Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918653C>T	uc009vos.1	-	6	853	c.-35_splice	c.e6+1		NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418													4	74	---	---	---	---	PASS
GPN2	54707	broad.mit.edu	37	1	27206046	27206046	+	3'UTR	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27206046C>T	uc001bnd.1	-	5						NM_018066	NP_060536	Q9H9Y4	GPN2_HUMAN	ATP binding domain 1 family, member B								GTP binding				0						GCTGAATATCCCCTTGCCAGC	0.587													3	29	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155640162	155640162	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155640162A>T	uc001fln.2	-	8	899	c.875T>A	c.(874-876)CTG>CAG	p.L292Q	YY1AP1_uc001flg.2_Missense_Mutation_p.L11Q|YY1AP1_uc010pgg.1_Missense_Mutation_p.L131Q|YY1AP1_uc010pgh.1_Missense_Mutation_p.L215Q|YY1AP1_uc010pgi.1_Missense_Mutation_p.L364Q|YY1AP1_uc001flh.2_Missense_Mutation_p.L364Q|YY1AP1_uc009wqt.2_Missense_Mutation_p.L215Q|YY1AP1_uc001flk.2_Missense_Mutation_p.L215Q|YY1AP1_uc001fll.2_Missense_Mutation_p.L226Q|YY1AP1_uc009wqv.2_Intron|YY1AP1_uc001flm.2_Missense_Mutation_p.L215Q|YY1AP1_uc001fli.2_Missense_Mutation_p.L226Q|YY1AP1_uc009wqu.2_Missense_Mutation_p.L59Q|YY1AP1_uc001flj.2_Missense_Mutation_p.L226Q|YY1AP1_uc009wqw.2_Missense_Mutation_p.L215Q|YY1AP1_uc001flo.2_Missense_Mutation_p.L160Q|YY1AP1_uc001flp.2_Missense_Mutation_p.L226Q|YY1AP1_uc010pgj.1_Missense_Mutation_p.L292Q|YY1AP1_uc009wqx.2_Missense_Mutation_p.L364Q|YY1AP1_uc010pgk.1_Intron	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	292					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CTTTGCCTTCAGGGAACACAC	0.453													73	213	---	---	---	---	PASS
RC3H1	149041	broad.mit.edu	37	1	173916576	173916576	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173916576A>G	uc001gju.3	-	14	2755	c.2668T>C	c.(2668-2670)TAT>CAT	p.Y890H	RC3H1_uc010pms.1_Missense_Mutation_p.Y890H|RC3H1_uc001gjv.2_Missense_Mutation_p.Y890H|RC3H1_uc010pmt.1_Missense_Mutation_p.Y890H	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin	890					cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GCACCCTGATATATAGTTTTG	0.468													5	277	---	---	---	---	PASS
ELK4	2005	broad.mit.edu	37	1	205592865	205592865	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205592865T>C	uc001hcy.1	-	2	1396	c.146A>G	c.(145-147)AAG>AGG	p.K49R	ELK4_uc001hcz.2_Missense_Mutation_p.K49R|SLC45A3_uc010prn.1_Missense_Mutation_p.K138R|SLC45A3_uc010pro.1_Missense_Mutation_p.K322R|SLC45A3_uc010prp.1_RNA|ELK4_uc010prq.1_RNA	NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	49	ETS.					cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			AGGCTTGTTCTTGCGAATCCC	0.448			T	SLC45A3	prostate								38	130	---	---	---	---	PASS
CD55	1604	broad.mit.edu	37	1	207498039	207498039	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207498039C>A	uc001hfq.3	+	3	716	c.422C>A	c.(421-423)CCA>CAA	p.P141Q	CD55_uc001hfp.3_Missense_Mutation_p.P141Q|CD55_uc001hfr.3_Missense_Mutation_p.P141Q|CD55_uc010psf.1_RNA|CD55_uc009xcf.2_Intron|CD55_uc009xce.2_Missense_Mutation_p.P141Q|CD55_uc009xcg.2_5'Flank	NM_000574	NP_000565	P08174	DAF_HUMAN	decay accelerating factor for complement isoform	141	Sushi 2.				complement activation, classical pathway|elevation of cytosolic calcium ion concentration|innate immune response|respiratory burst	anchored to membrane|extracellular region|integral to plasma membrane|membrane raft|soluble fraction	receptor activity			ovary(1)	1					Chloramphenicol(DB00446)	TCTCTATCACCAAAACTAACT	0.373													5	242	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215844374	215844374	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215844374G>A	uc001hku.1	-	64	14460	c.14073C>T	c.(14071-14073)AAC>AAT	p.N4691N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4691	Fibronectin type-III 32.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTGAGCTTCCGTTATAGATTA	0.363										HNSCC(13;0.011)			6	500	---	---	---	---	PASS
WDR26	80232	broad.mit.edu	37	1	224585925	224585925	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224585925C>T	uc001hop.3	-	12	1573	c.1207G>A	c.(1207-1209)GTT>ATT	p.V403I	WDR26_uc001hoq.3_Missense_Mutation_p.V387I|WDR26_uc010pvh.1_Missense_Mutation_p.V110I	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a	550	WD 4.					cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		CATAAATGAACTCCCTGCAGG	0.343													5	275	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234582585	234582585	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234582585T>C	uc001hwd.2	-	12	2098	c.2098A>G	c.(2098-2100)AAC>GAC	p.N700D		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	700					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CTGCATGTGTTCAACAGCTTC	0.443													6	230	---	---	---	---	PASS
OR2W3	343171	broad.mit.edu	37	1	248059095	248059095	+	Silent	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248059095G>T	uc001idp.1	+	3	476	c.207G>T	c.(205-207)CTG>CTT	p.L69L	OR2W3_uc010pzb.1_Silent_p.L69L	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTTCCTTCCTGGACCTCAGTT	0.577													14	55	---	---	---	---	PASS
SF3B14	51639	broad.mit.edu	37	2	24299166	24299166	+	5'UTR	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24299166G>T	uc002rev.2	-	1					LOC375190_uc002rew.2_5'Flank|SF3B14_uc010eyb.2_RNA	NM_016047	NP_057131	Q9Y3B4	PM14_HUMAN	splicing factor 3B, 14 kDa subunit						nuclear mRNA splicing, via spliceosome	nucleoplasm|U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGGCTTCGGGGGTTACACCGC	0.587													8	28	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25470497	25470497	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25470497C>T	uc002rgc.2	-	8	1234	c.977G>A	c.(976-978)CGC>CAC	p.R326H	DNMT3A_uc002rgd.2_Missense_Mutation_p.R326H|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.R137H	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	326	Interaction with DNMT1 and DNMT3B.|PWWP.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGACCCAGCGGGTGCCTTC	0.632			Mis|F|N|S		AML								35	146	---	---	---	---	PASS
CIB4	130106	broad.mit.edu	37	2	26806745	26806745	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26806745A>G	uc002rhm.2	-	5	379	c.350T>C	c.(349-351)ATT>ACT	p.I117T		NM_001029881	NP_001025052	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	117	EF-hand 2.|1 (Potential).						calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCTCATCAATGAAGCCATT	0.532													9	70	---	---	---	---	PASS
CEP68	23177	broad.mit.edu	37	2	65299148	65299148	+	Silent	SNP	T	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65299148T>G	uc002sdl.3	+	3	1132	c.918T>G	c.(916-918)ACT>ACG	p.T306T	CEP68_uc002sdj.2_Silent_p.T306T|CEP68_uc010yqb.1_Silent_p.T306T|CEP68_uc002sdk.3_Silent_p.T306T|CEP68_uc010yqc.1_Silent_p.T306T|CEP68_uc010yqd.1_Silent_p.T306T	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	306					centrosome organization	centrosome				skin(1)	1						TTGACTATACTTACCCACTGA	0.577													5	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	96568655	96568655	+	Intron	SNP	A	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96568655A>T	uc002sva.1	-						uc002suz.1_5'UTR|uc002svb.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		TTTTCTCCATACTTTTTTCCT	0.279													5	116	---	---	---	---	PASS
TMEM87B	84910	broad.mit.edu	37	2	112854863	112854863	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112854863C>A	uc002thm.2	+	13	1636	c.1267C>A	c.(1267-1269)CAA>AAA	p.Q423K		NM_032824	NP_116213	Q96K49	TM87B_HUMAN	transmembrane protein 87B precursor	423						integral to membrane					0						TGCAAAATGCCAATCAGTAAG	0.289													6	553	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141771195	141771195	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141771195C>A	uc002tvj.1	-	14	3282	c.2310G>T	c.(2308-2310)GAG>GAT	p.E770D	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	770	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCAATGTCACCTCACTTGTTA	0.378										TSP Lung(27;0.18)			6	356	---	---	---	---	PASS
ARHGAP15	55843	broad.mit.edu	37	2	144276895	144276895	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144276895G>A	uc002tvm.3	+	10	1038	c.887G>A	c.(886-888)TGG>TAG	p.W296*	ARHGAP15_uc002tvn.2_Nonsense_Mutation_p.W62*	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	296	Rho-GAP.				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		ACAGTTCCGTGGTTTGTAAAG	0.423													13	483	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098799	178098799	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098799T>G	uc002ulh.3	-	2	801	c.246A>C	c.(244-246)GAA>GAC	p.E82D	NFE2L2_uc002ulg.3_Missense_Mutation_p.E66D|NFE2L2_uc010zfa.1_Missense_Mutation_p.E66D|NFE2L2_uc002uli.3_Missense_Mutation_p.E66D|NFE2L2_uc010fra.2_Missense_Mutation_p.E66D|NFE2L2_uc010frb.2_Missense_Mutation_p.E66D	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	82					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTGGGAGAAATTCACCTGTCT	0.433			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			75	327	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179484778	179484778	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179484778C>T	uc010zfg.1	-	198	38886	c.38662G>A	c.(38662-38664)GAT>AAT	p.D12888N	TTN_uc010zfh.1_Missense_Mutation_p.D6583N|TTN_uc010zfi.1_Missense_Mutation_p.D6516N|TTN_uc010zfj.1_Missense_Mutation_p.D6391N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13815							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACACTCATCATCCAGCCTG	0.358													78	409	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179648513	179648513	+	Splice_Site	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179648513C>A	uc010zfg.1	-	17	3000	c.2776_splice	c.e17-1	p.V926_splice	TTN_uc010zfh.1_Splice_Site_p.V880_splice|TTN_uc010zfi.1_Splice_Site_p.V880_splice|TTN_uc010zfj.1_Splice_Site_p.V880_splice|TTN_uc002unb.2_Splice_Site_p.V926_splice	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTGTTACCTAGATTTTTA	0.318													5	254	---	---	---	---	PASS
C2orf88	84281	broad.mit.edu	37	2	191064624	191064624	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191064624C>G	uc002urq.2	+	3	417	c.38C>G	c.(37-39)CCT>CGT	p.P13R	C2orf88_uc002urr.2_Missense_Mutation_p.P13R|C2orf88_uc002urs.2_Missense_Mutation_p.P13R|C2orf88_uc002urt.2_Missense_Mutation_p.P13R	NM_001042521	NP_001035986	Q9BSF0	CB088_HUMAN	hypothetical protein LOC84281	13											0						TTCCCATTTCCTACCATATAT	0.433													41	150	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196753631	196753631	+	Silent	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196753631C>A	uc002utj.3	-	32	5222	c.5121G>T	c.(5119-5121)CTG>CTT	p.L1707L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1707	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TGTTGTCATCCAGCACAGTGT	0.403													5	220	---	---	---	---	PASS
SP140L	93349	broad.mit.edu	37	2	231226348	231226348	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231226348T>C	uc010fxm.1	+	5	550	c.459T>C	c.(457-459)TCT>TCC	p.S153S	SP140L_uc010fxn.1_Silent_p.S66S	NM_138402	NP_612411	Q9H930	LY10L_HUMAN	SP140 nuclear body protein-like	153						nucleus	DNA binding|metal ion binding			central_nervous_system(1)	1						ACAAATTGTCTTTCCAAGAAA	0.393													8	426	---	---	---	---	PASS
B3GNT7	93010	broad.mit.edu	37	2	232263303	232263303	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232263303G>C	uc002vrs.2	+	2	1053	c.873G>C	c.(871-873)AAG>AAC	p.K291N		NM_145236	NP_660279	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal	291	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TGTACGGCAAGGCCAGCTATC	0.647													4	27	---	---	---	---	PASS
ILKAP	80895	broad.mit.edu	37	2	239102922	239102922	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239102922C>T	uc002vxv.2	-	3	302	c.172G>A	c.(172-174)GAT>AAT	p.D58N	ILKAP_uc010zns.1_5'UTR|ILKAP_uc002vxw.2_5'UTR|ILKAP_uc010znt.1_5'UTR	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein	58						cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TTACCTGAATCGCCACTGCTA	0.393													36	167	---	---	---	---	PASS
DYNC1LI1	51143	broad.mit.edu	37	3	32587351	32587351	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32587351T>C	uc003cfb.3	-	3	415	c.327A>G	c.(325-327)GAA>GAG	p.E109E	DYNC1LI1_uc011axh.1_Intron	NM_016141	NP_057225	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain	109					cell division|interspecies interaction between organisms|mitosis|positive regulation of mitotic cell cycle spindle assembly checkpoint|transport	centrosome|condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|plasma membrane|spindle pole	ATP binding|motor activity			ovary(1)	1						CATCCCTGTCTTCATCATGCA	0.333													7	494	---	---	---	---	PASS
GLB1	2720	broad.mit.edu	37	3	33038793	33038793	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33038793G>A	uc003cfi.1	-	16	1895	c.1778C>T	c.(1777-1779)CCA>CTA	p.P593L	GLB1_uc003cfh.1_Missense_Mutation_p.P563L|GLB1_uc003cfj.1_Missense_Mutation_p.P462L|GLB1_uc011axk.1_Missense_Mutation_p.P641L	NM_000404	NP_000395	P16278	BGAL_HUMAN	galactosidase, beta 1 isoform a preproprotein	593					carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)				GCCCCGGGCTGGCCAATAGCG	0.587													7	29	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102157367	102157367	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102157367T>C	uc003dvs.1	+	9	918	c.36T>C	c.(34-36)ATT>ATC	p.I12I	ZPLD1_uc003dvt.1_Silent_p.I28I|ZPLD1_uc011bhg.1_Silent_p.I12I	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	12						integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TTCTAACAATTAGAGTGCTTC	0.433													85	270	---	---	---	---	PASS
UMPS	7372	broad.mit.edu	37	3	124457035	124457035	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124457035G>A	uc003ehl.3	+	3	1037	c.931G>A	c.(931-933)GAA>AAA	p.E311K	UMPS_uc003ehm.3_RNA|UMPS_uc011bka.1_Missense_Mutation_p.E133K|UMPS_uc011bkb.1_Missense_Mutation_p.E219K|UMPS_uc011bkc.1_Missense_Mutation_p.E133K|UMPS_uc003ehn.3_Missense_Mutation_p.E133K|UMPS_uc011bkd.1_Missense_Mutation_p.E133K	NM_000373	NP_000364	P11172	UMPS_HUMAN	uridine monophosphate synthase	311	OMPdecase.				'de novo' pyrimidine base biosynthetic process|'de novo' UMP biosynthetic process|pyrimidine nucleoside biosynthetic process	cytosol|nucleus	orotate phosphoribosyltransferase activity|orotidine-5'-phosphate decarboxylase activity			kidney(1)	1				GBM - Glioblastoma multiforme(114;0.146)		CTTGATATTTGAAGACCGGAA	0.318													24	141	---	---	---	---	PASS
RPN1	6184	broad.mit.edu	37	3	128350832	128350832	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128350832T>A	uc003ekr.1	-	4	878	c.802A>T	c.(802-804)AGA>TGA	p.R268*	RPN1_uc011bkq.1_Nonsense_Mutation_p.R96*	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor	268	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		TCTGGCTGTCTCTGGTAATCA	0.428			T	EVI1	AML								36	148	---	---	---	---	PASS
SKIL	6498	broad.mit.edu	37	3	170110164	170110164	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170110164A>C	uc003fgu.2	+	7	2726	c.2014A>C	c.(2014-2016)AAG>CAG	p.K672Q	SKIL_uc011bps.1_Missense_Mutation_p.K652Q|SKIL_uc003fgv.2_Missense_Mutation_p.K626Q|SKIL_uc003fgw.2_Missense_Mutation_p.K672Q	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	672	Potential.				cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AAAAGAGCTAAAGCTGCAAAT	0.388													62	220	---	---	---	---	PASS
SPATA16	83893	broad.mit.edu	37	3	172607280	172607280	+	3'UTR	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172607280C>T	uc003fin.3	-	11						NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TCCAGCTTCACAGTACTAGGT	0.443													5	154	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196388312	196388312	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196388312G>A	uc003fwv.2	+	3	1902	c.1798G>A	c.(1798-1800)GGG>AGG	p.G600R		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	600	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TGACTGCTGTGGGGTGGATGG	0.607													4	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	9241928	9241928	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9241928G>C	uc011bwo.1	+	1	1073	c.821G>C	c.(820-822)AGC>ACC	p.S274T						RecName: Full=Ubiquitin carboxyl-terminal hydrolase 17-like protein 2;          EC=3.1.2.15; AltName: Full=Ubiquitin thioesterase 17-like protein 2; AltName: Full=Ubiquitin-specific-processing protease 17-like protein 2; AltName: Full=Deubiquitinating enzyme 17-like protein 2; AltName: Full=Deubiquitinating protein 3;          Short=DUB-3;																		ACCGCCGCTAGCATCACTTCT	0.488													5	20	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83788377	83788377	+	Silent	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83788377A>G	uc003hnf.2	-	9	1139	c.975T>C	c.(973-975)GAT>GAC	p.D325D	SEC31A_uc003hne.2_Silent_p.D97D|SEC31A_uc011ccl.1_Silent_p.D325D|SEC31A_uc003hnl.2_Silent_p.D325D|SEC31A_uc003hng.2_Silent_p.D325D|SEC31A_uc003hnh.2_Silent_p.D325D|SEC31A_uc003hni.2_Silent_p.D325D|SEC31A_uc003hnj.2_Silent_p.D325D|SEC31A_uc011ccm.1_Silent_p.D320D|SEC31A_uc011ccn.1_Silent_p.D325D|SEC31A_uc003hnk.2_Silent_p.D325D|SEC31A_uc003hnm.2_Silent_p.D325D|SEC31A_uc003hnn.1_Silent_p.D325D|SEC31A_uc003hno.2_Silent_p.D325D	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	325	Interaction with SEC13.|WD 6.				COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				TGATACGCCCATCAAACGAAG	0.418													14	259	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95199614	95199614	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95199614A>G	uc003htc.3	+	17	2379	c.2124A>G	c.(2122-2124)ATA>ATG	p.I708M	SMARCAD1_uc003htb.3_Missense_Mutation_p.I708M|SMARCAD1_uc003htd.3_Missense_Mutation_p.I708M|SMARCAD1_uc010ila.2_Missense_Mutation_p.I571M|SMARCAD1_uc011cdw.1_Missense_Mutation_p.I278M	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	708					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AGGAGAGAATAGCACATGCAA	0.264													28	102	---	---	---	---	PASS
ABCE1	6059	broad.mit.edu	37	4	146042331	146042331	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146042331G>T	uc003ijx.2	+	12	1590	c.1150G>T	c.(1150-1152)GGT>TGT	p.G384C	ABCE1_uc003ijy.2_Missense_Mutation_p.G384C|ABCE1_uc010iot.2_RNA	NM_001040876	NP_001035809	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E, member 1	384	ABC transporter 2.|ATP 2 (Potential).				interspecies interaction between organisms|response to virus|RNA catabolic process	mitochondrion	ATP binding|ATPase activity|electron carrier activity|iron-sulfur cluster binding|ribonuclease inhibitor activity			skin(1)	1	all_hematologic(180;0.151)					GCCAGGAACGGGTAAAACGAC	0.348													6	374	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158142838	158142838	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158142838C>T	uc003ipm.3	+	2	567	c.108C>T	c.(106-108)GGC>GGT	p.G36G	GRIA2_uc011cit.1_5'UTR|GRIA2_uc003ipl.3_Silent_p.G36G|GRIA2_uc003ipk.3_5'UTR|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	36	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	TTCCTAGGGGCGCCGATCAAG	0.537													31	179	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169336909	169336909	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169336909T>C	uc003irq.3	-	21	2989	c.2768A>G	c.(2767-2769)AAG>AGG	p.K923R	DDX60L_uc003irr.1_Missense_Mutation_p.K923R|DDX60L_uc003irs.1_Missense_Mutation_p.K618R	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	923							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTCCATAATCTTGTCTGCCTG	0.303													6	226	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13737467	13737467	+	Silent	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13737467G>T	uc003jfd.2	-	66	11391	c.11349C>A	c.(11347-11349)GTC>GTA	p.V3783V	DNAH5_uc003jfc.2_Intron	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3783	Potential.|AAA 5 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TACTCAGCACGACAATGAGAC	0.448									Kartagener_syndrome				6	427	---	---	---	---	PASS
CARD6	84674	broad.mit.edu	37	5	40854485	40854485	+	Silent	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40854485C>A	uc003jmg.2	+	3	3126	c.3051C>A	c.(3049-3051)ACC>ACA	p.T1017T		NM_032587	NP_115976	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	1017					apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5						CATCCTCAACCAATCCTTCAC	0.502													4	97	---	---	---	---	PASS
AP3S1	1176	broad.mit.edu	37	5	115177762	115177762	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115177762A>C	uc003krl.2	+	1	144	c.28A>C	c.(28-30)AAC>CAC	p.N10H	AP3S1_uc003krk.2_5'UTR|AP3S1_uc003krm.2_Missense_Mutation_p.N10H|ATG12_uc003krh.2_5'Flank|ATG12_uc003kri.2_5'Flank|ATG12_uc003krj.2_5'Flank	NM_001284	NP_001275	Q92572	AP3S1_HUMAN	adaptor-related protein complex 3, sigma 1	10					insulin receptor signaling pathway|intracellular protein transport|vesicle-mediated transport	AP-type membrane coat adaptor complex|cytoplasmic vesicle membrane|Golgi apparatus|transport vesicle	protein binding|protein transporter activity				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;1.08e-07)|Epithelial(69;1.11e-06)|all cancers(49;5.2e-05)		AATCTTCAACAACCACGGGAA	0.692													7	27	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149499609	149499609	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149499609G>A	uc003lro.2	-	19	3133	c.2664C>T	c.(2662-2664)TCC>TCT	p.S888S	PDGFRB_uc010jhd.2_Silent_p.S727S	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	888	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGATCCCGAAGGACCACACGT	0.567			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								10	70	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154394675	154394675	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154394675G>T	uc010jih.1	+	1	1416	c.1256G>T	c.(1255-1257)AGG>ATG	p.R419M		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	419	Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATGTTGGAGAGGATCATTTTG	0.478													42	164	---	---	---	---	PASS
GCNT2	2651	broad.mit.edu	37	6	10529526	10529526	+	Silent	SNP	C	T	T	rs151060330		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10529526C>T	uc010joo.2	+	3	933	c.382C>T	c.(382-384)CTG>TTG	p.L128L	GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Silent_p.L127L|GCNT2_uc010jon.2_Silent_p.L127L	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,	128	Lumenal (Potential).					Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		CTGTGTGCACCTGGATCAGAA	0.478													24	58	---	---	---	---	PASS
MBOAT1	154141	broad.mit.edu	37	6	20152989	20152989	+	Silent	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20152989C>A	uc003ncx.1	-	2	316	c.111G>T	c.(109-111)GTG>GTT	p.V37V	MBOAT1_uc011dji.1_Intron	NM_001080480	NP_001073949	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain	37	Helical; (Potential).				phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			GCTGGCATACCACAAAATTCA	0.378													5	234	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24174990	24174990	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24174990G>T	uc003ndx.2	-	10	1701	c.1399C>A	c.(1399-1401)CAA>AAA	p.Q467K	DCDC2_uc003ndy.2_Missense_Mutation_p.Q467K|DCDC2_uc003ndw.2_Missense_Mutation_p.Q218K	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	467					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				TTGTTTTGTTGGTTGTTTTCA	0.368													8	698	---	---	---	---	PASS
GNMT	27232	broad.mit.edu	37	6	42931107	42931107	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42931107G>A	uc003otd.2	+	5	642	c.636G>A	c.(634-636)GTG>GTA	p.V212V	uc003ote.1_5'Flank	NM_018960	NP_061833	Q14749	GNMT_HUMAN	glycine N-methyltransferase	212					protein homotetramerization|protein modification process|S-adenosylmethionine metabolic process		folic acid binding|glycine binding|glycine N-methyltransferase activity				0	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	TGCTGATAGTGAACAACAAGG	0.592													12	36	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43491607	43491607	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43491607C>T	uc003ovp.2	-	32	3825	c.3614G>A	c.(3613-3615)TGA>TAA	p.*1205*	POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	1205					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AAGCTTGATTCAGGGTTCAAA	0.493													16	111	---	---	---	---	PASS
ZUFSP	221302	broad.mit.edu	37	6	116956957	116956957	+	3'UTR	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116956957T>C	uc003pxf.1	-	10						NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain							intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		AAACAAAGTATTGTTCTCAAT	0.308													5	162	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133846311	133846311	+	Silent	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133846311A>G	uc003qec.3	+	19	2216	c.1758A>G	c.(1756-1758)GAA>GAG	p.E586E	EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Silent_p.E563E|EYA4_uc011ecs.1_Silent_p.E592E|uc003qeg.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	586					anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GTTGCTTTGAACGAATAATGC	0.408													7	405	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152688149	152688149	+	Intron	SNP	T	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152688149T>G	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kja.1_Intron|SYNE1_uc003qov.2_Missense_Mutation_p.K470N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTATTTTATTTTATTTTTTG	0.373										HNSCC(10;0.0054)			3	7	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152688194	152688194	+	Intron	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152688194C>T	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kja.1_Intron|SYNE1_uc003qov.2_Silent_p.Q455Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGGAATTCTCTGGCATGTGC	0.438										HNSCC(10;0.0054)			6	13	---	---	---	---	PASS
C6orf70	55780	broad.mit.edu	37	6	170156904	170156904	+	Silent	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170156904G>T	uc003qxg.1	+	5	540	c.507G>T	c.(505-507)GTG>GTT	p.V169V	C6orf70_uc011ehb.1_Silent_p.V43V|C6orf70_uc003qxh.1_Silent_p.V169V|C6orf70_uc010kky.1_Silent_p.V43V	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780	169						integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		GTCAGTCTGTGGTAAGCTTGT	0.254													6	442	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	35009120	35009120	+	Silent	SNP	G	A	A	rs116030464	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35009120G>A	uc003tem.3	-	9	865	c.720C>T	c.(718-720)AGC>AGT	p.S240S		NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	240	Helical; (Potential).					integral to membrane					0						GTGCAATCAAGCTTCCTCTAT	0.358													4	213	---	---	---	---	PASS
PILRB	29990	broad.mit.edu	37	7	99950006	99950006	+	5'UTR	SNP	C	T	T	rs13246354	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99950006C>T	uc003uuk.2	+	7					PILRB_uc003uul.2_5'UTR|PILRB_uc003uum.1_RNA	NM_013440	NP_038468	Q9UKJ0	PILRB_HUMAN	paired immunoglobulin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCACAGGTGCCGGCCCTGCAG	0.647													4	18	---	---	---	---	PASS
MEPCE	56257	broad.mit.edu	37	7	100031142	100031142	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100031142T>A	uc003uuw.2	+	4	2148	c.2035T>A	c.(2035-2037)TAC>AAC	p.Y679N	MEPCE_uc003uuv.2_Missense_Mutation_p.Y210N	NM_019606	NP_062552	Q7L2J0	MEPCE_HUMAN	bin3, bicoid-interacting 3	679	Bin3-type SAM.						methyltransferase activity			upper_aerodigestive_tract(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCGTCCTGTGTACCTGTTCCA	0.587													17	94	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676555	100676555	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676555C>G	uc003uxp.1	+	3	1911	c.1858C>G	c.(1858-1860)CCA>GCA	p.P620A	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	620	Extracellular (Potential).|8.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAGCATGCCAACCTCAAC	0.478													6	158	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142498929	142498929	+	RNA	SNP	T	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142498929T>A	uc011ksh.1	+	3		c.308T>A			uc011ksi.1_RNA|uc003vzw.1_RNA|uc010loj.1_RNA|uc003wad.2_RNA|uc003wag.1_3'UTR|uc003wbe.3_RNA|uc003wbf.3_RNA|uc003wbg.3_RNA|uc003wbh.3_Missense_Mutation_p.L115H|uc003wbi.3_RNA|uc003wbj.3_RNA|uc003wbm.3_RNA|uc003wbn.3_RNA|uc010los.2_RNA					Homo sapiens mRNA for T-cell receptor beta chain, partial cds, clone:TCRVB.3.																		CAGCCCGCCCTCAATGACTCC	0.632													6	70	---	---	---	---	PASS
RPS20	6224	broad.mit.edu	37	8	56986629	56986629	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56986629G>A	uc003xsn.2	-	2	291	c.93C>T	c.(91-93)TCC>TCT	p.S31S	RPS20_uc003xsm.2_Silent_p.S31S|SNORD54_uc003xso.1_5'Flank|RPS20_uc011lea.1_RNA	NM_001023	NP_001014	P60866	RS20_HUMAN	ribosomal protein S20 isoform 2	31					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			CCTTTTCCAAGGATTTTACGT	0.488													21	97	---	---	---	---	PASS
TTPA	7274	broad.mit.edu	37	8	63985616	63985616	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63985616T>C	uc003xux.1	-	2	268	c.236A>G	c.(235-237)GAA>GGA	p.E79G		NM_000370	NP_000361	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	79					lipid metabolic process		transporter activity|vitamin E binding				0	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	TTCTGGACATTCTGCTCTCCA	0.373													6	371	---	---	---	---	PASS
FAM92A1	137392	broad.mit.edu	37	8	94717234	94717234	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94717234T>C	uc010maq.2	+	4	531	c.428T>C	c.(427-429)GTT>GCT	p.V143A	FAM92A1_uc003yfu.1_RNA|FAM92A1_uc003yfv.3_RNA	NM_145269	NP_660312	A1XBS5	F92A1_HUMAN	hypothetical protein LOC137392	143	Potential.										0	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GATCGACATGTTATTGTATCC	0.348													6	300	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101146127	101146127	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101146127C>A	uc003yjd.2	-	5	2743	c.2030G>T	c.(2029-2031)GGG>GTG	p.G677V	FBXO43_uc003yje.2_Missense_Mutation_p.G643V	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	677	IBR-type.				meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TTCTTCAGACCCATGATAAGC	0.458													7	481	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110598354	110598354	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110598354G>A	uc003ynj.3	-	4	628	c.465C>T	c.(463-465)GGC>GGT	p.G155G	SYBU_uc003yni.3_Silent_p.G152G|SYBU_uc003ynk.3_Silent_p.G36G|SYBU_uc010mco.2_Silent_p.G154G|SYBU_uc003ynl.3_Silent_p.G154G|SYBU_uc010mcp.2_Silent_p.G155G|SYBU_uc010mcq.2_Silent_p.G155G|SYBU_uc003yno.3_Silent_p.G36G|SYBU_uc010mcr.2_Silent_p.G155G|SYBU_uc003ynm.3_Silent_p.G154G|SYBU_uc003ynn.3_Silent_p.G154G|SYBU_uc010mcs.2_Silent_p.G36G|SYBU_uc010mct.2_Silent_p.G155G|SYBU_uc010mcu.2_Silent_p.G154G|SYBU_uc003ynp.3_Silent_p.G87G|SYBU_uc010mcv.2_Silent_p.G155G|SYBU_uc011lhw.1_Silent_p.G25G	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	155	Sufficient for interaction with KIF5B.|Ser-rich.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						CGGAAATGCTGCCTGTGCTGC	0.507													19	115	---	---	---	---	PASS
CBWD1	55871	broad.mit.edu	37	9	121206	121206	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121206A>G	uc003zga.3	-	15					CBWD1_uc010mgs.2_RNA|CBWD1_uc003zgb.3_3'UTR|CBWD1_uc003zgc.3_3'UTR|FOXD4_uc003zfz.2_5'Flank	NM_018491	NP_060961	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1 isoform 1								ATP binding|protein binding			ovary(1)	1	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TTTCATGTTCAGTATATGTAA	0.239													7	7	---	---	---	---	PASS
NPR2	4882	broad.mit.edu	37	9	35792438	35792438	+	Silent	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35792438A>G	uc003zyd.2	+	1	33	c.33A>G	c.(31-33)GCA>GCG	p.A11A	NPR2_uc010mlb.2_Silent_p.A11A	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	11					intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TGTTGGTGGCAGCCCTGGCAG	0.682													3	5	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84532917	84532917	+	3'UTR	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84532917C>T	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						GTCTTGTAGACGAAGCACTTT	0.463													3	15	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85622359	85622359	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85622359T>C	uc004amo.1	-	7	1282	c.1021A>G	c.(1021-1023)ATA>GTA	p.I341V		NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	341	Potential.				protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						TACTGGAGTATTTCAATTTGC	0.338													7	572	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	98774905	98774905	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98774905A>T	uc010msa.1	+	4	1892	c.1016A>T	c.(1015-1017)AAA>ATA	p.K339I	uc011lun.1_Intron					RecName: Full=Uncharacterized protein C9orf102;																		GAAACTAAGAAATCACCTGTT	0.368													29	90	---	---	---	---	PASS
SLC31A1	1317	broad.mit.edu	37	9	116019414	116019414	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116019414T>C	uc004bgu.2	+	3	337	c.151T>C	c.(151-153)TTT>CTT	p.F51L	FKBP15_uc010muu.1_Intron|SLC31A1_uc004bgv.3_Missense_Mutation_p.F51L	NM_001859	NP_001850	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporters),	51	Extracellular (Potential).					integral to plasma membrane	copper ion transmembrane transporter activity				0						CTACTTTGGCTTTAAGAATGT	0.403													10	731	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138713195	138713195	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138713195C>T	uc004cgr.3	-	11	3312	c.3312G>A	c.(3310-3312)CCG>CCA	p.P1104P	CAMSAP1_uc004cgq.3_Silent_p.P994P|CAMSAP1_uc010nbg.2_Silent_p.P826P	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	1104						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TCAGCTCCGCCGGCCTTCCGG	0.652													8	27	---	---	---	---	PASS
RBM17	84991	broad.mit.edu	37	10	6148173	6148173	+	Missense_Mutation	SNP	A	C	C	rs147926684	byFrequency	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6148173A>C	uc001ijb.2	+	5	703	c.477A>C	c.(475-477)GAA>GAC	p.E159D	RBM17_uc010qav.1_Missense_Mutation_p.E159D	NM_032905	NP_116294	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	159					mRNA processing|RNA splicing	spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						ATGAAGATGAAGATTATGAGC	0.368													10	407	---	---	---	---	PASS
LOC642826	642826	broad.mit.edu	37	10	47207813	47207813	+	RNA	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47207813T>C	uc001jei.2	-	12		c.1586A>G			uc009xnf.2_Missense_Mutation_p.H132R					Homo sapiens cDNA, FLJ99065.												0						TTTACTTACATGGTTTGTACA	0.294													24	240	---	---	---	---	PASS
ZDHHC16	84287	broad.mit.edu	37	10	99211881	99211881	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99211881C>T	uc001knj.2	+	4	627	c.278C>T	c.(277-279)TCC>TTC	p.S93F	ZDHHC16_uc001knp.2_Missense_Mutation_p.S93F|ZDHHC16_uc001knk.2_Missense_Mutation_p.S93F|ZDHHC16_uc001knl.2_Missense_Mutation_p.S93F|ZDHHC16_uc001knm.2_Intron|ZDHHC16_uc001knn.2_Missense_Mutation_p.S93F|ZDHHC16_uc010qow.1_Missense_Mutation_p.S93F|ZDHHC16_uc009xvq.2_RNA|ZDHHC16_uc001kno.2_Missense_Mutation_p.S93F|ZDHHC16_uc009xvr.2_Missense_Mutation_p.S93F	NM_198046	NP_932163	Q969W1	ZDH16_HUMAN	Abl-philin 2 isoform 1	93	Helical; (Potential).				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		CTGACAGGCTCCATTGTAGCT	0.547													20	102	---	---	---	---	PASS
CNNM1	26507	broad.mit.edu	37	10	101151315	101151315	+	3'UTR	SNP	G	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101151315G>C	uc001kpp.3	+	11					CNNM1_uc010qpi.1_3'UTR|CNNM1_uc009xwf.2_3'UTR|CNNM1_uc009xwg.2_3'UTR	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1						ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		AAATTCCAGAGCTTTGGGGGA	0.527													23	85	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105889954	105889954	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105889954T>C	uc001kxw.2	-	38	5057	c.4941A>G	c.(4939-4941)CTA>CTG	p.L1647L	C10orf79_uc009xxq.2_Silent_p.L926L	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1647											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		CTTCAGTCTGTAGTATTGAAA	0.328													8	680	---	---	---	---	PASS
IGF2	3481	broad.mit.edu	37	11	2154815	2154815	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2154815G>A	uc009yde.2	-	3	341	c.238C>T	c.(238-240)CTG>TTG	p.L80L	IGF2_uc001lvf.2_RNA|IGF2_uc001lvg.2_Silent_p.L80L|IGF2_uc009ydf.2_Silent_p.L136L|IGF2_uc001lvh.2_Silent_p.L80L|INS-IGF2_uc001lvi.2_RNA	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1	80	A.				glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TACGTCTCCAGGAGGGCCAGG	0.657													4	15	---	---	---	---	PASS
NAP1L4	4676	broad.mit.edu	37	11	2973236	2973236	+	Intron	SNP	A	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2973236A>T	uc001lxc.2	-						NAP1L4_uc001lxb.2_RNA|NAP1L4_uc009ydt.2_Intron|NAP1L4_uc010qxm.1_Intron|NAP1L4_uc010qxn.1_Intron	NM_005969	NP_005960	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4						nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding			ovary(1)	1		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		CAGGAAATTGAAAGTCACGCA	0.552													7	15	---	---	---	---	PASS
ZNF214	7761	broad.mit.edu	37	11	7021869	7021869	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7021869G>T	uc001mfa.2	-	3	1348	c.1045C>A	c.(1045-1047)CAG>AAG	p.Q349K	ZNF214_uc010ray.1_Missense_Mutation_p.Q349K|ZNF214_uc009yfh.1_Missense_Mutation_p.Q349K	NM_013249	NP_037381	Q9UL59	ZN214_HUMAN	zinc finger protein 214	349	C2H2-type 3; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGAAGTCTCTGGTGAATGTGA	0.373													6	277	---	---	---	---	PASS
COPB1	1315	broad.mit.edu	37	11	14481761	14481761	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14481761G>T	uc001mli.2	-	20	2946	c.2639C>A	c.(2638-2640)CCA>CAA	p.P880Q	COPB1_uc001mlg.2_Missense_Mutation_p.P880Q|COPB1_uc001mlh.2_Missense_Mutation_p.P880Q	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	880					COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						TACCTTTTCTGGAGTCAGGCA	0.358													7	583	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18955816	18955816	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18955816C>T	uc001mpg.2	-	1	734	c.516G>A	c.(514-516)TGG>TGA	p.W172*		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	172	Extracellular (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						ATGTTTGACACCAAGCAGAAT	0.532													9	593	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22215007	22215007	+	5'UTR	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22215007C>T	uc001mqi.2	+	1					ANO5_uc001mqj.2_5'UTR	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						TGCTGCCTCTCAGGCACCAGT	0.612													13	39	---	---	---	---	PASS
CSTF3	1479	broad.mit.edu	37	11	33108666	33108666	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33108666C>T	uc001muh.2	-	18	1829	c.1663G>A	c.(1663-1665)GCA>ACA	p.A555T	TCP11L1_uc001muf.1_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1	555					mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						ATTATAGCTGCTAGCTTAGCA	0.423													60	241	---	---	---	---	PASS
EHF	26298	broad.mit.edu	37	11	34680130	34680130	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34680130C>A	uc001mvr.1	+	8	769	c.658C>A	c.(658-660)CCA>ACA	p.P220T	EHF_uc009yke.1_Missense_Mutation_p.P197T|EHF_uc009ykf.1_Missense_Mutation_p.P223T	NM_012153	NP_036285	Q9NZC4	EHF_HUMAN	ets homologous factor	220	ETS.				cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			CCTCTTGAACCCAGACAAGAA	0.463													6	128	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46401080	46401080	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46401080G>A	uc001ncn.1	+	31	3324	c.3199G>A	c.(3199-3201)GTG>ATG	p.V1067M	DGKZ_uc001nch.1_Missense_Mutation_p.V895M|DGKZ_uc001ncj.1_Missense_Mutation_p.V845M|DGKZ_uc010rgr.1_Missense_Mutation_p.V844M|DGKZ_uc001nck.1_Missense_Mutation_p.V657M|DGKZ_uc001ncl.2_Missense_Mutation_p.V879M|DGKZ_uc001ncm.2_Missense_Mutation_p.V878M|DGKZ_uc009yky.1_Missense_Mutation_p.V884M|DGKZ_uc010rgs.1_Missense_Mutation_p.V856M|MDK_uc009ykz.1_5'Flank|MDK_uc001nco.2_5'Flank|MDK_uc001ncp.2_5'Flank|MDK_uc009yla.2_5'Flank|MDK_uc009ylb.2_5'Flank|MDK_uc001ncq.2_5'Flank|MDK_uc001ncr.2_5'Flank|MDK_uc001ncs.2_5'Flank	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	1067	ANK 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCACTACATCGTGGAGGCCGG	0.662													4	5	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62744178	62744178	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62744178A>G	uc001nwk.2	-	10					SLC22A6_uc001nwl.2_3'UTR|SLC22A6_uc001nwj.2_3'UTR|SLC22A6_uc001nwm.2_3'UTR	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a						alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						TTGGGTCACCATTTCCTCTTC	0.532													24	103	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62760889	62760889	+	Intron	SNP	G	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62760889G>C	uc001nwo.2	-						SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Silent_p.V512V|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Intron	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8						response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						CAGAGGCAGTGACTGACCAGT	0.617													15	40	---	---	---	---	PASS
TSGA10IP	254187	broad.mit.edu	37	11	65715544	65715544	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65715544C>T	uc001ogk.1	+	6	1108	c.1076C>T	c.(1075-1077)GCC>GTC	p.A359V	TSGA10IP_uc009yqw.1_Intron|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	359											0						AAGGCCTATGCCTCGGGATAC	0.582													12	34	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	69951865	69951865	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69951865T>C	uc001opj.2	+	5	1023	c.718T>C	c.(718-720)TTT>CTT	p.F240L	ANO1_uc001opk.1_Missense_Mutation_p.F212L|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_5'Flank	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	240	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						TAAGGATTCCTTTTTCGACAG	0.493													5	165	---	---	---	---	PASS
MMP10	4319	broad.mit.edu	37	11	102650035	102650035	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102650035T>C	uc001phg.1	-	3	427	c.405A>G	c.(403-405)AAA>AAG	p.K135K		NM_002425	NP_002416	P09238	MMP10_HUMAN	matrix metalloproteinase 10 preproprotein	135					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			kidney(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)		CTTTCAGAGCTTTCTCAATGG	0.408													7	449	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106681097	106681097	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106681097T>C	uc001pjg.1	-	5	1704	c.1314A>G	c.(1312-1314)CTA>CTG	p.L438L	GUCY1A2_uc010rvo.1_Silent_p.L459L|GUCY1A2_uc009yxn.1_Silent_p.L438L	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	438					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		CTGAGAGATGTAGCCCTCGGC	0.448													5	180	---	---	---	---	PASS
NPAT	4863	broad.mit.edu	37	11	108044478	108044478	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108044478T>C	uc001pjz.3	-	13	1335	c.1233A>G	c.(1231-1233)GAA>GAG	p.E411E	NPAT_uc001pka.2_Silent_p.E206E	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	411					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TTTCCTGGTCTTCTTGTCTAA	0.398													6	283	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11506582	11506582	+	Splice_Site	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11506582C>T	uc001qzw.1	-	3	490	c.453_splice	c.e3+1	p.P151_splice	PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1							extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGGAGGAGATCAGGGACTTCG	0.607													9	56	---	---	---	---	PASS
NCKAP5L	57701	broad.mit.edu	37	12	50190216	50190216	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50190216A>C	uc009zlk.2	-	8	1629	c.1427T>G	c.(1426-1428)CTC>CGC	p.L476R	NCKAP5L_uc001rvc.3_5'Flank|NCKAP5L_uc001rvb.2_Missense_Mutation_p.L69R	NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	472	Pro-rich.									central_nervous_system(1)	1						CTGGGGACTGAGCTGCGGGCC	0.652													8	13	---	---	---	---	PASS
CBX5	23468	broad.mit.edu	37	12	54645923	54645923	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54645923C>A	uc001sfh.3	-	3	544	c.226G>T	c.(226-228)GGT>TGT	p.G76C	CBX5_uc001sfk.3_Missense_Mutation_p.G76C|CBX5_uc001sfi.3_Missense_Mutation_p.G76C|CBX5_uc001sfj.3_Missense_Mutation_p.G76C	NM_001127322	NP_001120794	P45973	CBX5_HUMAN	heterochromatin protein 1-alpha	76	Chromo 1.				blood coagulation|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|nuclear centromeric heterochromatin|nuclear envelope|nucleolus|transcriptional repressor complex	methylated histone residue binding|protein binding, bridging|repressing transcription factor binding				0						TTATTTTCACCCTCCTTCATC	0.373													6	390	---	---	---	---	PASS
KIAA0748	9840	broad.mit.edu	37	12	55357546	55357546	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55357546T>G	uc001sgn.3	-	8	745	c.635A>C	c.(634-636)GAC>GCC	p.D212A	KIAA0748_uc001sgl.3_Missense_Mutation_p.D74A|KIAA0748_uc001sgm.3_5'UTR|KIAA0748_uc010spb.1_Intron|KIAA0748_uc010spc.1_Missense_Mutation_p.D74A|KIAA0748_uc010spd.1_Missense_Mutation_p.D212A|KIAA0748_uc001sgo.3_Intron	NM_001098815	NP_001092285	A2RU30	K0748_HUMAN	hypothetical protein LOC9840	212										ovary(1)|central_nervous_system(1)	2						GAGGCAGGGGTCTTCCATTTC	0.547													9	103	---	---	---	---	PASS
IGF1	3479	broad.mit.edu	37	12	102811512	102811512	+	3'UTR	SNP	C	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102811512C>G	uc001tjp.3	-	4					IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						TCTTCATTTCCTCTATTGTAT	0.398													40	168	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	20978266	20978266	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20978266A>G	uc001une.2	-	8					CRYL1_uc001unf.2_3'UTR|CRYL1_uc001ung.2_3'UTR	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		ATTACAAGAAATTCACTGGGG	0.552													19	88	---	---	---	---	PASS
FLT1	2321	broad.mit.edu	37	13	28942736	28942736	+	Intron	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28942736C>T	uc001usb.3	-						FLT1_uc010aar.1_Silent_p.S727S	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	atgatgatgacgatgatgatg	0.124													10	322	---	---	---	---	PASS
VPS36	51028	broad.mit.edu	37	13	53008976	53008976	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53008976C>A	uc001vgs.2	-	5	427	c.393G>T	c.(391-393)TGG>TGT	p.W131C	VPS36_uc001vgq.2_Missense_Mutation_p.W73C	NM_016075	NP_057159	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36	131	GLUE C-terminal.				cellular membrane organization|endosome transport|protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|late endosome|membrane|nucleus	lipid binding			skin(1)	1		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		GCATATTCTCCCATCTTCTTT	0.343													8	665	---	---	---	---	PASS
ARG2	384	broad.mit.edu	37	14	68086727	68086727	+	Silent	SNP	C	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68086727C>G	uc001xjs.2	+	1	149	c.33C>G	c.(31-33)CTC>CTG	p.L11L		NM_001172	NP_001163	P78540	ARGI2_HUMAN	arginase 2 precursor	11					arginine metabolic process|nitric oxide biosynthetic process|urea cycle	mitochondrial matrix	arginase activity|metal ion binding				0				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	CGCGTCTCCTCCAGACGCGAG	0.617													4	12	---	---	---	---	PASS
DUOX1	53905	broad.mit.edu	37	15	45428753	45428753	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45428753A>G	uc001zus.1	+	10	1298	c.952A>G	c.(952-954)ATC>GTC	p.I318V	DUOX1_uc001zut.1_Missense_Mutation_p.I318V|DUOX1_uc010bee.1_5'UTR	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor	318	Peroxidase-like; mediates peroxidase activity.|Extracellular (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGACCCCAGCATCTCCTCAGA	0.582													35	109	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55912369	55912369	+	Silent	SNP	T	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55912369T>A	uc002adg.2	-	20	3342	c.3294A>T	c.(3292-3294)ACA>ACT	p.T1098T		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	1098					multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGAAGCTGGTTGTCTGACCTG	0.498													36	157	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72642868	72642868	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72642868A>C	uc002aun.3	-	7	1003	c.796T>G	c.(796-798)TGG>GGG	p.W266G	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Missense_Mutation_p.W277G|HEXA_uc002auo.3_Missense_Mutation_p.W129G|HEXA_uc010bix.2_Missense_Mutation_p.W266G|HEXA_uc010biy.2_Missense_Mutation_p.W129G|HEXA_uc010uko.1_Missense_Mutation_p.W92G|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	266					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						CCTGGTCCCCAGGACAAAGTG	0.537													30	99	---	---	---	---	PASS
LINS1	55180	broad.mit.edu	37	15	101109927	101109927	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101109927G>T	uc002bwe.2	-	8	2081	c.1790C>A	c.(1789-1791)CCC>CAC	p.P597H	LINS1_uc002bwd.2_Missense_Mutation_p.P184H|LINS1_uc002bwf.2_Missense_Mutation_p.P597H|LINS1_uc002bwg.2_Missense_Mutation_p.P597H|LINS1_uc002bwh.2_Missense_Mutation_p.P597H	NM_001040614	NP_001035704	Q8NG48	LINES_HUMAN	lines homolog 1	597											0	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TGGTTCAGAGGGAGCATCGGA	0.537													27	102	---	---	---	---	PASS
CORO1A	11151	broad.mit.edu	37	16	30198495	30198495	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30198495G>A	uc002dww.2	+	5	709	c.587G>A	c.(586-588)CGT>CAT	p.R196H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CORO1A_uc010vej.1_3'UTR|CORO1A_uc010bzq.2_Missense_Mutation_p.R196H|CORO1A_uc010bzr.2_Missense_Mutation_p.R196H|CORO1A_uc002dwx.2_Missense_Mutation_p.R90H|CORO1A_uc002dwy.1_Missense_Mutation_p.R40H|LOC606724_uc002dwz.1_5'Flank	NM_007074	NP_009005	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	196	WD 4.				cell-substrate adhesion|innate immune response|leukocyte chemotaxis|negative regulation of actin nucleation|phagolysosome assembly|positive chemotaxis|regulation of cell shape|uropod organization	actin filament|cortical actin cytoskeleton|lamellipodium|phagocytic cup|phagocytic vesicle membrane	actin filament binding|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein homodimerization activity				0						ACCTCCTGCCGTGACAAGCGC	0.587													5	53	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30507854	30507854	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30507854C>A	uc002dyi.3	+	15	1975	c.1799C>A	c.(1798-1800)GCT>GAT	p.A600D	ITGAL_uc002dyj.3_Missense_Mutation_p.A517D|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	600	FG-GAP 7.|Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	GCAGATGTGGCTGTGGGGGCT	0.527													40	166	---	---	---	---	PASS
TAT	6898	broad.mit.edu	37	16	71606188	71606188	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71606188A>G	uc002fap.2	-	6	706	c.607T>C	c.(607-609)TAT>CAT	p.Y203H		NM_000353	NP_000344	P17735	ATTY_HUMAN	tyrosine aminotransferase	203					2-oxoglutarate metabolic process|glutamate metabolic process|L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	1-aminocyclopropane-1-carboxylate synthase activity|L-tyrosine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(2)	2		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Glutamic Acid(DB00142)|L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Pyridoxal Phosphate(DB00114)	TCAATTAGATATTCCAGTTGT	0.413													5	277	---	---	---	---	PASS
ALOXE3	59344	broad.mit.edu	37	17	8020117	8020117	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8020117G>A	uc010cnr.2	-	3	699	c.329C>T	c.(328-330)ACC>ATC	p.T110I	ALOXE3_uc002gka.2_Missense_Mutation_p.T266I|ALOXE3_uc010vuo.1_Missense_Mutation_p.T242I|ALOXE3_uc010vup.1_RNA	NM_021628	NP_067641	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3 isoform 2	110	PLAT.				leukotriene biosynthetic process		iron ion binding|lipoxygenase activity			skin(3)|lung(1)|central_nervous_system(1)	5						CAGCTCCACGGTGCAGTAGCC	0.562													16	79	---	---	---	---	PASS
USP22	23326	broad.mit.edu	37	17	20921423	20921423	+	Silent	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20921423A>G	uc002gym.3	-	5	726	c.522T>C	c.(520-522)GGT>GGC	p.G174G	USP22_uc002gyn.3_Silent_p.G162G|USP22_uc002gyl.3_Silent_p.G69G	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	174					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						GCCCACGCAGACCTGGACACA	0.542													5	80	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35928997	35928997	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35928997C>A	uc002hoa.2	-	11	1460	c.1377G>T	c.(1375-1377)CAG>CAT	p.Q459H	SYNRG_uc010wde.1_Missense_Mutation_p.Q381H|SYNRG_uc010wdf.1_Missense_Mutation_p.Q381H|SYNRG_uc002hoc.2_Missense_Mutation_p.Q380H|SYNRG_uc002hoe.2_Missense_Mutation_p.Q381H|SYNRG_uc002hod.2_Missense_Mutation_p.Q381H|SYNRG_uc010wdg.1_Missense_Mutation_p.Q298H|SYNRG_uc002hob.2_Missense_Mutation_p.Q459H|SYNRG_uc002hof.2_Missense_Mutation_p.Q171H|SYNRG_uc010cvd.1_Missense_Mutation_p.Q259H|SYNRG_uc002hog.1_Missense_Mutation_p.Q593H	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	459	DFXDF motif 1.				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						CTTGAAAATCCTGGAAGTCAT	0.363													6	327	---	---	---	---	PASS
TBC1D3	729873	broad.mit.edu	37	17	36358864	36358864	+	5'Flank	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36358864T>C	uc010cvk.2	-						TBC1D3_uc010wdn.1_RNA	NM_001123391	NP_001116863	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTTTCCTTGTTCTGCTTTGCC	0.393													9	615	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38450740	38450740	+	Silent	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38450740A>G	uc002huj.1	+	7	1278	c.1068A>G	c.(1066-1068)CAA>CAG	p.Q356Q		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	356					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						CTATTTTGCAAGATCGACTTA	0.363													7	324	---	---	---	---	PASS
KRTAP4-4	84616	broad.mit.edu	37	17	39316569	39316569	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39316569G>T	uc002hwc.2	-	1	415	c.375C>A	c.(373-375)TAC>TAA	p.Y125*		NM_032524	NP_115913	Q9BYR3	KRA44_HUMAN	keratin associated protein 4.4	125	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGGACACACAGTAGCTGGGGC	0.667													6	12	---	---	---	---	PASS
FMNL1	752	broad.mit.edu	37	17	43311611	43311611	+	Intron	SNP	A	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43311611A>T	uc002iin.2	+						FMNL1_uc002iio.2_Missense_Mutation_p.S165C	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						CAGAGAATTCAGCCCCCACAC	0.607													4	19	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43596309	43596309	+	5'Flank	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43596309G>A	uc010wjq.1	-						uc010wjr.1_5'Flank|uc010wjs.1_5'Flank|uc010wjt.1_3'UTR					Homo sapiens cDNA FLJ10120 fis, clone HEMBA1002863.												0						TTTTTTCTTCGGCAGCGTTCT	0.577													5	28	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44117124	44117124	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44117124G>T	uc002ikb.2	-	7	2232	c.2147C>A	c.(2146-2148)CCA>CAA	p.P716Q	KIAA1267_uc002ikc.2_Missense_Mutation_p.P716Q|KIAA1267_uc002ikd.2_Missense_Mutation_p.P716Q|KIAA1267_uc010dav.2_Missense_Mutation_p.P716Q|KIAA1267_uc010wkb.1_Missense_Mutation_p.P47Q|KIAA1267_uc010wkc.1_Missense_Mutation_p.P47Q	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	716						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				AGCTGAATCTGGCAGACTGCC	0.502													5	253	---	---	---	---	PASS
ARL17A	51326	broad.mit.edu	37	17	44630898	44630898	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44630898A>G	uc002iks.2	-	4					LRRC37A2_uc002ikn.1_Intron|ARL17A_uc002iko.3_Intron|LRRC37A2_uc002ikq.1_Intron	NM_001113738	NP_001107210	Q8IVW1	ARL17_HUMAN	hypothetical protein LOC51326 isoform a						protein transport|vesicle-mediated transport	Golgi apparatus	GTP binding				0						gtgcaatgacacgatctcggc	0.085													5	97	---	---	---	---	PASS
NSF	4905	broad.mit.edu	37	17	44832693	44832693	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44832693A>G	uc002iku.2	+	20	2275	c.2171A>G	c.(2170-2172)TAC>TGC	p.Y724C	NSF_uc010wke.1_Missense_Mutation_p.Y630C|NSF_uc010wkf.1_Missense_Mutation_p.Y630C|NSF_uc010wkg.1_Missense_Mutation_p.Y719C	NM_006178	NP_006169	P46459	NSF_HUMAN	vesicle-fusing ATPase	724					protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		GATCCTGAATACCGTGTGAGA	0.403													7	353	---	---	---	---	PASS
MTMR4	9110	broad.mit.edu	37	17	56589825	56589825	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56589825C>T	uc002iwj.2	-	4	246	c.136G>A	c.(136-138)GGC>AGC	p.G46S	MTMR4_uc010dcx.1_Missense_Mutation_p.G60S	NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	46						cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTGCCCGGCCCAGGAACTCT	0.522													9	43	---	---	---	---	PASS
TTYH2	94015	broad.mit.edu	37	17	72209750	72209750	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72209750C>T	uc002jkc.2	+	1	55	c.24C>T	c.(22-24)TAC>TAT	p.Y8Y	TTYH2_uc010wqw.1_5'Flank|MGC16275_uc002jkb.2_5'Flank	NM_032646	NP_116035	Q9BSA4	TTYH2_HUMAN	tweety 2 isoform 1	8	Extracellular (Potential).					chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4						GCGTGGACTACATCGCTCCCT	0.637													3	13	---	---	---	---	PASS
SEC14L1	6397	broad.mit.edu	37	17	75212424	75212424	+	3'UTR	SNP	T	C	C	rs142751453	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75212424T>C	uc002jto.2	+	17					SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_3'UTR|SEC14L1_uc002jtm.2_3'UTR|SEC14L1_uc010wti.1_3'UTR	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						gtaggtagggttagtaggtag	0.000													4	11	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76451801	76451801	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76451801G>A	uc010dhp.1	-	8	1317	c.1095C>T	c.(1093-1095)TAC>TAT	p.Y365Y	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGTAGCCCACGTAGGACACGA	0.498													7	99	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6973150	6973150	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6973150G>T	uc002knm.2	-	47	6774	c.6680C>A	c.(6679-6681)CCA>CAA	p.P2227Q	LAMA1_uc010wzj.1_Missense_Mutation_p.P1703Q	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2227	Laminin G-like 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGTTTTTGTTGGTGACTTTTG	0.363													6	531	---	---	---	---	PASS
B4GALT6	9331	broad.mit.edu	37	18	29264391	29264391	+	5'UTR	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29264391T>C	uc002kwz.3	-	1					B4GALT6_uc010dma.2_5'UTR|B4GALT6_uc010dmb.2_5'UTR	NM_004775	NP_004766	Q9UBX8	B4GT6_HUMAN	beta-1,4-galactosyltransferase 6						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding				0			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			CACAGACATCTTCCTCTTCCC	0.562													5	158	---	---	---	---	PASS
ARHGEF18	23370	broad.mit.edu	37	19	7512019	7512019	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7512019C>T	uc002mgi.2	+	5	1391	c.1138C>T	c.(1138-1140)CTT>TTT	p.L380F	ARHGEF18_uc010xjm.1_Missense_Mutation_p.L222F|ARHGEF18_uc002mgh.2_Missense_Mutation_p.L222F|ARHGEF18_uc002mgj.1_Missense_Mutation_p.L23F	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18	380	DH.				actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				CAAGTTGCTGCTTCAGCAAAA	0.274													4	229	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38901590	38901590	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38901590C>A	uc002oir.2	-	16	2115	c.1901G>T	c.(1900-1902)GGG>GTG	p.G634V	RASGRP4_uc010efz.1_RNA|RASGRP4_uc010ega.1_RNA|RASGRP4_uc010xua.1_Missense_Mutation_p.G565V|RASGRP4_uc010xub.1_Missense_Mutation_p.G600V|RASGRP4_uc010xuc.1_Missense_Mutation_p.G542V|RASGRP4_uc010xud.1_Missense_Mutation_p.G537V|RASGRP4_uc010xue.1_Missense_Mutation_p.G445V|RASGRP4_uc010egb.2_Missense_Mutation_p.G620V	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	634					activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AAGCTGGCACCCAGTCTCAGG	0.572													5	191	---	---	---	---	PASS
RTN2	6253	broad.mit.edu	37	19	45996518	45996518	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45996518G>A	uc002pcb.2	-	5	1161	c.933C>T	c.(931-933)ACC>ACT	p.T311T	RTN2_uc002pcc.2_Intron|RTN2_uc002pcd.2_Intron	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	311						integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GAGTAGGGGGGGTGGGGCCCC	0.552													8	18	---	---	---	---	PASS
ZNF766	90321	broad.mit.edu	37	19	52785448	52785448	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52785448A>G	uc002pyr.1	+	2	146	c.103A>G	c.(103-105)AGG>GGG	p.R35G	ZNF766_uc002pys.1_Missense_Mutation_p.R35G|ZNF766_uc002pyt.1_Missense_Mutation_p.R50G	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN	zinc finger protein 766	35	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		GGCTTTATACAGGGATGTGAT	0.488													6	251	---	---	---	---	PASS
ATRN	8455	broad.mit.edu	37	20	3559357	3559357	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3559357A>G	uc002wim.2	+	15	2572	c.2482A>G	c.(2482-2484)ACC>GCC	p.T828A	ATRN_uc002wil.2_Missense_Mutation_p.T828A	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1	828	Extracellular (Potential).|C-type lectin.				inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						TTCTCTTACAACCCAGAAGAA	0.388													6	232	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10621809	10621809	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10621809G>A	uc002wnw.2	-	24	3516	c.3000C>T	c.(2998-3000)ATC>ATT	p.I1000I		NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	1000	Extracellular (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						GCTCGCAAGCGATGTAGATTG	0.398									Alagille_Syndrome				10	244	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29623182	29623182	+	5'Flank	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29623182G>A	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						CATAGCCATTGAAATGGATGA	0.378													6	405	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29623233	29623233	+	5'Flank	SNP	C	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29623233C>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TCTTTTTACCCTGGGAGCTCC	0.423													8	310	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25007058	25007058	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25007058A>T	uc003aan.1	+	5	497	c.10A>T	c.(10-12)AAG>TAG	p.K4*	GGT1_uc003aas.1_Nonsense_Mutation_p.K4*|GGT1_uc003aat.1_Nonsense_Mutation_p.K4*|GGT1_uc003aau.1_Nonsense_Mutation_p.K4*|GGT1_uc003aav.1_Nonsense_Mutation_p.K4*|GGT1_uc003aaw.1_Nonsense_Mutation_p.K4*|GGT1_uc003aax.1_Nonsense_Mutation_p.K4*	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	4	Cytoplasmic (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	CATGAAGAAGAAGTTAGTGGT	0.602													5	22	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32555106	32555106	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32555106G>A	uc003amd.2	-	1	138	c.97C>T	c.(97-99)CCT>TCT	p.P33S		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	33										ovary(1)|skin(1)	2						ACAGTCTCAGGAATCTCACAC	0.577													4	24	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32555121	32555121	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32555121G>A	uc003amd.2	-	1	123	c.82C>T	c.(82-84)CAT>TAT	p.H28Y		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	28										ovary(1)|skin(1)	2						TCACACTCATGGCAGGGTCCC	0.562													5	20	---	---	---	---	PASS
APOBEC3B	9582	broad.mit.edu	37	22	39387382	39387382	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39387382C>T	uc003awo.1	+	6	823	c.769C>T	c.(769-771)CGC>TGC	p.R257C	APOBEC3A_uc011aoc.1_Intron|APOBEC3B_uc003awp.1_Intron|APOBEC3B_uc003awq.1_RNA|APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aoe.1_Intron|APOBEC3D_uc011aof.1_Intron	NM_004900	NP_004891	Q9UH17	ABC3B_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	257					negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(58;0.04)					TGCGGAGCTGCGCTTCTTGGA	0.542													7	53	---	---	---	---	PASS
POLDIP3	84271	broad.mit.edu	37	22	42992339	42992339	+	Silent	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42992339G>T	uc003bcu.2	-	5	765	c.666C>A	c.(664-666)TCC>TCA	p.S222S	POLDIP3_uc011app.1_Silent_p.S143S|POLDIP3_uc003bcv.2_Silent_p.S193S|POLDIP3_uc011apq.1_Silent_p.S239S|POLDIP3_uc010gza.2_RNA|POLDIP3_uc011apr.1_RNA|POLDIP3_uc010gzb.1_Intron	NM_032311	NP_115687	Q9BY77	PDIP3_HUMAN	DNA polymerase delta interacting protein 3	222					positive regulation of translation	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding				0						GGAGGGCCTTGGACATGGAAA	0.498													39	170	---	---	---	---	PASS
DGKK	139189	broad.mit.edu	37	X	50125531	50125531	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50125531A>G	uc010njr.1	-	18	2680	c.2620T>C	c.(2620-2622)TTC>CTC	p.F874L		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	874					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)					CTGGTGTTGAAGTCCAGAGAA	0.393													9	679	---	---	---	---	PASS
PGK1	5230	broad.mit.edu	37	X	77381347	77381347	+	3'UTR	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77381347T>C	uc004ecz.3	+	11					PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_3'UTR	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						GCCTTTTAGTTCCTGTGCACA	0.438													6	261	---	---	---	---	PASS
PLS3	5358	broad.mit.edu	37	X	114883764	114883764	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114883764G>T	uc004eqd.2	+	16	2166	c.1776G>T	c.(1774-1776)ATG>ATT	p.M592I	PLS3_uc011mtf.1_Missense_Mutation_p.M579I|PLS3_uc004eqe.2_Missense_Mutation_p.M592I|PLS3_uc011mtg.1_Missense_Mutation_p.M565I|PLS3_uc011mth.1_Missense_Mutation_p.M547I|PLS3_uc011mti.1_Missense_Mutation_p.M268I|PLS3_uc011mtj.1_Missense_Mutation_p.M186I|PLS3_uc011mtk.1_Missense_Mutation_p.M253I|PLS3_uc011mtl.1_RNA	NM_005032	NP_005023	P13797	PLST_HUMAN	plastin 3	592	CH 4.|Actin-binding 2.					cytoplasm	actin binding|calcium ion binding			lung(1)|breast(1)	2						CAGTGTCAATGGCTAGAAGAA	0.423													5	190	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123839011	123839011	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123839011C>T	uc004euj.2	-	5	931	c.867G>A	c.(865-867)TCG>TCA	p.S289S	ODZ1_uc011muj.1_Silent_p.S289S|ODZ1_uc010nqy.2_Silent_p.S289S	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	289	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TGGGAGGGGGCGAGTACACGG	0.517													28	97	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2665	2665	+	5'Flank	SNP	T	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2665T>C	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		ctgtctcttacttttaaccag	0.114													333	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9630	9630	+	RNA	SNP	G	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9630G>A	uc011mfi.1	+	1		c.968G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TCGCATCAGGAGTATCAATCA	0.463													121	199	---	---	---	---	PASS
TNFRSF4	7293	broad.mit.edu	37	1	1149473	1149473	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1149473G>T	uc001ade.2	-	1	40	c.35C>A	c.(34-36)CCG>CAG	p.P12Q	TNFRSF4_uc001adf.2_5'UTR	NM_003327	NP_003318	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily,	12					immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGCCGCACACGGCCCGCGGCC	0.672													10	7	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22166039	22166039	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22166039G>C	uc001bfj.2	-	73	9754	c.9714C>G	c.(9712-9714)AGC>AGG	p.S3238R	HSPG2_uc009vqd.2_Missense_Mutation_p.S3239R	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3238	Ig-like C2-type 18.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGGGCGCGGGGCTGCCTGTGG	0.647													7	25	---	---	---	---	PASS
C1orf59	113802	broad.mit.edu	37	1	109202538	109202538	+	5'UTR	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109202538A>C	uc001dvt.3	-	2					C1orf59_uc001dvu.3_5'UTR|C1orf59_uc009wer.2_5'UTR	NM_001102592	NP_001096062	Q5T8I9	HENMT_HUMAN	hypothetical protein LOC113802						gene silencing by RNA|piRNA metabolic process	P granule	metal ion binding|O-methyltransferase activity|RNA binding|RNA methyltransferase activity				0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0152)|Lung(183;0.0895)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.163)		AACAAAAATGAAGATTTATCC	0.348													13	16	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155640162	155640162	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155640162A>T	uc001fln.2	-	8	899	c.875T>A	c.(874-876)CTG>CAG	p.L292Q	YY1AP1_uc001flg.2_Missense_Mutation_p.L11Q|YY1AP1_uc010pgg.1_Missense_Mutation_p.L131Q|YY1AP1_uc010pgh.1_Missense_Mutation_p.L215Q|YY1AP1_uc010pgi.1_Missense_Mutation_p.L364Q|YY1AP1_uc001flh.2_Missense_Mutation_p.L364Q|YY1AP1_uc009wqt.2_Missense_Mutation_p.L215Q|YY1AP1_uc001flk.2_Missense_Mutation_p.L215Q|YY1AP1_uc001fll.2_Missense_Mutation_p.L226Q|YY1AP1_uc009wqv.2_Intron|YY1AP1_uc001flm.2_Missense_Mutation_p.L215Q|YY1AP1_uc001fli.2_Missense_Mutation_p.L226Q|YY1AP1_uc009wqu.2_Missense_Mutation_p.L59Q|YY1AP1_uc001flj.2_Missense_Mutation_p.L226Q|YY1AP1_uc009wqw.2_Missense_Mutation_p.L215Q|YY1AP1_uc001flo.2_Missense_Mutation_p.L160Q|YY1AP1_uc001flp.2_Missense_Mutation_p.L226Q|YY1AP1_uc010pgj.1_Missense_Mutation_p.L292Q|YY1AP1_uc009wqx.2_Missense_Mutation_p.L364Q|YY1AP1_uc010pgk.1_Intron	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	292					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CTTTGCCTTCAGGGAACACAC	0.453													43	99	---	---	---	---	PASS
ELK4	2005	broad.mit.edu	37	1	205592865	205592865	+	Missense_Mutation	SNP	T	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205592865T>C	uc001hcy.1	-	2	1396	c.146A>G	c.(145-147)AAG>AGG	p.K49R	ELK4_uc001hcz.2_Missense_Mutation_p.K49R|SLC45A3_uc010prn.1_Missense_Mutation_p.K138R|SLC45A3_uc010pro.1_Missense_Mutation_p.K322R|SLC45A3_uc010prp.1_RNA|ELK4_uc010prq.1_RNA	NM_001973	NP_001964	P28324	ELK4_HUMAN	ELK4 protein isoform a	49	ETS.					cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity				0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			AGGCTTGTTCTTGCGAATCCC	0.448			T	SLC45A3	prostate								120	277	---	---	---	---	PASS
OR2W3	343171	broad.mit.edu	37	1	248059095	248059095	+	Silent	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248059095G>T	uc001idp.1	+	3	476	c.207G>T	c.(205-207)CTG>CTT	p.L69L	OR2W3_uc010pzb.1_Silent_p.L69L	NM_001001957	NP_001001957	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|pancreas(1)	3	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTTCCTTCCTGGACCTCAGTT	0.577													77	183	---	---	---	---	PASS
CIB4	130106	broad.mit.edu	37	2	26806745	26806745	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26806745A>G	uc002rhm.2	-	5	379	c.350T>C	c.(349-351)ATT>ACT	p.I117T		NM_001029881	NP_001025052	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	117	EF-hand 2.|1 (Potential).						calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCCTCATCAATGAAGCCATT	0.532													18	62	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28816933	28816933	+	Intron	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28816933C>T	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_3'UTR	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					CTTCACCTCCCCGCTTGCATG	0.448													8	26	---	---	---	---	PASS
SIX3	6496	broad.mit.edu	37	2	45171737	45171737	+	Silent	SNP	C	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45171737C>A	uc002run.1	+	2	1044	c.837C>A	c.(835-837)GGC>GGA	p.G279G		NM_005413	NP_005404	O95343	SIX3_HUMAN	SIX homeobox 3	279					visual perception	nucleus					0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GACCGAGCGGCATGCGCTCGC	0.756													8	10	---	---	---	---	PASS
CEP68	23177	broad.mit.edu	37	2	65299148	65299148	+	Silent	SNP	T	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65299148T>G	uc002sdl.3	+	3	1132	c.918T>G	c.(916-918)ACT>ACG	p.T306T	CEP68_uc002sdj.2_Silent_p.T306T|CEP68_uc010yqb.1_Silent_p.T306T|CEP68_uc002sdk.3_Silent_p.T306T|CEP68_uc010yqc.1_Silent_p.T306T|CEP68_uc010yqd.1_Silent_p.T306T	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	306					centrosome organization	centrosome				skin(1)	1						TTGACTATACTTACCCACTGA	0.577													61	195	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098799	178098799	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098799T>G	uc002ulh.3	-	2	801	c.246A>C	c.(244-246)GAA>GAC	p.E82D	NFE2L2_uc002ulg.3_Missense_Mutation_p.E66D|NFE2L2_uc010zfa.1_Missense_Mutation_p.E66D|NFE2L2_uc002uli.3_Missense_Mutation_p.E66D|NFE2L2_uc010fra.2_Missense_Mutation_p.E66D|NFE2L2_uc010frb.2_Missense_Mutation_p.E66D	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	82					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTGGGAGAAATTCACCTGTCT	0.433			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			32	96	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179484778	179484778	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179484778C>T	uc010zfg.1	-	198	38886	c.38662G>A	c.(38662-38664)GAT>AAT	p.D12888N	TTN_uc010zfh.1_Missense_Mutation_p.D6583N|TTN_uc010zfi.1_Missense_Mutation_p.D6516N|TTN_uc010zfj.1_Missense_Mutation_p.D6391N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13815							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACACTCATCATCCAGCCTG	0.358													37	83	---	---	---	---	PASS
C2orf88	84281	broad.mit.edu	37	2	191064624	191064624	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191064624C>G	uc002urq.2	+	3	417	c.38C>G	c.(37-39)CCT>CGT	p.P13R	C2orf88_uc002urr.2_Missense_Mutation_p.P13R|C2orf88_uc002urs.2_Missense_Mutation_p.P13R|C2orf88_uc002urt.2_Missense_Mutation_p.P13R	NM_001042521	NP_001035986	Q9BSF0	CB088_HUMAN	hypothetical protein LOC84281	13											0						TTCCCATTTCCTACCATATAT	0.433													57	140	---	---	---	---	PASS
B3GNT7	93010	broad.mit.edu	37	2	232263303	232263303	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232263303G>C	uc002vrs.2	+	2	1053	c.873G>C	c.(871-873)AAG>AAC	p.K291N		NM_145236	NP_660279	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal	291	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TGTACGGCAAGGCCAGCTATC	0.647													10	30	---	---	---	---	PASS
ILKAP	80895	broad.mit.edu	37	2	239102922	239102922	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239102922C>T	uc002vxv.2	-	3	302	c.172G>A	c.(172-174)GAT>AAT	p.D58N	ILKAP_uc010zns.1_5'UTR|ILKAP_uc002vxw.2_5'UTR|ILKAP_uc010znt.1_5'UTR	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein	58						cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TTACCTGAATCGCCACTGCTA	0.393													8	28	---	---	---	---	PASS
GLB1	2720	broad.mit.edu	37	3	33038793	33038793	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33038793G>A	uc003cfi.1	-	16	1895	c.1778C>T	c.(1777-1779)CCA>CTA	p.P593L	GLB1_uc003cfh.1_Missense_Mutation_p.P563L|GLB1_uc003cfj.1_Missense_Mutation_p.P462L|GLB1_uc011axk.1_Missense_Mutation_p.P641L	NM_000404	NP_000395	P16278	BGAL_HUMAN	galactosidase, beta 1 isoform a preproprotein	593					carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)				GCCCCGGGCTGGCCAATAGCG	0.587													10	69	---	---	---	---	PASS
FAM116A	201627	broad.mit.edu	37	3	57678761	57678761	+	5'UTR	SNP	C	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57678761C>A	uc003dja.2	-	1						NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627											pancreas(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)		GCCCCCTGACCGTTCGCGCCG	0.761													4	5	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102157367	102157367	+	Silent	SNP	T	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102157367T>C	uc003dvs.1	+	9	918	c.36T>C	c.(34-36)ATT>ATC	p.I12I	ZPLD1_uc003dvt.1_Silent_p.I28I|ZPLD1_uc011bhg.1_Silent_p.I12I	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	12						integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TTCTAACAATTAGAGTGCTTC	0.433													22	42	---	---	---	---	PASS
UMPS	7372	broad.mit.edu	37	3	124457035	124457035	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124457035G>A	uc003ehl.3	+	3	1037	c.931G>A	c.(931-933)GAA>AAA	p.E311K	UMPS_uc003ehm.3_RNA|UMPS_uc011bka.1_Missense_Mutation_p.E133K|UMPS_uc011bkb.1_Missense_Mutation_p.E219K|UMPS_uc011bkc.1_Missense_Mutation_p.E133K|UMPS_uc003ehn.3_Missense_Mutation_p.E133K|UMPS_uc011bkd.1_Missense_Mutation_p.E133K	NM_000373	NP_000364	P11172	UMPS_HUMAN	uridine monophosphate synthase	311	OMPdecase.				'de novo' pyrimidine base biosynthetic process|'de novo' UMP biosynthetic process|pyrimidine nucleoside biosynthetic process	cytosol|nucleus	orotate phosphoribosyltransferase activity|orotidine-5'-phosphate decarboxylase activity			kidney(1)	1				GBM - Glioblastoma multiforme(114;0.146)		CTTGATATTTGAAGACCGGAA	0.318													34	93	---	---	---	---	PASS
ABTB1	80325	broad.mit.edu	37	3	127399686	127399686	+	3'UTR	SNP	T	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127399686T>C	uc003ejt.2	+	12					ABTB1_uc003ejr.2_3'UTR|ABTB1_uc003ejs.2_3'UTR|ABTB1_uc003eju.2_3'UTR|ABTB1_uc010hsm.2_3'UTR	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1							cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0						TTCTCTAAGCTGGTGTTCCCA	0.567													9	10	---	---	---	---	PASS
RPN1	6184	broad.mit.edu	37	3	128350832	128350832	+	Nonsense_Mutation	SNP	T	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128350832T>A	uc003ekr.1	-	4	878	c.802A>T	c.(802-804)AGA>TGA	p.R268*	RPN1_uc011bkq.1_Nonsense_Mutation_p.R96*	NM_002950	NP_002941	P04843	RPN1_HUMAN	ribophorin I precursor	268	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|melanosome|oligosaccharyltransferase complex|rough microsome	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(114;0.189)		TCTGGCTGTCTCTGGTAATCA	0.428			T	EVI1	AML								61	126	---	---	---	---	PASS
FAM194A	131831	broad.mit.edu	37	3	150421731	150421731	+	5'UTR	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150421731C>T	uc003eyg.2	-	1					FAM194A_uc003eyh.2_5'UTR	NM_152394	NP_689607	Q7L0X2	F194A_HUMAN	hypothetical protein LOC131831											skin(2)|ovary(1)	3						GCCGCGGCCCCGGTCGGCTCT	0.687													11	44	---	---	---	---	PASS
SKIL	6498	broad.mit.edu	37	3	170110164	170110164	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170110164A>C	uc003fgu.2	+	7	2726	c.2014A>C	c.(2014-2016)AAG>CAG	p.K672Q	SKIL_uc011bps.1_Missense_Mutation_p.K652Q|SKIL_uc003fgv.2_Missense_Mutation_p.K626Q|SKIL_uc003fgw.2_Missense_Mutation_p.K672Q	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	672	Potential.				cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AAAAGAGCTAAAGCTGCAAAT	0.388													30	90	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196388312	196388312	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196388312G>A	uc003fwv.2	+	3	1902	c.1798G>A	c.(1798-1800)GGG>AGG	p.G600R		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	600	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TGACTGCTGTGGGGTGGATGG	0.607													58	145	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196388313	196388313	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196388313G>T	uc003fwv.2	+	3	1903	c.1799G>T	c.(1798-1800)GGG>GTG	p.G600V		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	600	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GACTGCTGTGGGGTGGATGGC	0.612													57	145	---	---	---	---	PASS
SEC31A	22872	broad.mit.edu	37	4	83788377	83788377	+	Silent	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83788377A>G	uc003hnf.2	-	9	1139	c.975T>C	c.(973-975)GAT>GAC	p.D325D	SEC31A_uc003hne.2_Silent_p.D97D|SEC31A_uc011ccl.1_Silent_p.D325D|SEC31A_uc003hnl.2_Silent_p.D325D|SEC31A_uc003hng.2_Silent_p.D325D|SEC31A_uc003hnh.2_Silent_p.D325D|SEC31A_uc003hni.2_Silent_p.D325D|SEC31A_uc003hnj.2_Silent_p.D325D|SEC31A_uc011ccm.1_Silent_p.D320D|SEC31A_uc011ccn.1_Silent_p.D325D|SEC31A_uc003hnk.2_Silent_p.D325D|SEC31A_uc003hnm.2_Silent_p.D325D|SEC31A_uc003hnn.1_Silent_p.D325D|SEC31A_uc003hno.2_Silent_p.D325D	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1	325	Interaction with SEC13.|WD 6.				COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				TGATACGCCCATCAAACGAAG	0.418													12	122	---	---	---	---	PASS
SMARCAD1	56916	broad.mit.edu	37	4	95199614	95199614	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95199614A>G	uc003htc.3	+	17	2379	c.2124A>G	c.(2122-2124)ATA>ATG	p.I708M	SMARCAD1_uc003htb.3_Missense_Mutation_p.I708M|SMARCAD1_uc003htd.3_Missense_Mutation_p.I708M|SMARCAD1_uc010ila.2_Missense_Mutation_p.I571M|SMARCAD1_uc011cdw.1_Missense_Mutation_p.I278M	NM_020159	NP_064544	Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated	708					chromatin modification|nucleotide metabolic process|positive regulation of transcription, DNA-dependent|protein homooligomerization|regulation of DNA recombination	nuclear matrix	ATP binding|DNA binding|helicase activity			skin(2)|ovary(1)|breast(1)	4				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		AGGAGAGAATAGCACATGCAA	0.264													27	56	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158142838	158142838	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158142838C>T	uc003ipm.3	+	2	567	c.108C>T	c.(106-108)GGC>GGT	p.G36G	GRIA2_uc011cit.1_5'UTR|GRIA2_uc003ipl.3_Silent_p.G36G|GRIA2_uc003ipk.3_5'UTR|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	36	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	TTCCTAGGGGCGCCGATCAAG	0.537													50	133	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21751731	21751731	+	3'UTR	SNP	G	T	T	rs145035915		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21751731G>T	uc010iuc.2	-	12					CDH12_uc011cno.1_3'UTR|CDH12_uc003jgk.2_3'UTR|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						gtgtgtgtgtgtgtgtgtgtt	0.239										HNSCC(59;0.17)			5	29	---	---	---	---	PASS
ARSB	411	broad.mit.edu	37	5	78076073	78076073	+	3'UTR	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78076073G>T	uc003kfq.2	-	8						NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor						lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		AAATGCATTAGGGGTTGAAAT	0.483													6	24	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149499609	149499609	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149499609G>A	uc003lro.2	-	19	3133	c.2664C>T	c.(2662-2664)TCC>TCT	p.S888S	PDGFRB_uc010jhd.2_Silent_p.S727S	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	888	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGATCCCGAAGGACCACACGT	0.567			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								25	88	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154394675	154394675	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154394675G>T	uc010jih.1	+	1	1416	c.1256G>T	c.(1255-1257)AGG>ATG	p.R419M		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	419	Potential.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATGTTGGAGAGGATCATTTTG	0.478													51	142	---	---	---	---	PASS
GCNT2	2651	broad.mit.edu	37	6	10529526	10529526	+	Silent	SNP	C	T	T	rs151060330		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10529526C>T	uc010joo.2	+	3	933	c.382C>T	c.(382-384)CTG>TTG	p.L128L	GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Silent_p.L127L|GCNT2_uc010jon.2_Silent_p.L127L	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,	128	Lumenal (Potential).					Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		CTGTGTGCACCTGGATCAGAA	0.478													49	123	---	---	---	---	PASS
ATXN1	6310	broad.mit.edu	37	6	16327452	16327452	+	Missense_Mutation	SNP	G	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16327452G>C	uc003nbt.2	-	8	2061	c.1090C>G	c.(1090-1092)CAC>GAC	p.H364D	ATXN1_uc010jpi.2_Missense_Mutation_p.H364D|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	364					cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				GGGCTCGGGTGGACCACCACG	0.687													56	182	---	---	---	---	PASS
GNMT	27232	broad.mit.edu	37	6	42931107	42931107	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42931107G>A	uc003otd.2	+	5	642	c.636G>A	c.(634-636)GTG>GTA	p.V212V	uc003ote.1_5'Flank	NM_018960	NP_061833	Q14749	GNMT_HUMAN	glycine N-methyltransferase	212					protein homotetramerization|protein modification process|S-adenosylmethionine metabolic process		folic acid binding|glycine binding|glycine N-methyltransferase activity				0	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	TGCTGATAGTGAACAACAAGG	0.592													13	33	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43491607	43491607	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43491607C>T	uc003ovp.2	-	32	3825	c.3614G>A	c.(3613-3615)TGA>TAA	p.*1205*	POLR1C_uc003ovo.1_Intron	NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	1205					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AAGCTTGATTCAGGGTTCAAA	0.493													47	123	---	---	---	---	PASS
TPD52L1	7164	broad.mit.edu	37	6	125584215	125584215	+	3'UTR	SNP	C	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125584215C>A	uc003pzu.1	+	7					TPD52L1_uc003pzv.1_3'UTR|TPD52L1_uc003pzw.1_3'UTR|TPD52L1_uc003pzy.1_3'UTR|TPD52L1_uc003pzz.1_3'UTR	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1						DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		AAAACCCAGGCCTTGACATTG	0.463													3	9	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152688149	152688149	+	Intron	SNP	T	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152688149T>G	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kja.1_Intron|SYNE1_uc003qov.2_Missense_Mutation_p.K470N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTTATTTTATTTTATTTTTTG	0.373										HNSCC(10;0.0054)			4	8	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152688194	152688194	+	Intron	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152688194C>T	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kja.1_Intron|SYNE1_uc003qov.2_Silent_p.Q455Q	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGGAATTCTCTGGCATGTGC	0.438										HNSCC(10;0.0054)			9	17	---	---	---	---	PASS
MEPCE	56257	broad.mit.edu	37	7	100031142	100031142	+	Missense_Mutation	SNP	T	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100031142T>A	uc003uuw.2	+	4	2148	c.2035T>A	c.(2035-2037)TAC>AAC	p.Y679N	MEPCE_uc003uuv.2_Missense_Mutation_p.Y210N	NM_019606	NP_062552	Q7L2J0	MEPCE_HUMAN	bin3, bicoid-interacting 3	679	Bin3-type SAM.						methyltransferase activity			upper_aerodigestive_tract(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCGTCCTGTGTACCTGTTCCA	0.587													22	54	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676555	100676555	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676555C>G	uc003uxp.1	+	3	1911	c.1858C>G	c.(1858-1860)CCA>GCA	p.P620A	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	620	Extracellular (Potential).|8.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAGCATGCCAACCTCAAC	0.478													38	437	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142498929	142498929	+	RNA	SNP	T	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142498929T>A	uc011ksh.1	+	3		c.308T>A			uc011ksi.1_RNA|uc003vzw.1_RNA|uc010loj.1_RNA|uc003wad.2_RNA|uc003wag.1_3'UTR|uc003wbe.3_RNA|uc003wbf.3_RNA|uc003wbg.3_RNA|uc003wbh.3_Missense_Mutation_p.L115H|uc003wbi.3_RNA|uc003wbj.3_RNA|uc003wbm.3_RNA|uc003wbn.3_RNA|uc010los.2_RNA					Homo sapiens mRNA for T-cell receptor beta chain, partial cds, clone:TCRVB.3.																		CAGCCCGCCCTCAATGACTCC	0.632													20	135	---	---	---	---	PASS
RPS20	6224	broad.mit.edu	37	8	56986629	56986629	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56986629G>A	uc003xsn.2	-	2	291	c.93C>T	c.(91-93)TCC>TCT	p.S31S	RPS20_uc003xsm.2_Silent_p.S31S|SNORD54_uc003xso.1_5'Flank|RPS20_uc011lea.1_RNA	NM_001023	NP_001014	P60866	RS20_HUMAN	ribosomal protein S20 isoform 2	31					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)			CCTTTTCCAAGGATTTTACGT	0.488													46	91	---	---	---	---	PASS
WWP1	11059	broad.mit.edu	37	8	87479162	87479162	+	3'UTR	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87479162A>C	uc003ydt.2	+	25						NM_007013	NP_008944	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase						central nervous system development|entry of virus into host cell|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|signal transduction	cytoplasm|nucleus|plasma membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			lung(1)|liver(1)	2						GCATTTAAATACCCCAGCCAA	0.373													20	121	---	---	---	---	PASS
SYBU	55638	broad.mit.edu	37	8	110598354	110598354	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110598354G>A	uc003ynj.3	-	4	628	c.465C>T	c.(463-465)GGC>GGT	p.G155G	SYBU_uc003yni.3_Silent_p.G152G|SYBU_uc003ynk.3_Silent_p.G36G|SYBU_uc010mco.2_Silent_p.G154G|SYBU_uc003ynl.3_Silent_p.G154G|SYBU_uc010mcp.2_Silent_p.G155G|SYBU_uc010mcq.2_Silent_p.G155G|SYBU_uc003yno.3_Silent_p.G36G|SYBU_uc010mcr.2_Silent_p.G155G|SYBU_uc003ynm.3_Silent_p.G154G|SYBU_uc003ynn.3_Silent_p.G154G|SYBU_uc010mcs.2_Silent_p.G36G|SYBU_uc010mct.2_Silent_p.G155G|SYBU_uc010mcu.2_Silent_p.G154G|SYBU_uc003ynp.3_Silent_p.G87G|SYBU_uc010mcv.2_Silent_p.G155G|SYBU_uc011lhw.1_Silent_p.G25G	NM_001099754	NP_001093224	Q9NX95	SYBU_HUMAN	Golgi-localized syntaphilin-related protein	155	Sufficient for interaction with KIF5B.|Ser-rich.					cytoplasmic membrane-bounded vesicle|cytoskeleton|Golgi membrane|integral to membrane				ovary(1)	1						CGGAAATGCTGCCTGTGCTGC	0.507													3	22	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143603455	143603455	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143603455C>A	uc003ywm.2	+	20	3337	c.3154C>A	c.(3154-3156)CGC>AGC	p.R1052S		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1052	Cytoplasmic (Potential).				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CATCCGCAAGCGCTTCCTCTG	0.657													3	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413573	68413573	+	RNA	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413573G>A	uc004aex.2	+	1		c.128G>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		CAGTGGCGCCGGATCTAGGAA	0.572													2	2	---	---	---	---	PASS
FLJ43950	347127	broad.mit.edu	37	9	84532917	84532917	+	3'UTR	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84532917C>T	uc011lst.1	+	4					uc004ame.2_5'Flank	NR_026851				SubName: Full=cDNA FLJ43950 fis, clone TESTI4015293, moderately similar to FAM75-like protein;												0						GTCTTGTAGACGAAGCACTTT	0.463													5	16	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	98774905	98774905	+	Missense_Mutation	SNP	A	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98774905A>T	uc010msa.1	+	4	1892	c.1016A>T	c.(1015-1017)AAA>ATA	p.K339I	uc011lun.1_Intron					RecName: Full=Uncharacterized protein C9orf102;																		GAAACTAAGAAATCACCTGTT	0.368													24	71	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138713195	138713195	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138713195C>T	uc004cgr.3	-	11	3312	c.3312G>A	c.(3310-3312)CCG>CCA	p.P1104P	CAMSAP1_uc004cgq.3_Silent_p.P994P|CAMSAP1_uc010nbg.2_Silent_p.P826P	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	1104						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TCAGCTCCGCCGGCCTTCCGG	0.652													20	79	---	---	---	---	PASS
ZDHHC16	84287	broad.mit.edu	37	10	99211881	99211881	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99211881C>T	uc001knj.2	+	4	627	c.278C>T	c.(277-279)TCC>TTC	p.S93F	ZDHHC16_uc001knp.2_Missense_Mutation_p.S93F|ZDHHC16_uc001knk.2_Missense_Mutation_p.S93F|ZDHHC16_uc001knl.2_Missense_Mutation_p.S93F|ZDHHC16_uc001knm.2_Intron|ZDHHC16_uc001knn.2_Missense_Mutation_p.S93F|ZDHHC16_uc010qow.1_Missense_Mutation_p.S93F|ZDHHC16_uc009xvq.2_RNA|ZDHHC16_uc001kno.2_Missense_Mutation_p.S93F|ZDHHC16_uc009xvr.2_Missense_Mutation_p.S93F	NM_198046	NP_932163	Q969W1	ZDH16_HUMAN	Abl-philin 2 isoform 1	93	Helical; (Potential).				apoptosis	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		CTGACAGGCTCCATTGTAGCT	0.547													24	57	---	---	---	---	PASS
CNNM1	26507	broad.mit.edu	37	10	101151315	101151315	+	3'UTR	SNP	G	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101151315G>C	uc001kpp.3	+	11					CNNM1_uc010qpi.1_3'UTR|CNNM1_uc009xwf.2_3'UTR|CNNM1_uc009xwg.2_3'UTR	NM_020348	NP_065081	Q9NRU3	CNNM1_HUMAN	cyclin M1						ion transport	integral to membrane|plasma membrane					0		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		AAATTCCAGAGCTTTGGGGGA	0.527													11	12	---	---	---	---	PASS
IGF2	3481	broad.mit.edu	37	11	2154815	2154815	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2154815G>A	uc009yde.2	-	3	341	c.238C>T	c.(238-240)CTG>TTG	p.L80L	IGF2_uc001lvf.2_RNA|IGF2_uc001lvg.2_Silent_p.L80L|IGF2_uc009ydf.2_Silent_p.L136L|IGF2_uc001lvh.2_Silent_p.L80L|INS-IGF2_uc001lvi.2_RNA	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1	80	A.				glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TACGTCTCCAGGAGGGCCAGG	0.657													11	27	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22215007	22215007	+	5'UTR	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22215007C>T	uc001mqi.2	+	1					ANO5_uc001mqj.2_5'UTR	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						TGCTGCCTCTCAGGCACCAGT	0.612													11	13	---	---	---	---	PASS
CSTF3	1479	broad.mit.edu	37	11	33108666	33108666	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33108666C>T	uc001muh.2	-	18	1829	c.1663G>A	c.(1663-1665)GCA>ACA	p.A555T	TCP11L1_uc001muf.1_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1	555					mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						ATTATAGCTGCTAGCTTAGCA	0.423													109	286	---	---	---	---	PASS
DGKZ	8525	broad.mit.edu	37	11	46401080	46401080	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46401080G>A	uc001ncn.1	+	31	3324	c.3199G>A	c.(3199-3201)GTG>ATG	p.V1067M	DGKZ_uc001nch.1_Missense_Mutation_p.V895M|DGKZ_uc001ncj.1_Missense_Mutation_p.V845M|DGKZ_uc010rgr.1_Missense_Mutation_p.V844M|DGKZ_uc001nck.1_Missense_Mutation_p.V657M|DGKZ_uc001ncl.2_Missense_Mutation_p.V879M|DGKZ_uc001ncm.2_Missense_Mutation_p.V878M|DGKZ_uc009yky.1_Missense_Mutation_p.V884M|DGKZ_uc010rgs.1_Missense_Mutation_p.V856M|MDK_uc009ykz.1_5'Flank|MDK_uc001nco.2_5'Flank|MDK_uc001ncp.2_5'Flank|MDK_uc009yla.2_5'Flank|MDK_uc009ylb.2_5'Flank|MDK_uc001ncq.2_5'Flank|MDK_uc001ncr.2_5'Flank|MDK_uc001ncs.2_5'Flank	NM_001105540	NP_001099010	Q13574	DGKZ_HUMAN	diacylglycerol kinase zeta isoform 4	1067	ANK 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell migration|intracellular signal transduction|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of mitotic cell cycle|platelet activation	cytoplasm|lamellipodium|nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|diacylglycerol kinase activity|lipid kinase activity|metal ion binding|protein binding|protein C-terminus binding			pancreas(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCACTACATCGTGGAGGCCGG	0.662													7	24	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62744178	62744178	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62744178A>G	uc001nwk.2	-	10					SLC22A6_uc001nwl.2_3'UTR|SLC22A6_uc001nwj.2_3'UTR|SLC22A6_uc001nwm.2_3'UTR	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a						alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						TTGGGTCACCATTTCCTCTTC	0.532													5	11	---	---	---	---	PASS
SLC22A8	9376	broad.mit.edu	37	11	62760889	62760889	+	Intron	SNP	G	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62760889G>C	uc001nwo.2	-						SLC22A8_uc001nwn.1_3'UTR|SLC22A8_uc001nwp.2_Silent_p.V512V|SLC22A8_uc009yom.2_Intron|SLC22A8_uc010rmm.1_Intron|SLC22A8_uc009yon.2_Intron	NM_004254	NP_004245	Q8TCC7	S22A8_HUMAN	solute carrier family 22 member 8						response to toxin	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|organic anion transmembrane transporter activity			skin(2)|ovary(1)	3						CAGAGGCAGTGACTGACCAGT	0.617													39	100	---	---	---	---	PASS
TSGA10IP	254187	broad.mit.edu	37	11	65715544	65715544	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65715544C>T	uc001ogk.1	+	6	1108	c.1076C>T	c.(1075-1077)GCC>GTC	p.A359V	TSGA10IP_uc009yqw.1_Intron|TSGA10IP_uc009yqx.1_Intron	NM_152762	NP_689975	Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein	359											0						AAGGCCTATGCCTCGGGATAC	0.582													5	9	---	---	---	---	PASS
GPR152	390212	broad.mit.edu	37	11	67220120	67220120	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67220120A>C	uc001olm.2	-	1	81	c.76T>G	c.(76-78)TAC>GAC	p.Y26D	uc009yrw.1_Intron|CABP4_uc001oln.2_Intron|CABP4_uc001olo.2_5'Flank	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	26	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			CCTTGGGGGTAGGAGTCCTCA	0.652													15	64	---	---	---	---	PASS
TBX10	347853	broad.mit.edu	37	11	67401787	67401787	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67401787T>G	uc001omp.2	-	4	510	c.422A>C	c.(421-423)GAC>GCC	p.D141A		NM_005995	NP_005986	O75333	TBX10_HUMAN	T-box 10	141	T-box.				anatomical structure morphogenesis|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTGGCTGGGTCTGCCTTGCC	0.642													4	39	---	---	---	---	PASS
NCKAP5L	57701	broad.mit.edu	37	12	50190216	50190216	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50190216A>C	uc009zlk.2	-	8	1629	c.1427T>G	c.(1426-1428)CTC>CGC	p.L476R	NCKAP5L_uc001rvc.3_5'Flank|NCKAP5L_uc001rvb.2_Missense_Mutation_p.L69R	NM_001037806	NP_001032895	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	472	Pro-rich.									central_nervous_system(1)	1						CTGGGGACTGAGCTGCGGGCC	0.652													13	24	---	---	---	---	PASS
RDH5	5959	broad.mit.edu	37	12	56118392	56118392	+	3'UTR	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56118392A>C	uc001shk.2	+	5					RDH5_uc001shl.2_3'UTR	NM_002905	NP_002896	Q92781	RDH1_HUMAN	retinol dehydrogenase 5 (11-cis and 9-cis)						response to stimulus|visual perception	membrane	binding|retinol dehydrogenase activity			ovary(1)	1					NADH(DB00157)|Vitamin A(DB00162)	TTCTGCCCCCACCCTGGTACT	0.468											OREG0021908	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	21	---	---	---	---	PASS
IGF1	3479	broad.mit.edu	37	12	102811512	102811512	+	3'UTR	SNP	C	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102811512C>G	uc001tjp.3	-	4					IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						TCTTCATTTCCTCTATTGTAT	0.398													43	95	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	20978266	20978266	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20978266A>G	uc001une.2	-	8					CRYL1_uc001unf.2_3'UTR|CRYL1_uc001ung.2_3'UTR	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		ATTACAAGAAATTCACTGGGG	0.552													45	104	---	---	---	---	PASS
HNRNPC	3183	broad.mit.edu	37	14	21679266	21679266	+	3'UTR	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21679266G>A	uc001vzy.2	-	9					HNRNPC_uc001vzw.2_3'UTR|HNRNPC_uc001wad.2_3'UTR|HNRNPC_uc001vzx.2_RNA|HNRNPC_uc001vzz.2_3'UTR|HNRNPC_uc001waa.2_3'UTR|HNRNPC_uc010ail.2_3'UTR|HNRNPC_uc010tlq.1_RNA|HNRNPC_uc001wab.2_3'UTR|HNRNPC_uc001wac.2_3'UTR|HNRNPC_uc010tlr.1_3'UTR|HNRNPC_uc001waf.2_3'UTR|HNRNPC_uc001wae.2_3'UTR	NM_031314	NP_112604	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C							catalytic step 2 spliceosome|nucleoplasm	identical protein binding|nucleotide binding|RNA binding				0	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		AGGATGGGGAGAACAGTGAGC	0.418													3	44	---	---	---	---	PASS
ARG2	384	broad.mit.edu	37	14	68086727	68086727	+	Silent	SNP	C	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68086727C>G	uc001xjs.2	+	1	149	c.33C>G	c.(31-33)CTC>CTG	p.L11L		NM_001172	NP_001163	P78540	ARGI2_HUMAN	arginase 2 precursor	11					arginine metabolic process|nitric oxide biosynthetic process|urea cycle	mitochondrial matrix	arginase activity|metal ion binding				0				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	CGCGTCTCCTCCAGACGCGAG	0.617													3	23	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30025494	30025494	+	Missense_Mutation	SNP	C	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30025494C>G	uc001zcr.2	-	13	2015	c.1540G>C	c.(1540-1542)GAT>CAT	p.D514H	TJP1_uc010azl.2_Missense_Mutation_p.D502H|TJP1_uc001zcq.2_Missense_Mutation_p.D518H|TJP1_uc001zcs.2_Missense_Mutation_p.D514H	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	514					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TCTCCTACATCTGATTCTACA	0.323													3	57	---	---	---	---	PASS
DUOX1	53905	broad.mit.edu	37	15	45428753	45428753	+	Missense_Mutation	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45428753A>G	uc001zus.1	+	10	1298	c.952A>G	c.(952-954)ATC>GTC	p.I318V	DUOX1_uc001zut.1_Missense_Mutation_p.I318V|DUOX1_uc010bee.1_5'UTR	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor	318	Peroxidase-like; mediates peroxidase activity.|Extracellular (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GGACCCCAGCATCTCCTCAGA	0.582													60	106	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55912369	55912369	+	Silent	SNP	T	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55912369T>A	uc002adg.2	-	20	3342	c.3294A>T	c.(3292-3294)ACA>ACT	p.T1098T		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	1098					multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGAAGCTGGTTGTCTGACCTG	0.498													56	132	---	---	---	---	PASS
HEXA	3073	broad.mit.edu	37	15	72642868	72642868	+	Missense_Mutation	SNP	A	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72642868A>C	uc002aun.3	-	7	1003	c.796T>G	c.(796-798)TGG>GGG	p.W266G	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Missense_Mutation_p.W277G|HEXA_uc002auo.3_Missense_Mutation_p.W129G|HEXA_uc010bix.2_Missense_Mutation_p.W266G|HEXA_uc010biy.2_Missense_Mutation_p.W129G|HEXA_uc010uko.1_Missense_Mutation_p.W92G|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	266					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4						CCTGGTCCCCAGGACAAAGTG	0.537													45	125	---	---	---	---	PASS
LINS1	55180	broad.mit.edu	37	15	101109927	101109927	+	Missense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101109927G>T	uc002bwe.2	-	8	2081	c.1790C>A	c.(1789-1791)CCC>CAC	p.P597H	LINS1_uc002bwd.2_Missense_Mutation_p.P184H|LINS1_uc002bwf.2_Missense_Mutation_p.P597H|LINS1_uc002bwg.2_Missense_Mutation_p.P597H|LINS1_uc002bwh.2_Missense_Mutation_p.P597H	NM_001040614	NP_001035704	Q8NG48	LINES_HUMAN	lines homolog 1	597											0	Lung NSC(78;0.0018)|all_lung(78;0.00223)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00095)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			TGGTTCAGAGGGAGCATCGGA	0.537													38	95	---	---	---	---	PASS
UBN1	29855	broad.mit.edu	37	16	4924268	4924268	+	Silent	SNP	C	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4924268C>A	uc002cyb.2	+	15	2196	c.1857C>A	c.(1855-1857)GGC>GGA	p.G619G	UBN1_uc010uxw.1_Silent_p.G619G|UBN1_uc002cyc.2_Silent_p.G619G	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	619					chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						AGATTGGTGGCCCCATTGCTT	0.512													15	469	---	---	---	---	PASS
CORO1A	11151	broad.mit.edu	37	16	30198495	30198495	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30198495G>A	uc002dww.2	+	5	709	c.587G>A	c.(586-588)CGT>CAT	p.R196H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|CORO1A_uc010vej.1_3'UTR|CORO1A_uc010bzq.2_Missense_Mutation_p.R196H|CORO1A_uc010bzr.2_Missense_Mutation_p.R196H|CORO1A_uc002dwx.2_Missense_Mutation_p.R90H|CORO1A_uc002dwy.1_Missense_Mutation_p.R40H|LOC606724_uc002dwz.1_5'Flank	NM_007074	NP_009005	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	196	WD 4.				cell-substrate adhesion|innate immune response|leukocyte chemotaxis|negative regulation of actin nucleation|phagolysosome assembly|positive chemotaxis|regulation of cell shape|uropod organization	actin filament|cortical actin cytoskeleton|lamellipodium|phagocytic cup|phagocytic vesicle membrane	actin filament binding|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein homodimerization activity				0						ACCTCCTGCCGTGACAAGCGC	0.587													17	85	---	---	---	---	PASS
ITGAL	3683	broad.mit.edu	37	16	30507854	30507854	+	Missense_Mutation	SNP	C	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30507854C>A	uc002dyi.3	+	15	1975	c.1799C>A	c.(1798-1800)GCT>GAT	p.A600D	ITGAL_uc002dyj.3_Missense_Mutation_p.A517D|ITGAL_uc010vev.1_Intron	NM_002209	NP_002200	P20701	ITAL_HUMAN	integrin alpha L isoform a precursor	600	FG-GAP 7.|Extracellular (Potential).				blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|lung(3)|central_nervous_system(3)|breast(1)	10					Efalizumab(DB00095)	GCAGATGTGGCTGTGGGGGCT	0.527													38	126	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	90161666	90161666	+	3'UTR	SNP	G	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90161666G>C	uc002fqp.2	+	3					uc002fqq.2_3'UTR					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																		AGGGTTTCCAGCTGACCCACT	0.572													5	45	---	---	---	---	PASS
ALOXE3	59344	broad.mit.edu	37	17	8020117	8020117	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8020117G>A	uc010cnr.2	-	3	699	c.329C>T	c.(328-330)ACC>ATC	p.T110I	ALOXE3_uc002gka.2_Missense_Mutation_p.T266I|ALOXE3_uc010vuo.1_Missense_Mutation_p.T242I|ALOXE3_uc010vup.1_RNA	NM_021628	NP_067641	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3 isoform 2	110	PLAT.				leukotriene biosynthetic process		iron ion binding|lipoxygenase activity			skin(3)|lung(1)|central_nervous_system(1)	5						CAGCTCCACGGTGCAGTAGCC	0.562													26	80	---	---	---	---	PASS
KRTAP4-4	84616	broad.mit.edu	37	17	39316569	39316569	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39316569G>T	uc002hwc.2	-	1	415	c.375C>A	c.(373-375)TAC>TAA	p.Y125*		NM_032524	NP_115913	Q9BYR3	KRA44_HUMAN	keratin associated protein 4.4	125	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGGACACACAGTAGCTGGGGC	0.667													29	73	---	---	---	---	PASS
FMNL1	752	broad.mit.edu	37	17	43311611	43311611	+	Intron	SNP	A	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43311611A>T	uc002iin.2	+						FMNL1_uc002iio.2_Missense_Mutation_p.S165C	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						CAGAGAATTCAGCCCCCACAC	0.607													30	47	---	---	---	---	PASS
MTMR4	9110	broad.mit.edu	37	17	56589825	56589825	+	Missense_Mutation	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56589825C>T	uc002iwj.2	-	4	246	c.136G>A	c.(136-138)GGC>AGC	p.G46S	MTMR4_uc010dcx.1_Missense_Mutation_p.G60S	NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	46						cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTGCCCGGCCCAGGAACTCT	0.522													12	63	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76451801	76451801	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76451801G>A	uc010dhp.1	-	8	1317	c.1095C>T	c.(1093-1095)TAC>TAT	p.Y365Y	DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGTAGCCCACGTAGGACACGA	0.498													4	27	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6873513	6873513	+	Missense_Mutation	SNP	T	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6873513T>G	uc010wzi.1	+	7	767	c.529T>G	c.(529-531)TTT>GTT	p.F177V	ARHGAP28_uc002knc.2_Missense_Mutation_p.F302V|ARHGAP28_uc002knd.2_Missense_Mutation_p.F195V|ARHGAP28_uc002kne.2_Missense_Mutation_p.F195V|ARHGAP28_uc002knf.2_Missense_Mutation_p.F186V			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;	177					signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				ATTGACTGCCTTTTTTGATGC	0.388													40	60	---	---	---	---	PASS
RTN2	6253	broad.mit.edu	37	19	45996518	45996518	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45996518G>A	uc002pcb.2	-	5	1161	c.933C>T	c.(931-933)ACC>ACT	p.T311T	RTN2_uc002pcc.2_Intron|RTN2_uc002pcd.2_Intron	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	311						integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GAGTAGGGGGGGTGGGGCCCC	0.552													62	160	---	---	---	---	PASS
JAG1	182	broad.mit.edu	37	20	10621809	10621809	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10621809G>A	uc002wnw.2	-	24	3516	c.3000C>T	c.(2998-3000)ATC>ATT	p.I1000I		NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	1000	Extracellular (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9						GCTCGCAAGCGATGTAGATTG	0.398									Alagille_Syndrome				10	146	---	---	---	---	PASS
SSTR4	6754	broad.mit.edu	37	20	23016583	23016583	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23016583G>A	uc002wsr.2	+	1	527	c.463G>A	c.(463-465)GCG>ACG	p.A155T		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	155	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TCTGCGCGCGGCGACCTACCG	0.657													35	71	---	---	---	---	PASS
OGFR	11054	broad.mit.edu	37	20	61442846	61442846	+	Silent	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61442846G>A	uc002ydj.2	+	6	533	c.498G>A	c.(496-498)CGG>CGA	p.R166R	OGFR_uc002ydk.2_Silent_p.R149R|OGFR_uc002ydl.2_Silent_p.R114R	NM_007346	NP_031372	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	166					regulation of cell growth	cytoplasm|membrane|nucleus	opioid receptor activity				0	Breast(26;3.65e-08)					TCCAGGAGCGGCTTGTCCGGG	0.632													3	28	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22976033	22976033	+	Intron	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22976033C>T	uc011aim.1	+						POM121L1P_uc011ait.1_RNA					Parts of antibodies, mostly variable regions.												0						GACGTGAACGCCATCGCAGGC	0.557													3	35	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25007058	25007058	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25007058A>T	uc003aan.1	+	5	497	c.10A>T	c.(10-12)AAG>TAG	p.K4*	GGT1_uc003aas.1_Nonsense_Mutation_p.K4*|GGT1_uc003aat.1_Nonsense_Mutation_p.K4*|GGT1_uc003aau.1_Nonsense_Mutation_p.K4*|GGT1_uc003aav.1_Nonsense_Mutation_p.K4*|GGT1_uc003aaw.1_Nonsense_Mutation_p.K4*|GGT1_uc003aax.1_Nonsense_Mutation_p.K4*	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	4	Cytoplasmic (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	CATGAAGAAGAAGTTAGTGGT	0.602													4	19	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32555106	32555106	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32555106G>A	uc003amd.2	-	1	138	c.97C>T	c.(97-99)CCT>TCT	p.P33S		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	33										ovary(1)|skin(1)	2						ACAGTCTCAGGAATCTCACAC	0.577													34	60	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32555121	32555121	+	Missense_Mutation	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32555121G>A	uc003amd.2	-	1	123	c.82C>T	c.(82-84)CAT>TAT	p.H28Y		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	28										ovary(1)|skin(1)	2						TCACACTCATGGCAGGGTCCC	0.562													40	60	---	---	---	---	PASS
POLDIP3	84271	broad.mit.edu	37	22	42992339	42992339	+	Silent	SNP	G	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42992339G>T	uc003bcu.2	-	5	765	c.666C>A	c.(664-666)TCC>TCA	p.S222S	POLDIP3_uc011app.1_Silent_p.S143S|POLDIP3_uc003bcv.2_Silent_p.S193S|POLDIP3_uc011apq.1_Silent_p.S239S|POLDIP3_uc010gza.2_RNA|POLDIP3_uc011apr.1_RNA|POLDIP3_uc010gzb.1_Intron	NM_032311	NP_115687	Q9BY77	PDIP3_HUMAN	DNA polymerase delta interacting protein 3	222					positive regulation of translation	cytoplasm|nuclear speck	nucleotide binding|protein binding|RNA binding				0						GGAGGGCCTTGGACATGGAAA	0.498													12	50	---	---	---	---	PASS
COX7B	1349	broad.mit.edu	37	X	77160816	77160816	+	3'UTR	SNP	A	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77160816A>G	uc004ecu.1	+	3						NM_001866	NP_001857	P24311	COX7B_HUMAN	cytochrome c oxidase subunit VIIb precursor						respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity				0						TTGATGCCAAATTAAAGCACT	0.343													3	44	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123839011	123839011	+	Silent	SNP	C	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123839011C>T	uc004euj.2	-	5	931	c.867G>A	c.(865-867)TCG>TCA	p.S289S	ODZ1_uc011muj.1_Silent_p.S289S|ODZ1_uc010nqy.2_Silent_p.S289S	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	289	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TGGGAGGGGGCGAGTACACGG	0.517													97	149	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9630	9630	+	RNA	SNP	G	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9630G>A	uc011mfi.1	+	1		c.968G>A			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TCGCATCAGGAGTATCAATCA	0.463													186	340	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10144136	10144136	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10144136delT	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GTGCTTGTAGTTTTACCAACT	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	11379015	11379015	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11379015delC								UBIAD1 (30525 upstream) : PTCHD2 (160280 downstream)																							CCAAGACCAGCCCCACACCAG	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14880767	14880768	+	IGR	INS	-	C	C	rs146192531	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14880767_14880768insC								PRDM2 (729195 upstream) : KAZ (44445 downstream)																							ACCTACAGCCACACAAATACAG	0.356													3	5	---	---	---	---	
IGSF21	84966	broad.mit.edu	37	1	18497390	18497390	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18497390delA	uc001bau.1	+							NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CACCTTCAGGAAGGGCTTCAT	0.488													4	2	---	---	---	---	
SFRS13A	10772	broad.mit.edu	37	1	24294251	24294251	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24294251delT	uc010oee.1	-						SFRS13A_uc001bij.1_Intron	NM_006625	NP_006616	O75494	SRS10_HUMAN	FUS interacting protein (serine-arginine rich) 1						assembly of spliceosomal tri-snRNP|cytoplasmic transport|mRNA export from nucleus|mRNA splice site selection|negative regulation of nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent	cytoplasm|nuclear speck	nucleotide binding|RNA binding|RS domain binding|unfolded protein binding				0						tttggtttcctttattcttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	31558066	31558066	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31558066delC								PUM1 (19303 upstream) : NKAIN1 (94527 downstream)																							gacaaactgaccccccctccc	0.000													3	3	---	---	---	---	
DBT	1629	broad.mit.edu	37	1	100657114	100657114	+	3'UTR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100657114delA	uc001dta.2	-	11					DBT_uc010oug.1_3'UTR	NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase						branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		ATCTGCCCATAAAAAAATTCT	0.214													5	3	---	---	---	---	
KIAA1614	57710	broad.mit.edu	37	1	180906915	180906916	+	Intron	INS	-	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180906915_180906916insC	uc001gok.2	+						KIAA1614_uc001gol.1_Intron|KIAA1614_uc001gom.1_Intron	NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710											ovary(3)|skin(1)	4						TGAGGCAACCGCCTCCCCCTGG	0.594													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194488701	194488701	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194488701delT								None (None upstream) : None (None downstream)																							AAGAAGAAAGTTTTTTTTTGT	0.199													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	203060647	203060647	+	IGR	DEL	T	-	-	rs67773469		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203060647delT								MYOG (5270 upstream) : ADORA1 (36189 downstream)																							tcaggatgccttTTTTTTTTT	0.244													4	2	---	---	---	---	
INTS7	25896	broad.mit.edu	37	1	212180338	212180338	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212180338delT	uc001hiw.1	-						INTS7_uc009xdb.1_Intron|INTS7_uc001hix.1_Intron|INTS7_uc001hiy.1_Intron|INTS7_uc010pta.1_Intron	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7						snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		CAATCCTTTCTTTTTTTTTTT	0.353													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212382576	212382577	+	IGR	INS	-	G	G	rs151220598	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212382576_212382577insG								DTL (104390 upstream) : PPP2R5A (76302 downstream)																							tctctctctcagtgtgctagaa	0.267													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	234673496	234673496	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234673496delA								TARBP1 (58647 upstream) : IRF2BP2 (66521 downstream)																							GATAAGTGACAAAAAAAAGAC	0.498													4	2	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241838281	241838282	+	Intron	INS	-	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241838281_241838282insC	uc001hze.1	+									B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			tttctttccttctttcctccct	0.000													6	4	---	---	---	---	
SCCPDH	51097	broad.mit.edu	37	1	246929807	246929808	+	Intron	INS	-	C	C	rs143881217	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246929807_246929808insC	uc001ibr.2	+							NM_016002	NP_057086	Q8NBX0	SCPDH_HUMAN	saccharopine dehydrogenase (putative)							midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		GGCAGTAGTAACCCTGACTGAC	0.455													8	4	---	---	---	---	
TTC15	51112	broad.mit.edu	37	2	3462310	3462310	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3462310delA	uc002qxm.1	+						TTC15_uc002qxn.1_Intron|TTC15_uc010ewm.1_Intron	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15								binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		tggtgtgtggatgttgggtgt	0.289													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20320989	20320989	+	IGR	DEL	G	-	-	rs75236829		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20320989delG								LAPTM4A (69200 upstream) : SDC1 (79569 downstream)																							atatctaccaggtatttcaaa	0.000													3	3	---	---	---	---	
HADHB	3032	broad.mit.edu	37	2	26508605	26508607	+	Intron	DEL	GGG	-	-	rs10673554		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26508605_26508607delGGG	uc002rgz.2	+						HADHB_uc010ykv.1_Intron|HADHB_uc010ykw.1_Intron|HADHB_uc002rha.2_Intron|HADHB_uc010ykx.1_Intron	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta						fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					tttgttttttgggtttttttttt	0.172													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30191017	30191018	+	IGR	INS	-	A	A	rs144489862	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30191017_30191018insA								ALK (46585 upstream) : YPEL5 (178732 downstream)																							GGAGAGAGAGGAAAAAAAAAAC	0.287													5	3	---	---	---	---	
SLC8A1	6546	broad.mit.edu	37	2	40402646	40402647	+	Intron	INS	-	TG	TG	rs146364894	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40402646_40402647insTG	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron|SLC8A1_uc002rsb.1_Intron	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	acatacgtatatgtgtgtgtgt	0.193													4	3	---	---	---	---	
AFTPH	54812	broad.mit.edu	37	2	64770967	64770967	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64770967delT	uc002scz.2	+						AFTPH_uc002sda.2_Intron|AFTPH_uc002sdb.2_Intron	NM_203437	NP_982261	Q6ULP2	AFTIN_HUMAN	aftiphilin protein isoform a						protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding			ovary(2)	2						ACCCCAGAGCTTACAACTTAC	0.418													4	2	---	---	---	---	
GMCL1	64395	broad.mit.edu	37	2	70066969	70066969	+	Intron	DEL	T	-	-	rs76461708		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70066969delT	uc002sfu.2	+							NM_178439	NP_848526	Q96IK5	GMCL1_HUMAN	germ cell-less						cell differentiation|multicellular organismal development|spermatogenesis	nuclear matrix				ovary(3)	3						AGTATGACCATTTTTTTTTTT	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73163317	73163317	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73163317delC								EMX1 (1297 upstream) : SFXN5 (5849 downstream)																							TCACTTGTGTCCAGTCAGTGC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	88618182	88618182	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88618182delG								THNSL2 (132037 upstream) : FOXI3 (129544 downstream)																							ccagattcaaggggtgagacg	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92119527	92119527	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92119527delG								GGT8P (149374 upstream) : FKSG73 (9632 downstream)																							TAAAATTTTTGCTTCTTTTTC	0.358													45	27	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121729320	121729320	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121729320delC	uc010flp.2	+						GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GGTTGGCATGCCCAGGTCTGG	0.547													4	2	---	---	---	---	
KYNU	8942	broad.mit.edu	37	2	143718077	143718078	+	Intron	INS	-	A	A	rs141976561	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143718077_143718078insA	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	ACCTTAATCTGAAAAAAAAAAC	0.257													14	9	---	---	---	---	
FMNL2	114793	broad.mit.edu	37	2	153431965	153431965	+	Intron	DEL	A	-	-	rs66727260		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153431965delA	uc002tye.2	+							NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						CCAACCAAACAAAAAAAAAAA	0.159													4	7	---	---	---	---	
SCN1A	6323	broad.mit.edu	37	2	166852347	166852350	+	Intron	DEL	TTAA	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166852347_166852350delTTAA	uc010zcz.1	-							NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TTTTTGGTCTTTAATTTTTTTTGT	0.309													21	20	---	---	---	---	
BMPR2	659	broad.mit.edu	37	2	203406833	203406833	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203406833delA	uc002uzf.3	+						BMPR2_uc010ftr.2_Intron	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II						anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						gactccgtctaaaaaaaaaaa	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229369969	229369970	+	IGR	DEL	AG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229369969_229369970delAG								SPHKAP (323608 upstream) : PID1 (518720 downstream)																							ggaagagttaagagtcactttt	0.000													5	5	---	---	---	---	
DNER	92737	broad.mit.edu	37	2	230506059	230506059	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230506059delG	uc002vpv.2	-							NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		acttagaggtggagaagaaaa	0.090													4	2	---	---	---	---	
GIGYF2	26058	broad.mit.edu	37	2	233652243	233652244	+	Intron	INS	-	T	T	rs148236449	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233652243_233652244insT	uc002vti.3	+						GIGYF2_uc010zmj.1_Intron|GIGYF2_uc002vtg.2_Intron|GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc010zml.1_Intron	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b						cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TCACTTTTCTATTTTTCTGGGG	0.337													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239367648	239367651	+	IGR	DEL	GGAA	-	-	rs4040078		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239367648_239367651delGGAA								ASB1 (6758 upstream) : TWIST2 (389022 downstream)																							CAAGggagtcggaaggaaggaaag	0.279													3	4	---	---	---	---	
ITPR1	3708	broad.mit.edu	37	3	4637383	4637383	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4637383delG	uc003bqa.2	+						ITPR1_uc010hbz.2_Intron|ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		AGTAGGAGCTGGGGGTTGCAG	0.448													1	5	---	---	---	---	
ATP2B2	491	broad.mit.edu	37	3	10622986	10622986	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10622986delC	uc003bvw.2	-							NM_001683	NP_001674	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 2						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GCCAGAGGAGCCCCACAAGGC	0.488													4	2	---	---	---	---	
HIGD1A	25994	broad.mit.edu	37	3	42827309	42827309	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42827309delT	uc003cma.3	-						HIGD1A_uc010hid.2_Intron|HIGD1A_uc003cmb.3_Intron	NM_001099669	NP_001093139	Q9Y241	HIG1A_HUMAN	HIG1 domain family, member 1A isoform b						response to stress	integral to membrane|protein complex	protein binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.217)		ATTGACAGGATTTTTTTTTTC	0.279													8	4	---	---	---	---	
ALS2CL	259173	broad.mit.edu	37	3	46720034	46720034	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46720034delT	uc003cqa.1	-						ALS2CL_uc003cpx.1_5'Flank|ALS2CL_uc003cpy.1_5'Flank|ALS2CL_uc003cpz.1_Intron|ALS2CL_uc003cqb.1_Intron|ALS2CL_uc003cqc.1_Intron	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1						endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TGCTGAGGGGTTCATAATCCT	0.557													4	2	---	---	---	---	
KCTD6	200845	broad.mit.edu	37	3	58487415	58487416	+	3'UTR	INS	-	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58487415_58487416insT	uc003dkj.3	+	3					KCTD6_uc003dki.3_3'UTR|KCTD6_uc003dkk.3_3'UTR	NM_001128214	NP_001121686	Q8NC69	KCTD6_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000177)|Kidney(10;0.00229)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.148)		GAAGATACTGATTTTTTTTTTT	0.411													5	3	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115342811	115342811	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115342811delT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		CTAGAAATAATTTTTTTTTTT	0.423													5	3	---	---	---	---	
PODXL2	50512	broad.mit.edu	37	3	127354745	127354745	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127354745delG	uc003ejq.2	+							NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor						leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						cacctttgctggtcttgtctg	0.000													6	3	---	---	---	---	
CCDC48	79825	broad.mit.edu	37	3	128736588	128736589	+	Intron	INS	-	CT	CT	rs142112591	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128736588_128736589insCT	uc011bkt.1	+							NM_024768	NP_079044	Q9HA90	CCD48_HUMAN	coiled-coil domain containing 48												0						gggATAATCCCGTCTTCTGGTC	0.282													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137478458	137478458	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137478458delT								IL20RB (748538 upstream) : SOX14 (5121 downstream)																							GTACCCCTGGTTTTGCTCGGC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148807358	148807359	+	IGR	DEL	CA	-	-	rs58599913		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148807358_148807359delCA								HLTF (3017 upstream) : HPS3 (40012 downstream)																							catgcccgtgcacacacacaca	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	185847754	185847755	+	IGR	DEL	TC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185847754_185847755delTC								ETV5 (20853 upstream) : DGKG (17236 downstream)																							TCTGCTGCCTTCTCTCTCTCTG	0.416													4	2	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	192446957	192446960	+	5'Flank	DEL	TATT	-	-	rs145703570		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192446957_192446960delTATT	uc003fsy.2	-							NM_004113	NP_004104	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		GTACTCTTCATATTTATTCtttta	0.176													0	6	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194960461	194960461	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194960461delC	uc003fum.3	-						C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		CTTTATGAAGCCCAGAGTCAA	0.214													4	2	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2109743	2109743	+	Intron	DEL	C	-	-	rs113505721		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2109743delC	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			gctccttttgcctggtgagca	0.184								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					1	6	---	---	---	---	
PPP2R2C	5522	broad.mit.edu	37	4	6423781	6423781	+	Intron	DEL	T	-	-	rs144681179		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6423781delT	uc003gjc.2	-						PPP2R2C_uc003gjb.2_5'Flank|PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						ATTGGTGCAATTTTTTTTTTT	0.423													2	4	---	---	---	---	
CCDC149	91050	broad.mit.edu	37	4	24875588	24875591	+	Intron	DEL	TTGT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24875588_24875591delTTGT	uc011bxr.1	-						CCDC149_uc003grc.2_Intron|CCDC149_uc003grb.2_Intron|CCDC149_uc003grd.2_Intron|CCDC149_uc003gre.2_Intron	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)				TTTCCTAAAATTGTTTGAACACAA	0.284													7	4	---	---	---	---	
CCKAR	886	broad.mit.edu	37	4	26487662	26487662	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26487662delT	uc003gse.1	-							NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	TGTATGTATATTTTTAAAAGA	0.224													4	2	---	---	---	---	
CEP135	9662	broad.mit.edu	37	4	56825658	56825659	+	Intron	INS	-	TG	TG	rs34865047		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56825658_56825659insTG	uc003hbi.2	+						CEP135_uc003hbh.1_Intron|CEP135_uc010igz.1_Intron	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4						centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					AGTTTTAAATCTTGTTACAAAC	0.361													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	74739675	74739676	+	IGR	INS	-	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74739675_74739676insT								CXCL1 (2722 upstream) : PF4 (107120 downstream)																							agggcatcagctttgtctcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	183734465	183734466	+	IGR	DEL	AC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183734465_183734466delAC								ODZ3 (10288 upstream) : DCTD (76779 downstream)																							ccacatagagacacacacacct	0.000													4	2	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1085619	1085619	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1085619delC	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	GGGAGGCCGTCCCCGGACACA	0.721													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6766287	6766287	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6766287delA								PAPD7 (9126 upstream) : ADCY2 (630056 downstream)																							TCCCCAGGGGAGTCCATCAGT	0.517											OREG0016495	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7302563	7302564	+	Intron	DEL	TT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7302563_7302564delTT	uc003jdy.1	-											Homo sapiens cDNA FLJ42124 fis, clone TESTI2009477, weakly  similar to TRICHOHYALIN.																		ttttcttttctttttttttttt	0.213													3	3	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11516218	11516218	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11516218delA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						acagtgtctcaaaaaaaaaTT	0.124													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34180032	34180032	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34180032delA								C1QTNF3 (136715 upstream) : RAI14 (476401 downstream)																							GCATGCACAGAAAAACGGTGC	0.303													4	2	---	---	---	---	
GDNF	2668	broad.mit.edu	37	5	37837860	37837861	+	Intron	DEL	CT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37837860_37837861delCT	uc011cpi.1	-						GDNF_uc011cpc.1_5'Flank|GDNF_uc011cpd.1_5'Flank|GDNF_uc011cpe.1_5'Flank|GDNF_uc011cpf.1_5'Flank|GDNF_uc011cpg.1_5'Flank|GDNF_uc011cph.1_5'Flank	NM_000514	NP_000505	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor isoform 1						adult locomotory behavior|anti-apoptosis|axon guidance|branching involved in ureteric bud morphogenesis|enteric nervous system development|mRNA stabilization|negative regulation of neuron apoptosis|neural crest cell migration|peristalsis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of dopamine secretion|positive regulation of monooxygenase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of ureteric bud formation|postganglionic parasympathetic nervous system development|regulation of dopamine uptake|signal transduction|sympathetic nervous system development	extracellular region	growth factor activity|protein homodimerization activity				0	all_lung(31;0.00118)					GCTGGTTTTCCTCTCCCCACTT	0.589											OREG0016575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
CXXC5	51523	broad.mit.edu	37	5	139049332	139049333	+	Intron	DEL	AC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139049332_139049333delAC	uc010jfg.1	+						CXXC5_uc003let.2_Intron	NM_016463	NP_057547	Q7LFL8	CXXC5_HUMAN	CXXC finger 5						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|nucleus	DNA binding|signal transducer activity|zinc ion binding			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCAAGCTACACACACACAC	0.559													4	2	---	---	---	---	
HAVCR1	26762	broad.mit.edu	37	5	156459582	156459582	+	Intron	DEL	C	-	-	rs61047347		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156459582delC	uc010jij.1	-						HAVCR1_uc011ddl.1_Intron|HAVCR1_uc003lwi.2_Intron	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1						interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCAAATCATTCAATGTTTACT	0.284													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	902276	902277	+	IGR	DEL	TG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:902276_902277delTG								EXOC2 (209167 upstream) : LOC285768 (58965 downstream)																							TGTGTGGCATTGTGTGTGTGCA	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2309682	2309682	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2309682delT								GMDS (63836 upstream) : C6orf195 (313290 downstream)																							ttcttttttattttttttttt	0.090													3	3	---	---	---	---	
TXNDC5	81567	broad.mit.edu	37	6	7961949	7961949	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7961949delT	uc003mxw.2	-							NM_001145549	NP_001139021	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)					gccattttggtttcattccct	0.000													4	2	---	---	---	---	
ATXN1	6310	broad.mit.edu	37	6	16524023	16524023	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16524023delG	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				AACAAAGTGTGGGAAAGAACA	0.507													4	2	---	---	---	---	
SCGN	10590	broad.mit.edu	37	6	25670628	25670629	+	Intron	DEL	TT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25670628_25670629delTT	uc003nfb.2	+						SCGN_uc010jpz.2_Intron	NM_006998	NP_008929	O76038	SEGN_HUMAN	secretagogin precursor							extracellular region|transport vesicle membrane	calcium ion binding			ovary(2)|pancreas(1)	3						AAACATGGACTTAGACAATCAG	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33918368	33918369	+	IGR	DEL	GT	-	-	rs147700351		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33918368_33918369delGT								MLN (146575 upstream) : MIR1275 (49380 downstream)																							ctgtgtgtgagtgtgtgtgtgt	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	37000396	37000397	+	IGR	INS	-	T	T	rs146078867		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37000396_37000397insT								FGD2 (3551 upstream) : PIM1 (137525 downstream)																							ttctttctttcttttttttttt	0.000													6	3	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53787794	53787794	+	3'UTR	DEL	T	-	-	rs67155925		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53787794delT	uc003pcd.1	+	14						NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CCCGGTGTGATTTTTTTTTTT	0.458													3	3	---	---	---	---	
COL12A1	1303	broad.mit.edu	37	6	75855327	75855327	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75855327delC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CTGATGTTTTCTTTTTTtttt	0.144													4	2	---	---	---	---	
FAM184A	79632	broad.mit.edu	37	6	119282833	119282835	+	Intron	DEL	GTT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119282833_119282835delGTT	uc003pyj.2	-						FAM184A_uc003pyk.3_Intron|FAM184A_uc003pyl.3_Intron|FAM184A_uc003pyi.2_Intron	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1											ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						TTTTTCTTAGGTTGTTCTTAAAG	0.291													9	16	---	---	---	---	
ALDH8A1	64577	broad.mit.edu	37	6	135270801	135270801	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135270801delA	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		TGAGAATTGCAAAAAAAAACT	0.358													3	5	---	---	---	---	
HBS1L	10767	broad.mit.edu	37	6	135306205	135306205	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135306205delA	uc003qez.2	-						HBS1L_uc003qey.2_Intron|HBS1L_uc011ecy.1_Intron|HBS1L_uc011ecz.1_Intron|HBS1L_uc011eda.1_Intron	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein						signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		CTAATGGGAGAAAAAAAAACT	0.363													5	3	---	---	---	---	
TXLNB	167838	broad.mit.edu	37	6	139610172	139610173	+	Intron	DEL	AA	-	-	rs57639611		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139610172_139610173delAA	uc011eds.1	-							NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta							cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		TAACGTAGAGAAAGGCAATGTC	0.243													6	4	---	---	---	---	
TXLNB	167838	broad.mit.edu	37	6	139610176	139610177	+	Intron	DEL	GC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139610176_139610177delGC	uc011eds.1	-							NM_153235	NP_694967	Q8N3L3	TXLNB_HUMAN	taxilin beta							cytoplasm				large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		GTAGAGAAAGGCAATGTCCTTT	0.238													7	4	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	145029206	145029206	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145029206delT	uc003qkt.2	+							NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAAAATTAACTTTTTTTTTTT	0.279													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150300312	150300315	+	IGR	DEL	TGAG	-	-	rs62441838		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150300312_150300315delTGAG								ULBP1 (5468 upstream) : RAET1K (18842 downstream)																							tgtgtgtgtttgagtgagtgtgAA	0.422													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158375072	158375072	+	IGR	DEL	A	-	-	rs68028724		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158375072delA								SNX9 (8963 upstream) : SYNJ2 (27847 downstream)																							CTGATAGCTTAAAAAAAACAA	0.373													4	2	---	---	---	---	
INTS1	26173	broad.mit.edu	37	7	1543476	1543477	+	Intron	INS	-	CCCCAAAGAC	CCCCAAAGAC	rs145605530	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1543476_1543477insCCCCAAAGAC	uc003skn.2	-						INTS1_uc003skq.2_Intron	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GCAGCTGAGATccccaaagacc	0.559													4	4	---	---	---	---	
DNAH11	8701	broad.mit.edu	37	7	21912709	21912710	+	Intron	INS	-	T	T	rs72365929		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21912709_21912710insT	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TCCCTTTTGGCTTTTTTTTTTT	0.302									Kartagener_syndrome				4	3	---	---	---	---	
KLHL7	55975	broad.mit.edu	37	7	23191495	23191495	+	Intron	DEL	A	-	-	rs5882889		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23191495delA	uc003svs.3	+						KLHL7_uc003svr.3_Intron|KLHL7_uc011jys.1_Intron|KLHL7_uc011jyt.1_Intron|KLHL7_uc003svt.2_Intron|KLHL7_uc011jyv.1_Intron	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1							Golgi apparatus|nucleolus|plasma membrane					0						TGCTGAGAATAAATGAATTGG	0.403													5	20	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	50239068	50239068	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50239068delA								C7orf72 (39710 upstream) : IKZF1 (105310 downstream)																							aagtgaagacaatggcatgag	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57498589	57498589	+	IGR	DEL	T	-	-	rs75462970		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57498589delT								ZNF479 (291018 upstream) : ZNF716 (11294 downstream)																							CCCTGCCTCCTTTTTTTTTTC	0.343													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64324578	64324579	+	IGR	INS	-	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64324578_64324579insG								LOC168474 (10400 upstream) : ZNF273 (18292 downstream)																							CTGGACAGGCTGGTCTGGGGGG	0.579													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65268568	65268570	+	IGR	DEL	CTT	-	-	rs75342027		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65268568_65268570delCTT								CCT6P1 (39907 upstream) : VKORC1L1 (69687 downstream)																							CCTCTTTTTCCTTCttttttaaa	0.365													9	4	---	---	---	---	
RABGEF1	27342	broad.mit.edu	37	7	66098581	66098581	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66098581delT	uc003tvf.2	+						KCTD7_uc003tvd.3_Intron|KCTD7_uc003tve.2_Intron	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1						endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						AAGAGATCAATTTTTTTTTTT	0.333													5	3	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73903633	73903633	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73903633delG	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						tgtcatggtcgggggtgtcac	0.000													4	2	---	---	---	---	
SLC25A13	10165	broad.mit.edu	37	7	95775777	95775777	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95775777delA	uc003uof.3	-						SLC25A13_uc003uog.3_Intron|SLC25A13_uc011kik.1_Intron	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	GTAGAAATGCAAAAAAAAATG	0.224													12	6	---	---	---	---	
RASA4	10156	broad.mit.edu	37	7	102290065	102290065	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102290065delT	uc011kld.1	-						POLR2J2_uc003vai.2_Intron|POLR2J2_uc003vah.2_Intron|uc003vak.3_5'Flank|SPDYE2_uc011kle.1_5'Flank			O43374	RASL2_HUMAN	Homo sapiens mRNA for KIAA0538 protein, partial cds.						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0						GGTGACACtctttttttttgt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	115144230	115144230	+	IGR	DEL	G	-	-	rs11354677		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115144230delG								MDFIC (484967 upstream) : TFEC (430972 downstream)																							TTTTTTTGCCGAAAACAGTTG	0.453													3	8	---	---	---	---	
SLC4A2	6522	broad.mit.edu	37	7	150758810	150758811	+	Intron	INS	-	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150758810_150758811insC	uc003wit.3	+						SLC4A2_uc011kve.1_5'Flank|SLC4A2_uc003wiu.3_5'Flank	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member						bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		gcccttttcggcccccctcgcc	0.208													4	2	---	---	---	---	
DNAJB6	10049	broad.mit.edu	37	7	157148187	157148187	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157148187delA	uc003wnk.2	+						DNAJB6_uc003wnj.2_Intron|DNAJB6_uc003wnl.2_Intron|DNAJB6_uc011kvy.1_Intron|DNAJB6_uc011kvz.1_Intron|DNAJB6_uc010lqt.2_Intron	NM_058246	NP_490647	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization|negative regulation of caspase activity|protein folding|response to unfolded protein	nucleus|perinuclear region of cytoplasm	ATPase activator activity|chaperone binding|heat shock protein binding|unfolded protein binding			ovary(2)	2	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GGGCCAGTGGAGGGGTGAAAG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	995038	995039	+	Intron	DEL	AG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:995038_995039delAG	uc003wpj.1	+											Homo sapiens cDNA clone IMAGE:4824304.																		ATAAGTGAGCAGAGAGAACCTC	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	9764823	9764824	+	IGR	DEL	GA	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9764823_9764824delGA								MIR124-1 (3841 upstream) : MSRA (147006 downstream)																							gggagagagggagagagagaga	0.450													4	2	---	---	---	---	
ASAH1	427	broad.mit.edu	37	8	17914872	17914872	+	3'UTR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17914872delA	uc003wyl.2	-	14					ASAH1_uc010ltb.1_RNA|ASAH1_uc003wym.2_3'UTR|ASAH1_uc003wyn.2_3'UTR|ASAH1_uc003wyo.2_3'UTR	NM_177924	NP_808592	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform a						ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)		TGATAGGGGGAAAAAAAAAAG	0.378													4	8	---	---	---	---	
PEBP4	157310	broad.mit.edu	37	8	22769548	22769548	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22769548delA	uc003xcn.1	-							NM_144962	NP_659399	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		CGGATTGGGTAAGGGGGGGCG	0.607													4	2	---	---	---	---	
PTK2B	2185	broad.mit.edu	37	8	27309209	27309209	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27309209delC	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_Intron|PTK2B_uc003xfq.1_Intron|PTK2B_uc003xfs.1_3'UTR	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)		CCACCCCATTCCTCTCCCTGC	0.597													4	2	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38683083	38683083	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38683083delT	uc010lwp.2	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc011lbz.1_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Intron|TACC1_uc011lcb.1_Intron|TACC1_uc011lcc.1_Intron|TACC1_uc011lcd.1_Intron|TACC1_uc003xmh.3_Intron|TACC1_uc010lwq.2_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			acaatgactcttttttttttt	0.000													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55343944	55343944	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55343944delA								MRPL15 (282870 upstream) : SOX17 (26551 downstream)																							agaccttgtcaaaaaaaaaaa	0.114													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	72466304	72466305	+	IGR	DEL	AC	-	-	rs5892288		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72466304_72466305delAC								EYA1 (191837 upstream) : MSC (287472 downstream)																							GTGAGGCCGGACACAGGGGGAT	0.441													2	4	---	---	---	---	
MATN2	4147	broad.mit.edu	37	8	99044194	99044194	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99044194delT	uc003yic.2	+						MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Intron|MATN2_uc010mbi.1_Intron|MATN2_uc010mbj.1_Intron|RPL30_uc010mbk.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CAACTTCACCTTTTTTTTCTG	0.418													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105993486	105993486	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105993486delT								LRP12 (392266 upstream) : ZFPM2 (337661 downstream)																							CTCATCtttattttttttttt	0.373													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110714511	110714512	+	IGR	DEL	TT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110714511_110714512delTT								SYBU (10491 upstream) : KCNV1 (264723 downstream)																							caccTCCGCCTTTACTATTTCC	0.213													4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	129031406	129031408	+	Intron	DEL	TGC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129031406_129031408delTGC	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						GTGCCCAGGATGCTGCTGCTGCC	0.498													4	3	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139725959	139725962	+	Intron	DEL	ACCG	-	-	rs72213105	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139725959_139725962delACCG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTCCACCCCCACCGCCCCGCCGTA	0.495										HNSCC(7;0.00092)			4	2	---	---	---	---	
UHRF2	115426	broad.mit.edu	37	9	6497578	6497578	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6497578delT	uc003zjy.2	+						UHRF2_uc003zjz.2_Intron|UHRF2_uc003zkb.2_Intron	NM_152896	NP_690856	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains						cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TGGGTTAAGGTTTTTTTTTTT	0.294													5	3	---	---	---	---	
C9orf93	203238	broad.mit.edu	37	9	15721604	15721617	+	Intron	DEL	TTCAAGAATTTTAT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15721604_15721617delTTCAAGAATTTTAT	uc003zmd.2	+						C9orf93_uc010mih.1_Intron|C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)		TAAAATTCTATTCAAGAATTTTATTCTCCAAGTA	0.294													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	22501460	22501460	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22501460delT								DMRTA1 (48988 upstream) : None (None downstream)																							tgtattatccttttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68416273	68416273	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68416273delG								FAM27B (622084 upstream) : MIR1299 (585966 downstream)																							CTAGGtttttggttgttcttt	0.030													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	97314199	97314199	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97314199delA								HIATL1 (90998 upstream) : FBP2 (6806 downstream)																							TAATCAGTTTAAAAAAAAAAA	0.313													1	6	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113139339	113139349	+	Intron	DEL	TTAGATGGATC	-	-	rs111675740		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113139339_113139349delTTAGATGGATC	uc010mtz.2	-						SVEP1_uc010mty.2_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						GAAAATGACTTTAGATGGATCTTAATAACAG	0.379													5	3	---	---	---	---	
RABEPK	10244	broad.mit.edu	37	9	127968225	127968226	+	Intron	INS	-	TC	TC	rs35136218		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127968225_127968226insTC	uc004bpi.2	+						RABEPK_uc004bph.1_Intron|RABEPK_uc004bpj.2_Intron|RABEPK_uc004bpk.2_Intron|RABEPK_uc004bpl.1_Intron|RABEPK_uc004bpm.2_Intron	NM_005833	NP_005824	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs						receptor-mediated endocytosis|vesicle docking involved in exocytosis	endosome membrane|plasma membrane				ovary(1)	1						ggaaaagagaattgagaatgac	0.000													0	6	---	---	---	---	
ITIH5	80760	broad.mit.edu	37	10	7667737	7667740	+	Intron	DEL	AAAG	-	-	rs60969196		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7667737_7667740delAAAG	uc001ijq.2	-						ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						caaaaaaaaaaaagaaagaaagaa	0.039													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38910578	38910579	+	IGR	INS	-	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38910578_38910579insG								LOC399744 (169498 upstream) : None (None downstream)																							CTTCCAATTTATTTTCTTCCTG	0.243													4	3	---	---	---	---	
AGAP6	414189	broad.mit.edu	37	10	51768242	51768243	+	Intron	DEL	TT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51768242_51768243delTT	uc001jix.3	+							NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						tttttttttctttttttttttt	0.000													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	61815228	61815229	+	Intron	INS	-	T	T	rs149397890	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61815228_61815229insT	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TTACTTGGAACTTTTTTTTTTA	0.282													4	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69634673	69634673	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69634673delA								DNAJC12 (36736 upstream) : SIRT1 (9754 downstream)																							CCATCTCAACAAAAAAAAAAA	0.279													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77051611	77051611	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77051611delG								COMTD1 (55841 upstream) : ZNF503 (105994 downstream)																							TCATGTCCAAGGTAGAGGAGG	0.507													4	2	---	---	---	---	
SEMA4G	57715	broad.mit.edu	37	10	102736745	102736745	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102736745delT	uc010qpt.1	+						SEMA4G_uc001krv.2_Intron|SEMA4G_uc001krw.1_Intron|SEMA4G_uc001krx.2_Intron	NM_017893	NP_060363	Q9NTN9	SEM4G_HUMAN	semaphorin 4G						cell differentiation|nervous system development	integral to membrane	receptor activity			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		gtcaagagacttttaggacaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	126568225	126568225	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126568225delC								FAM175B (42987 upstream) : ZRANB1 (60747 downstream)																							CCTCTACCCACCCCAGTGGAT	0.323													4	2	---	---	---	---	
CTBP2	1488	broad.mit.edu	37	10	126830985	126830986	+	Intron	DEL	AG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126830985_126830986delAG	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CGCACTTCCTAGGCTGGCCCTT	0.327													4	2	---	---	---	---	
IFITM1	8519	broad.mit.edu	37	11	314518	314519	+	Intron	DEL	TG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:314518_314519delTG	uc001loy.3	+							NM_003641	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1						negative regulation of cell proliferation|regulation of immune response|response to virus|type I interferon-mediated signaling pathway	integral to membrane|plasma membrane	protein binding|receptor signaling protein activity				0		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CTGTGTGATCTGTGTGTGTGTG	0.579													5	3	---	---	---	---	
GTF2H1	2965	broad.mit.edu	37	11	18369686	18369687	+	Intron	INS	-	TTTG	TTTG			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18369686_18369687insTTTG	uc001moi.2	+						GTF2H1_uc001moh.2_Intron|GTF2H1_uc009yhm.2_Intron|GTF2H1_uc001moj.2_Intron	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,						mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						TTTTAttgttttttgtttgttt	0.312								NER					6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49428320	49428321	+	IGR	INS	-	T	T	rs71049344		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49428320_49428321insT								FOLH1 (198098 upstream) : LOC440040 (151759 downstream)																							atctatctatcatctatatctg	0.163													4	2	---	---	---	---	
INCENP	3619	broad.mit.edu	37	11	61905617	61905617	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61905617delG	uc001nsw.1	+						INCENP_uc009ynw.1_Intron|INCENP_uc001nsx.1_Intron	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa						chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						GGTTGGGGGTGAGGCGGGGCT	0.622													4	2	---	---	---	---	
LTBP3	4054	broad.mit.edu	37	11	65311761	65311762	+	Intron	DEL	TC	-	-	rs34294277		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65311761_65311762delTC	uc001oej.2	-						LTBP3_uc001oef.2_5'UTR|LTBP3_uc001oeg.2_Intron|LTBP3_uc001oeh.2_Intron|LTBP3_uc010roi.1_Intron|LTBP3_uc001oei.2_Intron|LTBP3_uc010roj.1_Intron|LTBP3_uc010rok.1_Intron	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding							extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3						ACCTCCACCTTCTCTCTCACAG	0.584													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	65675789	65675789	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65675789delT								FOSL1 (7792 upstream) : C11orf68 (8495 downstream)																							cagcaaggtcttctgcgagcc	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68067690	68067690	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68067690delG								C11orf24 (28221 upstream) : LRP5 (12418 downstream)																							GGAGAATCCCGTGGCGTTTAC	0.368													4	2	---	---	---	---	
ARHGEF17	9828	broad.mit.edu	37	11	73060678	73060678	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73060678delA	uc001otu.2	+							NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						aaaacaaaacaaaaaaaacaa	0.264													4	2	---	---	---	---	
RDX	5962	broad.mit.edu	37	11	110135839	110135840	+	Intron	INS	-	G	G	rs12576698		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110135839_110135840insG	uc001pku.2	-						RDX_uc009yxx.1_Intron|RDX_uc009yxy.2_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc010rwe.1_Intron	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		tttttgttttttttttttttgt	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	119615917	119615917	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119615917delG								PVRL1 (16482 upstream) : TRIM29 (366078 downstream)																							ACGTGGAGGTGGGGCAGAGAG	0.562													4	2	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120662945	120662946	+	Intron	DEL	GT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120662945_120662946delGT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	cagcagcaccgtgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	122376683	122376684	+	IGR	DEL	CT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122376683_122376684delCT								LOC399959 (138216 upstream) : UBASH3B (149714 downstream)																							ACTGCCCACACTGTCTCAGGCA	0.505											OREG0021438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	6	---	---	---	---	
CRTAM	56253	broad.mit.edu	37	11	122741787	122741787	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122741787delA	uc001pyj.2	+						CRTAM_uc001pyk.2_Intron	NM_019604	NP_062550	O95727	CRTAM_HUMAN	class-I MHC-restricted T cell associated						cell recognition|detection of tumor cell|positive regulation of cytokine secretion|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	integral to membrane|plasma membrane	receptor binding			ovary(1)	1		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		aacctgtctcaaaaaaaaacc	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	131110557	131110557	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131110557delT								SNX19 (324175 upstream) : NTM (129814 downstream)																							ACTGGTTGTATTTTCTTCTGT	0.398													4	2	---	---	---	---	
JAM3	83700	broad.mit.edu	37	11	133995211	133995211	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133995211delT	uc001qhb.1	+						JAM3_uc009zcz.1_Intron	NM_032801	NP_116190	Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3 precursor						angiogenesis|blood coagulation|regulation of neutrophil chemotaxis	cell-cell contact zone|desmosome|extracellular space|integral to membrane	integrin binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		TGTCAGAGGCTTTTTTTAGGT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5629426	5629427	+	IGR	INS	-	GATC	GATC	rs139841019	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5629426_5629427insGATC								NTF3 (24963 upstream) : ANO2 (42390 downstream)																							GACAGTGAGAGGATCAGATGAG	0.421													6	4	---	---	---	---	
FAM66C	440078	broad.mit.edu	37	12	8365392	8365393	+	Intron	INS	-	T	T	rs147603516	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8365392_8365393insT	uc001qug.3	+											Homo sapiens cDNA FLJ38982 fis, clone NT2RI2005239.												0						ctgcttctgagtttttttttga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	8508536	8508537	+	IGR	INS	-	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8508536_8508537insT								LOC653113 (112994 upstream) : LOC389634 (1025 downstream)																							gagggaatacatttgctccagc	0.183													4	2	---	---	---	---	
SFRS2IP	9169	broad.mit.edu	37	12	46319793	46319793	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46319793delA	uc001rox.2	-						SFRS2IP_uc001row.2_Intron	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,						spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		ATGCTAAGTGACTTGTAAACA	0.244													20	10	---	---	---	---	
PRPF40B	25766	broad.mit.edu	37	12	50023818	50023819	+	5'Flank	INS	-	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50023818_50023819insA	uc001rur.1	+						PRPF40B_uc001rup.1_Intron|PRPF40B_uc001ruq.1_Intron|PRPF40B_uc001rus.1_5'Flank	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1						mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						GAGAATTAGGGAGACAAGCATT	0.441													4	2	---	---	---	---	
FMNL3	91010	broad.mit.edu	37	12	50043874	50043875	+	Intron	INS	-	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50043874_50043875insA	uc001ruv.1	-						FMNL3_uc001ruw.1_Intron|FMNL3_uc001rut.1_Intron|FMNL3_uc001ruu.1_Intron	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1						actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						GCAATGATCCCGGGGGAACACT	0.302													4	2	---	---	---	---	
RARG	5916	broad.mit.edu	37	12	53626026	53626026	+	5'UTR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53626026delC	uc001sce.2	-	1					RARG_uc001scf.2_5'UTR|RARG_uc001scg.2_5'UTR|RARG_uc010soc.1_5'UTR	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1						canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)|lung(1)	4					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	tccctccccacccccccccca	0.343													5	3	---	---	---	---	
FLJ12825	440101	broad.mit.edu	37	12	54515536	54515536	+	RNA	DEL	C	-	-	rs112977992		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54515536delC	uc001sey.2	+	2		c.3460delC				NR_026655				Homo sapiens cDNA FLJ12825 fis, clone NT2RP2002800.												0						CCATCCCCTACCCCAATCAGG	0.517													5	7	---	---	---	---	
LRP1	4035	broad.mit.edu	37	12	57586409	57586409	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57586409delC	uc001snd.2	+						MIR1228_hsa-mir-1228|MI0006318_5'Flank	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1						aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCTAAAAGCACACACATCCTC	0.622													4	2	---	---	---	---	
NXPH4	11247	broad.mit.edu	37	12	57617301	57617302	+	Intron	DEL	CA	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57617301_57617302delCA	uc010srf.1	+						NXPH4_uc009zpj.2_Intron	NM_007224	NP_009155	O95158	NXPH4_HUMAN	neurexophilin 4 precursor						neuropeptide signaling pathway	extracellular region					0						atgtaccggccacacacacaca	0.267													4	2	---	---	---	---	
NR2C1	7181	broad.mit.edu	37	12	95456708	95456709	+	Intron	INS	-	CATT	CATT	rs140218822	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95456708_95456709insCATT	uc001tdm.3	-						NR2C1_uc010suu.1_Intron|NR2C1_uc001tdo.3_Intron|NR2C1_uc001tdn.3_Intron	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						AATAGTAAGAACATTTTGACCT	0.267													6	6	---	---	---	---	
C12orf48	55010	broad.mit.edu	37	12	102572142	102572142	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102572142delA	uc001tjf.2	+						C12orf48_uc001tjg.2_Intron|C12orf48_uc010swa.1_Intron|C12orf48_uc001tjh.2_Intron|C12orf48_uc010swb.1_Intron|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_Intron|C12orf48_uc001tjk.2_Intron|C12orf48_uc009zud.2_Intron	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010						response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						accagaacctaatgtctTCTT	0.164													4	2	---	---	---	---	
POLR3B	55703	broad.mit.edu	37	12	106804914	106804914	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106804914delT	uc001tlp.2	+						POLR3B_uc001tlq.2_Intron	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1						innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						ACATTAAttcttttttttttg	0.119													6	3	---	---	---	---	
RBM19	9904	broad.mit.edu	37	12	114292202	114292202	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114292202delC	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					ACCCAGGCCACCCAGGAGACC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	121197288	121197288	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121197288delT								ACADS (19478 upstream) : SPPL3 (3748 downstream)																							CACTGAAGACTTTTTTTTTTT	0.323													4	2	---	---	---	---	
TMEM132B	114795	broad.mit.edu	37	12	126000456	126000457	+	Intron	DEL	AC	-	-	rs141263765		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126000456_126000457delAC	uc001uhe.1	+							NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		acacacacaaacacatgtacat	0.114													4	2	---	---	---	---	
TPTE2P1	646405	broad.mit.edu	37	13	25539913	25539921	+	Intron	DEL	CCTCTGCCT	-	-	rs113634042		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25539913_25539921delCCTCTGCCT	uc010tdh.1	-						TPTE2P1_uc001upx.3_Intron	NR_026730				RecName: Full=C2 tensin-type domain-containing protein ENSP00000371290;												0						ctcactgcaacctctgcctcctgggttca	0.029													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	28051053	28051053	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28051053delA								MTIF3 (26342 upstream) : LNX2 (68999 downstream)																							CTCTTACCCTAAATCTAGTCT	0.413													4	2	---	---	---	---	
SLC7A1	6541	broad.mit.edu	37	13	30099547	30099547	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30099547delC	uc001uso.2	-							NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid						cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GGACAACCTGCCCTAAACCTT	0.572													4	2	---	---	---	---	
PDS5B	23047	broad.mit.edu	37	13	33315050	33315050	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315050delT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		CCTTTCAACCTTTTTTTTTTT	0.358													11	6	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114840450	114840450	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114840450delA	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TCCATTCTGTAAAAAAAACGC	0.547													4	2	---	---	---	---	
SLC7A8	23428	broad.mit.edu	37	14	23595988	23595988	+	3'UTR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23595988delC	uc001wiz.2	-	11					SLC7A8_uc001wiw.2_3'UTR|SLC7A8_uc001wix.2_3'UTR|SLC7A8_uc010tnk.1_3'UTR|SLC7A8_uc010tnl.1_3'UTR|SLC7A8_uc001wiy.2_RNA|SLC7A8_uc010akj.2_3'UTR	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TTGAGCCTGTCCCCCCACAAT	0.592													4	2	---	---	---	---	
KIAA0831	22863	broad.mit.edu	37	14	55839024	55839025	+	Intron	INS	-	C	C	rs141913903	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55839024_55839025insC	uc001xbx.1	-						FBXO34_uc001xbv.2_Intron|KIAA0831_uc001xbw.1_Intron	NM_014924	NP_055739	Q6ZNE5	BAKOR_HUMAN	Barkor						autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0						CCCATCTGCCTCCTCTTGCTGG	0.495													4	3	---	---	---	---	
ATP6V1D	51382	broad.mit.edu	37	14	67813840	67813841	+	Intron	DEL	AC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67813840_67813841delAC	uc001xjf.2	-						ATP6V1D_uc001xje.2_Intron	NM_015994	NP_057078	Q9Y5K8	VATD_HUMAN	H(+)-transporting two-sector ATPase						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting two-sector ATPase complex, catalytic domain|vacuolar proton-transporting V-type ATPase complex	protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)|lung(1)	2				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		agctgaaactacaggcacgtgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	90230658	90230658	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90230658delA								FOXN3 (145164 upstream) : C14orf143 (32813 downstream)																							GAAGCTGAGGAAGTGGTAATG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98933355	98933355	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98933355delA								C14orf64 (488894 upstream) : C14orf177 (244595 downstream)																							TGAATCACAGAAAAAAATGCA	0.493													4	2	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102489437	102489437	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102489437delA	uc001yks.2	+						DYNC1H1_uc001ykt.1_3'UTR	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ccacctctacaaaaaaatttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23108635	23108636	+	Intron	INS	-	T	T	rs145228617	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23108635_23108636insT	uc001yvf.2	-											Homo sapiens cDNA clone IMAGE:5275816.																		caatatttaaatttttttaatt	0.129													2	6	---	---	---	---	
ATP10A	57194	broad.mit.edu	37	15	25957684	25957684	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25957684delT	uc010ayu.2	-							NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ATAAGAGAGATTTTTTTTTGC	0.403													4	2	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27319485	27319486	+	Intron	INS	-	A	A	rs143237291	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27319485_27319486insA	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		tcgtcagagccccaagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	30897862	30897862	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30897862delT								FAM7A2 (4962 upstream) : ARHGAP11B (18835 downstream)																							TGCCTTTTTCTTTTTTTTTTC	0.423													8	4	---	---	---	---	
CATSPER2	117155	broad.mit.edu	37	15	43925307	43925308	+	Intron	INS	-	TA	TA	rs150432967	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43925307_43925308insTA	uc001zsh.2	-						STRC_uc010udz.1_5'Flank|CATSPER2_uc010bdm.2_Intron|CATSPER2_uc001zsi.2_Intron|CATSPER2_uc001zsj.2_Intron	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		TGTgtcatccttaactcttctc	0.228													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	48686104	48686105	+	IGR	DEL	TC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48686104_48686105delTC								DUT (50536 upstream) : FBN1 (14400 downstream)																							ACATTATGGGTCTCTCTCTCAG	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62534753	62534753	+	RNA	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62534753delT	uc002ain.1	-	11		c.2894delA			uc002aio.2_5'Flank|uc002aip.2_5'Flank|uc002air.1_5'Flank|uc002ais.2_5'Flank|uc002ait.2_5'Flank|uc002aiu.2_5'Flank|uc002aiv.2_5'Flank|uc002aix.1_5'Flank|uc002aiy.2_5'Flank|uc002aiz.1_5'Flank|uc002aja.2_5'Flank|uc002ajb.2_5'Flank|uc002ajc.2_5'Flank|uc002ajd.2_5'Flank|uc002aje.2_5'Flank|uc002ajf.2_5'Flank|uc010uhn.1_5'Flank|uc002ajg.1_5'Flank					Homo sapiens cDNA FLJ38723 fis, clone KIDNE2010137, weakly similar to GOLGIN-95.																		TTCCCATAACTTTTTTTTTTT	0.323													4	2	---	---	---	---	
PTPLAD1	51495	broad.mit.edu	37	15	65852386	65852386	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65852386delT	uc002apc.2	+						PTPLAD1_uc002apb.1_Intron|PTPLAD1_uc010uiw.1_Intron	NM_016395	NP_057479	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain						activation of JUN kinase activity|fatty acid biosynthetic process|I-kappaB kinase/NF-kappaB cascade|Rac protein signal transduction	endoplasmic reticulum membrane|integral to membrane	GTPase activator activity|lyase activity|protein binding				0						GGCTGTGttgttttttttttt	0.144													6	3	---	---	---	---	
ZWILCH	55055	broad.mit.edu	37	15	66808185	66808186	+	Intron	DEL	TC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66808185_66808186delTC	uc002aqb.2	+						RPL4_uc002apx.2_Intron|ZWILCH_uc010bhu.1_Intron|ZWILCH_uc002aqa.2_Intron|ZWILCH_uc010bhv.2_Intron	NM_017975	NP_060445	Q9H900	ZWILC_HUMAN	Zwilch						cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding			ovary(1)	1						gcacttatcttccctttctcta	0.015													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70780296	70780296	+	IGR	DEL	C	-	-	rs35268652		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70780296delC								TLE3 (390040 upstream) : UACA (166599 downstream)																							AGCCACCTAACCCAATTCCTT	0.274											OREG0023242	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PDE8A	5151	broad.mit.edu	37	15	85678303	85678303	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85678303delG	uc002blh.2	+						PDE8A_uc002bli.2_Intron|PDE8A_uc010bnc.2_Intron|PDE8A_uc010bnd.2_Intron|PDE8A_uc002blj.2_Intron|PDE8A_uc002blk.2_Intron|PDE8A_uc002bll.2_Intron	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			GTGCAAGCATGGGAACGTTCT	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85787616	85787616	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85787616delG	uc010upj.1	+						uc010upk.1_5'Flank	NM_198181	NP_937824			golgi autoantigen, golgin subfamily a, 6D-like																		TTTTTTTTTTGAGAATCCAGA	0.512													4	2	---	---	---	---	
LUC7L	55692	broad.mit.edu	37	16	240191	240191	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:240191delC	uc002cgc.1	-						LUC7L_uc002cga.1_Intron|LUC7L_uc002cgd.1_Intron|LUC7L_uc002cge.1_Intron|LUC7L_uc002cgb.1_Intron	NM_201412	NP_958815	Q9NQ29	LUC7L_HUMAN	LUC7-like isoform b								metal ion binding			central_nervous_system(1)	1		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				ACTATGAGGGCCCCACCCCTC	0.488													4	2	---	---	---	---	
IFT140	9742	broad.mit.edu	37	16	1597309	1597310	+	Intron	INS	-	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1597309_1597310insA	uc002cmb.2	-						IFT140_uc002clz.2_Intron|TMEM204_uc002cmc.2_Intron|TMEM204_uc002cmd.2_Intron|TMEM204_uc010brr.1_Intron	NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				AAGCTGACTTGTAGAAGTCCGC	0.520													4	2	---	---	---	---	
CORO7	79585	broad.mit.edu	37	16	4397803	4397803	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4397803delG	uc002cwf.2	-						CORO7_uc002cwe.2_Intron|TIMM16_uc002cwd.2_Intron	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						CAGCTGACTTGGCATCCAACT	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	7767025	7767025	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7767025delA								A2BP1 (3685 upstream) : TMEM114 (852478 downstream)																							GGCTCTAAAGAAAAAAAAAAT	0.473													4	2	---	---	---	---	
KIAA0430	9665	broad.mit.edu	37	16	15700399	15700400	+	Intron	DEL	CT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15700399_15700400delCT	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						CCTGCCTCTCCTCTCTCTCTCT	0.520													4	2	---	---	---	---	
ABCC1	4363	broad.mit.edu	37	16	16090951	16090952	+	Intron	DEL	TT	-	-	rs67820374		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16090951_16090952delTT	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	GCGCtttctctttttttttttt	0.277													4	2	---	---	---	---	
RRN3P1	730092	broad.mit.edu	37	16	21823255	21823255	+	Intron	DEL	A	-	-	rs113316739		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21823255delA	uc010vbl.1	-						uc002diq.3_Intron|RRN3P1_uc002djl.2_Intron	NR_003370				SubName: Full=Putative uncharacterized protein ENSP00000219758;												0						GAACAGCTATAAAAAAAGTTA	0.284													21	13	---	---	---	---	
DCTN5	84516	broad.mit.edu	37	16	23672834	23672835	+	Intron	INS	-	T	T	rs149908072	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23672834_23672835insT	uc002dly.1	+							NM_032486	NP_115875	Q9BTE1	DCTN5_HUMAN	dynactin 5							centrosome	transferase activity			upper_aerodigestive_tract(1)	1				GBM - Glioblastoma multiforme(48;0.0156)		gaggtcaggagtttgagaccag	0.035													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33941513	33941513	+	IGR	DEL	G	-	-	rs140215358		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33941513delG								None (None upstream) : MIR1826 (23995 downstream)																							GGTCTACAAAGCATTTGATTT	0.308													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34720247	34720247	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34720247delC								LOC146481 (5280 upstream) : None (None downstream)																							TCCTCGAAGTCCCACTGAGCC	0.592													4	2	---	---	---	---	
PHKB	5257	broad.mit.edu	37	16	47598870	47598870	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47598870delT	uc002eev.3	+						PHKB_uc002eeu.3_Intron	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				tctgtgtgtctttttttTTTT	0.194													9	8	---	---	---	---	
CDH5	1003	broad.mit.edu	37	16	66406315	66406315	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66406315delG	uc002eom.3	+							NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		AGAGGAGAGAGGACAGCAAGT	0.493													4	2	---	---	---	---	
CA7	766	broad.mit.edu	37	16	66887038	66887044	+	Intron	DEL	TAAGTCT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66887038_66887044delTAAGTCT	uc002eqi.2	+						uc002eqh.2_Intron|CA7_uc002eqj.2_Intron	NM_005182	NP_005173	P43166	CAH7_HUMAN	carbonic anhydrase VII isoform 1						one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		CATTTGCTGATAAGTCTTAGCTAGATG	0.493													5	3	---	---	---	---	
CTRL	1506	broad.mit.edu	37	16	67968174	67968174	+	5'Flank	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67968174delG	uc002euw.2	-							NM_001907	NP_001898	P40313	CTRL_HUMAN	chymotrypsin-like precursor						digestion|proteolysis	extracellular space	serine-type endopeptidase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		GTGGAGTGGTGGGGGAGCCTT	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	77255785	77255786	+	IGR	INS	-	TTTT	TTTT	rs71382658		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77255785_77255786insTTTT								SYCE1L (8809 upstream) : ADAMTS18 (60240 downstream)																							CTCTCTCTCTCttttttttttt	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	84317711	84317712	+	IGR	INS	-	T	T	rs150669297	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84317711_84317712insT								KCNG4 (44355 upstream) : WFDC1 (10689 downstream)																							GAAAGACGGCCTTTTTTTCCTG	0.599													2	5	---	---	---	---	
NXN	64359	broad.mit.edu	37	17	825084	825085	+	Intron	INS	-	T	T			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:825084_825085insT	uc002fsa.2	-							NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		GGCCCAGGCTCTCTCCCTCATT	0.446													2	4	---	---	---	---	
FGF11	2256	broad.mit.edu	37	17	7348220	7348220	+	3'UTR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7348220delC	uc002ggz.2	+	5					FGF11_uc010vtw.1_3'UTR|FGF11_uc010cmi.2_3'UTR|FGF11_uc010vtx.1_3'UTR|FGF11_uc002gha.3_3'UTR|CHRNB1_uc002ghb.2_5'Flank|CHRNB1_uc010vty.1_5'Flank|CHRNB1_uc010vtz.1_5'Flank	NM_004112	NP_004103	Q92914	FGF11_HUMAN	fibroblast growth factor 11						cell-cell signaling|nervous system development|signal transduction		growth factor activity				0		Prostate(122;0.157)				GGTCTCCACTCCAGCTTTCTC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	8596551	8596551	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8596551delG								MYH10 (62515 upstream) : CCDC42 (36696 downstream)																							TCCTTTTGGTGGGTTCTTAGT	0.473													4	2	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11865995	11865997	+	Intron	DEL	CTG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11865995_11865997delCTG	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCAGCTATCTCTGCTGCTGCTGC	0.084													10	7	---	---	---	---	
SREBF1	6720	broad.mit.edu	37	17	17717348	17717348	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17717348delC	uc002gru.1	-						SREBF1_uc002gro.3_5'Flank|SREBF1_uc002grp.1_Intron|SREBF1_uc002grq.1_Intron|SREBF1_uc002grr.1_Intron|SREBF1_uc002grs.1_Intron|SREBF1_uc002grt.1_Intron|MIR33B_hsa-mir-33b|MI0003646_5'Flank	NM_004176	NP_004167	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription						cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|sterol response element binding			skin(1)	1						cccccctcctcccagggatgg	0.453													4	2	---	---	---	---	
SLC5A10	125206	broad.mit.edu	37	17	18856048	18856048	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18856048delG	uc002guu.1	+						SLC5A10_uc002gur.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron|uc002gus.1_Intron	NM_001042450	NP_001035915	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/glucose						sodium ion transport|transmembrane transport	integral to membrane	transporter activity			ovary(1)	1						ggagggccctgggaactgggg	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21365888	21365888	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21365888delT								KCNJ12 (42709 upstream) : C17orf51 (65684 downstream)																							tccagcccactttttttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	26011093	26011093	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26011093delC								LGALS9 (34508 upstream) : NOS2 (72700 downstream)																							CTGAGGTGCTCCCCCTGCACA	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	30439692	30439693	+	IGR	INS	-	GAGGC	GAGGC	rs150029068	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30439692_30439693insGAGGC								LRRC37B (59175 upstream) : RHOT1 (29780 downstream)																							GGGCCAGCGCTGAGGCCGCCGC	0.589													3	3	---	---	---	---	
HNF1B	6928	broad.mit.edu	37	17	36092672	36092672	+	Intron	DEL	A	-	-	rs3837868		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36092672delA	uc002hok.3	-						HNF1B_uc010wdi.1_Intron|HNF1B_uc010cve.1_Intron	NM_000458	NP_000449	P35680	HNF1B_HUMAN	hepatocyte nuclear factor 1-beta isoform 1						endocrine pancreas development|genitalia development|kidney development|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric nephron tubule development|regulation of pronephros size	nucleus	DNA binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CCAATCGTTTAAAAAAAAAAT	0.214									Hereditary_Prostate_Cancer				4	4	---	---	---	---	
AARSD1	80755	broad.mit.edu	37	17	41123984	41123985	+	Intron	INS	-	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41123984_41123985insG	uc002icf.2	-						AARSD1_uc002icd.2_Intron|AARSD1_uc002ice.2_Intron|AARSD1_uc010whg.1_Intron|AARSD1_uc002icg.2_Intron|AARSD1_uc002ich.2_Intron|AARSD1_uc010whh.1_Intron	NM_025267	NP_079543	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1						alanyl-tRNA aminoacylation	cytoplasm	alanine-tRNA ligase activity|ATP binding|metal ion binding|nucleic acid binding				0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		aggcaggaggatcacaaggtca	0.094													3	3	---	---	---	---	
BRCA1	672	broad.mit.edu	37	17	41247621	41247621	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41247621delA	uc002icq.2	-						BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Intron|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Intron|BRCA1_uc002ict.2_Intron|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Intron|BRCA1_uc002ide.1_Intron|BRCA1_uc010cyy.1_Intron|BRCA1_uc010whs.1_Intron|BRCA1_uc010cyz.2_Intron|BRCA1_uc010cza.2_Intron|BRCA1_uc010wht.1_Intron	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		acaaacaaacaaaaaaaaAAA	0.164			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			4	4	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45691346	45691346	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45691346delT	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010wkv.1_Intron|NPEPPS_uc002ils.1_Intron	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						CTTATTATTAttttttttttt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	45945418	45945418	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45945418delT								SP6 (12178 upstream) : SP2 (28098 downstream)																							ACACATCCTCTTAGGTCATCA	0.582													4	2	---	---	---	---	
CA10	56934	broad.mit.edu	37	17	49745458	49745458	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49745458delT	uc002itw.3	-						CA10_uc002itu.3_Intron|CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)			GGCCTCTGTCTTTTGCCAGGG	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	61550226	61550227	+	IGR	INS	-	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61550226_61550227insC								CYB561 (26504 upstream) : ACE (4207 downstream)																							acttcatctcaccccatcgtat	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72547748	72547749	+	IGR	DEL	GT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72547748_72547749delGT								CD300C (5466 upstream) : CD300LD (28362 downstream)																							CTGGTGCTGAGTGAAGGGGGCT	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	75244142	75244143	+	IGR	INS	-	G	G			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75244142_75244143insG								SEC14L1 (30963 upstream) : SEPT9 (33349 downstream)																							AGGATGTGGCTGGGGGCCCCTC	0.554													4	2	---	---	---	---	
CANT1	124583	broad.mit.edu	37	17	77003479	77003479	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77003479delA	uc002jwn.2	-						CANT1_uc002jwk.2_Intron|CANT1_uc002jwj.2_Intron|CANT1_uc002jwl.2_Intron	NM_001159772	NP_001153244	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity				0			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			TTCAACAAACAATAGAAAAAT	0.403			T	ETV4	prostate								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77721545	77721546	+	IGR	INS	-	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77721545_77721546insC								ENPP7 (5525 upstream) : CBX2 (30447 downstream)																							GCTCCTCGGATCCGGCGCCACC	0.738													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78662351	78662351	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78662351delT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						agcctcacaGTTGTGCTCAAA	0.353													4	2	---	---	---	---	
ELP2	55250	broad.mit.edu	37	18	33723066	33723066	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33723066delT	uc002kzk.1	+						ELP2_uc010xcg.1_Intron|ELP2_uc002kzl.1_Intron|ELP2_uc002kzm.1_Intron|ELP2_uc010xch.1_Intron|ELP2_uc002kzn.1_Intron|ELP2_uc002kzo.1_Intron	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2						regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						tttttctttcttttttttttt	0.159													4	3	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47352665	47352666	+	3'UTR	INS	-	A	A	rs149289525	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352665_47352666insA	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTAGGTACAAAAAATAATG	0.347													10	6	---	---	---	---	
NEDD4L	23327	broad.mit.edu	37	18	55725982	55725982	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55725982delG	uc002lgy.2	+						NEDD4L_uc002lgz.2_Intron|NEDD4L_uc002lgx.2_Intron|NEDD4L_uc010xee.1_Intron|NEDD4L_uc002lha.1_Intron	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally						cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						GTTCAAAGCTGGGCACTCTGT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76588723	76588723	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76588723delT								None (None upstream) : SALL3 (151552 downstream)																							CACTGAGTTCTTACAAAAGCC	0.468													4	2	---	---	---	---	
SHC2	25759	broad.mit.edu	37	19	444269	444270	+	Intron	DEL	CT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:444269_444270delCT	uc002loq.3	-							NM_012435	NP_036567	P98077	SHC2_HUMAN	SHC (Src homology 2 domain containing)						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol					0		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCCTGTCCCTAGCACTGGAT	0.426													4	2	---	---	---	---	
OR1M1	125963	broad.mit.edu	37	19	9203755	9203756	+	5'Flank	INS	-	AC	AC	rs4804095	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9203755_9203756insAC	uc010xkj.1	+							NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						attctatatatacacacacaca	0.213													4	3	---	---	---	---	
ELL	8178	broad.mit.edu	37	19	18614721	18614721	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18614721delC	uc002njh.2	-						ELL_uc010ebq.2_Intron	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		TGCTGCCTGGCCAAGGTTAAG	0.612			T	MLL	AL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	23709386	23709386	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23709386delG								ZNF91 (131117 upstream) : ZNF675 (126323 downstream)																							gaggacctaaggggctgtgaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24362114	24362114	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24362114delA								LOC100101266 (15865 upstream) : None (None downstream)																							ggaagtggagaaaaaaaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	29553570	29553571	+	IGR	INS	-	A	A	rs144439109	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29553570_29553571insA								LOC148145 (93515 upstream) : UQCRFS1 (144596 downstream)																							GCTGATTGCACGGGGGGGAAGG	0.475													2	6	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	30959159	30959159	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30959159delC	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AATGCTGAGACCAGGGCAAAG	0.507													4	2	---	---	---	---	
ITPKC	80271	broad.mit.edu	37	19	41243447	41243449	+	Intron	DEL	CCT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41243447_41243449delCCT	uc002oot.2	+							NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C							cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAATCCAAGCCCTCACTCCTCTG	0.433													20	10	---	---	---	---	
KLC3	147700	broad.mit.edu	37	19	45851634	45851636	+	Intron	DEL	GAG	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45851634_45851636delGAG	uc002pbf.1	+						KLC3_uc010ejy.1_Intron|KLC3_uc002pbg.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GCCAGGCAGAGAGGAGTCAGAGA	0.621													4	2	---	---	---	---	
NOVA2	4858	broad.mit.edu	37	19	46472840	46472840	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46472840delG	uc002pdv.2	-							NM_002516	NP_002507	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2							nucleus	RNA binding				0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		GCTACGTTGAGGGTGTGAGAT	0.323													4	2	---	---	---	---	
DHDH	27294	broad.mit.edu	37	19	49443612	49443612	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49443612delA	uc002ple.1	+							NM_014475	NP_055290	Q9UQ10	DHDH_HUMAN	dimeric dihydrodiol dehydrogenase						carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		actccatctcaaaaaaaaaaa	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49759286	49759286	+	IGR	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49759286delA								TRPM4 (44195 upstream) : SLC6A16 (33608 downstream)																							cGTTCCGGTGACACAGGTAAG	0.284													4	2	---	---	---	---	
KLK5	25818	broad.mit.edu	37	19	51452567	51452568	+	Intron	INS	-	C	C			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51452567_51452568insC	uc002pue.2	-						KLK5_uc002puf.2_Intron|KLK5_uc002pug.2_Intron	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein						epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		CCCATTCCCAACCCTAATTCTT	0.337													4	2	---	---	---	---	
KLK10	5655	broad.mit.edu	37	19	51516024	51516024	+	3'UTR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51516024delT	uc002puy.2	-	6					KLK10_uc002puz.2_3'UTR|KLK10_uc002pva.2_3'UTR	NM_145888	NP_665895	O43240	KLK10_HUMAN	kallikrein-related peptidase 10 preproprotein						cell cycle|proteolysis	extracellular region	serine-type endopeptidase activity			lung(2)	2		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		ataggtgctattaaaaaaaaa	0.000													4	2	---	---	---	---	
ETFB	2109	broad.mit.edu	37	19	51855530	51855530	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51855530delC	uc002pwh.2	-						ETFB_uc002pwg.2_Intron	NM_001985	NP_001976	P38117	ETFB_HUMAN	electron-transfer-flavoprotein, beta polypeptide						respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity				0		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000226)|OV - Ovarian serous cystadenocarcinoma(262;0.00661)		tcatagaactcccatagctcc	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54007435	54007444	+	Intron	DEL	TGAACATCTC	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54007435_54007444delTGAACATCTC	uc002qbv.2	+											full-length cDNA clone CS0DI081YH01 of Placenta Cot 25-normalized of Homo sapiens (human).																		CAGCTGGTGGTGAACATCTCTGCAATGATC	0.457													5	4	---	---	---	---	
TMEM150B	284417	broad.mit.edu	37	19	55824818	55824819	+	Intron	DEL	TG	-	-	rs140754447		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55824818_55824819delTG	uc010esw.1	-						TMEM150B_uc010yfu.1_Intron|TMEM150B_uc010yfv.1_Intron|TMEM150B_uc010yfw.1_Intron	NM_001085488	NP_001078957	A6NC51	T150B_HUMAN	transmembrane protein 150B precursor							integral to membrane					0						AGCCTCGGACTGTGTTTTGCAA	0.545													4	3	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56756952	56756952	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56756952delG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						AGTCATCACAGAGAATGAAGC	0.478													4	2	---	---	---	---	
ZIK1	284307	broad.mit.edu	37	19	58096807	58096808	+	Intron	DEL	GT	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58096807_58096808delGT	uc002qpg.2	+						ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Intron|ZIK1_uc002qpi.2_Intron|ZIK1_uc002qpj.2_Intron	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		tactctgtgggtgtgatggagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19804033	19804033	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19804033delT								SLC24A3 (100493 upstream) : RIN2 (66177 downstream)																							CTCTGCCTGCTTTTTTTTTTT	0.388													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	22692083	22692083	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22692083delT								FOXA2 (125982 upstream) : SSTR4 (323974 downstream)																							agtgttgaggtttccctctaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25908502	25908503	+	IGR	INS	-	TA	TA	rs112698831		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25908502_25908503insTA								FAM182B (59716 upstream) : LOC100134868 (81932 downstream)																							gtgtatgtatgtgtgtgtgtgt	0.094													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37251790	37251791	+	IGR	INS	-	GG	GG			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37251790_37251791insGG								ADIG (34686 upstream) : SLC32A1 (101314 downstream)																							ctggccctgctctgtcCCCTGC	0.257													6	4	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41351133	41351133	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41351133delG	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAAATGGGCTGGCTAGAAACT	0.493													4	2	---	---	---	---	
SGK2	10110	broad.mit.edu	37	20	42212638	42212638	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42212638delT	uc002xkv.2	+						SGK2_uc002xkt.2_Intron|SGK2_uc002xkr.2_Intron|SGK2_uc010ggm.2_Intron|SGK2_uc002xks.2_Intron|SGK2_uc002xku.2_Intron	NM_016276	NP_057360	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2 isoform						intracellular protein kinase cascade|response to oxidative stress		ATP binding|potassium channel regulator activity|protein serine/threonine kinase activity|sodium channel regulator activity			lung(3)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	6		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			attctatgtgtttttttttaa	0.000													4	2	---	---	---	---	
EYA2	2139	broad.mit.edu	37	20	45789429	45789429	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45789429delT	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				ctcCCCTCTCTTTTTTTTTTT	0.219													4	2	---	---	---	---	
STAU1	6780	broad.mit.edu	37	20	47751709	47751711	+	Intron	DEL	AAG	-	-	rs76353114		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47751709_47751711delAAG	uc002xud.2	-						STAU1_uc002xua.2_Intron|STAU1_uc002xub.2_Intron|STAU1_uc002xuc.2_Intron|STAU1_uc002xue.2_Intron|STAU1_uc002xuf.2_Intron|STAU1_uc002xug.2_Intron	NM_017453	NP_059347	O95793	STAU1_HUMAN	staufen isoform b							microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			GGTGGGAGAAAAGAAAGTGGGTT	0.360													8	5	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	52039574	52039574	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52039574delA	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			taatttgcccaaaaaatcaca	0.239													4	2	---	---	---	---	
CHRNA4	1137	broad.mit.edu	37	20	61988398	61988399	+	Intron	INS	-	T	T	rs59061351	by1000genomes	TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61988398_61988399insT	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_Intron|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	ACAGGACCACAACCCACAGGAC	0.629													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62114518	62114518	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62114518delC								KCNQ2 (10525 upstream) : EEF1A2 (4848 downstream)																							GTGCCTGCAGCCCCACTCCGG	0.602													4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37556164	37556164	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37556164delC	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TACATGGtttctttttttttt	0.234													4	2	---	---	---	---	
KCNJ6	3763	broad.mit.edu	37	21	39028740	39028740	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39028740delA	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	AGGCTGAGTCAAAGTGGTTGG	0.602													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	45597070	45597070	+	IGR	DEL	C	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45597070delC								C21orf33 (31466 upstream) : ICOSLG (49654 downstream)																							ggagctgagtccaggagctga	0.259													4	2	---	---	---	---	
psiTPTE22	387590	broad.mit.edu	37	22	17088404	17088404	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17088404delT	uc010gqq.2	+						psiTPTE22_uc002zls.1_Intron|psiTPTE22_uc002zlq.3_Intron|psiTPTE22_uc002zlr.2_Intron					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						TTGCCTTTACTTTTTTTTTTC	0.289													10	8	---	---	---	---	
C22orf25	128989	broad.mit.edu	37	22	20039700	20039700	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20039700delA	uc010grw.1	+						C22orf25_uc002zrb.1_Intron|C22orf25_uc002zrc.1_Intron|C22orf25_uc002zrd.1_Intron|C22orf25_uc002zre.2_Intron|C22orf25_uc010grx.2_Intron|C22orf25_uc011ahe.1_Intron|C22orf25_uc011ahf.1_Intron|C22orf25_uc011ahg.1_Intron|C22orf25_uc002zrg.2_Intron|C22orf25_uc011ahh.1_Intron|C22orf25_uc002zrf.2_Intron|C22orf25_uc011ahi.1_Intron|C22orf25_uc010gry.1_Intron|C22orf25_uc002zrh.1_Intron	NM_152906	NP_690870	Q6ICL3	CV025_HUMAN	hypothetical protein LOC128989												0	Colorectal(54;0.0533)					GCCCAAGTGGAAGGATGTGTT	0.592													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	29821278	29821278	+	IGR	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29821278delT								AP1B1 (36709 upstream) : RFPL1S (11728 downstream)																							ACTTTGTCCCTTTTTTTGCAT	0.348													4	2	---	---	---	---	
LIF	3976	broad.mit.edu	37	22	30641974	30641974	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30641974delG	uc003agz.2	-						LIF_uc011aks.1_Intron|uc003aha.2_5'Flank	NM_002309	NP_002300	P15018	LIF_HUMAN	leukemia inhibitory factor (cholinergic						immune response|leukemia inhibitory factor signaling pathway|negative regulation of hormone secretion|positive regulation of cell proliferation|positive regulation of macrophage differentiation|positive regulation of MAPKKK cascade|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of metanephric nephron tubule epithelial cell differentiation		cytokine activity|growth factor activity|leukemia inhibitory factor receptor binding				0			Epithelial(10;0.171)			TGAAGATGGTGGGGGCCGGGG	0.682													4	2	---	---	---	---	
MFNG	4242	broad.mit.edu	37	22	37881036	37881037	+	Intron	INS	-	GC	GC			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37881036_37881037insGC	uc003ass.1	-						MFNG_uc011ani.1_Intron|MFNG_uc011anj.1_Intron|CARD10_uc003ast.1_Intron	NM_002405	NP_002396	O00587	MFNG_HUMAN	O-fucosylpeptide						pattern specification process	extracellular space|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity			lung(1)	1	Melanoma(58;0.0574)					tgtgtgtgtgtACCCATTCTCC	0.480													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	40120026	40120026	+	IGR	DEL	G	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40120026delG								CACNA1I (34288 upstream) : ENTHD1 (19024 downstream)																							TGGACCACGTGGGTCCATGAC	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	3856195	3856196	+	IGR	DEL	GT	-	-	rs36108839		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3856195_3856196delGT								PRKX (224534 upstream) : None (None downstream)																							gaaagcctgagtgtgtgtgtgt	0.208													4	3	---	---	---	---	
SYAP1	94056	broad.mit.edu	37	X	16772087	16772087	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16772087delT	uc004cxp.2	+						SYAP1_uc004cxo.2_Intron|SYAP1_uc011miv.1_Intron	NM_032796	NP_116185	Q96A49	SYAP1_HUMAN	SYAP1 protein											skin(1)	1	Hepatocellular(33;0.0997)					GCCACCCCCCTGTGTGGACAC	0.428													4	2	---	---	---	---	
ITM2A	9452	broad.mit.edu	37	X	78616443	78616444	+	3'UTR	INS	-	T	T	rs147492416		TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78616443_78616444insT	uc004edh.2	-	6					ITM2A_uc011mqr.1_3'UTR	NM_004867	NP_004858	O43736	ITM2A_HUMAN	integral membrane protein 2A							integral to membrane	protein binding			lung(2)	2						GTGGTTAGTAGTTTTTTTTTTT	0.257													6	16	---	---	---	---	
NDUFA1	4694	broad.mit.edu	37	X	119007009	119007009	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119007009delT	uc004esc.3	+						RNF113A_uc004esb.2_5'Flank	NM_004541	NP_004532	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			large_intestine(1)	1					NADH(DB00157)	TAGATATTTCttttttttttt	0.269													4	3	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138678585	138678586	+	Intron	INS	-	A	A			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138678585_138678586insA	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					taagattttttaaaaaaaACAA	0.158													10	5	---	---	---	---	
F8	2157	broad.mit.edu	37	X	154148489	154148489	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-02D-1386-10	TCGA-B2-4098-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154148489delT	uc004fmt.2	-							NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor						acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	gctttctttcttttttttttt	0.109													5	3	---	---	---	---	
GRHL3	57822	broad.mit.edu	37	1	24671698	24671698	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671698delC	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		TACACCTGTGCCCCCTCCACA	0.672													4	2	---	---	---	---	
KDM4A	9682	broad.mit.edu	37	1	44160187	44160187	+	Intron	DEL	A	-	-	rs71897447		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44160187delA	uc001cjx.2	+						KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						actccgtctcaaaaaaaaaaa	0.199													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	111391696	111391696	+	IGR	DEL	T	-	-	rs34558917		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111391696delT								KCNA3 (174041 upstream) : CD53 (22125 downstream)																							GCGGTAGGCCttttttttttt	0.328													5	3	---	---	---	---	
MYOC	4653	broad.mit.edu	37	1	171608072	171608072	+	Intron	DEL	A	-	-	rs111827292		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171608072delA	uc001ghu.2	-						MYOC_uc010pmk.1_Intron	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor						anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					tgtctttgctaaaaacacaaa	0.000													3	5	---	---	---	---	
MR1	3140	broad.mit.edu	37	1	181024113	181024116	+	Intron	DEL	AAAC	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181024113_181024116delAAAC	uc001goq.1	+						MR1_uc001gor.1_Intron|MR1_uc001gos.1_Intron|MR1_uc010pns.1_Intron	NM_001531	NP_001522	Q95460	HMR1_HUMAN	major histocompatibility complex, class						antigen processing and presentation of peptide antigen via MHC class I|immune response	endoplasmic reticulum|extracellular region|integral to membrane|MHC class I protein complex	MHC class I receptor activity			skin(1)	1						AATGATAGTGAAACAAACAAAAAA	0.275													3	3	---	---	---	---	
GUK1	2987	broad.mit.edu	37	1	228333457	228333458	+	Intron	INS	-	C	C			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228333457_228333458insC	uc001hsh.2	+						GUK1_uc001hsi.2_Intron|GUK1_uc001hsj.2_5'UTR|GUK1_uc010pvv.1_Intron	NM_000858	NP_000849	Q16774	KGUA_HUMAN	guanylate kinase 1 isoform b						nucleobase, nucleoside and nucleotide interconversion|purine nucleotide metabolic process	cytosol	ATP binding|guanylate kinase activity				0		Prostate(94;0.0405)				TCTTGCACACTCCCCCCCACAC	0.584													3	5	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236647463	236647463	+	3'UTR	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236647463delT	uc001hxu.1	+	6					EDARADD_uc001hxv.1_3'UTR	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CGGCCGTGAATGAGAAGAAGT	0.562													123	58	---	---	---	---	
GPN1	11321	broad.mit.edu	37	2	27861521	27861522	+	Intron	INS	-	T	T	rs144811438	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27861521_27861522insT	uc010ymc.1	+						GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Intron|GPN1_uc010ezg.1_Intron	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a							cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						TCTGGTCCTGGTACTTGGCAGT	0.411													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34041837	34041838	+	IGR	INS	-	CCTCC	CCTCC	rs141683394	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34041837_34041838insCCTCC								MYADML (88553 upstream) : None (None downstream)																							tcttctcttctcctcccctccc	0.000													4	3	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161282846	161282847	+	Intron	INS	-	AAGG	AAGG	rs138498508	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161282846_161282847insAAGG	uc002ubo.2	-						RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						ggaaggaaggaaaggaaggaag	0.099													4	3	---	---	---	---	
C2orf80	389073	broad.mit.edu	37	2	209036457	209036458	+	Intron	INS	-	CCACTCCAT	CCACTCCAT	rs149518601	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209036457_209036458insCCACTCCAT	uc002vcr.2	-							NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073											skin(1)	1						accagtgtgagccaGCCCACTC	0.218													6	3	---	---	---	---	
TEX264	51368	broad.mit.edu	37	3	51728004	51728015	+	Intron	DEL	TTCCTTCCTTCC	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51728004_51728015delTTCCTTCCTTCC	uc010hls.2	+						TEX264_uc003dbk.3_Intron|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Intron|TEX264_uc003dbm.3_Intron	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		ATCCCTttctttccttccttccttccttcctt	0.156													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194284078	194284079	+	IGR	INS	-	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194284078_194284079insT								ATP13A3 (95110 upstream) : TMEM44 (24324 downstream)																							GCCCCCCTCCCttttttttttg	0.267													4	2	---	---	---	---	
FAT1	2195	broad.mit.edu	37	4	187532980	187532980	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187532980delA	uc003izf.2	-							NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						AAAGTTTAACACttttttttt	0.154										HNSCC(5;0.00058)			4	3	---	---	---	---	
FAM193B	54540	broad.mit.edu	37	5	176958227	176958227	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176958227delG	uc003mhs.3	-						FAM193B_uc003mht.2_Intron|FAM193B_uc003mhu.2_Intron|FAM193B_uc003mhv.2_Intron|FAM193B_uc003mhw.2_Intron	NM_019057	NP_061930	E9PET5	E9PET5_HUMAN	hypothetical protein LOC54540												0						CCTGGGGGTTGGGGCGAGGGT	0.622													4	2	---	---	---	---	
AGXT2L2	85007	broad.mit.edu	37	5	177657361	177657361	+	Intron	DEL	T	-	-	rs34888455		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177657361delT	uc003miz.2	-						AGXT2L2_uc003mjc.2_Intron|AGXT2L2_uc003mja.2_Intron|AGXT2L2_uc003mjb.2_Intron	NM_153373	NP_699204	Q8IUZ5	AT2L2_HUMAN	alanine-glyoxylate aminotransferase 2-like 2							mitochondrion	pyridoxal phosphate binding|transaminase activity			pancreas(1)	1	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.181)|all cancers(165;0.235)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	TAAGGAGGACttttttttttt	0.249													4	2	---	---	---	---	
RASGEF1C	255426	broad.mit.edu	37	5	179548318	179548319	+	Intron	INS	-	T	T	rs34192976		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179548318_179548319insT	uc003mlq.2	-						RASGEF1C_uc003mlr.2_Intron|RASGEF1C_uc003mlp.3_Intron	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTAAAAGTACAttttttttttt	0.193													4	3	---	---	---	---	
CDKAL1	54901	broad.mit.edu	37	6	20546402	20546403	+	Intron	DEL	AT	-	-	rs34206163		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20546402_20546403delAT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron|CDKAL1_uc010jpo.1_Intron|CDKAL1_uc003ndb.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			tcttttttcaatatacccaaga	0.000													9	7	---	---	---	---	
ZKSCAN3	80317	broad.mit.edu	37	6	28329301	28329301	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28329301delT	uc003nle.3	+						ZKSCAN3_uc010jrc.2_Intron|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3						positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						TCCAATTTCATTTAAGGATAG	0.383													48	21	---	---	---	---	
BAT3	7917	broad.mit.edu	37	6	31611498	31611499	+	Intron	INS	-	AAA	AAA	rs9281540		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31611498_31611499insAAA	uc003nvg.3	-						BAT3_uc003nvf.3_Intron|BAT3_uc003nvh.3_Intron|BAT3_uc003nvi.3_Intron|BAT3_uc011dnw.1_Intron|BAT3_uc011dnx.1_Intron	NM_004639	NP_004630	P46379	BAG6_HUMAN	HLA-B associated transcript-3 isoform a						apoptosis in response to endoplasmic reticulum stress|brain development|cell differentiation|chromatin modification|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|embryo development|internal peptidyl-lysine acetylation|kidney development|lung development|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|protein stabilization|spermatogenesis|synaptonemal complex assembly|tail-anchored membrane protein insertion into ER membrane|transport|ubiquitin-dependent protein catabolic process	BAT3 complex|nucleus	polyubiquitin binding|proteasome binding|ribosome binding				0						gactccatctcaaaaaaaaaaa	0.173													4	2	---	---	---	---	
KLHL31	401265	broad.mit.edu	37	6	53516197	53516198	+	3'UTR	INS	-	AAAAAAA	AAAAAAA	rs67397082		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53516197_53516198insAAAAAAA	uc003pcb.3	-	3					uc003pcc.1_5'Flank	NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					TGTATTTTGCTaaaaaaaaaaa	0.396											OREG0017507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
ELOVL4	6785	broad.mit.edu	37	6	80631176	80631177	+	Intron	INS	-	AA	AA	rs35137040		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80631176_80631177insAA	uc003pja.3	-						ELOVL4_uc011dyt.1_Intron	NM_022726	NP_073563	Q9GZR5	ELOV4_HUMAN	elongation of very long chain fatty acids-like						fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups			ovary(1)|skin(1)	2		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	gactccatctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
FAM188B	84182	broad.mit.edu	37	7	30891616	30891616	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30891616delT	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron|AQP1_uc011kac.1_5'Flank	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182												0						TTTCCATTTCTTTTTTTTTTC	0.438													5	3	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99032218	99032218	+	Intron	DEL	A	-	-	rs80240572		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99032218delA	uc003uqh.2	-						PTCD1_uc011kiw.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ccgtctcTACaaaaaaaaaaa	0.209													5	3	---	---	---	---	
SPDYE2	441273	broad.mit.edu	37	7	102197784	102197784	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102197784delT	uc011kkx.1	+						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron|POLR2J3_uc011kkw.1_Intron|SPDYE2_uc003vaa.1_Intron	NM_001031618	NP_001026789	Q495Y8	SPDE2_HUMAN	speedy homolog E2												0						TCCTACAGtcttttttttttt	0.289													8	4	---	---	---	---	
DNAJB6	10049	broad.mit.edu	37	7	157177943	157177950	+	Intron	DEL	TAAAATGG	-	-	rs112549325		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157177943_157177950delTAAAATGG	uc003wnk.2	+						DNAJB6_uc003wnj.2_Intron|DNAJB6_uc003wnl.2_Intron|DNAJB6_uc011kvy.1_Intron|DNAJB6_uc011kvz.1_Intron|DNAJB6_uc010lqt.2_Intron	NM_058246	NP_490647	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization|negative regulation of caspase activity|protein folding|response to unfolded protein	nucleus|perinuclear region of cytoplasm	ATPase activator activity|chaperone binding|heat shock protein binding|unfolded protein binding			ovary(2)	2	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		GCAGCATTGTTAAAATGGTAAAATGGAA	0.288													4	2	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	124988404	124988404	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124988404delT	uc003yqw.2	+							NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCAAATCAAATTAATAAAAAT	0.328													37	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68430364	68430365	+	IGR	INS	-	A	A	rs140332329		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68430364_68430365insA								FAM27B (636175 upstream) : MIR1299 (571874 downstream)																							TTATGCAGAAGAAAAAATTAAC	0.322													9	5	---	---	---	---	
DENND1A	57706	broad.mit.edu	37	9	126220283	126220284	+	Intron	INS	-	TT	TT			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126220283_126220284insTT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						ttttcttttccttttttttttt	0.213													4	2	---	---	---	---	
TDRD1	56165	broad.mit.edu	37	10	115985616	115985616	+	Intron	DEL	A	-	-	rs74608976		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115985616delA	uc001lbg.1	+						TDRD1_uc001lbf.2_Intron|TDRD1_uc001lbh.1_Intron|TDRD1_uc001lbi.1_Intron|TDRD1_uc010qsc.1_Intron|TDRD1_uc001lbj.2_Intron	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1						DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		accctgtctcaaaaaaaaaaa	0.114													5	3	---	---	---	---	
GRK5	2869	broad.mit.edu	37	10	121184781	121184784	+	Intron	DEL	ACAC	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121184781_121184784delACAC	uc001led.2	+						GRK5_uc009xzh.2_Intron|GRK5_uc010qta.1_Intron	NM_005308	NP_005299	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5						G-protein signaling, coupled to cAMP nucleotide second messenger|regulation of G-protein coupled receptor protein signaling pathway|tachykinin receptor signaling pathway	cytoplasm|plasma membrane|soluble fraction	ATP binding|G-protein coupled receptor kinase activity|phospholipid binding|protein kinase C binding|signal transducer activity			lung(2)|stomach(1)	3		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		acacacacatacacacacacacac	0.279													4	3	---	---	---	---	
MMP21	118856	broad.mit.edu	37	10	127459418	127459419	+	Intron	INS	-	A	A	rs77251184		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127459418_127459419insA	uc001liu.2	-							NM_147191	NP_671724	Q8N119	MMP21_HUMAN	matrix metalloproteinase 21 preproprotein						proteolysis	extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)	2		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ccagtgtctacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	86736377	86736378	+	IGR	INS	-	AA	AA			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86736377_86736378insAA								FZD4 (69944 upstream) : TMEM135 (12687 downstream)																							gactccatctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
GXYLT1	283464	broad.mit.edu	37	12	42491075	42491076	+	Intron	INS	-	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42491075_42491076insA	uc001rms.3	-						GXYLT1_uc001rmt.3_Intron	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3						O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						ttgttttcaggaaaaaaaaatg	0.000													4	2	---	---	---	---	
NR4A1	3164	broad.mit.edu	37	12	52449188	52449189	+	Intron	INS	-	AG	AG	rs146999133	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52449188_52449189insAG	uc001rzs.2	+						NR4A1_uc010sno.1_Intron|NR4A1_uc001rzr.2_3'UTR|NR4A1_uc009zmb.1_3'UTR|NR4A1_uc001rzt.2_Intron|NR4A1_uc009zmc.2_5'Flank	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CCGGGACACTCGGGCCCATGGG	0.629													4	3	---	---	---	---	
TSPAN19	144448	broad.mit.edu	37	12	85423547	85423547	+	Frame_Shift_Del	DEL	C	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85423547delC	uc009zsj.2	-	3	190	c.89delG	c.(88-90)GGAfs	p.G30fs		NM_001100917	NP_001094387	P0C672	TSN19_HUMAN	tetraspanin 19	30	Helical; (Potential).					integral to membrane				ovary(1)	1						TGCACCAAATCCCATGAATAA	0.259													4	2	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109604483	109604484	+	Intron	DEL	CC	-	-	rs3858708		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109604483_109604484delCC	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	aaaaaaaaaaCCGAAGGTGCTT	0.297													4	2	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119957680	119957683	+	Intron	DEL	TGTA	-	-	rs71900111	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957680_119957683delTGTA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		tgtgtgtgtgtgtatacctgtgtg	0.167													8	6	---	---	---	---	
NCOR2	9612	broad.mit.edu	37	12	124812275	124812277	+	Intron	DEL	AGG	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124812275_124812277delAGG	uc010tay.1	-						NCOR2_uc010taz.1_Intron|NCOR2_uc010tax.1_Intron	NM_006312	NP_006303	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gagagagggaaggaggaggagga	0.350													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	20444690	20444691	+	IGR	INS	-	CTTC	CTTC	rs145125818	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20444690_20444691insCTTC								ZMYM5 (6914 upstream) : ZMYM2 (88119 downstream)																							tttctttctttcttccttcctt	0.005													3	3	---	---	---	---	
NBEA	26960	broad.mit.edu	37	13	35770236	35770236	+	Frame_Shift_Del	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35770236delT	uc001uvb.2	+	31	5369	c.5163delT	c.(5161-5163)AATfs	p.N1721fs	NBEA_uc010abi.2_Frame_Shift_Del_p.N377fs	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1721						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TAACTGAAAATCCTAGTGAAA	0.423													58	30	---	---	---	---	
MYEF2	50804	broad.mit.edu	37	15	48451631	48451632	+	Intron	DEL	GT	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48451631_48451632delGT	uc001zwi.3	-						MYEF2_uc001zwj.3_Intron|MYEF2_uc001zwl.2_Intron	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		AACCTtgtgcgtgtgtgtgtgt	0.203													5	4	---	---	---	---	
CCPG1	9236	broad.mit.edu	37	15	55758877	55758877	+	Intron	DEL	A	-	-	rs11286206		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55758877delA	uc002acy.2	-						DYX1C1_uc010ugh.1_Intron|DYX1C1_uc010ugi.1_Intron|DYX1C1_uc002adb.2_Intron|DYX1C1_uc002adc.2_Intron|DYX1C1_uc002add.2_Intron	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2						cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		TGTAAATTTCAAAAGAAAGCA	0.348													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102312241	102312241	+	RNA	DEL	A	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102312241delA	uc010utk.1	+	1		c.34delA			uc010utl.1_5'Flank|uc010utm.1_5'Flank|uc002ccq.3_5'Flank|uc010utn.1_5'Flank|uc002ccs.1_5'Flank|uc010uto.1_5'Flank|uc002cct.1_5'Flank|uc002ccu.2_5'Flank|uc002ccv.1_5'Flank|uc002ccw.2_5'Flank					DQ593367																		AGTGGCCGGGAAATTTGCTGT	0.592													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1075431	1075454	+	IGR	DEL	TGGAGGGTGCTGAGGTCCCTGGTG	-	-	rs72021683	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1075431_1075454delTGGAGGGTGCTGAGGTCCCTGGTG								SOX8 (38453 upstream) : LOC146336 (38630 downstream)																							GTCCCCGGCTTGGAGGGTGCTGAGGTCCCTGGTGTGGAGGGTGC	0.692													4	2	---	---	---	---	
IFT140	9742	broad.mit.edu	37	16	1656866	1656866	+	Intron	DEL	C	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1656866delC	uc002cmb.2	-							NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				cacgcatacacccccccacat	0.080													2	9	---	---	---	---	
IL4R	3566	broad.mit.edu	37	16	27367406	27367406	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27367406delT	uc002don.2	+						IL4R_uc002dop.3_Intron|IL4R_uc010bxy.2_Intron|IL4R_uc002doo.2_Intron	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CACttttttcttttttttttt	0.214													5	3	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58540061	58540062	+	Intron	DEL	TC	-	-	rs72499708		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58540061_58540062delTC	uc002eno.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc002enm.2_Intron|NDRG4_uc010vif.1_Intron|NDRG4_uc010cdk.2_Intron|NDRG4_uc010vig.1_Intron|NDRG4_uc010vih.1_Intron|NDRG4_uc010vii.1_Intron|NDRG4_uc002enp.2_Intron|NDRG4_uc002enq.1_5'UTR	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						tgtgtgtgtgtctgtgtgtgtg	0.307													4	3	---	---	---	---	
SF3B3	23450	broad.mit.edu	37	16	70565170	70565171	+	Intron	INS	-	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70565170_70565171insA	uc002ezf.2	+							NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				gactccatctcaaaaaaaaacg	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	81762150	81762151	+	IGR	INS	-	CCTTCCTT	CCTTCCTT	rs71388371	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81762150_81762151insCCTTCCTT								CMIP (16785 upstream) : PLCG2 (50779 downstream)																							ctccctccctcccttccttcct	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255723	87255725	+	Intron	DEL	CAC	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255723_87255725delCAC	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		ccaccaccatcaccaccaccacc	0.000													4	3	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1387740	1387754	+	Intron	DEL	GGGCCTGGGTGCTGA	-	-	rs71886519		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1387740_1387754delGGGCCTGGGTGCTGA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGGGTGCGGGGGGCCTGGGTGCTGAGGGCCTGGGT	0.698													3	5	---	---	---	---	
SUPT6H	6830	broad.mit.edu	37	17	27023603	27023604	+	Intron	INS	-	AAAA	AAAA			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27023603_27023604insAAAA	uc002hby.2	+						SUPT6H_uc010crt.2_Intron	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					gagactgtctcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
KRT9	3857	broad.mit.edu	37	17	39727346	39727346	+	Intron	DEL	T	-	-	rs77388119		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39727346delT	uc002hxe.3	-						JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9						intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				TCAGCTCACGTTAACCCAGGT	0.493													4	7	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377700	45377701	+	Intron	INS	-	GC	GC	rs113076632		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377700_45377701insGC	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	TTGTCTTACAGGCGCGCGCGCG	0.525													4	3	---	---	---	---	
EPN3	55040	broad.mit.edu	37	17	48617904	48617904	+	Intron	DEL	A	-	-	rs66736597		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48617904delA	uc002ira.3	+						SPATA20_uc002irc.2_5'Flank|EPN3_uc010wms.1_Intron|EPN3_uc010wmt.1_Intron|EPN3_uc010wmu.1_Intron	NM_017957	NP_060427	Q9H201	EPN3_HUMAN	epsin 3							clathrin-coated vesicle|nucleus|perinuclear region of cytoplasm	lipid binding			ovary(1)	1	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GAAACGCAGCAAAATGTTCTC	0.577													4	3	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58037277	58037277	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58037277delA	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron|RNFT1_uc010wop.1_3'UTR	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			tctcaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CCDC137	339230	broad.mit.edu	37	17	79639370	79639371	+	Intron	INS	-	A	A			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79639370_79639371insA	uc002kbc.3	+						CCDC137_uc002kbd.2_Intron	NM_199287	NP_954981	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137											central_nervous_system(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			cctgtgtcaagaaaaaaaaaaa	0.267													4	8	---	---	---	---	
DUS1L	64118	broad.mit.edu	37	17	80018086	80018089	+	Intron	DEL	GTGA	-	-	rs72082050		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80018086_80018089delGTGA	uc002kdq.2	-						DUS1L_uc002kdp.2_Intron|DUS1L_uc002kdr.2_Intron|DUS1L_uc002kds.2_Intron|DUS1L_uc002kdt.2_Intron	NM_022156	NP_071439	Q6P1R4	DUS1L_HUMAN	PP3111 protein						tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity			skin(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TGCCGCTGCTGTGAGGAGTGCCCT	0.681													1	12	---	---	---	---	
ANKRD30B	374860	broad.mit.edu	37	18	14779833	14779834	+	Intron	INS	-	CCA	CCA			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14779833_14779834insCCA	uc010dlo.2	+						ANKRD30B_uc010xak.1_Intron	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											ovary(1)|skin(1)	2						GTGGTTGTTATTCAATAGAATA	0.257													5	3	---	---	---	---	
C18orf8	29919	broad.mit.edu	37	18	21089321	21089322	+	Intron	DEL	AT	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21089321_21089322delAT	uc010xax.1	+						C18orf8_uc010xau.1_Intron|C18orf8_uc010xav.1_Intron|C18orf8_uc010xaw.1_Intron|C18orf8_uc002kul.2_Intron	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TCAGTACTGaatatatatatat	0.168													4	2	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67807195	67807195	+	Intron	DEL	A	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67807195delA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTTCGAATTTAAAAAAAAAAA	0.289													4	2	---	---	---	---	
APC2	10297	broad.mit.edu	37	19	1452862	1452863	+	Intron	INS	-	C	C	rs148977773	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1452862_1452863insC	uc002lsr.1	+						APC2_uc002lss.1_Intron|APC2_uc002lst.1_5'UTR|APC2_uc002lsu.1_5'UTR	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCCTGAGACCCCCCCCAAC	0.673													5	5	---	---	---	---	
SLC25A23	79085	broad.mit.edu	37	19	6444414	6444418	+	Intron	DEL	AGCTG	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6444414_6444418delAGCTG	uc002mex.1	-						SLC25A23_uc010duu.1_5'Flank|SLC25A23_uc002meu.2_5'Flank|SLC25A23_uc002mev.2_Intron|SLC25A23_uc002mew.1_5'Flank|SLC25A23_uc010xjd.1_Intron	NM_024103	NP_077008	Q9BV35	SCMC3_HUMAN	solute carrier family 25, member 23						transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)|pancreas(1)	2						AGGTGCTACTAGCTGAGCACTTGGT	0.551													6	5	---	---	---	---	
EMR4P	326342	broad.mit.edu	37	19	6991048	6991049	+	5'Flank	INS	-	AAACCAAC	AAACCAAC	rs141228849	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6991048_6991049insAAACCAAC	uc010xjk.1	-							NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						actccatctcgaaaccaacaaa	0.144													5	3	---	---	---	---	
ZNF69	7620	broad.mit.edu	37	19	12022630	12022632	+	Intron	DEL	ATA	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12022630_12022632delATA	uc002mst.3	+							NM_021915	NP_068734	Q9UC07	ZNF69_HUMAN	zinc finger protein 69							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				Lung(535;0.011)		aacttaaagtataataataataa	0.138													4	2	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17743406	17743407	+	Intron	INS	-	TG	TG	rs149718390	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17743406_17743407insTG	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TTGCTGTTGACTGAATTTTCTG	0.119													12	9	---	---	---	---	
ITPKC	80271	broad.mit.edu	37	19	41243447	41243449	+	Intron	DEL	CCT	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41243447_41243449delCCT	uc002oot.2	+							NM_025194	NP_079470	Q96DU7	IP3KC_HUMAN	inositol 1,4,5-trisphosphate 3-kinase C							cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAATCCAAGCCCTCACTCCTCTG	0.433													10	6	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49966857	49966857	+	Intron	DEL	G	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49966857delG	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		aggaggggctggggcctggac	0.000													4	2	---	---	---	---	
IRF3	3661	broad.mit.edu	37	19	50163285	50163286	+	Intron	INS	-	A	A	rs141108976	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50163285_50163286insA	uc010end.1	-						IRF3_uc002pos.1_Intron|IRF3_uc002pot.1_Intron|IRF3_uc002pox.1_Intron|IRF3_uc002poy.1_Intron|IRF3_uc002pou.2_Intron|IRF3_uc002pov.2_Intron|IRF3_uc002pow.2_Intron	NM_001571	NP_001562	Q14653	IRF3_HUMAN	interferon regulatory factor 3						interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		cacacacacacCCCCTGCTGTA	0.337													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25079658	25079658	+	IGR	DEL	A	-	-	rs151125724		TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25079658delA								VSX1 (16891 upstream) : LOC284798 (41776 downstream)																							actctgtctcaaaaaaaaaaa	0.139													4	2	---	---	---	---	
ITCH	83737	broad.mit.edu	37	20	33028273	33028273	+	Intron	DEL	T	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33028273delT	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6						ttttaatttcttttttttttg	0.129													4	2	---	---	---	---	
EIF3D	8664	broad.mit.edu	37	22	36912879	36912881	+	Intron	DEL	GAC	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36912879_36912881delGAC	uc003apq.2	-						EIF3D_uc011amr.1_Intron|EIF3D_uc003apr.2_Intron|EIF3D_uc011ams.1_Intron|EIF3D_uc011amt.1_Intron	NM_003753	NP_003744	O15371	EIF3D_HUMAN	eukaryotic translation initiation factor 3							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1						TAACTTTGTTGACAAGGCCAAGG	0.532													60	28	---	---	---	---	
CACNA1I	8911	broad.mit.edu	37	22	39994293	39994294	+	Intron	INS	-	GCCCT	GCCCT	rs148307297	by1000genomes	TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39994293_39994294insGCCCT	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	cgccccgccccgccctgcccTC	0.327													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1501563	1501564	+	3'UTR	INS	-	T	T			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1501563_1501564insT	uc004cps.2	+	12					IL3RA_uc011mhd.1_3'UTR	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	TGATAAAGTGATTTTTTTTTTT	0.426													5	3	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2638660	2638661	+	Intron	DEL	GC	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2638660_2638661delGC	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						TTTTTAGTTTGCtttttttttt	0.163													4	2	---	---	---	---	
KDM6A	7403	broad.mit.edu	37	X	44949174	44949174	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44949174delA	uc004dge.3	+	25	4110	c.3735delA	c.(3733-3735)ACAfs	p.T1245fs	KDM6A_uc011mkz.1_Frame_Shift_Del_p.T1297fs|KDM6A_uc011mla.1_Frame_Shift_Del_p.T1200fs|KDM6A_uc011mlb.1_Frame_Shift_Del_p.T1252fs|KDM6A_uc011mlc.1_Frame_Shift_Del_p.T949fs|KDM6A_uc011mld.1_Frame_Shift_Del_p.T884fs	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	1245	JmjC.				histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						GTCCACTTACAGGTATTATAA	0.353			D|N|F|S		renal|oesophageal SCC|MM								37	23	---	---	---	---	
NCRNA00182	100302692	broad.mit.edu	37	X	73393541	73393542	+	Intron	DEL	TG	-	-			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73393541_73393542delTG	uc010nlq.1	-											Homo sapiens cDNA FLJ33139 fis, clone UTERU1000109.												0						tgtgcgtatatgtgtgtgtgtg	0.005													3	4	---	---	---	---	
FLNA	2316	broad.mit.edu	37	X	153577115	153577116	+	3'UTR	INS	-	G	G			TCGA-B2-4098-01A-01D-1458-08	TCGA-B2-4098-10A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153577115_153577116insG	uc004fkk.2	-	48					FLNA_uc004fki.2_3'UTR|FLNA_uc011mzn.1_3'UTR|FLNA_uc010nuu.1_3'UTR	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2						actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGTGACAGGCGGGCGGCCAGG	0.743													8	4	---	---	---	---	
