3_uc002ztk.2_Missense_Mutation_p.D467V|AIFM3_uc002ztl.2_Missense_Mutation_p.D473V|AIFM3_uc011ahx.1_Missense_Mutation_p.D455V|AIFM3_uc002ztm.1_Missense_Mutation_p.D279V|LZTR1_uc002ztn.2_5'Flank	NM_144704	NP_653305	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor,	467		FAD (Potential).			activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GCAGCTGGCGATGCTGTCACC	0.582					733											0.25	35.126458	38.306012	14	42	KEEP	---	---	---	---	10	6	23	25	-1	capture	Missense_Mutation	SNP	21332217	21332217	AIFM3	22	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	428	288
UBP1	7342	broad.mit.edu	37	3	33454282	33454282	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:33454282T>C	uc003cfq.3	-	4	910	c.380A>G	c.(379-381)CAA>CGA	p.Q127R	UBP1_uc003cfr.3_Missense_Mutation_p.Q127R|UBP1_uc010hga.2_Missense_Mutation_p.Q127R	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a	127					negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						CTCTGTGTATTGTAGCCGTCT	0.438																0.032258	-29.651055	7.512059	5	150	KEEP	---	---	---	---	6	0	80	92	-1	capture	Missense_Mutation	SNP	33454282	33454282	UBP1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	16777	288
TMF1	7110	broad.mit.edu	37	3	69097485	69097485	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:69097485C>T	uc003dnn.2	-	2	618	c.371G>A	c.(370-372)CGA>CAA	p.R124Q	TMF1_uc011bfx.1_Missense_Mutation_p.R124Q	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	124					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TTCTTCTGGTCGTTGTGATTT	0.418																0.282468	210.888767	223.987634	87	221	KEEP	---	---	---	---	51	49	131	118	-1	capture	Missense_Mutation	SNP	69097485	69097485	TMF1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16111	288
IQCG	84223	broad.mit.edu	37	3	197616555	197616555	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:197616555G>A	uc003fyo.2	-	11	1374	c.1228C>T	c.(1228-1230)CGG>TGG	p.R410W	IQCG_uc003fyn.2_Missense_Mutation_p.R312W|IQCG_uc003fyp.2_Missense_Mutation_p.R410W|IQCG_uc003fym.2_Missense_Mutation_p.R111W	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	410	IQ.										0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		ATTTCTCTCCGTATCATAGTG	0.463																0.37037	131.107796	133.103668	50	85	KEEP	---	---	---	---	29	28	37	55	-1	capture	Missense_Mutation	SNP	197616555	197616555	IQCG	3	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	7733	288
NPFFR2	10886	broad.mit.edu	37	4	72897628	72897628	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:72897628T>A	uc003hgg.2	+	1	108	c.10T>A	c.(10-12)TTC>ATC	p.F4I	NPFFR2_uc010iig.1_5'UTR	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	4	Extracellular (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TATGAATAGCTTCTTCGGAAC	0.562																0.367647	62.948938	63.999102	25	43	KEEP	---	---	---	---	14	15	21	25	-1	capture	Missense_Mutation	SNP	72897628	72897628	NPFFR2	4	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	10485	288
ROPN1L	83853	broad.mit.edu	37	5	10461398	10461398	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:10461398T>G	uc003jex.3	+	4	791	c.520T>G	c.(520-522)TAC>GAC	p.Y174D		NM_031916	NP_114122	Q96C74	ROP1L_HUMAN	ropporin 1-like	174					ciliary or flagellar motility|signal transduction	cytoplasm|motile cilium	cAMP-dependent protein kinase regulator activity|protein binding			ovary(1)	1						CGTTTACCGCTACTTGGCCAG	0.527																0.32	131.150811	135.467768	48	102	KEEP	---	---	---	---	23	34	55	57	-1	capture	Missense_Mutation	SNP	10461398	10461398	ROPN1L	5	T	G	G	G	1	0	0	0	0	1	0	0	0	689	53	4	4	13417	288
VCAN	1462	broad.mit.edu	37	5	82816676	82816676	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:82816676G>A	uc003kii.3	+	7	2907	c.2551G>A	c.(2551-2553)GCA>ACA	p.A851T	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Missense_Mutation_p.A851T|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	851	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		TGAAGATGGAGCAGATGAATT	0.408																0.37037	86.626168	87.823297	30	51	KEEP	---	---	---	---	14	17	25	28	-1	capture	Missense_Mutation	SNP	82816676	82816676	VCAN	5	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	17020	288
ADAMTS2	9509	broad.mit.edu	37	5	178555036	178555036	+	Silent	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:178555036G>A	uc003mjw.2	-	17	2541	c.2541C>T	c.(2539-2541)AAC>AAT	p.N847N		NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	847	Spacer.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CTTCCAGGACGTTGTTGTCGT	0.587					1974											0.323077	103.008201	106.619376	42	88	KEEP	---	---	---	---	16	30	53	47	-1	capture	Silent	SNP	178555036	178555036	ADAMTS2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	265	288
OR2B6	26212	broad.mit.edu	37	6	27925491	27925491	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27925491G>T	uc011dkx.1	+	1	473	c.473G>T	c.(472-474)TGG>TTG	p.W158L		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AACTCAGTGTGGTTGTCTACC	0.493																0.386207	151.261319	152.908231	56	89	KEEP	---	---	---	---	28	31	49	46	0.474576271186	capture	Missense_Mutation	SNP	27925491	27925491	OR2B6	6	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	10895	288
APOBEC2	10930	broad.mit.edu	37	6	41029317	41029317	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41029317T>C	uc003opl.2	+	2	529	c.382T>C	c.(382-384)TGT>CGT	p.C128R	UNC5CL_uc010jxe.1_Intron|APOBEC2_uc010jxf.2_RNA	NM_006789	NP_006780	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	128		Zinc; catalytic.			DNA demethylation|mRNA processing		cytidine deaminase activity|RNA binding|zinc ion binding				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTCCAGCCCCTGTGCAGCGTG	0.572	Ovarian(118;1320 2185 8096 29684)															0.019802	-44.155495	8.082065	4	198	KEEP	---	---	---	---	3	2	114	121	-1	capture	Missense_Mutation	SNP	41029317	41029317	APOBEC2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	781	288
PNLDC1	154197	broad.mit.edu	37	6	160240043	160240043	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160240043G>A	uc003qsx.1	+	17	1461	c.1290G>A	c.(1288-1290)TGG>TGA	p.W430*	PNLDC1_uc003qsy.1_Nonsense_Mutation_p.W441*	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	430	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TCAAAAGGTGGCCTGGGGTCA	0.463																0.327103	93.526796	96.344226	35	72	KEEP	---	---	---	---	19	22	28	51	-1	capture	Nonsense_Mutation	SNP	160240043	160240043	PNLDC1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	546	42	5	2	12051	288
PRPS1L1	221823	broad.mit.edu	37	7	18066638	18066638	+	Silent	SNP	T	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:18066638T>A	uc003stz.2	-	1	849	c.768A>T	c.(766-768)CCA>CCT	p.P256P		NM_175886	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like	256					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			ovary(1)	1	Lung NSC(10;0.0385)|all_lung(11;0.0736)					GAGAAATGGCTGGGCCAGAAA	0.448																0.26087	105.182282	113.512728	42	119	KEEP	---	---	---	---	28	20	54	74	-1	capture	Silent	SNP	18066638	18066638	PRPS1L1	7	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	12475	288
SAMD9	54809	broad.mit.edu	37	7	92730646	92730646	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92730646C>G	uc003umf.2	-	3	5021	c.4765G>C	c.(4765-4767)GTT>CTT	p.V1589L	SAMD9_uc003umg.2_Missense_Mutation_p.V1589L	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1589						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GGCTCTTAAACAATTTCAATG	0.378																0.258216	169.929	181.207868	55	158	KEEP	---	---	---	---	25	37	96	90	-1	capture	Missense_Mutation	SNP	92730646	92730646	SAMD9	7	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	13718	288
EGR3	1960	broad.mit.edu	37	8	22550311	22550311	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22550311C>T	uc003xcm.1	-	1	505	c.147G>A	c.(145-147)ATG>ATA	p.M49I	EGR3_uc011kzn.1_5'Flank|EGR3_uc011kzo.1_5'Flank	NM_004430	NP_004421	Q06889	EGR3_HUMAN	early growth response 3	49					circadian rhythm|muscle organ development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		TACCTGTAGCCATCTGATTGT	0.338																0.265306	33.952466	36.391815	13	36	KEEP	---	---	---	---	9	5	21	18	-1	capture	Missense_Mutation	SNP	22550311	22550311	EGR3	8	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	4928	288
CNGB3	54714	broad.mit.edu	37	8	87666239	87666239	+	Splice_Site	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:87666239C>T	uc003ydx.2	-	7	949	c.903_splice	c.e7+1	p.Q301_splice	CNGB3_uc010maj.2_Splice_Site_p.Q163_splice	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TTGTCACCTACCTGAAATTTT	0.294																0.142857	14.205869	22.809095	10	60	KEEP	---	---	---	---	4	7	31	42	-1	capture	Splice_Site	SNP	87666239	87666239	CNGB3	8	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	3566	288
RGS22	26166	broad.mit.edu	37	8	101065160	101065160	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:101065160G>A	uc003yjb.1	-	10	1754	c.1559C>T	c.(1558-1560)GCT>GTT	p.A520V	RGS22_uc003yja.1_Missense_Mutation_p.A339V|RGS22_uc003yjc.1_Missense_Mutation_p.A508V|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	520					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TTCAGCACTAGCATATTTTGT	0.393					790											0.020725	-43.264402	6.373298	4	189	KEEP	---	---	---	---	4	1	97	120	-1	capture	Missense_Mutation	SNP	101065160	101065160	RGS22	8	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	13197	288
DMRT3	58524	broad.mit.edu	37	9	990870	990870	+	Silent	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:990870C>T	uc003zgw.1	+	2	1322	c.1284C>T	c.(1282-1284)CGC>CGT	p.R428R		NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor	428					cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity	p.R428C(1)		ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		TTCCTGCCCGCGCCACGGAAG	0.552																0.553571	86.321736	86.461011	31	25	KEEP	---	---	---	---	15	19	13	16	-1	capture	Silent	SNP	990870	990870	DMRT3	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4545	288
GAPVD1	26130	broad.mit.edu	37	9	128092422	128092422	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:128092422G>A	uc010mwx.2	+	13	2424	c.2098G>A	c.(2098-2100)GAC>AAC	p.D700N	GAPVD1_uc011lzs.1_Missense_Mutation_p.D700N|GAPVD1_uc004bpp.2_Missense_Mutation_p.D700N|GAPVD1_uc004bpq.2_Missense_Mutation_p.D700N|GAPVD1_uc004bpr.2_Missense_Mutation_p.D679N|GAPVD1_uc004bps.2_Missense_Mutation_p.D700N|GAPVD1_uc010mwy.1_Missense_Mutation_p.D559N	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	700					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AGTGCTTCTTGACCCCTGCAC	0.478																0.353982	102.460384	104.586931	40	73	KEEP	---	---	---	---	28	18	38	40	-1	capture	Missense_Mutation	SNP	128092422	128092422	GAPVD1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	6179	288
PNPLA4	8228	broad.mit.edu	37	X	7870101	7870101	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:7870101G>A	uc011mhq.1	-	6	721	c.559C>T	c.(559-561)CGA>TGA	p.R187*	PNPLA4_uc011mhr.1_Nonsense_Mutation_p.R187*|PNPLA4_uc011mhs.1_Nonsense_Mutation_p.R100*	NM_004650	NP_004641	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	187					lipid catabolic process		triglyceride lipase activity				0		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				ATGTCCAGTCGTCCACTGAAG	0.512																0.386667	75.352007	76.197897	29	46	KEEP	---	---	---	---	17	15	26	28	-1	capture	Nonsense_Mutation	SNP	7870101	7870101	PNPLA4	23	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	12070	288
SMS	6611	broad.mit.edu	37	X	21995314	21995314	+	Silent	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:21995314G>A	uc004dag.2	+	5	566	c.465G>A	c.(463-465)TCG>TCA	p.S155S	SMS_uc011mjq.1_Silent_p.S59S|SMS_uc004daf.1_Silent_p.S102S|SMS_uc010nfs.2_5'Flank|SMS_uc010nft.2_5'Flank	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase	155					methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	TTCTACACTCGAAGCAGTTTG	0.433																0.296875	92.856482	97.54758	38	90	KEEP	---	---	---	---	22	20	60	42	-1	capture	Silent	SNP	21995314	21995314	SMS	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14705	288
MAOB	4129	broad.mit.edu	37	X	43628565	43628565	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:43628565C>G	uc004dfz.3	-	13	1512	c.1336G>C	c.(1336-1338)GCA>CCA	p.A446P	MAOB_uc011mkx.1_Missense_Mutation_p.S397T|MAOB_uc011mky.1_Missense_Mutation_p.A430P	NM_000898	NP_000889	P27338	AOFB_HUMAN	monoamine oxidase B	446	Cytoplasmic.				xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	electron carrier activity|primary amine oxidase activity			ovary(1)|central_nervous_system(1)	2					Amantadine(DB00915)|Bupropion(DB01156)|Carbidopa(DB00190)|Citalopram(DB00215)|Dopamine(DB00988)|Entacapone(DB00494)|Furazolidone(DB00614)|Ginkgo biloba(DB01381)|Ibuprofen(DB01050)|Imipramine(DB00458)|Iproniazid(DB04818)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Maprotiline(DB00934)|Meclizine(DB00737)|Moclobemide(DB01171)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Rasagiline(DB01367)|Selegiline(DB01037)|Tranylcypromine(DB00752)	TCTCGGGCTGCTCTCTCCCCG	0.572																0.22449	29.137224	32.629396	11	38	KEEP	---	---	---	---	4	8	19	24	-1	capture	Missense_Mutation	SNP	43628565	43628565	MAOB	23	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	9140	288
CFP	5199	broad.mit.edu	37	X	47486225	47486225	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47486225C>G	uc004dig.3	-	6	1013	c.887G>C	c.(886-888)TGT>TCT	p.C296S	CFP_uc004dih.2_Missense_Mutation_p.C296S|CFP_uc004dii.1_Missense_Mutation_p.C232S|CFP_uc010nhu.2_Missense_Mutation_p.C296S	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor	296	TSP type-1 4.				complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						ATCGCCAGCACAGAAGGGGCC	0.642																0.28125	27.062412	28.437851	9	23	KEEP	---	---	---	---	7	3	12	13	-1	capture	Missense_Mutation	SNP	47486225	47486225	CFP	23	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	3259	288
DGAT2L6	347516	broad.mit.edu	37	X	69421881	69421881	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69421881G>A	uc004dxx.1	+	5	711	c.614G>A	c.(613-615)CGT>CAT	p.R205H		NM_198512	NP_940914	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	205					lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)	1						CTCAAGCAGCGTAAAGGTTTT	0.547																0.292683	28.681006	30.260626	12	29	KEEP	---	---	---	---	9	3	15	15	-1	capture	Missense_Mutation	SNP	69421881	69421881	DGAT2L6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4417	288
ATP7A	538	broad.mit.edu	37	X	77296145	77296145	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77296145G>T	uc004ecx.3	+	19	3875	c.3715G>T	c.(3715-3717)GCT>TCT	p.A1239S		NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	1239	Cytoplasmic (Potential).				ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						AGCAGAACTGGCTATCCATAT	0.413																0.371585	180.607652	183.236351	68	115	KEEP	---	---	---	---	37	34	55	67	0.521126760563	capture	Missense_Mutation	SNP	77296145	77296145	ATP7A	23	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	1181	288
TMSB15A	11013	broad.mit.edu	37	X	101770022	101770022	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101770022C>T	uc004eje.2	-	2	193	c.70G>A	c.(70-72)GAA>AAA	p.E24K		NM_021992	NP_068832	P0CG34	TB15A_HUMAN	thymosin-like 8	24					actin cytoskeleton organization|sequestering of actin monomers	cytoplasm|cytoskeleton	actin binding				0						TTTTTTTCTTCAGTATTAGTT	0.368																0.375	122.090932	123.873216	48	80	KEEP	---	---	---	---	29	27	53	42	-1	capture	Missense_Mutation	SNP	101770022	101770022	TMSB15A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	16138	288
GPRASP2	114928	broad.mit.edu	37	X	101970131	101970131	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:101970131A>G	uc004ejk.2	+	4	1668	c.334A>G	c.(334-336)ACT>GCT	p.T112A	GPRASP2_uc004ejl.2_Missense_Mutation_p.T112A|GPRASP2_uc004ejm.2_Missense_Mutation_p.T112A|GPRASP2_uc011mrp.1_5'Flank	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	112						cytoplasm	protein binding			ovary(1)	1						TCGTTCTAAAACTGATGCCAA	0.572																0.335366	176.555521	180.498231	55	109	KEEP	---	---	---	---	31	32	46	74	-1	capture	Missense_Mutation	SNP	101970131	101970131	GPRASP2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	6656	288
RAB9B	51209	broad.mit.edu	37	X	103080388	103080388	+	Silent	SNP	C	T	T	rs142893082	byFrequency	TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103080388C>T	uc004ell.1	-	3	612	c.327G>A	c.(325-327)GCG>GCA	p.A109A	RAB9B_uc004eli.1_Intron	NM_016370	NP_057454	Q9NP90	RAB9B_HUMAN	RAB9B, member RAS oncogene family	109					Golgi to endosome transport|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			lung(3)	3						CCTTCACATCCGCATAGTAAA	0.488																0.360515	219.123636	223.118279	84	149	KEEP	---	---	---	---	39	50	87	75	-1	capture	Silent	SNP	103080388	103080388	RAB9B	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12854	288
SPTBN5	51332	broad.mit.edu	37	15	42164092	42164092	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42164092delA	uc001zos.2	-	28	5417	c.5084delT	c.(5083-5085)CTGfs	p.L1695fs		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1730	Spectrin 14.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		ATGCAGCCTCAGGGTCCCCTC	0.677																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	42164092	42164092	SPTBN5	15	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	15014	288
C16orf82	162083	broad.mit.edu	37	16	27078770	27078770	+	Frame_Shift_Del	DEL	G	-	-			TCGA-76-6664-01	TCGA-76-6664-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27078770delG	uc010vcm.1	+	1	552	c.454delG	c.(454-456)GGGfs	p.G152fs		NM_001145545	NP_001139017	Q7Z2V1	TNT_HUMAN	hypothetical protein LOC162083	215											0						GCAGACTGGAGGGAAAGAGTG	0.652																0.33			2	4		---	---	---	---						capture_indel	Frame_Shift_Del	DEL	27078770	27078770	C16orf82	16	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	1823	288
