Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	569445	569445	+	RNA	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:569445G>A	uc001abc.2	+	1		c.119G>A								full-length cDNA clone CS0DL012YI10 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human).																		GATTAAAAATGCCCTAGCCCA	0.463													8	9	---	---	---	---	PASS
CHD5	26038	broad.mit.edu	37	1	6219487	6219487	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6219487T>C	uc001amb.1	-	3	396	c.296A>G	c.(295-297)AAG>AGG	p.K99R		NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	99	Lys-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		tttcttcttcttctttttatt	0.274													7	504	---	---	---	---	PASS
PHC2	1912	broad.mit.edu	37	1	33796958	33796958	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33796958C>T	uc001bxg.1	-	11	2048	c.1994G>A	c.(1993-1995)TGT>TAT	p.C665Y	PHC2_uc001bxh.1_Missense_Mutation_p.C637Y|PHC2_uc009vuh.1_Missense_Mutation_p.C666Y|PHC2_uc001bxe.1_Missense_Mutation_p.C130Y|PHC2_uc001bxf.1_Missense_Mutation_p.C80Y	NM_198040	NP_932157	Q8IXK0	PHC2_HUMAN	polyhomeotic-like 2 isoform a	665	FCS-type.				multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCTCTTTGCACAAGCCATGGA	0.552													32	64	---	---	---	---	PASS
FOXJ3	22887	broad.mit.edu	37	1	42744163	42744163	+	Silent	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42744163T>C	uc001che.2	-	5	537	c.225A>G	c.(223-225)AAA>AAG	p.K75K	FOXJ3_uc001chf.2_Silent_p.K75K|FOXJ3_uc001chg.2_Silent_p.K75K|FOXJ3_uc001chh.1_Silent_p.K75K	NM_014947	NP_055762	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	75					embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTTTCCCATCTTTGTGCTGTT	0.388													8	555	---	---	---	---	PASS
MCOLN3	55283	broad.mit.edu	37	1	85488090	85488090	+	Intron	SNP	G	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85488090G>C	uc001dkp.2	-						MCOLN3_uc001dko.2_5'UTR|MCOLN3_uc001dkq.2_Intron	NM_018298	NP_060768	Q8TDD5	MCLN3_HUMAN	mucolipin 3							integral to membrane	ion channel activity			skin(1)	1				all cancers(265;0.00957)|Epithelial(280;0.0254)		GACTCTAAGAGAGAGTGGAAA	0.269													47	113	---	---	---	---	PASS
RPL5	6125	broad.mit.edu	37	1	93298531	93298531	+	Intron	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93298531T>C	uc001doz.2	+						FAM69A_uc001dpc.2_3'UTR|RPL5_uc001dpa.2_Intron|RPL5_uc001dpb.2_5'UTR	NM_000969	NP_000960	P46777	RL5_HUMAN	ribosomal protein L5						endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	5S rRNA binding|protein binding|structural constituent of ribosome				0		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		ACGTTTGGCATCACTGATTGC	0.259													5	187	---	---	---	---	PASS
TCHHL1	126637	broad.mit.edu	37	1	152060504	152060504	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152060504C>T	uc001ezo.1	-	2	181	c.116G>A	c.(115-117)GGC>GAC	p.G39D		NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	39							calcium ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			CCCAAACTCGCCCTGGATGAG	0.443													64	115	---	---	---	---	PASS
DEDD	9191	broad.mit.edu	37	1	161093708	161093708	+	Silent	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161093708C>A	uc001fxz.2	-	4	527	c.354G>T	c.(352-354)CTG>CTT	p.L118L	NIT1_uc001fxw.2_Intron|DEDD_uc009wty.2_Silent_p.L118L|DEDD_uc001fya.2_Silent_p.L118L|DEDD_uc001fyb.2_Silent_p.L118L|DEDD_uc010pkb.1_Silent_p.L75L|DEDD_uc001fyc.2_5'UTR	NM_001039712	NP_001034801	O75618	DEDD_HUMAN	death effector domain-containing protein	118					apoptosis|induction of apoptosis via death domain receptors|negative regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			ATGTCTCCTCCAGATACTTGT	0.507													101	208	---	---	---	---	PASS
FCGR2B	2213	broad.mit.edu	37	1	161647424	161647424	+	3'UTR	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161647424G>T	uc001gaz.1	+	8					FCGR2B_uc001gay.1_3'UTR|FCGR2B_uc001gba.1_3'UTR|FCGR2B_uc001gbb.1_3'UTR|FCGR2B_uc009wun.1_3'UTR	NM_004001	NP_003992	P31994	FCG2B_HUMAN	Fc fragment of IgG, low affinity IIb, receptor						immune response|interspecies interaction between organisms|regulation of immune response	integral to membrane|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TTCCCCTTGGGGAGGACAGGG	0.468			T	?	ALL								32	41	---	---	---	---	PASS
ATP1B1	481	broad.mit.edu	37	1	169099253	169099253	+	RNA	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169099253C>T	uc001gfs.1	+	5		c.698C>T						P05026	AT1B1_HUMAN	Synthetic construct DNA, clone: pF1KB8186, Homo sapiens ATP1B1 gene for ATPase, Na+/K+ transporting, beta 1 polypeptide, without stop codon, in Flexi system.						ATP biosynthetic process|blood coagulation|leukocyte migration	sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	all_hematologic(923;0.208)					TTTAGCCTCCCAAGAATGAGT	0.383													6	263	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197029544	197029544	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197029544T>C	uc001gtt.1	-	5	801	c.757A>G	c.(757-759)ATT>GTT	p.I253V		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	253	Sushi 4.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TAGCATTGAATTAAATCAGAT	0.318													50	106	---	---	---	---	PASS
ATP6V1G3	127124	broad.mit.edu	37	1	198492507	198492507	+	3'UTR	SNP	A	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198492507A>T	uc001gup.2	-	4					ATP6V1G3_uc009wzd.2_3'UTR|ATP6V1G3_uc001guo.2_3'UTR	NM_133262	NP_573569	Q96LB4	VATG3_HUMAN	ATPase, H+ transporting, lysosomal, V1 subunit						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase complex	ATPase binding			central_nervous_system(1)	1						TTTCTTGAAAACTGTGATGTA	0.368													55	117	---	---	---	---	PASS
CD34	947	broad.mit.edu	37	1	208061326	208061326	+	Intron	SNP	A	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208061326A>C	uc001hgw.1	-						CD34_uc001hgv.1_Intron|CD34_uc001hgx.1_3'UTR|CD34_uc010psj.1_Intron	NM_001025109	NP_001020280	P28906	CD34_HUMAN	CD34 antigen isoform a						cell-cell adhesion|leukocyte migration|regulation of immune response	integral to membrane	carbohydrate binding			ovary(1)	1						GAGACACTGGATGGGAGAGGG	0.373													4	24	---	---	---	---	PASS
PLXNA2	5362	broad.mit.edu	37	1	208207921	208207921	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208207921A>G	uc001hgz.2	-	27	5539	c.4781T>C	c.(4780-4782)GTG>GCG	p.V1594A		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	1594	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CAGAGCCACCACCGACCTGTC	0.522													58	110	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220318884	220318884	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220318884C>A	uc001hmc.2	+	22	2889	c.2785C>A	c.(2785-2787)CAG>AAG	p.Q929K	IARS2_uc001hmd.2_Missense_Mutation_p.Q265K	NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	929					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	CAGCACCTCTCAGTTGAATGA	0.398													59	96	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220823963	220823963	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220823963A>G	uc001hmn.3	+	14	2069	c.1472A>G	c.(1471-1473)AAC>AGC	p.N491S	MARK1_uc009xdw.2_Missense_Mutation_p.N491S|MARK1_uc010pun.1_Missense_Mutation_p.N491S|MARK1_uc001hmm.3_Missense_Mutation_p.N469S	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	491					intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		TTCTTGAAGAACAATGTGTAT	0.338													5	134	---	---	---	---	PASS
VIT	5212	broad.mit.edu	37	2	37041378	37041378	+	Silent	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37041378A>G	uc002rpl.2	+	16	2177	c.1956A>G	c.(1954-1956)GAA>GAG	p.E652E	VIT_uc002rpm.2_Silent_p.E630E|VIT_uc010ezv.2_Silent_p.E608E|VIT_uc010ezw.2_Silent_p.E609E	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin	637	VWFA 2.					proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)				AGGAGCTAGAAGTCATTGCCA	0.512													5	110	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39250004	39250004	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39250004T>C	uc002rrk.3	-	10	1606	c.1565A>G	c.(1564-1566)AAT>AGT	p.N522S	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_Missense_Mutation_p.N136S|SOS1_uc002rrl.2_Missense_Mutation_p.N254S	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	522	PH.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				TATAACACTATTTTCATCTTT	0.323									Noonan_syndrome				93	148	---	---	---	---	PASS
PTCD3	55037	broad.mit.edu	37	2	86350863	86350863	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86350863C>T	uc002sqw.2	+	9	760	c.694C>T	c.(694-696)CAT>TAT	p.H232Y	PTCD3_uc010ytc.1_RNA|PTCD3_uc002sqx.1_5'Flank	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor	232						mitochondrion	protein binding			ovary(1)	1						GAAAGCTGGTCATCAGTTTGG	0.398													21	346	---	---	---	---	PASS
CHST10	9486	broad.mit.edu	37	2	101009691	101009691	+	3'UTR	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101009691T>C	uc002tam.2	-	7						NM_004854	NP_004845	O43529	CHSTA_HUMAN	HNK-1 sulfotransferase						carbohydrate biosynthetic process|cell adhesion	Golgi membrane|integral to membrane|membrane fraction				ovary(1)	1						ATATTTGAATTCATAGGTCTT	0.488													5	153	---	---	---	---	PASS
CHCHD5	84269	broad.mit.edu	37	2	113343969	113343969	+	Intron	SNP	T	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113343969T>A	uc002thz.1	+						CHCHD5_uc002tia.2_Silent_p.S112S	NM_032309	NP_115685	Q9BSY4	CHCH5_HUMAN	coiled-coil-helix-coiled-coil-helix domain												0						TCAGTTCATCTCTTTTCTCCA	0.348													4	8	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													10	28	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138413221	138413221	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138413221C>T	uc002tva.1	+	21	4009	c.4009C>T	c.(4009-4011)CCT>TCT	p.P1337S	THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTGTTCTGTGCCTTGCCCAGG	0.478													4	88	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	207008817	207008817	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207008817C>A	uc002vbe.2	-	10	1039	c.912G>T	c.(910-912)GAG>GAT	p.E304D	NDUFS1_uc010ziq.1_Missense_Mutation_p.E318D|NDUFS1_uc010zir.1_Missense_Mutation_p.E268D|NDUFS1_uc010zis.1_Missense_Mutation_p.E247D|NDUFS1_uc010zit.1_Missense_Mutation_p.E193D|NDUFS1_uc010ziu.1_Missense_Mutation_p.E188D	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	304					apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	TGACCATTGGCTCGGTAAGTC	0.368													78	141	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220497001	220497001	+	Silent	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220497001C>T	uc002vmp.3	+	8	1247	c.978C>T	c.(976-978)AAC>AAT	p.N326N	SLC4A3_uc002vmo.3_Silent_p.N353N|SLC4A3_uc010fwm.2_Translation_Start_Site|SLC4A3_uc010fwn.1_Translation_Start_Site	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	326	Cytoplasmic.				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGAGCTGAACGAGCTGATGC	0.672													10	14	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191563	10191563	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191563G>T	uc003bvc.2	+	3	769	c.556G>T	c.(556-558)GAA>TAA	p.E186*	VHL_uc003bvd.2_Nonsense_Mutation_p.E145*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	186			E -> K (in VHLD; type I).|Missing (in VHLD).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.E186*(2)|p.E186fs*28(1)|p.E186fs*14(1)|p.E186fs*27(1)|p.Y185fs*11(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		GTCGCTCTACGAAGATCTGGA	0.512		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				39	36	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52682418	52682418	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52682418A>C	uc003des.2	-	7	767	c.755T>G	c.(754-756)ATA>AGA	p.I252R	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.I252R|PBRM1_uc003der.2_Missense_Mutation_p.I252R|PBRM1_uc003det.2_Missense_Mutation_p.I252R|PBRM1_uc003deu.2_Missense_Mutation_p.I252R|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.I252R|PBRM1_uc010hmk.1_Missense_Mutation_p.I252R|PBRM1_uc003dey.2_Missense_Mutation_p.I252R|PBRM1_uc003dez.1_Missense_Mutation_p.I252R|PBRM1_uc003dfb.1_Missense_Mutation_p.I150R	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	252	Bromo 2.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GAGGAGATCTATATCTTTGGC	0.303			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								217	232	---	---	---	---	PASS
C3orf67	200844	broad.mit.edu	37	3	58923375	58923375	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58923375A>C	uc003dkt.1	-	5	426	c.17T>G	c.(16-18)ATT>AGT	p.I6S	uc003dku.1_Intron|C3orf67_uc003dkv.1_5'UTR|C3orf67_uc003dkw.2_5'UTR|C3orf67_uc011bfg.1_RNA	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	6											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GATACTTACAATTTTACGTTT	0.229													152	346	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140122627	140122627	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140122627G>C	uc003etn.2	+	3	579	c.389G>C	c.(388-390)GGT>GCT	p.G130A	CLSTN2_uc003etm.2_Missense_Mutation_p.G130A	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	130	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TATGACTGTGGTGCTGGGCCC	0.587										HNSCC(16;0.037)			21	45	---	---	---	---	PASS
WFS1	7466	broad.mit.edu	37	4	6303445	6303445	+	Silent	SNP	G	A	A	rs139040290		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6303445G>A	uc003giy.2	+	8	2089	c.1923G>A	c.(1921-1923)ACG>ACA	p.T641T	WFS1_uc003gix.2_Silent_p.T641T|WFS1_uc003giz.2_Silent_p.T459T	NM_001145853	NP_001139325	O76024	WFS1_HUMAN	wolframin	641	Helical; (Potential).				endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding			central_nervous_system(2)	2				Colorectal(103;0.0512)		TGTGGCTCACGGCCATCGTGC	0.597													60	40	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46976378	46976378	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46976378T>C	uc003gxg.2	-	6	731	c.592A>G	c.(592-594)AGT>GGT	p.S198G		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	198	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATCATCTCACTCTTTGGATAG	0.403													60	134	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84374975	84374975	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84374975T>C	uc003hom.2	-	2	600	c.421A>G	c.(421-423)ACA>GCA	p.T141A	HELQ_uc010ikb.2_Missense_Mutation_p.T141A|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA|HELQ_uc003hon.1_Missense_Mutation_p.T35A|HELQ_uc003hoo.1_Missense_Mutation_p.T104A|HELQ_uc003hop.1_Missense_Mutation_p.T35A|HELQ_uc003hoq.1_Missense_Mutation_p.T141A|MRPS18C_uc003hor.3_5'Flank|MRPS18C_uc011ccu.1_5'Flank	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	141							ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						GCAAAGTCTGTAGCATGTTTC	0.373								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					7	347	---	---	---	---	PASS
QRFPR	84109	broad.mit.edu	37	4	122301466	122301466	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301466C>T	uc010inj.1	-	1	716	c.337G>A	c.(337-339)GGG>AGG	p.G113R	QRFPR_uc010ink.1_RNA|QRFPR_uc003ids.2_Missense_Mutation_p.G113R|QRFPR_uc010inl.1_Missense_Mutation_p.G113R	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103	113	Extracellular (Potential).					plasma membrane	neuropeptide Y receptor activity				0						CTCTTACCCCCCAGCCAGTTG	0.453													4	48	---	---	---	---	PASS
SLC7A11	23657	broad.mit.edu	37	4	139144404	139144404	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139144404G>A	uc011chb.1	-	4	875	c.595C>T	c.(595-597)CTC>TTC	p.L199F		NM_014331	NP_055146	Q9UPY5	XCT_HUMAN	solute carrier family 7, (cationic amino acid	199	Helical; (Potential).				blood coagulation|cellular nitrogen compound metabolic process|leukocyte migration|response to toxin	integral to membrane|plasma membrane	cystine:glutamate antiporter activity|protein binding			skin(1)	1	all_hematologic(180;0.166)				L-Cystine(DB00138)|L-Glutamic Acid(DB00142)|Sulfasalazine(DB00795)	ATTGCTGTGAGCTTGCAAAAG	0.393													102	175	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154508914	154508914	+	Silent	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154508914A>G	uc003inm.3	+	15	1552	c.1500A>G	c.(1498-1500)GAA>GAG	p.E500E	KIAA0922_uc010ipp.2_Silent_p.E501E|KIAA0922_uc010ipq.2_Silent_p.E353E|KIAA0922_uc010ips.1_Missense_Mutation_p.K111R	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	500	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				TGGGTTTTGAAGTGATAGCAC	0.358													7	560	---	---	---	---	PASS
SLC6A18	348932	broad.mit.edu	37	5	1232438	1232438	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1232438G>T	uc003jby.1	+	2	388	c.265G>T	c.(265-267)GTG>TTG	p.V89L		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	89	Helical; Name=3; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CAGCGTCGGCGTGTGGACGGC	0.657													5	12	---	---	---	---	PASS
CAPSL	133690	broad.mit.edu	37	5	35921149	35921149	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35921149G>C	uc003jjt.1	-	2	169	c.74C>G	c.(73-75)CCC>CGC	p.P25R	CAPSL_uc003jju.1_Missense_Mutation_p.P25R	NM_001042625	NP_001036090	Q8WWF8	CAPSL_HUMAN	calcyphosine-like	25						cytoplasm	calcium ion binding			skin(1)	1	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)			TCTTTCAATGGGGTCGGTGGC	0.602													38	83	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37108561	37108561	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37108561G>A	uc011cpa.1	-	51	9482	c.9251C>T	c.(9250-9252)CCG>CTG	p.P3084L	C5orf42_uc003jko.1_Missense_Mutation_p.P115L|C5orf42_uc003jkp.1_RNA|C5orf42_uc011coy.1_Missense_Mutation_p.P1602L|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.P2177L	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	3084										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			ACTATGACACGGAGCATTAGA	0.373													5	269	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40947837	40947837	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40947837C>A	uc003jmh.2	+	8	986	c.872C>A	c.(871-873)GCC>GAC	p.A291D	C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	291	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				GACTACAGTGCCTACCGAAGA	0.423													50	147	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	59284433	59284433	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59284433C>T	uc003jsb.2	-	3	367	c.154G>A	c.(154-156)GCC>ACC	p.A52T	PDE4D_uc010iwj.1_Missense_Mutation_p.A52T|PDE4D_uc003jse.1_Missense_Mutation_p.A64T	NM_006203	NP_006194	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 2	Error:Variant_position_missing_in_Q08499_after_alignment					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	TGTCTGAAGGCGAGAGGGGGA	0.483													73	126	---	---	---	---	PASS
SSBP2	23635	broad.mit.edu	37	5	80911317	80911317	+	Missense_Mutation	SNP	C	A	A	rs11555880		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80911317C>A	uc003kho.2	-	4	468	c.257G>T	c.(256-258)AGT>ATT	p.S86I	SSBP2_uc003khn.2_5'UTR|SSBP2_uc003khp.2_Missense_Mutation_p.S86I|SSBP2_uc011ctp.1_Missense_Mutation_p.S86I|SSBP2_uc011ctq.1_Missense_Mutation_p.S86I|SSBP2_uc011ctr.1_Missense_Mutation_p.S86I	NM_012446	NP_036578	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2	86					regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		TTTTGCTTCACTTGAGTGTTC	0.343													75	149	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89925105	89925105	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89925105A>G	uc003kju.2	+	9	1684	c.1588A>G	c.(1588-1590)AGC>GGC	p.S530G	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	530	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GAAGATTGAAAGCAGCCCAGG	0.373													7	270	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139866633	139866633	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139866633G>A	uc003lfs.1	+	14	2357	c.2233G>A	c.(2233-2235)GGA>AGA	p.G745R	ANKHD1_uc003lfq.1_Missense_Mutation_p.G764R|ANKHD1_uc003lfr.2_Missense_Mutation_p.G745R|ANKHD1_uc003lft.1_Missense_Mutation_p.G209R|ANKHD1_uc003lfu.1_Missense_Mutation_p.G225R|ANKHD1_uc003lfv.1_Missense_Mutation_p.G75R	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	745						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCCTTTTAGGAGTGCAAAA	0.388													56	111	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140501616	140501616	+	Silent	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140501616A>G	uc003lip.1	+	1	36	c.36A>G	c.(34-36)CAA>CAG	p.Q12Q		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	12					calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAAACAGGCAAGTGTTGGCCT	0.478													6	309	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20846388	20846388	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20846388A>G	uc003ndc.1	+	9	895	c.721A>G	c.(721-723)AGA>GGA	p.R241G	CDKAL1_uc003ndd.1_Missense_Mutation_p.R241G|CDKAL1_uc003nde.1_Missense_Mutation_p.R171G	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	241					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ACTAGTAGATAGAGCCAAACA	0.328													5	254	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	29231822	29231822	+	IGR	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29231822A>G								OR2J2 (89472 upstream) : OR14J1 (42645 downstream)																							GAACCCAAGGAGCATAAGCCA	0.373													14	17	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38840747	38840747	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38840747G>A	uc003ooe.1	+	49	7252	c.6652G>A	c.(6652-6654)GTT>ATT	p.V2218I		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CTTAAATTCCGTTTTGGATGA	0.383													6	190	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138655319	138655319	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138655319G>A	uc003qhu.2	+	33	5336	c.5336G>A	c.(5335-5337)AGG>AAG	p.R1779K		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	1779					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GACTCTTATAGGACTGCCAGG	0.562													6	59	---	---	---	---	PASS
RBM16	22828	broad.mit.edu	37	6	155154462	155154462	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155154462A>G	uc003qqa.2	+	21	3981	c.3749A>G	c.(3748-3750)AAG>AGG	p.K1250R	TIAM2_uc003qqb.2_5'UTR|RBM16_uc011efj.1_Missense_Mutation_p.K1316R|RBM16_uc011efk.1_Missense_Mutation_p.K1295R|RBM16_uc003qpz.2_Missense_Mutation_p.K1250R|RBM16_uc010kji.2_Missense_Mutation_p.K892R	NM_014892	NP_055707	Q9UPN6	SCAF8_HUMAN	RNA-binding motif protein 16	1250					mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)		AACAAGGAGAAGAGTGACACA	0.383													7	154	---	---	---	---	PASS
MGC87042	256227	broad.mit.edu	37	7	22534457	22534457	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22534457G>T	uc003svh.2	-	2	115	c.18C>A	c.(16-18)GAC>GAA	p.D6E	MGC87042_uc010kum.1_Missense_Mutation_p.D6E			Q6NZ63	STEAL_HUMAN	SubName: Full=cDNA FLJ60218, highly similar to Six transmembrane epithelial antigen ofprostate 1;	6						integral to membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0						GGTTTGTGATGTCTTTTCTGC	0.249													118	284	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91630322	91630322	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91630322A>G	uc003ulg.2	+	8	1316	c.1091A>G	c.(1090-1092)GAA>GGA	p.E364G	AKAP9_uc003ule.2_Missense_Mutation_p.E376G|AKAP9_uc003ulf.2_Missense_Mutation_p.E364G|AKAP9_uc003uli.2_5'UTR	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	376	Glu-rich.|Potential.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			gaattacaagaacagattgtg	0.010			T	BRAF	papillary thyroid								6	244	---	---	---	---	PASS
FAM200A	221786	broad.mit.edu	37	7	99145313	99145313	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99145313G>A	uc003ura.2	-	2	1057	c.718C>T	c.(718-720)CAC>TAC	p.H240Y	FAM200A_uc003urb.2_Missense_Mutation_p.H240Y	NM_145111	NP_659802	Q8TCP9	F200A_HUMAN	hypothetical protein LOC221786	240	Extracellular (Potential).					integral to membrane	nucleic acid binding				0						ataaaacagtgattccaaaca	0.000													110	194	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100677754	100677754	+	Silent	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677754A>G	uc003uxp.1	+	3	3110	c.3057A>G	c.(3055-3057)GAA>GAG	p.E1019E	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1019	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|15.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CTTCTACTGAAGCCAGTTCAC	0.522													5	158	---	---	---	---	PASS
MRPL15	29088	broad.mit.edu	37	8	55049858	55049858	+	Silent	SNP	C	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55049858C>G	uc003xsa.2	+	3	357	c.294C>G	c.(292-294)CTC>CTG	p.L98L		NM_014175	NP_054894	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15 precursor	98					translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome				0		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			CTTTGAGTCTCAATAGACTGC	0.418													88	165	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55542213	55542213	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55542213T>C	uc003xsd.1	+	4	5919	c.5771T>C	c.(5770-5772)ATT>ACT	p.I1924T	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1924					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTAACTGTTATTATCCAACCC	0.373													8	123	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76470752	76470752	+	Splice_Site	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76470752G>T	uc003yaq.2	+	8	863	c.593_splice	c.e8-1	p.G198_splice	HNF4G_uc003yar.2_Splice_Site_p.G235_splice	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma						endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CTCTCTCATAGGAAACAACTA	0.358													6	118	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77745639	77745639	+	Intron	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77745639T>C	uc003yav.2	+						ZFHX4_uc003yau.1_Missense_Mutation_p.S1131P|ZFHX4_uc003yaw.1_Intron	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GAGATCGACCTCAGGTAATGG	0.408										HNSCC(33;0.089)			6	202	---	---	---	---	PASS
PTENP1	11191	broad.mit.edu	37	9	33675588	33675588	+	Silent	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33675588C>T	uc003zth.3	-	1	1831	c.960G>A	c.(958-960)CCG>CCA	p.P320P		NR_023917				SubName: Full=Phosphatase and tensin homolog 2; Flags: Fragment;												0						CTGGATTTGACGGCTCCTCTA	0.388													56	127	---	---	---	---	PASS
RECK	8434	broad.mit.edu	37	9	36118916	36118916	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36118916A>G	uc003zyv.2	+	18	2502	c.2416A>G	c.(2416-2418)AAG>GAG	p.K806E	RECK_uc003zyw.2_Missense_Mutation_p.K678E|RECK_uc003zyx.2_RNA	NM_021111	NP_066934	O95980	RECK_HUMAN	RECK protein precursor	806						anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TGCTTCTGTCAAGTGTCCTTC	0.587													5	60	---	---	---	---	PASS
MELK	9833	broad.mit.edu	37	9	36665549	36665549	+	Missense_Mutation	SNP	C	T	T	rs144052967		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36665549C>T	uc003zzn.2	+	14	1517	c.1379C>T	c.(1378-1380)ACG>ATG	p.T460M	MELK_uc011lpm.1_Missense_Mutation_p.T329M|MELK_uc011lpn.1_Missense_Mutation_p.T419M|MELK_uc011lpo.1_Missense_Mutation_p.T266M|MELK_uc010mll.2_Missense_Mutation_p.T428M|MELK_uc011lpp.1_Missense_Mutation_p.T412M|MELK_uc010mlm.2_Missense_Mutation_p.T389M|MELK_uc011lpq.1_Missense_Mutation_p.T266M|MELK_uc011lpr.1_Missense_Mutation_p.T389M|MELK_uc011lps.1_Missense_Mutation_p.T380M	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	460			T -> M (in an ovarian mucinous carcinoma sample; somatic mutation).	T->A: Inhibits interaction with PPP1R8.		cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity	p.T460M(1)		ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			ATACTCACTACGCCAAATCGT	0.353													7	200	---	---	---	---	PASS
ROD1	9991	broad.mit.edu	37	9	115038125	115038125	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115038125T>A	uc004bfw.2	-	4	474	c.287A>T	c.(286-288)CAG>CTG	p.Q96L	ROD1_uc004bfv.2_Missense_Mutation_p.Q102L|ROD1_uc004bfx.2_Missense_Mutation_p.Q99L|ROD1_uc011lwu.1_Missense_Mutation_p.Q68L|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Missense_Mutation_p.Q68L	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1	96	RRM 1.				anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						ATTACATACCTGGCTTTTTCC	0.214													93	211	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12070760	12070760	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12070760T>A	uc001ila.2	-	2	1603	c.1129A>T	c.(1129-1131)ACT>TCT	p.T377S	UPF2_uc001ilb.2_Missense_Mutation_p.T377S|UPF2_uc001ilc.2_Missense_Mutation_p.T377S|UPF2_uc009xiz.1_Missense_Mutation_p.T377S	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	377	MIF4G 1.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				TGTCTCTCAGTATTCTGGAGC	0.373													72	169	---	---	---	---	PASS
LOC100133308	100133308	broad.mit.edu	37	10	45602513	45602513	+	RNA	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45602513T>C	uc001jby.2	-	1		c.924A>G			LOC100133308_uc001jbz.2_RNA|LOC100133308_uc009xmq.1_RNA					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						GTCACTTAGATAGAGTGCACA	0.403													13	51	---	---	---	---	PASS
POLR3A	11128	broad.mit.edu	37	10	79781986	79781986	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79781986T>C	uc001jzn.2	-	6	896	c.802A>G	c.(802-804)AGT>GGT	p.S268G		NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	268					innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TTCAAATCACTCACAACGGAG	0.428													6	266	---	---	---	---	PASS
LIPK	643414	broad.mit.edu	37	10	90497391	90497391	+	Splice_Site	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90497391G>T	uc010qmv.1	+	6	670	c.670_splice	c.e6-1	p.V224_splice		NM_001080518	NP_001073987	Q5VXJ0	LIPK_HUMAN	lipase, family member K precursor						lipid catabolic process	extracellular region	hydrolase activity			ovary(2)	2		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		TTATCTTGTAGGTGTTGTTTG	0.393													118	386	---	---	---	---	PASS
FAS	355	broad.mit.edu	37	10	90768745	90768745	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90768745C>A	uc001kfr.2	+	4	780	c.434C>A	c.(433-435)CCT>CAT	p.P145H	FAS_uc010qna.1_RNA|FAS_uc001kfs.2_Missense_Mutation_p.P145H|FAS_uc001kft.2_Missense_Mutation_p.P145H|FAS_uc010qnb.1_Intron|FAS_uc010qnc.1_Intron|FAS_uc001kfw.2_Intron|FAS_uc010qnd.1_Intron|FAS_uc010qne.1_Intron|FAS_uc009xtp.2_RNA	NM_000043	NP_000034	P25445	TNR6_HUMAN	tumor necrosis factor receptor superfamily,	145	TNFR-Cys 3.|Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)		CACTGTGACCCTTGCACCAAG	0.323									Autoimmune_Lymphoproliferative_syndrome_type_I				6	260	---	---	---	---	PASS
HECTD2	143279	broad.mit.edu	37	10	93221997	93221997	+	Intron	SNP	G	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93221997G>C	uc001khl.2	+						LOC100188947_uc010qnl.1_Intron|HECTD2_uc001khk.2_3'UTR|HECTD2_uc010qnm.1_Intron|HECTD2_uc001khm.2_Intron|HECTD2_uc009xty.1_Intron	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						TATATCAAAAGCAGCCATACA	0.274													12	91	---	---	---	---	PASS
PPRC1	23082	broad.mit.edu	37	10	103899864	103899864	+	Silent	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103899864G>A	uc001kum.2	+	5	1638	c.1599G>A	c.(1597-1599)GAG>GAA	p.E533E	PPRC1_uc001kun.2_Silent_p.E413E|PPRC1_uc010qqj.1_Silent_p.E533E|PPRC1_uc009xxa.2_RNA	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor	533					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CTGCCTTGGAGAATTCTAGCC	0.542													4	73	---	---	---	---	PASS
RBM20	282996	broad.mit.edu	37	10	112557368	112557368	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112557368A>G	uc001kzf.2	+	6	1688	c.1630A>G	c.(1630-1632)AAG>GAG	p.K544E		NM_001134363	NP_001127835	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	544	RRM.					nucleus	nucleotide binding|RNA binding|zinc ion binding				0						GCCCTTTGGAAAGGTCACTAA	0.502													5	146	---	---	---	---	PASS
MS4A12	54860	broad.mit.edu	37	11	60264961	60264961	+	Missense_Mutation	SNP	C	T	T	rs148561730		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60264961C>T	uc001npr.2	+	2	227	c.170C>T	c.(169-171)CCG>CTG	p.P57L	MS4A12_uc009ynb.2_Missense_Mutation_p.P57L	NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	57	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						ATCACATCTCCGGGAATCTTT	0.458													69	99	---	---	---	---	PASS
DAGLA	747	broad.mit.edu	37	11	61504731	61504731	+	Silent	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61504731C>T	uc001nsa.2	+	14	1560	c.1449C>T	c.(1447-1449)TTC>TTT	p.F483F		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	483	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		TCCTCTCCTTCCTTCTGCGCC	0.647													34	84	---	---	---	---	PASS
EHD1	10938	broad.mit.edu	37	11	64645686	64645686	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64645686G>A	uc001obu.1	-	1	506	c.251C>T	c.(250-252)CCG>CTG	p.P84L	EHD1_uc001obv.1_Missense_Mutation_p.P84L|EHD1_uc010rnq.1_Missense_Mutation_p.P98L	NM_006795	NP_006786	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	84					blood coagulation|cholesterol homeostasis|endocytic recycling|intracellular protein transport|low-density lipoprotein particle clearance|positive regulation of cholesterol storage|protein homooligomerization	early endosome membrane|lipid particle|plasma membrane|platelet dense tubular network membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|protein binding				0						GCGCATCCCCGGGAAGTCCTG	0.657													17	45	---	---	---	---	PASS
EHBP1L1	254102	broad.mit.edu	37	11	65349886	65349886	+	Silent	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65349886G>A	uc001oeo.3	+	9	2008	c.1743G>A	c.(1741-1743)GTG>GTA	p.V581V	EHBP1L1_uc001oep.1_Intron	NM_001099409	NP_001092879	Q8N3D4	EH1L1_HUMAN	tangerin	581	Glu-rich.									central_nervous_system(1)	1						GGTTGGAGGTGCTGGGAACCC	0.567													10	27	---	---	---	---	PASS
ALG8	79053	broad.mit.edu	37	11	77832111	77832111	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77832111G>T	uc001oza.1	-	4	543	c.478C>A	c.(478-480)CAT>AAT	p.H160N	ALG8_uc001oyz.1_Missense_Mutation_p.H160N|ALG8_uc009yux.1_Missense_Mutation_p.H58N|ALG8_uc009yuy.1_RNA	NM_024079	NP_076984	Q9BVK2	ALG8_HUMAN	dolichyl pyrophosphate Glc1Man9GlcNAc2	160	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity|dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity	p.H160Y(1)		ovary(2)|pancreas(1)	3	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			TCAAGGATACGGTCCACAATT	0.323													6	396	---	---	---	---	PASS
PIH1D2	120379	broad.mit.edu	37	11	111941238	111941238	+	Silent	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111941238C>T	uc001pmq.3	-	5	817	c.735G>A	c.(733-735)GAG>GAA	p.E245E	PIH1D2_uc009yyl.2_Silent_p.E245E|PIH1D2_uc001pmp.3_Silent_p.E245E|PIH1D2_uc010rws.1_Silent_p.E245E	NM_138789	NP_620144	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2 isoform 1	245										ovary(1)	1		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		TCAGAGGTTTCTCACTGTGAT	0.388													5	244	---	---	---	---	PASS
SCN4B	6330	broad.mit.edu	37	11	118007796	118007796	+	Silent	SNP	C	A	A	rs111905160		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118007796C>A	uc001pse.2	-	5	875	c.633G>T	c.(631-633)ACG>ACT	p.T211T	SCN4B_uc010rxu.1_Silent_p.T101T|SCN4B_uc010rxv.1_Silent_p.T77T	NM_174934	NP_777594	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta	211	Cytoplasmic (Potential).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)		AGCCGTTCTCCGTGTTGTCAT	0.577													4	90	---	---	---	---	PASS
BIN2	51411	broad.mit.edu	37	12	51685713	51685713	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51685713T>C	uc001ryg.2	-	10	1229	c.1177A>G	c.(1177-1179)ACC>GCC	p.T393A	BIN2_uc009zlz.2_Missense_Mutation_p.T361A|BIN2_uc001ryh.2_Missense_Mutation_p.T269A|BIN2_uc010sng.1_Missense_Mutation_p.T367A	NM_016293	NP_057377	Q9UBW5	BIN2_HUMAN	bridging integrator 2	393						cytoplasm	protein binding			ovary(1)	1						TCACTTGCGGTGCGGGTTCGG	0.592													5	72	---	---	---	---	PASS
RAB3IP	117177	broad.mit.edu	37	12	70149258	70149258	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70149258G>T	uc001svp.2	+	2	565	c.118G>T	c.(118-120)GGT>TGT	p.G40C	RAB3IP_uc001svl.1_Missense_Mutation_p.G24C|RAB3IP_uc001svm.2_Missense_Mutation_p.G24C|RAB3IP_uc001svn.2_Missense_Mutation_p.G24C|RAB3IP_uc001svo.2_RNA|RAB3IP_uc001svq.2_Missense_Mutation_p.G40C|RAB3IP_uc001svr.2_RNA|RAB3IP_uc001svs.2_RNA	NM_175623	NP_783322	Q96QF0	RAB3I_HUMAN	RAB3A interacting protein isoform alpha 2	40					cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			GGACCTTCTTGGTGTGTATGA	0.463													6	210	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88514929	88514929	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88514929A>G	uc001tar.2	-	14	1548	c.1204T>C	c.(1204-1206)TCT>CCT	p.S402P	CEP290_uc001tat.2_Missense_Mutation_p.S164P|CEP290_uc009zsl.1_RNA	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	402	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						GTCTGTTGAGAAAGGGTTGAA	0.383													7	372	---	---	---	---	PASS
LUM	4060	broad.mit.edu	37	12	91502726	91502726	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91502726C>T	uc001tbm.2	-	2	420	c.31G>A	c.(31-33)GCA>ACA	p.A11T	LUM_uc001tbn.2_Intron	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	11					collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						CCAATCAATGCCAGGAAGAGA	0.348													6	154	---	---	---	---	PASS
CKAP2	26586	broad.mit.edu	37	13	53035216	53035216	+	Silent	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53035216A>G	uc001vgv.2	+	4	455	c.258A>G	c.(256-258)AGA>AGG	p.R86R	CKAP2_uc001vgt.2_Silent_p.R85R|CKAP2_uc001vgu.2_Silent_p.R85R|CKAP2_uc010tha.1_Silent_p.R37R	NM_001098525	NP_001091995	Q8WWK9	CKAP2_HUMAN	cytoskeleton associated protein 2 isoform 2	86					apoptosis|cell cycle	centrosome|microtubule|spindle pole				ovary(1)|skin(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		ACATGAAGAGACCTGCAGAGA	0.348													5	170	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96508471	96508471	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96508471A>G	uc001vmt.2	-	34	4119	c.3949T>C	c.(3949-3951)TTC>CTC	p.F1317L	UGGT2_uc001vms.2_Missense_Mutation_p.F37L	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	1317	Glucosyltransferase.				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						ACATCAAGGAAAAGAATTTTG	0.373													6	227	---	---	---	---	PASS
PPM1A	5494	broad.mit.edu	37	14	60712724	60712724	+	5'UTR	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60712724C>A	uc010apn.2	+	1					uc001xev.1_5'Flank|PPM1A_uc001xew.3_Missense_Mutation_p.N53K	NM_021003	NP_066283	P35813	PPM1A_HUMAN	protein phosphatase 1A isoform 1						cell cycle arrest|insulin receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein dephosphorylation|Wnt receptor signaling pathway	cytosol|nucleus|protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein serine/threonine phosphatase activity|signal transducer activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.046)		aaagaggaAACCAAATGAAGA	0.204													13	497	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64545255	64545255	+	Silent	SNP	G	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64545255G>C	uc001xgm.2	+	55	11324	c.11094G>C	c.(11092-11094)GGG>GGC	p.G3698G	SYNE2_uc001xgl.2_Silent_p.G3698G|SYNE2_uc010apy.2_Silent_p.G60G|SYNE2_uc010apw.1_Silent_p.G404G|SYNE2_uc010apx.1_Silent_p.G90G	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3698	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTAACAATGGGCTTCATAATG	0.343													108	236	---	---	---	---	PASS
ADAM21	8747	broad.mit.edu	37	14	70925981	70925981	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70925981A>T	uc001xmd.2	+	1	1765	c.1765A>T	c.(1765-1767)ACC>TCC	p.T589S		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	589	Cys-rich.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CAATGGTGTCACCTGCTGGGG	0.418													81	158	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77327095	77327095	+	Silent	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77327095G>A	uc001xsx.2	+	11	1278	c.1164G>A	c.(1162-1164)CCG>CCA	p.P388P	C14orf166B_uc010asn.1_Silent_p.P148P|C14orf166B_uc001xsw.2_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	388											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CCGTTCACCCGCAGCTGGACG	0.537													50	90	---	---	---	---	PASS
CALM1	801	broad.mit.edu	37	14	90867746	90867746	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90867746G>A	uc001xyl.1	+	3	380	c.178G>A	c.(178-180)GGT>AGT	p.G60S	CALM1_uc010atq.1_Missense_Mutation_p.G61S|CALM1_uc010atr.1_RNA|CALM1_uc001xym.1_Missense_Mutation_p.G24S	NM_006888	NP_008819	P62158	CALM_HUMAN	calmodulin 1 isoform 1	60	EF-hand 2.|2.				activation of phospholipase C activity|G-protein coupled receptor protein signaling pathway|glucose metabolic process|glycogen catabolic process|muscle contraction|negative regulation of ryanodine-sensitive calcium-release channel activity|nerve growth factor receptor signaling pathway|nitric oxide metabolic process|platelet activation|platelet degranulation|positive regulation of ryanodine-sensitive calcium-release channel activity|regulation of cytokinesis|regulation of nitric-oxide synthase activity|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to calcium ion|synaptic transmission	centrosome|cytosol|extracellular region|nucleoplasm|plasma membrane|spindle microtubule|spindle pole	calcium ion binding|N-terminal myristoylation domain binding|phospholipase binding|protein domain specific binding|thioesterase binding|titin binding			central_nervous_system(1)	1		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.208)	Aprindine(DB01429)|Bepridil(DB01244)|Dibucaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Miconazole(DB01110)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)	GGATGCTGATGGTAAGAGCTT	0.433													6	259	---	---	---	---	PASS
ATXN3	4287	broad.mit.edu	37	14	92530602	92530602	+	3'UTR	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92530602A>G	uc001yac.3	-	11					ATXN3_uc010aug.2_3'UTR|ATXN3_uc001yad.3_3'UTR|ATXN3_uc010auh.2_3'UTR|ATXN3_uc001yae.3_3'UTR	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		AGTGGACCCTATGCTGTAATC	0.338													4	73	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106134536	106134536	+	Intron	SNP	T	C	C	rs3211548		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106134536T>C	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001ysb.1_RNA					Parts of antibodies, mostly variable regions.												0						AGCATCCTCGTGCGACCGCGA	0.642													5	16	---	---	---	---	PASS
CTXN2	399697	broad.mit.edu	37	15	48493508	48493508	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48493508C>A	uc001zwm.1	+	2	252	c.11C>A	c.(10-12)ACC>AAC	p.T4N	SLC12A1_uc010uew.1_Intron	NM_001145668	NP_001139140	P0C2S0	CTXN2_HUMAN	cortexin 2	4						integral to membrane					0						ATGAGTAGTACCTACTGTGGC	0.408													63	132	---	---	---	---	PASS
STRA6	64220	broad.mit.edu	37	15	74472524	74472524	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74472524C>A	uc002axk.2	-	19	2083	c.1901G>T	c.(1900-1902)CGC>CTC	p.R634L	STRA6_uc002axi.2_Missense_Mutation_p.R443L|STRA6_uc010ulh.1_Missense_Mutation_p.R672L|STRA6_uc002axj.2_Missense_Mutation_p.R673L|STRA6_uc010bji.2_Missense_Mutation_p.R634L|STRA6_uc002axl.2_Missense_Mutation_p.R566L|STRA6_uc002axm.2_Missense_Mutation_p.R634L|STRA6_uc002axn.2_Missense_Mutation_p.R625L|STRA6_uc010uli.1_Missense_Mutation_p.R671L	NM_022369	NP_071764	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid gene 6 homolog	634	Cytoplasmic (Potential).				adrenal gland development|alveolar primary septum development|developmental growth|diaphragm development|digestive tract morphogenesis|ear development|embryonic camera-type eye formation|embryonic digestive tract development|eyelid development in camera-type eye|face morphogenesis|feeding behavior|female genitalia development|kidney development|lung vasculature development|neuromuscular process|nose morphogenesis|paramesonephric duct development|positive regulation of behavior|pulmonary artery morphogenesis|pulmonary valve morphogenesis|smooth muscle tissue development|transport|uterus morphogenesis|ventricular septum development|vocal learning	integral to membrane|plasma membrane|protein complex	receptor activity			central_nervous_system(1)	1						AGCCCTGCCGCGGCTGGCCCC	0.637													3	6	---	---	---	---	PASS
DPEP2	64174	broad.mit.edu	37	16	68026474	68026474	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68026474C>T	uc010cey.2	-	2	493	c.329G>A	c.(328-330)CGC>CAC	p.R110H	DPEP2_uc002evd.3_Missense_Mutation_p.R110H|DPEP2_uc002eve.2_Missense_Mutation_p.R110H|DPEP2_uc002evf.2_RNA|DPEP2_uc002evg.2_Intron	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN	dipeptidase 2 precursor	110					hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		GCTGAAATTGCGCAGGTTAAC	0.587													10	44	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2076117	2076117	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2076117G>T	uc002fub.1	-	13	3247	c.3192C>A	c.(3190-3192)TTC>TTA	p.F1064L	SMG6_uc010vqv.1_Missense_Mutation_p.F156L	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	1064					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						GTATGTTACAGAAATCAGCCA	0.458													46	108	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10551954	10551954	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10551954C>T	uc002gmq.1	-	7	732	c.655G>A	c.(655-657)GAT>AAT	p.D219N		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	219	Myosin head-like.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						ATGATTTGATCTTCCAGAGTC	0.348													59	126	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36484363	36484363	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36484363A>C	uc002hpz.2	-	11	5110	c.5089T>G	c.(5089-5091)TTG>GTG	p.L1697V		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	1697	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CCAGCAGTCAAGTTTTCCTCC	0.542													8	125	---	---	---	---	PASS
PSMC5	5705	broad.mit.edu	37	17	61907491	61907491	+	Splice_Site	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61907491A>G	uc002jcb.2	+	5	306	c.265_splice	c.e5-2	p.V89_splice	FTSJ3_uc002jca.2_5'Flank|PSMC5_uc010ddy.2_Splice_Site_p.V66_splice|PSMC5_uc010ddz.2_Splice_Site_p.V10_splice|PSMC5_uc002jcc.2_Splice_Site_p.V81_splice|PSMC5_uc002jcd.2_Splice_Site_p.V81_splice	NM_002805	NP_002796	P62195	PRS8_HUMAN	proteasome 26S ATPase subunit 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of programmed cell death|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|ATPase activity|thyrotropin-releasing hormone receptor binding|transcription cofactor activity|transcription factor binding			large_intestine(1)	1						TTGTTTCTTTAGGTACATCCT	0.458													188	431	---	---	---	---	PASS
CACNG5	27091	broad.mit.edu	37	17	64876762	64876762	+	Silent	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64876762T>C	uc010wqi.1	+	4	609	c.372T>C	c.(370-372)CGT>CGC	p.R124R	CACNG5_uc002jfr.2_Silent_p.R124R|CACNG5_uc010wqj.1_Silent_p.R124R	NM_145811	NP_665810	Q9UF02	CCG5_HUMAN	voltage-dependent calcium channel gamma-5	124					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|postsynaptic density|postsynaptic membrane	voltage-gated calcium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)			GACACATCCGTCCCCACCGGA	0.453													7	314	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42530906	42530906	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42530906G>A	uc010dni.2	+	4	1897	c.1601G>A	c.(1600-1602)TGC>TAC	p.C534Y		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	534						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AGGTGGACTTGCAGCAAACCA	0.517									Schinzel-Giedion_syndrome				37	54	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42530907	42530907	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42530907C>A	uc010dni.2	+	4	1898	c.1602C>A	c.(1600-1602)TGC>TGA	p.C534*		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	534						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGTGGACTTGCAGCAAACCAA	0.512									Schinzel-Giedion_syndrome				38	54	---	---	---	---	PASS
CCDC11	220136	broad.mit.edu	37	18	47753885	47753885	+	Silent	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47753885G>T	uc002lee.2	-	8	1502	c.1411C>A	c.(1411-1413)CGA>AGA	p.R471R		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	471	Potential.									ovary(1)|pancreas(1)|skin(1)	3				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)		TCAAACTCTCGGCGTTTCTCT	0.502													6	429	---	---	---	---	PASS
ZNF653	115950	broad.mit.edu	37	19	11597943	11597943	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11597943T>C	uc002mrz.1	-	5	1255	c.1202A>G	c.(1201-1203)GAG>GGG	p.E401G		NM_138783	NP_620138	Q96CK0	ZN653_HUMAN	zinc finger protein 653	401					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTCCTTCTCCTCCTTCTTTAG	0.647													4	53	---	---	---	---	PASS
ZNF439	90594	broad.mit.edu	37	19	11979300	11979300	+	Silent	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11979300G>T	uc002mss.2	+	3	1544	c.1416G>T	c.(1414-1416)GGG>GGT	p.G472G	ZNF439_uc002msr.2_Silent_p.G336G	NM_152262	NP_689475	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	472	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						AGAAATGTGGGAAAGCCTTCA	0.388													28	63	---	---	---	---	PASS
C19orf42	79086	broad.mit.edu	37	19	16764933	16764933	+	Missense_Mutation	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16764933T>C	uc002ner.2	-	4	172	c.125A>G	c.(124-126)GAC>GGC	p.D42G	C19orf42_uc002neo.1_RNA|C19orf42_uc002nep.1_Intron	NM_024104	NP_077009	Q9BQ49	CS042_HUMAN	hypothetical protein LOC79086 precursor	42	Extracellular (Potential).					integral to membrane					0						CCGGATGTTGTCACCTGGAAG	0.493													6	226	---	---	---	---	PASS
ZNF702P	79986	broad.mit.edu	37	19	53489892	53489892	+	RNA	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53489892G>T	uc002qan.3	-	2		c.260C>A				NR_003578				Synthetic construct DNA, clone: pF1KB9679, Homo sapiens ZNF702 gene for zinc finger protein 702, without stop codon, in Flexi system.												0						tcagcttcctgctttgttttc	0.000													5	11	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34515757	34515757	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34515757A>T	uc002xek.1	+	14	2171	c.2060A>T	c.(2059-2061)AAT>ATT	p.N687I		NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	687	PHD-type.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					CTGGAAGAAAATGTGCCCGAG	0.443													106	244	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	22	20295349	20295349	+	RNA	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20295349A>G	uc002zrw.1	+	2		c.2829A>G								Homo sapiens mRNA for KIAA1653 protein, partial cds.																		GAGCTGGCTCACCGTGAGGGC	0.622													6	42	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24810514	24810514	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24810514A>G	uc002zzw.2	+	17	3584	c.3277A>G	c.(3277-3279)ATG>GTG	p.M1093V	CYTSA_uc002zzv.3_Missense_Mutation_p.M1093V|CYTSA_uc011ajq.1_Missense_Mutation_p.M1054V	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	1093	CH.				cell cycle|cell division						0						CATTAATGAAATGGTACGGAC	0.547													5	126	---	---	---	---	PASS
LOC347376	347376	broad.mit.edu	37	X	50648543	50648543	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50648543G>T	uc010njs.2	+	1	112	c.106G>T	c.(106-108)GTG>TTG	p.V36L		NR_003933				RecName: Full=Histone H3; Flags: Fragment;												0						TACTGGAGGGGTGAAGAAACC	0.498													4	10	---	---	---	---	PASS
PHF8	23133	broad.mit.edu	37	X	54019191	54019191	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54019191C>A	uc004dsu.2	-	14	1889	c.1816G>T	c.(1816-1818)GCC>TCC	p.A606S	PHF8_uc004dst.2_Missense_Mutation_p.A570S|PHF8_uc004dsv.2_Missense_Mutation_p.A436S|PHF8_uc004dsw.2_Missense_Mutation_p.A469S|PHF8_uc004dsx.2_Missense_Mutation_p.A334S|PHF8_uc004dsy.2_Missense_Mutation_p.A570S	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	606					brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						ATCAATAGGGCCAATGGGCTC	0.507													65	107	---	---	---	---	PASS
FMR1NB	158521	broad.mit.edu	37	X	147106527	147106527	+	3'UTR	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147106527A>G	uc004fcm.2	+	5						NM_152578	NP_689791	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor							integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GTAGCAAGAGACCAAAGGTAA	0.393													6	317	---	---	---	---	PASS
TMEM185A	84548	broad.mit.edu	37	X	148690436	148690436	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148690436C>A	uc011mxq.1	-	4	612	c.301G>T	c.(301-303)GTC>TTC	p.V101F	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|TMEM185A_uc011mxp.1_Missense_Mutation_p.V42F|TMEM185A_uc004fdo.2_Intron|TMEM185A_uc004fdp.3_Missense_Mutation_p.V18F	NM_032508	NP_115897	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	101	Helical; (Potential).					integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CTGTCACAGACCAGAACTTCA	0.488													66	147	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151896050	151896050	+	RNA	SNP	G	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151896050G>T	uc004fgb.2	-	4		c.717C>A						P43365	MAGAC_HUMAN	Homo sapiens melanoma antigen family A, 12, mRNA (cDNA clone MGC:4914 IMAGE:3450217), complete cds.											skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TCTACACCCTGTTGGCTATTT	0.448													10	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	1870	1870	+	5'Flank	SNP	A	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:1870A>G	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		GAATTAACTAGAAATAACTTT	0.403													31	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2515	2515	+	5'Flank	SNP	T	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2515T>C	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		AAAAACATCACCTCTAGCATC	0.438													10	150	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2960	2960	+	5'Flank	SNP	T	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2960T>G	uc004coq.3	-						uc004cos.3_RNA|uc011mfh.1_5'Flank					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		CCTATTCTAGAGTCCATATCA	0.428													39	4	---	---	---	---	PASS
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						CTGTTTTTTTTGTTTGTTTGTT	0.317													7	4	---	---	---	---	
KCNAB2	8514	broad.mit.edu	37	1	6109436	6109437	+	Intron	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6109436_6109437delCA	uc009vlv.1	+						KCNAB2_uc001alv.1_Intron|KCNAB2_uc001alw.1_Intron|KCNAB2_uc001alx.1_Intron|KCNAB2_uc001aly.1_Intron|KCNAB2_uc009vlw.1_Intron|KCNAB2_uc001alu.2_Intron	NM_003636	NP_003627	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane|juxtaparanode region of axon	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity				0	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		gtgaattcagcacacaggacag	0.000													4	2	---	---	---	---	
ESPN	83715	broad.mit.edu	37	1	6512263	6512263	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6512263delT	uc001amy.2	+						ESPN_uc001amz.2_Intron	NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin						sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		Attttctttcttttttttttt	0.328													5	6	---	---	---	---	
APITD1	378708	broad.mit.edu	37	1	10502149	10502149	+	Intron	DEL	A	-	-	rs67409731		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10502149delA	uc001are.2	+						APITD1_uc001arf.2_Intron|APITD1_uc001arg.2_Intron|APITD1_uc001arh.2_Intron	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform						DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		aaaaaaaaagaaaaaaaaAAT	0.189													3	4	---	---	---	---	
SRM	6723	broad.mit.edu	37	1	11116944	11116944	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11116944delT	uc001arz.1	-						SRM_uc001ary.1_5'Flank	NM_003132	NP_003123	P19623	SPEE_HUMAN	spermidine synthase						spermidine biosynthetic process	cytosol	protein homodimerization activity|spermidine synthase activity				0	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)|Spermine(DB00127)	ttttttattatttttttttga	0.299													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18428054	18428054	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18428054delT								ACTL8 (274498 upstream) : IGSF21 (6186 downstream)																							CAGGAAAAAGTAAAAATCTTG	0.279													4	2	---	---	---	---	
HP1BP3	50809	broad.mit.edu	37	1	21073761	21073761	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21073761delT	uc001bdw.1	-						HP1BP3_uc001bdv.1_Intron|HP1BP3_uc010odh.1_Intron|HP1BP3_uc001bdy.1_Intron|HP1BP3_uc010odf.1_Intron|HP1BP3_uc010odg.1_Intron	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74						nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		atatgtggacttttttttttc	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22611550	22611551	+	IGR	DEL	GG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22611550_22611551delGG								WNT4 (141165 upstream) : ZBTB40 (166793 downstream)																							tgattcactaggggaggcaggt	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	24442969	24442969	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24442969delG								MYOM3 (4304 upstream) : IL22RA1 (3292 downstream)																							TGTCGCTCTCGGAGTCCAGTT	0.542													5	4	---	---	---	---	
EPB41	2035	broad.mit.edu	37	1	29338635	29338635	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29338635delT	uc001brm.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001bri.1_Intron|EPB41_uc001brj.1_Intron|EPB41_uc009vtk.1_Intron|EPB41_uc001brk.2_Intron|EPB41_uc001brl.1_Intron|EPB41_uc009vtl.1_Intron|EPB41_uc009vtm.1_Intron	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		ATTTTGTTGATTTTTTTTTTT	0.358													3	4	---	---	---	---	
PTPRU	10076	broad.mit.edu	37	1	29652060	29652060	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29652060delA	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron|PTPRU_uc001brx.2_Intron	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CCCCCACAATACTGGAGTTGG	0.602													127	69	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30094636	30094637	+	IGR	DEL	AA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30094636_30094637delAA								PTPRU (441321 upstream) : None (None downstream)																							aggcaaaattaatagcatgtgc	0.000													4	2	---	---	---	---	
TINAGL1	64129	broad.mit.edu	37	1	32044483	32044484	+	Intron	INS	-	TCTA	TCTA			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32044483_32044484insTCTA	uc001bta.2	+						TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Intron|TINAGL1_uc010ogj.1_Intron|TINAGL1_uc010ogk.1_Intron	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		GAGCTGgtgtgtgtgtgtgtgt	0.297													3	6	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34247669	34247671	+	Intron	DEL	TGA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34247669_34247671delTGA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAGTGGGTATTGATGATGATGAT	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	48241508	48241508	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48241508delG								FOXD2 (335146 upstream) : SKINTL (325879 downstream)																							gtgtgagagtgggggtgaagg	0.000													4	2	---	---	---	---	
C1orf168	199920	broad.mit.edu	37	1	57189521	57189522	+	Intron	INS	-	AC	AC	rs145636808	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57189521_57189522insAC	uc001cym.3	-						C1orf168_uc001cyl.2_Intron	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920											ovary(3)|skin(2)	5						TGTGTATATGTACACACACGTA	0.297													6	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58747693	58747693	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58747693delT	uc001cyt.1	-							NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						tatctcatgctttttccctct	0.010													4	2	---	---	---	---	
TACSTD2	4070	broad.mit.edu	37	1	59045329	59045331	+	5'Flank	DEL	TCG	-	-	rs72233190		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59045329_59045331delTCG	uc001cyz.3	-							NM_002353	NP_002344	P09758	TACD2_HUMAN	tumor-associated calcium signal transducer 2						cell proliferation|cell surface receptor linked signaling pathway|visual perception	cytosol|integral to plasma membrane	receptor activity				0	all_cancers(7;6.54e-05)					atcatcatcatcGTGCTCCTGCC	0.246													5	3	---	---	---	---	
LRRC8B	23507	broad.mit.edu	37	1	89991142	89991142	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89991142delG	uc001dni.2	+						LRRC8B_uc001dnh.2_Intron	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGATTTGTTTGAGAAAGAAAG	0.453													4	2	---	---	---	---	
LRRC8B	23507	broad.mit.edu	37	1	89991144	89991144	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89991144delG	uc001dni.2	+						LRRC8B_uc001dnh.2_Intron	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member							integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		ATTTGTTTGAGAAAGAAAGGG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	95750640	95750640	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95750640delT								RWDD3 (37867 upstream) : None (None downstream)																							ttgtatgaccttaggtgagct	0.109													4	2	---	---	---	---	
DBT	1629	broad.mit.edu	37	1	100676029	100676029	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100676029delA	uc001dta.2	-						DBT_uc010oug.1_Intron	NM_001918	NP_001909	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase						branched chain family amino acid catabolic process|fatty-acyl-CoA biosynthetic process	microtubule cytoskeleton|mitochondrial alpha-ketoglutarate dehydrogenase complex|mitochondrial nucleoid	acyltransferase activity|cofactor binding|dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity|protein binding			pancreas(1)	1		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		TTTAAGCAGGAAAAAAAAAAG	0.289													6	5	---	---	---	---	
VAV3	10451	broad.mit.edu	37	1	108139185	108139191	+	Intron	DEL	TACCCCC	-	-	rs17229691		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108139185_108139191delTACCCCC	uc001dvk.1	-						VAV3_uc010ouu.1_Intron|VAV3_uc001dvj.1_Intron|VAV3_uc010ouv.1_Intron|VAV3_uc010ouw.1_Intron	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TAATATGAGTTACCCCCTATTGTTATT	0.372													5	3	---	---	---	---	
C1orf103	55791	broad.mit.edu	37	1	111490408	111490409	+	3'UTR	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111490408_111490409delCA	uc001eaa.2	-	4					C1orf103_uc001dzz.2_3'UTR|C1orf103_uc001eab.2_3'UTR|C1orf103_uc001eac.1_3'UTR	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		GTAAATTATTCACAAGTCATAT	0.287													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145298623	145298630	+	Intron	DEL	ATGGTGCT	-	-	rs66470618		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145298623_145298630delATGGTGCT	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ttaggcaggcatggtgctgcacgcctat	0.111													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149208502	149208503	+	IGR	INS	-	G	G	rs79236895	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149208502_149208503insG								LOC645166 (255448 upstream) : LOC388692 (70973 downstream)																							aaaaaGTTTTTATTTGTATAGT	0.149													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165998787	165998788	+	IGR	DEL	GG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165998787_165998788delGG								UCK2 (121450 upstream) : FAM78B (30628 downstream)																							CTGAAGTTCTGGGAACACTGCT	0.436													4	2	---	---	---	---	
TNR	7143	broad.mit.edu	37	1	175546411	175546411	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175546411delC	uc009wwu.1	-						TNR_uc010pmz.1_Intron	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					GTTTGTTGGGCAGGTTGTGTC	0.448													4	2	---	---	---	---	
KLHL12	59349	broad.mit.edu	37	1	202878423	202878423	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202878423delT	uc001gyo.1	-						KLHL12_uc001gym.1_5'Flank|KLHL12_uc001gyn.1_Intron|KLHL12_uc010pqc.1_Intron|KLHL12_uc009xah.1_Intron	NM_021633	NP_067646	Q53G59	KLH12_HUMAN	kelch-like 12						Wnt receptor signaling pathway		protein binding				0			BRCA - Breast invasive adenocarcinoma(75;0.166)			CCAGAAATGATTTTTAAAATT	0.348													4	2	---	---	---	---	
PLEKHA6	22874	broad.mit.edu	37	1	204314511	204314512	+	Intron	DEL	GA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204314511_204314512delGA	uc001hau.2	-							NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3											ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GAAGGTGCCTGAGCTTCCCCTA	0.579													4	2	---	---	---	---	
FAIM3	9214	broad.mit.edu	37	1	207096657	207096657	+	5'Flank	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207096657delG	uc001hey.2	-						FAIM3_uc010prz.1_5'Flank|FAIM3_uc010psa.1_5'Flank|FAIM3_uc010psb.1_5'Flank	NM_005449	NP_005440	O60667	FAIM3_HUMAN	Fas apoptotic inhibitory molecule 3 isoform a						anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)					GGAAGTGTGTGGGGGGGTGGG	0.572													4	2	---	---	---	---	
MARK1	4139	broad.mit.edu	37	1	220794162	220794163	+	Intron	DEL	TA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220794162_220794163delTA	uc001hmn.3	+						MARK1_uc009xdw.2_Intron|MARK1_uc010pun.1_Intron|MARK1_uc001hmm.3_Intron	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1						intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		CTGGAAATATTATATTATAGAT	0.332													4	2	---	---	---	---	
ARF1	375	broad.mit.edu	37	1	228279469	228279470	+	Intron	DEL	CT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228279469_228279470delCT	uc001hrr.2	+						ARF1_uc001hrs.2_Intron|ARF1_uc001hrt.2_Intron|ARF1_uc009xev.2_Intron|ARF1_uc001hru.2_Intron|ARF1_uc001hrv.2_Intron	NM_001024226	NP_001019397	P84077	ARF1_HUMAN	ADP-ribosylation factor 1						cellular copper ion homeostasis|COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|protein transport|regulation of defense response to virus by virus|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction|viral reproduction	cytosol|Golgi membrane|perinuclear region of cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding|receptor signaling protein activity				0		Prostate(94;0.0405)				aatgtcaggcctacagaaatgg	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229982426	229982426	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229982426delA								URB2 (186480 upstream) : GALNT2 (211110 downstream)																							acaaGCAAACAAAAAAATGCA	0.333													4	2	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236701098	236701099	+	Intron	INS	-	A	A	rs145113368	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236701098_236701099insA	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GATTTCAGTATAAAAAATTAGA	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	245040650	245040651	+	IGR	INS	-	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245040650_245040651insG								HNRNPU (12823 upstream) : EFCAB2 (92520 downstream)																							tctcaaaaaaaacaaaaataca	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10573737	10573737	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10573737delT								HPCAL1 (5995 upstream) : ODC1 (6771 downstream)																							tcatggtgtgtggggcatggt	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16937369	16937370	+	IGR	INS	-	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16937369_16937370insT								FAM49A (90273 upstream) : RAD51AP2 (754616 downstream)																							AATGGGGCTTATTTTTCCTCTG	0.446													4	2	---	---	---	---	
WDR35	57539	broad.mit.edu	37	2	20169510	20169510	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20169510delT	uc002rdi.2	-						WDR35_uc002rdj.2_Intron|WDR35_uc010ext.2_Intron|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTCTTGAAttttttttttt	0.144													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20654862	20654862	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20654862delG								RHOB (5662 upstream) : HS1BP3 (162702 downstream)																							CTAGGCAGGTGGGAAGGGGAA	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	36204658	36204658	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36204658delT								None (None upstream) : CRIM1 (378739 downstream)																							agtcctgtggtttttcctgta	0.015													4	2	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39075225	39075225	+	Intron	DEL	A	-	-	rs75260498		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39075225delA	uc002rrf.2	-						DHX57_uc002rrd.3_Intron|DHX57_uc002rre.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				actctgtctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	45023432	45023432	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45023432delG								C2orf34 (23703 upstream) : SIX3 (145605 downstream)																							GGAAAATGGTGGTAAAGGTGG	0.468													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47171071	47171071	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47171071delG	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|MCFD2_uc010fba.2_5'Flank|MCFD2_uc010yof.1_5'Flank	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			GAGGCAGAAAGGGAAGATGAG	0.483													4	2	---	---	---	---	
TTC7A	57217	broad.mit.edu	37	2	47286950	47286951	+	Intron	DEL	CC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47286950_47286951delCC	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|TTC7A_uc002rvq.2_Intron|TTC7A_uc002rvr.2_Intron	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			tggccttagtcccatgccttga	0.124													4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63256343	63256343	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63256343delG	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			gctatcttttgtaggccacag	0.149									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100184422	100184423	+	Intron	DEL	AC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100184422_100184423delAC	uc002tag.2	-						AFF3_uc002taf.2_Intron	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CAAGAGCTGTACCTTCCGCTGC	0.460													4	2	---	---	---	---	
IL1R1	3554	broad.mit.edu	37	2	102791553	102791554	+	Intron	INS	-	TC	TC	rs141256291	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102791553_102791554insTC	uc002tbq.2	+						IL1R1_uc010fix.2_Intron|IL1R1_uc002tbp.2_Intron|IL1R1_uc002tbr.2_Intron	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor						innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	ATCAGGGAGGTTCTCTCTCTCC	0.381													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	105170872	105170874	+	IGR	DEL	TAC	-	-	rs142607087		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105170872_105170874delTAC								LOC150568 (41658 upstream) : POU3F3 (301095 downstream)																							TGCATGCATATACTACATATGTA	0.399													14	10	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109292205	109292206	+	Intron	INS	-	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109292205_109292206insG	uc002teg.2	+						LIMS1_uc002tef.2_Intron|LIMS1_uc002teh.2_Intron|LIMS1_uc002tei.2_Intron|LIMS1_uc002tej.2_Intron|LIMS1_uc002tek.3_Intron	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						TCACCTCTAAAGGGGAAAAAAG	0.376													4	2	---	---	---	---	
PAX8	7849	broad.mit.edu	37	2	114013024	114013024	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114013024delA	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_RNA|LOC654433_uc010fks.2_RNA|LOC654433_uc010fkt.2_RNA|LOC654433_uc002tjr.3_RNA|LOC654433_uc002tjs.3_RNA	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						TCCACAGTCCAAAAAAAAAAG	0.408			T	PPARG	follicular thyroid		Thyroid dysgenesis 						5	3	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121606053	121606053	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121606053delT	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TTTCTCTTTATTTTGGGTGGA	0.552													4	2	---	---	---	---	
PLA2R1	22925	broad.mit.edu	37	2	160801222	160801223	+	Intron	INS	-	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160801222_160801223insT	uc002ube.1	-						PLA2R1_uc010zcp.1_Intron	NM_007366	NP_031392	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1 isoform 1 precursor						endocytosis	extracellular space|integral to plasma membrane	receptor activity|sugar binding			skin(2)|ovary(1)	3						ACTTATAATGATTTTTTTTCTC	0.351													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	184923261	184923261	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184923261delT								NUP35 (896854 upstream) : ZNF804A (539832 downstream)																							CCTGAAGAGCTTAGCTCTATG	0.383													4	2	---	---	---	---	
CASP10	843	broad.mit.edu	37	2	202052152	202052152	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202052152delT	uc002uxl.1	+						CASP10_uc002uxi.1_Intron|CASP10_uc010zhn.1_Intron|CASP10_uc002uxj.1_Intron|CASP10_uc002uxk.1_Intron|CASP10_uc010fta.1_Intron|CASP10_uc002uxm.1_Intron|CASP10_uc010ftb.1_Intron	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein						apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						GTTTTATGCCTTTTTTTTTTT	0.259													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	208203229	208203229	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208203229delG								MIR1302-4 (69081 upstream) : CREB1 (191387 downstream)																							ACACATCTCTGCTGACAGACC	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217796093	217796093	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217796093delT								TNP1 (71311 upstream) : DIRC3 (352655 downstream)																							gatgggttggtttggcaggtc	0.000													4	2	---	---	---	---	
IHH	3549	broad.mit.edu	37	2	219921185	219921188	+	Intron	DEL	GCTG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219921185_219921188delGCTG	uc002vjo.1	-							NM_002181	NP_002172	Q14623	IHH_HUMAN	Indian hedgehog homolog precursor						cell-cell signaling|intein-mediated protein splicing|proteolysis	extracellular space|plasma membrane	cholesterol binding|patched binding|peptidase activity			breast(1)	1		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGCAGGTGAGCTGGAGAACAGTG	0.559													4	2	---	---	---	---	
UBE2F	140739	broad.mit.edu	37	2	238950220	238950222	+	3'UTR	DEL	AAC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238950220_238950222delAAC	uc002vxk.2	+	10					UBE2F_uc010znn.1_3'UTR|UBE2F_uc002vxl.2_RNA|UBE2F_uc010zno.1_RNA|UBE2F_uc010znp.1_3'UTR|SCLY_uc002vxm.3_Intron	NM_080678	NP_542409	Q969M7	UBE2F_HUMAN	NEDD8-conjugating enzyme						protein neddylation		ATP binding|NEDD8 ligase activity|protein binding				0		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;6.7e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|Kidney(56;3.53e-09)|KIRC - Kidney renal clear cell carcinoma(57;9.79e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000136)|Lung(119;0.0126)|LUSC - Lung squamous cell carcinoma(224;0.0301)		TGCTTACCTTAACATGTTTACTT	0.365													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241318657	241318657	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241318657delC								OTOS (238584 upstream) : GPC1 (56458 downstream)																							tctcacgtggcccccaagctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5933212	5933213	+	IGR	INS	-	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5933212_5933213insT								EDEM1 (671563 upstream) : GRM7 (969589 downstream)																							TCCTGGTTTCCTTTTGGTCCTG	0.307													4	2	---	---	---	---	
FBLN2	2199	broad.mit.edu	37	3	13659079	13659082	+	Intron	DEL	CCAT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13659079_13659082delCCAT	uc011avb.1	+						FBLN2_uc011auz.1_Intron|FBLN2_uc011ava.1_Intron|FBLN2_uc011avc.1_Intron	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			acccatccacccatccatccatcc	0.000													11	11	---	---	---	---	
GOLGA4	2803	broad.mit.edu	37	3	37378346	37378346	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37378346delT	uc003cgv.2	+						GOLGA4_uc003cgw.2_Intron|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Intron	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4						Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						CTACTCAACATTTTTTTTTCT	0.174													3	3	---	---	---	---	
CTNNB1	1499	broad.mit.edu	37	3	41236447	41236447	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41236447delG	uc010hia.1	+							NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin						adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	GTGTTTGGATGGGGGCGGGGA	0.423		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				4	2	---	---	---	---	
AMT	275	broad.mit.edu	37	3	49454438	49454438	+	3'UTR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49454438delC	uc003cww.2	-	9					AMT_uc011bcn.1_3'UTR|AMT_uc003cwx.2_3'UTR|AMT_uc011bco.1_3'UTR|AMT_uc003cwy.2_3'UTR|AMT_uc011bcp.1_3'UTR|AMT_uc011bcq.1_3'UTR	NM_000481	NP_000472	P48728	GCST_HUMAN	aminomethyltransferase isoform 1 precursor						glycine catabolic process	mitochondrion	aminomethyltransferase activity|transaminase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GTTCCCTCAGCCATCCCCAAG	0.488													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	55005459	55005459	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55005459delT	uc003dhf.2	+						CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		TGAATCCCAGTTTTACAGTAA	0.428													4	2	---	---	---	---	
DNAH12	201625	broad.mit.edu	37	3	57345116	57345116	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57345116delT	uc003dit.2	-						DNAH12_uc010hnc.2_Intron	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						AGATTGTTAGtttttttttgg	0.164													7	4	---	---	---	---	
LRIG1	26018	broad.mit.edu	37	3	66459844	66459844	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66459844delG	uc003dmx.2	-						LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Intron	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GCGACAGTCTGTCACTACTAA	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	80388277	80388279	+	IGR	DEL	GTG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80388277_80388279delGTG								ROBO1 (571218 upstream) : None (None downstream)																							atacaagggtgtggtacctgtaa	0.000													4	2	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100700087	100700088	+	Intron	INS	-	A	A	rs145114286		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100700087_100700088insA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron|ABI3BP_uc003dup.3_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						ACTTTTGCCTTAAAAAAAAAAA	0.386													4	3	---	---	---	---	
MORC1	27136	broad.mit.edu	37	3	108819090	108819090	+	Intron	DEL	A	-	-	rs78907417		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108819090delA	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						aatctgtctcaaaaaaaaaaa	0.164													11	5	---	---	---	---	
RAB7A	7879	broad.mit.edu	37	3	128517687	128517689	+	Intron	DEL	AAG	-	-	rs13075455		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128517687_128517689delAAG	uc003eks.1	+						RAB7A_uc010hsv.1_Intron|RAB7A_uc003ekt.2_Intron	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		aaaaaaaaaaaagaATCCCAGGA	0.207													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139510635	139510635	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139510635delC								NMNAT3 (113795 upstream) : CLSTN2 (143392 downstream)																							agactgaggtcctagagagga	0.000													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143016767	143016768	+	Intron	DEL	GT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143016767_143016768delGT	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						AATCCTAGTAGTGACAAGTAAA	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147184104	147184104	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147184104delC								ZIC1 (49600 upstream) : None (None downstream)																							tcttgggcttctggtggtgac	0.000													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149275790	149275790	+	Intron	DEL	A	-	-	rs10554239		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149275790delA	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			gctccatctcaaaaaaaaaaa	0.095													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	150437543	150437543	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150437543delT								FAM194A (15801 upstream) : SIAH2 (21368 downstream)																							TTTGCTTTTCTTTTTTTTAAC	0.363													4	2	---	---	---	---	
MECOM	2122	broad.mit.edu	37	3	168849313	168849314	+	5'UTR	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168849313_168849314delAG	uc003ffi.3	-	3					MECOM_uc010hwk.1_Frame_Shift_Del_p.F7fs|MECOM_uc003ffj.3_Frame_Shift_Del_p.F48fs|MECOM_uc011bpi.1_5'UTR|MECOM_uc003ffn.3_5'UTR|MECOM_uc003ffk.2_5'UTR|MECOM_uc003ffl.2_Frame_Shift_Del_p.F144fs|MECOM_uc011bpj.1_Frame_Shift_Del_p.F172fs|MECOM_uc011bpk.1_5'UTR|MECOM_uc010hwn.2_Frame_Shift_Del_p.F172fs|MECOM_uc003ffm.1_Frame_Shift_Del_p.F48fs	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						ACTACTCTATAGAATATCTTTA	0.406													99	49	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180599215	180599215	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180599215delT								CCDC39 (143553 upstream) : FXR1 (31237 downstream)																							agtctccttctttttttttcc	0.000													3	3	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183668075	183668075	+	Intron	DEL	T	-	-	rs4148588		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183668075delT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GATGCTCTGATTTTTTTTTTT	0.358													3	3	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185879676	185879677	+	Intron	INS	-	TG	TG	rs145872642	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185879676_185879677insTG	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	gtttctgtgtctgtgtgtgtgt	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	7091390	7091390	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7091390delT								GRPEL1 (21590 upstream) : FLJ36777 (7761 downstream)																							agataaacagttttttttttt	0.000													4	3	---	---	---	---	
CCDC149	91050	broad.mit.edu	37	4	24821761	24821761	+	Intron	DEL	G	-	-	rs144507372		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24821761delG	uc011bxr.1	-						CCDC149_uc003grc.2_Intron|CCDC149_uc003grb.2_Intron|CCDC149_uc003grd.2_Intron|CCDC149_uc011bxq.1_Intron	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)				TTACACTATTGCACCACCCTA	0.458													3	3	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41438817	41438818	+	Intron	INS	-	A	A	rs146848440	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41438817_41438818insA	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						GGAGCTGGTTGAAAAAAAAAAT	0.406													6	3	---	---	---	---	
SCD5	79966	broad.mit.edu	37	4	83667310	83667311	+	Intron	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83667310_83667311delCA	uc003hna.2	-						SCD5_uc003hnb.3_Intron|SCD5_uc003hnc.2_Intron	NM_001037582	NP_001032671	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				CAACTGGAGTCACACATGCTGA	0.351													4	2	---	---	---	---	
HELQ	113510	broad.mit.edu	37	4	84367468	84367468	+	Intron	DEL	T	-	-	rs35146359		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84367468delT	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						ACTAAAAAAAtttttttttta	0.129								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					5	3	---	---	---	---	
ARHGAP24	83478	broad.mit.edu	37	4	86851884	86851884	+	Intron	DEL	T	-	-	rs13126782	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86851884delT	uc003hpk.2	+						ARHGAP24_uc003hpj.2_Intron|ARHGAP24_uc003hpl.2_Intron|ARHGAP24_uc010ikf.2_Intron|ARHGAP24_uc003hpm.2_5'UTR	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GAAAAGGAAGTTTTTTTTTGC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	126153015	126153015	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126153015delG								ANKRD50 (519128 upstream) : FAT4 (84552 downstream)																							agagggcaatggtgagcTGGT	0.070													4	2	---	---	---	---	
OTUD4	54726	broad.mit.edu	37	4	146099717	146099718	+	Intron	INS	-	C	C	rs143481609	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146099717_146099718insC	uc003ika.3	-						OTUD4_uc003ijz.3_Intron|OTUD4_uc003ikb.3_Intron	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3								protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					ATACCCCACAGCAACACTGAAA	0.455													7	5	---	---	---	---	
CTSO	1519	broad.mit.edu	37	4	156858762	156858762	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156858762delT	uc003ipg.2	-							NM_001334	NP_001325	P43234	CATO_HUMAN	cathepsin O preproprotein						proteolysis	lysosome	cysteine-type endopeptidase activity				0	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		CTTTGCGttcttttttttttc	0.154													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	174766220	174766220	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174766220delA								MORF4 (228426 upstream) : FBXO8 (391592 downstream)																							tctttgcagtaacatggaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16056986	16056987	+	IGR	DEL	AC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16056986_16056987delAC								FBXL7 (117086 upstream) : MARCH11 (10487 downstream)																							CTCACTCCTTACACACACACAC	0.515													6	3	---	---	---	---	
UGT3A1	133688	broad.mit.edu	37	5	35998261	35998276	+	Intron	DEL	CTAACTGATGCCTCAG	-	-	rs57738871		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35998261_35998276delCTAACTGATGCCTCAG	uc003jjy.1	-							NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1							integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			aaaggaaattctaactgatgcctcagctttagaaaa	0.000													3	3	---	---	---	---	
IL31RA	133396	broad.mit.edu	37	5	55159299	55159299	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55159299delC	uc003jql.2	+						IL31RA_uc003jqk.2_Intron|IL31RA_uc011cqj.1_Intron|IL31RA_uc003jqm.2_Intron|IL31RA_uc003jqn.2_Intron|IL31RA_uc010iwa.1_Intron|IL31RA_uc003jqo.2_Intron	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor						anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CATCCGTTTTCAAGGCGTGCA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	56056036	56056036	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56056036delA								ANKRD55 (526850 upstream) : MAP3K1 (54864 downstream)																							CATTAGATATAATAGCAGCAA	0.388													4	2	---	---	---	---	
MIER3	166968	broad.mit.edu	37	5	56226157	56226157	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56226157delA	uc003jrd.1	-						MIER3_uc003jqz.1_Intron|MIER3_uc003jra.1_Intron|MIER3_uc003jrb.1_Intron|MIER3_uc003jrc.1_Intron	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TGTCTGGCTGAAAAAAAAAAA	0.259													4	3	---	---	---	---	
ARSB	411	broad.mit.edu	37	5	78134838	78134839	+	Intron	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78134838_78134839delAG	uc003kfq.2	-						ARSB_uc003kfr.3_Intron	NM_000046	NP_000037	P15848	ARSB_HUMAN	arylsulfatase B isoform 1 precursor						lysosomal transport|lysosome organization	lysosome	arylsulfatase activity|metal ion binding|N-acetylgalactosamine-4-sulfatase activity			upper_aerodigestive_tract(1)	1		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		CTCTCAGGTAAGAACAGGGCAG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	110255109	110255109	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110255109delC								SLC25A46 (156627 upstream) : TSLP (150669 downstream)																							CTGCTGACGTCCCAGCTAGAG	0.582													4	2	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127623331	127623331	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127623331delT	uc003kuu.2	-							NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		gtacctgaagtttttagtggt	0.090													4	2	---	---	---	---	
ADAMTS19	171019	broad.mit.edu	37	5	129073032	129073032	+	3'UTR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129073032delT	uc003kvb.1	+	23					ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		aattaatttatttttttGCCT	0.259													4	2	---	---	---	---	
FSTL4	23105	broad.mit.edu	37	5	132623510	132623511	+	Intron	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132623510_132623511delCA	uc003kyn.1	-							NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTACTCCAATCACACACATCCT	0.510													4	2	---	---	---	---	
TRPC7	57113	broad.mit.edu	37	5	135654533	135654533	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135654533delT	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ttcactgttgtttttttttta	0.000													4	2	---	---	---	---	
KLHL3	26249	broad.mit.edu	37	5	137034332	137034332	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137034332delC	uc010jek.2	-						KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|MYOT_uc011cye.1_Intron|KLHL3_uc010jem.1_Intron|KLHL3_uc010jen.1_Intron	NM_017415	NP_059111	Q9UH77	KLHL3_HUMAN	kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		CTATCTATTGCCCACTTCCAT	0.299													4	2	---	---	---	---	
DPYSL3	1809	broad.mit.edu	37	5	146779972	146779973	+	Intron	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146779972_146779973delAG	uc003lon.1	-						DPYSL3_uc003loo.2_Intron	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATTATTTTAAGTACAGGCTAT	0.366													4	2	---	---	---	---	
CSNK1A1	1452	broad.mit.edu	37	5	148899081	148899082	+	Intron	DEL	AA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148899081_148899082delAA	uc003lqx.1	-						CSNK1A1_uc011dcb.1_Intron|CSNK1A1_uc011dcc.1_Intron|CSNK1A1_uc003lqv.1_Intron|CSNK1A1_uc003lqw.1_Intron|CSNK1A1_uc003lqy.1_Intron|CSNK1A1_uc010jha.1_Intron	NM_001892	NP_001883	P48729	KC1A_HUMAN	casein kinase 1, alpha 1 isoform 2						cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		TTCACTCAGTAAGACTAATCAT	0.401													4	2	---	---	---	---	
C5orf4	10826	broad.mit.edu	37	5	154206262	154206262	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154206262delT	uc003lvs.3	-						C5orf4_uc011dde.1_Intron	NM_032385	NP_115761	Q96IV6	CE004_HUMAN	hypothetical protein LOC10826						fatty acid biosynthetic process	integral to membrane	iron ion binding|oxidoreductase activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			gaaatgttggtagagcctttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157167488	157167488	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157167488delG								THG1L (717 upstream) : LSM11 (3267 downstream)																							CAGAGCAGCAGGGATCATCAC	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161832589	161832590	+	IGR	DEL	TT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161832589_161832590delTT								GABRG2 (250045 upstream) : None (None downstream)																							GTTAAATAGGTTGAGGCCTTGA	0.297													4	2	---	---	---	---	
N4BP3	23138	broad.mit.edu	37	5	177545869	177545870	+	Intron	DEL	TT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177545869_177545870delTT	uc003mik.1	+						N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3							cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGAGttttctttttttttttt	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	179818937	179818938	+	IGR	INS	-	ATC	ATC	rs140623349	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179818937_179818938insATC								GFPT2 (38622 upstream) : CNOT6 (102479 downstream)																							TCATCACCATAATCCTGATCGC	0.342													3	10	---	---	---	---	
GCNT2	2651	broad.mit.edu	37	6	10530192	10530192	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10530192delA	uc010joo.2	+						GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Intron|GCNT2_uc010jon.2_3'UTR	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		ATGTCAAATTAAAAAAAAAAT	0.328													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14277776	14277776	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14277776delC								CD83 (140630 upstream) : JARID2 (967958 downstream)																							ctgctctcaacacagcagcct	0.000													4	2	---	---	---	---	
HIST1H2BJ	8970	broad.mit.edu	37	6	27099962	27099962	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27099962delA	uc003niu.1	-						HIST1H2AG_uc003niw.2_5'Flank			P06899	H2B1J_HUMAN	Homo sapiens histone cluster 1, H2bj, mRNA (cDNA clone IMAGE:4048288), with apparent retained intron.						defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding				0						TGGCAGATCTAAAAAAAAAAA	0.328													3	3	---	---	---	---	
HLA-L	3139	broad.mit.edu	37	6	30234086	30234086	+	3'UTR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30234086delG	uc003npv.2	+	7						NR_027822				SubName: Full=MHC class I antigen; Flags: Fragment;												0						atctctcataggaaccactgt	0.020													4	2	---	---	---	---	
DST	667	broad.mit.edu	37	6	56434627	56434628	+	Intron	DEL	AT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56434627_56434628delAT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACAAATGGAAATTTAGTATTAG	0.292													167	110	---	---	---	---	
PHF3	23469	broad.mit.edu	37	6	64410483	64410483	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64410483delT	uc003pep.1	+						PHF3_uc010kah.1_Intron|PHF3_uc003pen.2_Intron|PHF3_uc011dxs.1_Intron	NM_015153	NP_055968	Q92576	PHF3_HUMAN	PHD finger protein 3						multicellular organismal development|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			TACATGCttcttttttttttg	0.159													13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	71881175	71881175	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71881175delC								B3GAT2 (214387 upstream) : OGFRL1 (117302 downstream)																							ttgtcactttcagcaatgtta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	72367076	72367077	+	IGR	DEL	GT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72367076_72367077delGT								C6orf155 (236628 upstream) : RIMS1 (229573 downstream)																							tctggcagtagtgtctgcactc	0.000													4	2	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74473010	74473010	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74473010delT	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						TTTCAACAACTTTAGCCAATC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	86000182	86000182	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86000182delA								TBX18 (526283 upstream) : NT5E (159120 downstream)																							cctcctaagtagctgggatta	0.000													4	2	---	---	---	---	
C6orf165	154313	broad.mit.edu	37	6	88125702	88125702	+	Intron	DEL	A	-	-	rs34892535		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88125702delA	uc003plv.2	+						C6orf165_uc003plw.2_Intron|C6orf165_uc010kbv.1_Intron|C6orf165_uc003plu.1_Intron	NM_001031743	NP_001026913	Q8IYR0	CF165_HUMAN	hypothetical protein LOC154313 isoform 1											central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TTTTTATCTGAAAAAAAAAAA	0.279													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112647042	112647042	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112647042delT								LAMA4 (71214 upstream) : RFPL4B (21490 downstream)																							GCTTTGCAGCTTTTTTTTTTC	0.453													9	7	---	---	---	---	
NT5DC1	221294	broad.mit.edu	37	6	116560514	116560514	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116560514delT	uc003pwj.2	+						NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_152729	NP_689942	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase, cytosolic II-like 1 protein								hydrolase activity|metal ion binding				0		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		tattataaaattagggaaaga	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116774831	116774831	+	IGR	DEL	T	-	-	rs113147033		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116774831delT								DSE (15391 upstream) : FAM26F (7725 downstream)																							CTACTAGCTATTTTTTTTTTT	0.294													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	121893516	121893517	+	IGR	DEL	AG	-	-	rs140475771	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121893516_121893517delAG								GJA1 (122644 upstream) : HSF2 (827179 downstream)																							acggcagtgcagaggagaagtg	0.000													4	2	---	---	---	---	
STX7	8417	broad.mit.edu	37	6	132789254	132789255	+	Intron	DEL	GG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132789254_132789255delGG	uc003qdg.2	-						STX7_uc011ecg.1_Intron|STX7_uc011ech.1_Intron	NM_003569	NP_003560	O15400	STX7_HUMAN	syntaxin 7						intracellular protein transport|post-Golgi vesicle-mediated transport	early endosome membrane|integral to membrane	SNAP receptor activity				0	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		GAAATAAGCTGGAATAATGTTT	0.406													4	2	---	---	---	---	
UTRN	7402	broad.mit.edu	37	6	144661607	144661608	+	Intron	DEL	GA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144661607_144661608delGA	uc003qkt.2	+						UTRN_uc010khq.1_Intron	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTCCTCCGTGGAGAGAGGATTA	0.441													4	2	---	---	---	---	
TIAM2	26230	broad.mit.edu	37	6	155469781	155469782	+	Intron	DEL	TC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155469781_155469782delTC	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron|TIAM2_uc010kjj.2_Intron|TIAM2_uc003qqf.2_Intron|TIAM2_uc011efl.1_5'Flank|TIAM2_uc003qqg.2_5'Flank	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ATTGTCATTTTCTGAACAAAAT	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164350822	164350822	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164350822delT								QKI (355930 upstream) : None (None downstream)																							CTGACTAAAATAAGGAGAAGG	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164350825	164350826	+	IGR	DEL	GG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164350825_164350826delGG								QKI (355933 upstream) : None (None downstream)																							ACTAAAATAAGGAGAAGGAGTC	0.490													4	2	---	---	---	---	
TAX1BP1	8887	broad.mit.edu	37	7	27793356	27793357	+	Intron	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27793356_27793357delAG	uc003szl.2	+						TAX1BP1_uc011jzo.1_Intron|TAX1BP1_uc003szk.2_Intron|TAX1BP1_uc011jzp.1_Intron	NM_006024	NP_006015	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I)						anti-apoptosis|apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production	cytosol	identical protein binding|kinase binding|zinc ion binding			breast(1)	1			GBM - Glioblastoma multiforme(3;0.0823)			TTGAATAATCAGATCTTTCACT	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	39017501	39017501	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39017501delT								VPS41 (68701 upstream) : POU6F2 (28907 downstream)																							GCAGCTTGACTTTTTTTCCCC	0.448													4	2	---	---	---	---	
YKT6	10652	broad.mit.edu	37	7	44246365	44246367	+	Intron	DEL	CTC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44246365_44246367delCTC	uc003tkm.2	+						YKT6_uc011kbv.1_Intron	NM_006555	NP_006546	O15498	YKT6_HUMAN	YKT6 v-SNARE protein						ER to Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi|vesicle docking involved in exocytosis|vesicle targeting	cytoplasmic vesicle membrane|cytosol|endoplasmic reticulum|endosome|Golgi membrane|integral to plasma membrane|mitochondrion|SNARE complex	protein-cysteine S-palmitoleyltransferase activity|SNAP receptor activity				0						GCCTTGTGTTCTCGCCCCCTGTG	0.571													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63680897	63680897	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63680897delT								ZNF735 (231 upstream) : ZNF679 (7955 downstream)																							TTAAAAACAGttttttttttc	0.129													5	3	---	---	---	---	
STEAP4	79689	broad.mit.edu	37	7	87905889	87905889	+	3'UTR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87905889delT	uc003ujs.2	-	5					STEAP4_uc010lek.2_3'UTR	NM_024636	NP_078912	Q687X5	STEA4_HUMAN	tumor necrosis factor, alpha-induced protein 9						fat cell differentiation|ion transport|iron ion homeostasis	Golgi membrane|integral to membrane|plasma membrane	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	Esophageal squamous(14;0.00802)					TTAGTTTAACTTTTTTTTTAA	0.294													4	2	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89926774	89926774	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89926774delG	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						AGCCAGAGATGATCACTAAGA	0.219													4	4	---	---	---	---	
PON1	5444	broad.mit.edu	37	7	94947279	94947279	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94947279delA	uc003uns.2	-						PON1_uc011kih.1_Intron	NM_000446	NP_000437	P27169	PON1_HUMAN	paraoxonase 1 precursor						aromatic compound catabolic process|carboxylic acid catabolic process|organophosphate catabolic process|phosphatidylcholine metabolic process|positive regulation of binding|positive regulation of cholesterol efflux|positive regulation of transporter activity|response to external stimulus	spherical high-density lipoprotein particle	aryldialkylphosphatase activity|arylesterase activity|calcium ion binding|phospholipid binding|protein homodimerization activity			pancreas(1)	1	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0031)		Atorvastatin(DB01076)|Cefazolin(DB01327)	GAGCCTTTCTAAAAAAAAGTT	0.269													4	2	---	---	---	---	
BUD31	8896	broad.mit.edu	37	7	99010969	99010970	+	Intron	DEL	GA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99010969_99010970delGA	uc003uqf.2	+						BUD31_uc011kiu.1_Intron|BUD31_uc011kiv.1_Intron|BUD31_uc003uqg.3_Intron	NM_003910	NP_003901	P41223	BUD31_HUMAN	G10 protein						regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AGTGCCACCTGATCCTGCGTGT	0.475													4	2	---	---	---	---	
ZNF789	285989	broad.mit.edu	37	7	99082821	99082822	+	Intron	DEL	CC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99082821_99082822delCC	uc003uqq.1	+						ZNF789_uc010lfw.1_Intron|ZNF789_uc003uqr.1_Intron	NM_213603	NP_998768	Q5FWF6	ZN789_HUMAN	zinc finger protein 789 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CTTACTGTGTCCCGATGCAGCT	0.282													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100812705	100812706	+	IGR	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100812705_100812706delCA								VGF (3853 upstream) : C7orf52 (1072 downstream)																							TTCCACCTGTCACACACATAAC	0.416													4	2	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101860085	101860086	+	Intron	INS	-	TCT	TCT	rs380576		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101860085_101860086insTCT	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						cccacacacacccccacacaca	0.000													4	3	---	---	---	---	
IFRD1	3475	broad.mit.edu	37	7	112113112	112113123	+	Intron	DEL	TGTGTGTGTGTA	-	-	rs59135774		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112113112_112113123delTGTGTGTGTGTA	uc003vgh.2	+						IFRD1_uc011kmn.1_Intron|IFRD1_uc003vgj.2_Intron|IFRD1_uc011kmo.1_Intron|IFRD1_uc011kmp.1_Intron|IFRD1_uc003vgk.2_Intron	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1						multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						tgtgtgtgtgtgtgtgtgtgtatatatgtgtc	0.198													4	2	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	121960005	121960008	+	3'UTR	DEL	AAAC	-	-	rs3832517		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121960005_121960008delAAAC	uc010lkp.2	-	29					CADPS2_uc011knx.1_3'UTR|CADPS2_uc003vkg.3_3'UTR|CADPS2_uc010lkq.2_3'UTR	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TTCTCcaaaaaaacaaacaaacaa	0.270													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	123278228	123278228	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123278228delC								ASB15 (296 upstream) : LMOD2 (17633 downstream)																							caaacactttctacatacagc	0.000													4	2	---	---	---	---	
EXOC4	60412	broad.mit.edu	37	7	133417774	133417774	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133417774delA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				CGTCTTCAGTAATCAGCCTGA	0.418													4	2	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133811972	133811973	+	5'Flank	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133811972_133811973delAG	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						gaaaaataacagaagagactga	0.322													4	2	---	---	---	---	
TBXAS1	6916	broad.mit.edu	37	7	139575865	139575865	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139575865delA	uc011kqv.1	+						TBXAS1_uc003vvh.2_Intron|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Intron|TBXAS1_uc003vvj.2_Intron|TBXAS1_uc011kqw.1_Intron|TBXAS1_uc011kqx.1_Intron	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					GCCCATGGGGAAAGTGTGCTG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2486707	2486708	+	IGR	DEL	TG	-	-	rs140279333	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2486707_2486708delTG								MYOM2 (393328 upstream) : CSMD1 (306168 downstream)																							cctctgtgactgtccccagctg	0.000													4	2	---	---	---	---	
CDCA2	157313	broad.mit.edu	37	8	25327222	25327227	+	Intron	DEL	ATACAC	-	-	rs112567636		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25327222_25327227delATACAC	uc003xep.1	+						PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Intron|CDCA2_uc003xeq.1_Intron|CDCA2_uc003xer.1_Intron	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2						cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ACACTTTGAGATACACTTTATGAGAT	0.335													4	7	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38810442	38810444	+	Intron	DEL	TCT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38810442_38810444delTCT	uc003xmi.3	+						PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			CTACACAACATCTTCTTCTTATA	0.246													7	5	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40584194	40584194	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40584194delT	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			cactgcctgctttttgtgaaa	0.119													4	2	---	---	---	---	
POTEA	340441	broad.mit.edu	37	8	43154214	43154214	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43154214delT	uc003xpz.1	+						POTEA_uc003xqa.1_Intron	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2											ovary(1)	1						tctttctttctttctttcttt	0.060													6	3	---	---	---	---	
BEYLA	497634	broad.mit.edu	37	8	47752236	47752237	+	5'Flank	INS	-	AA	AA	rs141101713	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47752236_47752237insAA	uc010lxr.1	+						BEYLA_uc003xqb.1_5'Flank	NR_027013				Homo sapiens cDNA FLJ40156 fis, clone TESTI2014385.												0						gccctgcacttacagtgcattg	0.000													4	3	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48557561	48557561	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48557561delC	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				tagagatgtacccaggggctg	0.000													4	2	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48586205	48586205	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48586205delT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_5'UTR|KIAA0146_uc010lxv.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				AGTGGATTTCTTTTTTTTTTC	0.343													8	4	---	---	---	---	
PRKDC	5591	broad.mit.edu	37	8	48856675	48856675	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48856675delC	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				CCTATATTAACCCCATTAATC	0.388								NHEJ					45	33	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58080008	58080008	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58080008delA								IMPAD1 (173581 upstream) : C8orf71 (112094 downstream)																							GGAGGAAAGGAGGCAGATTTG	0.363													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	68762374	68762374	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68762374delA								CPA6 (103754 upstream) : PREX2 (101974 downstream)																							tcttctctgcaaacactctca	0.000													4	2	---	---	---	---	
SLCO5A1	81796	broad.mit.edu	37	8	70594237	70594237	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70594237delA	uc003xyl.2	-						SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Intron	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TCATCCCTGGAAAAAAAAATA	0.378													6	3	---	---	---	---	
KCNB2	9312	broad.mit.edu	37	8	73530882	73530882	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73530882delC	uc003xzb.2	+							NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			TAAGCAATTACAAGAGGAAAA	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75008325	75008325	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75008325delA								LY96 (67020 upstream) : JPH1 (138616 downstream)																							ctaacctttcaaaaaacccta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76665038	76665039	+	IGR	INS	-	C	C			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76665038_76665039insC								HNF4G (185979 upstream) : LOC100192378 (858076 downstream)																							CCTTCTGGGAACAGCCACTTGA	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93662985	93662985	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93662985delG								RUNX1T1 (555279 upstream) : C8orf83 (232880 downstream)																							taccaactctgccttcaaaac	0.000													4	2	---	---	---	---	
MATN2	4147	broad.mit.edu	37	8	98915110	98915111	+	Intron	DEL	TT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98915110_98915111delTT	uc003yic.2	+						MATN2_uc003yib.1_Intron|MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron|MATN2_uc003yie.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TTTAGGCAGCTTAAGAAAGCAG	0.545													4	2	---	---	---	---	
PABPC1	26986	broad.mit.edu	37	8	101725594	101725594	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101725594delT	uc003yjs.1	-						PABPC1_uc011lhc.1_Intron|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Intron|PABPC1_uc003yju.2_Intron	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			ATTAAGAAGGTAAACACCTTC	0.403													4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	128813374	128813375	+	Intron	DEL	GT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128813374_128813375delGT	uc003ysj.2	+						PVT1_uc010mdq.2_Intron|PVT1_uc010mdp.1_Intron					Human proto-oncogene myc mRNA, 5' end, clone DMmyc.												0						agcaagggaggtaggagaaccc	0.000													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141242529	141242532	+	Intron	DEL	TCTC	-	-	rs145796550		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141242529_141242532delTCTC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						TTTGTCCTTTTCTCTCTCTATTAC	0.441													4	2	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4855362	4855363	+	Intron	INS	-	TC	TC	rs149545594	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4855362_4855363insTC	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron|RCL1_uc010mhl.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGAGCGGTGGGTCTCTTTGCCC	0.530													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	15040570	15040570	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15040570delA	uc003zln.1	-											Homo sapiens cDNA FLJ46077 fis, clone TESTI2003768, weakly  similar to Chloride channel protein 3.																		gtataataataaaaaaaaaaG	0.159													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	32199366	32199366	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32199366delC								None (None upstream) : ACO1 (185235 downstream)																							tAGCCGTTTTCAGTAAATGTC	0.109													4	2	---	---	---	---	
SUGT1P1	441394	broad.mit.edu	37	9	33235850	33235850	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33235850delC	uc010mjq.1	-							NR_003667				Homo sapiens suppressor of G2 allele of SKP1 pseudogene (S. cerevisiae) (SUGT1P), non-coding RNA.												0						acagaaggcacaatgcgagtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	34893046	34893046	+	IGR	DEL	C	-	-	rs71506187		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34893046delC								C9orf144 (54463 upstream) : KIAA1045 (64475 downstream)																							TTCTCACCTGCCAGCAATTGC	0.527													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66455348	66455349	+	Intron	INS	-	G	G	rs142146645		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66455348_66455349insG	uc010mng.1	-						uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		GACAGAGGGATGAGAAATAGAA	0.144													3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74204892	74204892	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74204892delA								TRPM3 (143072 upstream) : TMEM2 (93390 downstream)																							TATGCTCTTGAAAAAAAAAAT	0.393													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	87032517	87032517	+	IGR	DEL	G	-	-	rs148658880	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87032517delG								SLC28A3 (49104 upstream) : NTRK2 (250949 downstream)																							ACTTTTCCATGGGGGGGTGGC	0.502													4	2	---	---	---	---	
AGTPBP1	23287	broad.mit.edu	37	9	88258051	88258052	+	Intron	DEL	TA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88258051_88258052delTA	uc011ltd.1	-						AGTPBP1_uc004aod.3_5'UTR|AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						TATTGTTGGGTAGTTTTGTTTT	0.267													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106443393	106443395	+	IGR	DEL	TGA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106443393_106443395delTGA								CYLC2 (662623 upstream) : SMC2 (413146 downstream)																							CACTCGCATCTGATAAGGAGAGA	0.409													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110746390	110746391	+	IGR	INS	-	T	T	rs143022604	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110746390_110746391insT								KLF4 (494343 upstream) : ACTL7B (870480 downstream)																							GGCAACCTTTATGCAGCTCATT	0.366													4	2	---	---	---	---	
DFNB31	25861	broad.mit.edu	37	9	117186125	117186125	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117186125delC	uc004biz.3	-						DFNB31_uc004bix.2_Intron|DFNB31_uc004biy.3_Intron|DFNB31_uc004bja.3_Intron	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1						inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						ATACTCATCTCCAAATCCTAT	0.468													4	2	---	---	---	---	
DBC1	1620	broad.mit.edu	37	9	122049157	122049157	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122049157delT	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GGTTATTCAATAAAAAATGAT	0.413													4	2	---	---	---	---	
MAPKAP1	79109	broad.mit.edu	37	9	128409231	128409231	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128409231delT	uc004bpv.2	-						MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron|MAPKAP1_uc010mxc.1_Intron	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						ATAACCATACTTTTTAACTGC	0.418													4	2	---	---	---	---	
RALGPS1	9649	broad.mit.edu	37	9	129962198	129962199	+	Intron	INS	-	GCACACTCACATATACACAC	GCACACTCACATATACACAC	rs112586596	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129962198_129962199insGCACACTCACATATACACAC	uc004bqo.1	+						RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						cacgtacacatgcacactcaca	0.297													6	3	---	---	---	---	
ASS1	445	broad.mit.edu	37	9	133330011	133330011	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133330011delA	uc004bzm.2	+						ASS1_uc004bzn.2_Intron|ASS1_uc010mza.2_Intron|ASS1_uc004bzo.2_Intron|ASS1_uc010mzb.2_Intron|ASS1_uc004bzp.2_Intron|ASS1_uc010mzc.2_Intron	NM_000050	NP_000041	P00966	ASSY_HUMAN	argininosuccinate synthetase 1						arginine biosynthetic process|urea cycle	cytosol	argininosuccinate synthase activity|ATP binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CTTCTCTTTTatctctctgtc	0.284													4	2	---	---	---	---	
UBAC1	10422	broad.mit.edu	37	9	138831328	138831329	+	Intron	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138831328_138831329delCA	uc004cgt.2	-						UBAC1_uc004cgs.1_Intron|UBAC1_uc004cgu.2_Intron	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		agcccacactcactcaccacag	0.168													14	17	---	---	---	---	
PNPLA7	375775	broad.mit.edu	37	9	140418568	140418568	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140418568delC	uc004cnf.2	-						PNPLA7_uc011mfa.1_5'Flank|PNPLA7_uc010ncj.1_Intron	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7						lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		ctcctttcttcccaccactgg	0.075													4	2	---	---	---	---	
CELF2	10659	broad.mit.edu	37	10	11300012	11300012	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11300012delC	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron|CELF2_uc010qbk.1_Intron|CELF2_uc010qbl.1_Intron|CELF2_uc010qbm.1_Intron|CELF2_uc001iko.3_Intron|CELF2_uc001ikp.3_Intron|CELF2_uc010qbn.1_Intron|CELF2_uc009xiw.1_3'UTR|CELF2_uc010qbo.1_Intron|CELF2_uc010qbp.1_Intron	NM_001025077	NP_001020248	O95319	CELF2_HUMAN	CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0						TTTTATTTCTCCAGTTCAGAA	0.458													4	2	---	---	---	---	
CUBN	8029	broad.mit.edu	37	10	16958050	16958051	+	Intron	INS	-	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16958050_16958051insA	uc001ioo.2	-							NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	taaaaataaataaataaataaG	0.356													24	13	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32329555	32329558	+	Intron	DEL	ACAC	-	-	rs145271745		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32329555_32329558delACAC	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				ACACCCTAAAacacacacacacac	0.235													7	4	---	---	---	---	
FAM170B	170370	broad.mit.edu	37	10	50343924	50343924	+	5'Flank	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50343924delC	uc001jhj.2	-						uc001jhi.1_RNA|uc001jhk.1_5'Flank			A6NMN3	F170B_HUMAN	RecName: Full=Putative protein FAM170B;												0						CTAAACAGTTCAGATAGGTGA	0.443													4	2	---	---	---	---	
A1CF	29974	broad.mit.edu	37	10	52611831	52611831	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52611831delC	uc001jjj.2	-						A1CF_uc010qhn.1_Intron|A1CF_uc001jji.2_Intron|A1CF_uc001jjh.2_Intron|A1CF_uc010qho.1_Intron|A1CF_uc009xov.2_Intron|A1CF_uc001jjk.1_Intron	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2						cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1						CGTGCGCAGTCCAAAGTCCAC	0.383													4	2	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93695681	93695681	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93695681delT	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				AGACTTAAACTTTTTTTTTTT	0.279													5	3	---	---	---	---	
PLCE1	51196	broad.mit.edu	37	10	95782903	95782903	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95782903delC	uc001kjk.2	+							NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				ggctgcagaacaaagatggca	0.075													4	2	---	---	---	---	
CYP2E1	1571	broad.mit.edu	37	10	135351623	135351623	+	Intron	DEL	T	-	-	rs71474737		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135351623delT	uc001lnj.1	+						CYP2E1_uc001lnk.1_Intron|CYP2E1_uc009ybl.1_Intron|CYP2E1_uc009ybm.1_Intron|CYP2E1_uc001lnl.1_Intron	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,						drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	TGTAGGTGGATTTTTTTTTTC	0.348									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				3	3	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	693971	693971	+	Intron	DEL	T	-	-	rs35573497		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:693971delT	uc001lqq.1	-						TMEM80_uc001lqr.2_5'Flank|TMEM80_uc001lqs.2_5'Flank|TMEM80_uc010qwi.1_5'Flank	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		GCAGCCCCCCTGGGCCACCAC	0.667													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1125427	1125428	+	IGR	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1125427_1125428delAG								MUC2 (21010 upstream) : MUC5B (17046 downstream)																							GACAAGAGGCAGAGCCAGGAGG	0.649													4	3	---	---	---	---	
DNHD1	144132	broad.mit.edu	37	11	6550533	6550533	+	Intron	DEL	A	-	-	rs71470015		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6550533delA	uc001mdw.3	+							NM_144666	NP_653267	Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1 isoform 1						microtubule-based movement	dynein complex	microtubule motor activity			ovary(2)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGCTCACTGCAAAGGCCGGCC	0.517													5	6	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	32117556	32117557	+	Intron	DEL	CT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32117556_32117557delCT	uc010reb.1	+						RCN1_uc010rea.1_Intron|RCN1_uc001mtk.2_5'Flank	NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					CCTCCCCCACCTAAAAAAAAGT	0.282													4	2	---	---	---	---	
QSER1	79832	broad.mit.edu	37	11	32924954	32924955	+	Intron	DEL	GT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32924954_32924955delGT	uc001mty.2	+							NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1											ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					atgttgggaggtgataccagaa	0.000													4	2	---	---	---	---	
PRR5L	79899	broad.mit.edu	37	11	36482039	36482041	+	Intron	DEL	GTA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36482039_36482041delGTA	uc001mwo.3	+						PRR5L_uc001mwp.2_Intron|PRR5L_uc009ykk.2_Intron|PRR5L_uc010rfc.1_Intron	NM_001160167	NP_001153639	Q6MZQ0	PRR5L_HUMAN	protor-2 isoform a											ovary(1)	1						tagtatctctgtagtatctctgt	0.478													4	2	---	---	---	---	
PRG3	10394	broad.mit.edu	37	11	57147891	57147893	+	Intron	DEL	AAC	-	-	rs146870216		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57147891_57147893delAAC	uc001njv.1	-							NM_006093	NP_006084	Q9Y2Y8	PRG3_HUMAN	proteoglycan 3 precursor						basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0						acaaaaaacaaacaaaaaaaaaa	0.123													8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57668093	57668096	+	IGR	DEL	CTTT	-	-	rs145625700		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57668093_57668096delCTTT								CTNND1 (81442 upstream) : OR9Q1 (123257 downstream)																							GGATTTATAACTTTCTTCCTGACA	0.475													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57674942	57674943	+	IGR	INS	-	T	T	rs148467647		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57674942_57674943insT								CTNND1 (88291 upstream) : OR9Q1 (116410 downstream)																							ataaacactgattttttttttt	0.000													4	2	---	---	---	---	
GIF	2694	broad.mit.edu	37	11	59611620	59611620	+	Intron	DEL	T	-	-	rs72085643		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59611620delT	uc001noi.2	-						GIF_uc010rkz.1_Intron	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)						cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						tctttctttcttttttttttg	0.194													13	6	---	---	---	---	
TPCN2	219931	broad.mit.edu	37	11	68842304	68842304	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68842304delC	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_Intron	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AGGCTTTGCTCCTGGTGTGTT	0.547													4	2	---	---	---	---	
ARRB1	408	broad.mit.edu	37	11	74993260	74993260	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74993260delT	uc001owe.1	-						ARRB1_uc001owf.1_Intron	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A						G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						ATCTAAAGGGTTTGGCCCAGC	0.373													4	2	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75152589	75152590	+	Intron	DEL	GT	-	-	rs34643232		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75152589_75152590delGT	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001own.3_Intron|GDPD5_uc009yuc.2_Intron|GDPD5_uc009yud.2_Intron	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						CTGCCCGACCgtgtgtgtgtgt	0.569													6	3	---	---	---	---	
GUCY1A2	2977	broad.mit.edu	37	11	106856558	106856558	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106856558delA	uc001pjg.1	-						GUCY1A2_uc010rvo.1_Intron|GUCY1A2_uc009yxn.1_Intron	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		GAAGACTGAGAAAAAAAAGAA	0.343													4	2	---	---	---	---	
ACAT1	38	broad.mit.edu	37	11	108011163	108011168	+	Intron	DEL	TTATTA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108011163_108011168delTTATTA	uc001pjy.2	+						ACAT1_uc001pjx.2_Intron	NM_000019	NP_000010	P24752	THIL_HUMAN	acetyl-Coenzyme A acetyltransferase 1 precursor						acetoacetic acid biosynthetic process|branched chain family amino acid catabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	acetyl-CoA C-acetyltransferase activity|metal ion binding			ovary(3)	3		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	TTTGAGAAATTTATTAGAACTTTTTC	0.345													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112625568	112625568	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112625568delT								PTS (484891 upstream) : NCAM1 (206427 downstream)																							ATTAAGTCCCTCAAAAGGCAA	0.423													4	2	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5914992	5914993	+	Intron	DEL	GG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5914992_5914993delGG	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						GAGGGCCATTGGATATATTTCA	0.470													4	2	---	---	---	---	
DERA	51071	broad.mit.edu	37	12	16135558	16135558	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16135558delT	uc001rde.2	+						DERA_uc010shx.1_Intron	NM_015954	NP_057038	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase-like						deoxyribonucleoside catabolic process|deoxyribonucleotide catabolic process	cytoplasm	deoxyribose-phosphate aldolase activity|protein binding				0		Hepatocellular(102;0.121)				TTCTTCCACATTTTTTTTTGT	0.373													8	4	---	---	---	---	
USP15	9958	broad.mit.edu	37	12	62789934	62789935	+	Intron	DEL	AT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62789934_62789935delAT	uc001src.1	+						USP15_uc001srb.1_Intron	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		CCTTAGTGagatatatatatat	0.223													4	2	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62982152	62982153	+	Intron	INS	-	T	T	rs72264005		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62982152_62982153insT	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srf.2_Intron|MON2_uc001srg.2_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		GTCTACCTTACTTTTTTTTTTT	0.277													3	4	---	---	---	---	
WIF1	11197	broad.mit.edu	37	12	65514569	65514569	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65514569delA	uc001ssk.2	-							NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor						multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TAACCGACGCAAAAAAATGCC	0.398			T	HMGA2	pleomorphic salivary gland adenoma								4	2	---	---	---	---	
PTPRB	5787	broad.mit.edu	37	12	70926115	70926115	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70926115delC	uc001swb.3	-						uc001svz.2_Intron|PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CCCAACCccacccccccacag	0.194													5	3	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72665168	72665168	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72665168delA	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						TCTCTATGTTAATAGCCAAAG	0.493													4	2	---	---	---	---	
SYT1	6857	broad.mit.edu	37	12	79702326	79702327	+	Intron	INS	-	AGAC	AGAC	rs140848209	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79702326_79702327insAGAC	uc001sys.2	+						SYT1_uc001syt.2_Intron|SYT1_uc001syu.2_Intron|SYT1_uc001syv.2_Intron	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I						detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						gaaagaaagaaagaaaaaagaa	0.000													4	3	---	---	---	---	
MRPL42	28977	broad.mit.edu	37	12	93894748	93894748	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93894748delA	uc001tcr.2	+						MRPL42_uc001tcq.2_Intron|MRPL42_uc001tcs.2_Intron|MRPL42_uc001tct.2_Intron	NM_172177	NP_751917	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42 isoform a						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome			ovary(2)	2						cagtctctagaaaaaaaaaat	0.109													4	2	---	---	---	---	
IGF1	3479	broad.mit.edu	37	12	102821757	102821757	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102821757delG	uc001tjp.3	-						IGF1_uc001tjn.2_Intron|IGF1_uc001tjm.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111285	NP_001104755	P05019	IGF1_HUMAN	insulin-like growth factor 1 isoform 3						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2						GAGAGGTCCTGGGGAATGTTT	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	107295417	107295417	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107295417delT								RIC8B (12325 upstream) : C12orf23 (54127 downstream)																							CTTAttttacttttttttttt	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110047731	110047732	+	IGR	INS	-	G	G	rs149101671	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110047731_110047732insG								MVK (12661 upstream) : C12orf34 (104458 downstream)																							TGATAAATGGAGGGGCAGGGGG	0.530													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111821937	111821938	+	IGR	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111821937_111821938delAG								FAM109A (15012 upstream) : SH2B3 (21814 downstream)																							GATTCTCTCTAGGCAGGAATTG	0.460													4	2	---	---	---	---	
SLC24A6	80024	broad.mit.edu	37	12	113740540	113740541	+	Intron	DEL	GT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113740540_113740541delGT	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235	Q6J4K2	NCKX6_HUMAN	solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1						GACAGAGTAAGTGACAGAGCCC	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	113885575	113885577	+	IGR	DEL	GGG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113885575_113885577delGGG								SDSL (9495 upstream) : LHX5 (15117 downstream)																							ggggcatgcaggggaaacagcat	0.025													4	2	---	---	---	---	
MSI1	4440	broad.mit.edu	37	12	120809497	120809497	+	5'Flank	DEL	A	-	-	rs112962110		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120809497delA	uc001tye.1	-							NM_002442	NP_002433	O43347	MSI1H_HUMAN	musashi 1						nervous system development	cytoplasm|nucleus	nucleotide binding			central_nervous_system(2)|breast(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATTTTGGATTAAAAAAAAAAA	0.398													3	5	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	130320909	130320910	+	Intron	DEL	GA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130320909_130320910delGA	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTTGAGACAGGAGAGAGAGAGA	0.436													4	2	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132398256	132398256	+	Intron	DEL	C	-	-	rs68126752		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132398256delC	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		ccaaaaaaaacaaaaaaaTGC	0.318													8	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	33526344	33526344	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33526344delG								PDS5B (174189 upstream) : KL (63857 downstream)																							ggaaatgtgtggggctgatga	0.000													4	2	---	---	---	---	
MTRF1	9617	broad.mit.edu	37	13	41828987	41828987	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41828987delT	uc001uxx.2	-						MTRF1_uc001uxy.2_Intron|MTRF1_uc001uxz.2_Intron|MTRF1_uc010tff.1_Intron|MTRF1_uc001uyc.1_Intron	NM_004294	NP_004285	O75570	RF1M_HUMAN	mitochondrial translational release factor 1						regulation of translational termination	mitochondrion	translation release factor activity, codon specific				0		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		AAACCTTGTGTTTTTTTTTTT	0.264													4	2	---	---	---	---	
EPSTI1	94240	broad.mit.edu	37	13	43543043	43543044	+	Intron	INS	-	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43543043_43543044insA	uc001uyw.1	-						EPSTI1_uc001uyx.1_Intron	NM_001002264	NP_001002264	Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 isoform 1											ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CAGAAAATCAGAAAAAAAAAAA	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	105413324	105413325	+	IGR	DEL	GG	-	-	rs112049629		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105413324_105413325delGG								None (None upstream) : DAOA (704891 downstream)																							TGAAGAGTAAGGTGCACTGAAT	0.446													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52711749	52711749	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52711749delA								NID2 (175803 upstream) : PTGDR (22682 downstream)																							ccagaactttatccaggtctc	0.045													4	2	---	---	---	---	
EXOC5	10640	broad.mit.edu	37	14	57676110	57676110	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57676110delA	uc001xct.2	-						EXOC5_uc001xcs.2_Intron|EXOC5_uc010trg.1_Intron|EXOC5_uc010trh.1_Intron	NM_006544	NP_006535	O00471	EXOC5_HUMAN	SEC10 protein						exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3						aatttaaaataaaaaaaaata	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	61622531	61622532	+	IGR	INS	-	A	A	rs150250509	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61622531_61622532insA								SLC38A6 (72081 upstream) : PRKCH (31755 downstream)																							GACTCCGTGGTAAAAAAAAATC	0.272													7	12	---	---	---	---	
FUT8	2530	broad.mit.edu	37	14	66188896	66188896	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66188896delT	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron|FUT8_uc001xis.2_Intron	NM_178155	NP_835368	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		ATGGAGACTATTTTTTTTTGT	0.343													7	4	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72895133	72895134	+	Intron	INS	-	T	T			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72895133_72895134insT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc010arg.2_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TCTGTGGGAGATTCAGTTCGCC	0.307													4	2	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72908380	72908381	+	Intron	DEL	GC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72908380_72908381delGC	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc010arg.2_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		TCCTCAGACTGCCCAGCACTCA	0.584													4	2	---	---	---	---	
GABRB3	2562	broad.mit.edu	37	15	26828761	26828761	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26828761delA	uc001zaz.2	-						GABRB3_uc010uae.1_Intron|GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TTTATCAAGGAAAAAAAAAAC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	39037722	39037722	+	IGR	DEL	A	-	-	rs5812051		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39037722delA								C15orf53 (45483 upstream) : C15orf54 (505163 downstream)																							TGGTATAGTTAAAAATCTTGA	0.388													6	6	---	---	---	---	
DAPK2	23604	broad.mit.edu	37	15	64201250	64201251	+	Intron	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64201250_64201251delCA	uc002amr.2	-						DAPK2_uc010uim.1_RNA	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		GCTGCACCTTCAGCCGCCTTGC	0.495													4	2	---	---	---	---	
CILP	8483	broad.mit.edu	37	15	65501776	65501776	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65501776delT	uc002aon.2	-							NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein						negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CCCTCTTATCTTTTTTTCCTC	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	66143253	66143253	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66143253delT								DENND4A (58622 upstream) : RAB11A (18543 downstream)																							tgctgaaatatttacagatgg	0.134													4	2	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78322651	78322651	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78322651delT	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						ggggattcccttttttttttt	0.000													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	82074150	82074151	+	IGR	DEL	GT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82074150_82074151delGT								TMC3 (407732 upstream) : MEX3B (259977 downstream)																							ACAGGTGTGAGTAGAATATGAA	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84858138	84858139	+	IGR	INS	-	T	T	rs71453232		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84858138_84858139insT								ADAMTSL3 (149547 upstream) : LOC388152 (9461 downstream)																							TGGGGAGCTGGTGCAGAGGCCT	0.599													11	6	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99309270	99309271	+	Intron	DEL	AC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99309270_99309271delAC	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	GGTGTTCTCTACAGACTGCAGG	0.609													4	2	---	---	---	---	
ADAMTS17	170691	broad.mit.edu	37	15	100819466	100819466	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100819466delC	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CCTTGGGCTTCATGTCAGAGC	0.607													4	2	---	---	---	---	
CASKIN1	57524	broad.mit.edu	37	16	2231708	2231709	+	Intron	INS	-	A	A			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2231708_2231709insA	uc010bsg.1	-							NM_020764	NP_065815	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1						signal transduction	cytoplasm				skin(2)	2						gggctggggcggggctggggct	0.208													6	3	---	---	---	---	
FAM86A	196483	broad.mit.edu	37	16	5140733	5140733	+	Intron	DEL	G	-	-	rs116862288	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5140733delG	uc002cyo.2	-						FAM86A_uc002cyp.2_Intron	NM_201400	NP_958802	Q96G04	FA86A_HUMAN	hypothetical protein LOC196483 isoform 1												0						cgggcctcaagggtgtcacgc	0.040													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15132211	15132212	+	Intron	INS	-	AAAGTTG	AAAGTTG	rs147448533	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15132211_15132212insAAAGTTG	uc002ddc.2	+						NTAN1_uc002ddd.2_Intron|NTAN1_uc010uzo.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTAGTAAGAAAAAAGTTGATTG	0.361													4	2	---	---	---	---	
TMC5	79838	broad.mit.edu	37	16	19455155	19455158	+	Intron	DEL	GTAC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19455155_19455158delGTAC	uc002dgc.3	+						TMC5_uc010vaq.1_Intron|TMC5_uc002dgb.3_Intron|TMC5_uc010var.1_Intron	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a							integral to membrane				skin(1)	1						gaatggatgggtacatggatggat	0.000													8	6	---	---	---	---	
USP31	57478	broad.mit.edu	37	16	23161923	23161923	+	5'Flank	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23161923delA	uc002dll.2	-							NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)		TGGTTCCATTAAAAAAAAAAT	0.224													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26393225	26393226	+	IGR	DEL	CC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26393225_26393226delCC								HS3ST4 (244217 upstream) : C16orf82 (684993 downstream)																							CAAATACCTTCCCATTGTTGGC	0.208													4	2	---	---	---	---	
GTF3C1	2975	broad.mit.edu	37	16	27489513	27489513	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27489513delA	uc002dov.1	-						GTF3C1_uc002dou.2_Intron	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						aaaaggaaagaaaaaaaaaag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	52760514	52760514	+	IGR	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52760514delG								TOX3 (178800 upstream) : CHD9 (328431 downstream)																							ttggatttttgtcactcaaaa	0.114													4	2	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53351969	53351969	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53351969delA	uc002ehb.2	+						CHD9_uc002egy.2_Intron|CHD9_uc002ehc.2_Intron|CHD9_uc002ehf.2_Intron|CHD9_uc010cbw.2_Intron	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				accctgtctcaaaaaaaaata	0.085													3	4	---	---	---	---	
DUS2L	54920	broad.mit.edu	37	16	68110817	68110818	+	Intron	DEL	TT	-	-	rs113367225		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68110817_68110818delTT	uc002evi.2	+						DUS2L_uc002evj.2_Intron|DUS2L_uc010vkk.1_Intron|DUS2L_uc010cez.2_Intron	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog						tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)		GACATCTCTCTTTTTTTTTTTT	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79755260	79755260	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79755260delC								MAF (120638 upstream) : DYNLRB2 (819594 downstream)																							GATCCGGGGTCACAGAGAAGG	0.463													4	2	---	---	---	---	
GAN	8139	broad.mit.edu	37	16	81388855	81388856	+	Intron	DEL	GG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81388855_81388856delGG	uc002fgo.2	+							NM_022041	NP_071324	Q9H2C0	GAN_HUMAN	gigaxonin						cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)				GAGTTTGTGTGGCAGTGCAGTT	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20488023	20488025	+	IGR	DEL	CTC	-	-	rs76850913		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20488023_20488025delCTC								LGALS9B (117175 upstream) : CCDC144NL (278685 downstream)																							GAGATGAGTTCTCCCTCCTCCTC	0.557													3	3	---	---	---	---	
JUP	3728	broad.mit.edu	37	17	39742181	39742183	+	Intron	DEL	TGC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39742181_39742183delTGC	uc010wfs.1	-						KRT14_uc002hxf.1_Intron|KRT14_uc010cxp.1_Intron	NM_021991	NP_068831	P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TCCTCCCCTGTGCTGGAGAACAA	0.369													4	2	---	---	---	---	
KAT2A	2648	broad.mit.edu	37	17	40270129	40270130	+	Intron	INS	-	GAC	GAC	rs35360387		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40270129_40270130insGAC	uc002hyx.2	-							NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like						chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						GGAGAGAGAGAGTCAGGGACGG	0.629													4	2	---	---	---	---	
SGCA	6442	broad.mit.edu	37	17	48246775	48246776	+	Intron	INS	-	AC	AC	rs146398455	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48246775_48246776insAC	uc002iqi.2	+						SGCA_uc010wmh.1_3'UTR|SGCA_uc002iqj.2_Intron|SGCA_uc010wmi.1_Intron|uc010dbn.1_5'Flank	NM_000023	NP_000014	Q16586	SGCA_HUMAN	sarcoglycan, alpha isoform 1 precursor						muscle contraction|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(2)	2						AGTCTGAGGATacacacacaca	0.446											OREG0024558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	4	---	---	---	---	
LUC7L3	51747	broad.mit.edu	37	17	48817432	48817432	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48817432delA	uc002isr.2	+						LUC7L3_uc002isp.1_Intron|LUC7L3_uc010wmw.1_Intron|LUC7L3_uc002isq.2_Intron|LUC7L3_uc002iss.2_Intron	NM_006107	NP_006098	O95232	LC7L3_HUMAN	LUC7-like 3						apoptosis|mRNA processing|response to stress|RNA splicing	focal adhesion|nuclear speck	DNA binding|mRNA binding|protein binding				0						CTTCTCTTTTAACCATATATG	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	50686480	50686480	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50686480delA								CA10 (449103 upstream) : None (None downstream)																							AGGAAGAAGGAAAAAAGTAGT	0.383													4	2	---	---	---	---	
BRIP1	83990	broad.mit.edu	37	17	59941027	59941028	+	5'Flank	INS	-	G	G			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59941027_59941028insG	uc002izk.1	-							NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						GAAAAAAAAAAAAAAAAACAAG	0.500			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
ABCA6	23460	broad.mit.edu	37	17	67124603	67124603	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67124603delT	uc002jhw.1	-							NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					gtGAGGTGACTTTTTTTTTTA	0.149													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70436596	70436596	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70436596delA	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		TTTCTTAAGGAAAAAAAAATC	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72095094	72095095	+	IGR	INS	-	CA	CA	rs147371323	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72095094_72095095insCA								C17orf54 (270418 upstream) : RPL38 (104700 downstream)																							acacacttgctcacacacacac	0.109													3	4	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8276098	8276099	+	Intron	DEL	AG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8276098_8276099delAG	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CAAGTCCTTTAGGTTGGTTCCA	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	10112814	10112814	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10112814delC								VAPA (152797 upstream) : APCDD1 (341811 downstream)																							TTCAGTGGTGCCAGGAATATC	0.333													4	2	---	---	---	---	
FHOD3	80206	broad.mit.edu	37	18	34037127	34037127	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34037127delC	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CTGAGAGGGACAGGTGAGGAG	0.468													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34918414	34918414	+	Intron	DEL	A	-	-	rs9948470	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34918414delA	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						caccactgtcactaccaccat	0.214													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34918416	34918416	+	Intron	DEL	T	-	-	rs532558	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34918416delT	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						ccactgtcactaccaccatca	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	36470995	36470995	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36470995delC								None (None upstream) : LOC647946 (315893 downstream)																							ATTATTCAGTCCCATGCCCAG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45333307	45333308	+	IGR	DEL	TC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45333307_45333308delTC								IER3IP1 (630562 upstream) : SMAD2 (26159 downstream)																							ttctttacattcaacccatcag	0.040													4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46168122	46168124	+	Intron	DEL	GAA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46168122_46168124delGAA	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GTAACTCCGTGAAACACCCAACT	0.488													4	2	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48349621	48349623	+	Intron	DEL	CCC	-	-	rs71171345		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48349621_48349623delCCC	uc002lex.3	-						MRO_uc010dpc.2_Intron	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		tttgcttcctcccacttctctac	0.236													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	52272237	52272237	+	IGR	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52272237delC								C18orf26 (5513 upstream) : RAB27B (223603 downstream)																							aaagagtggtccccaggagtg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75167257	75167258	+	IGR	DEL	CT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75167257_75167258delCT								GALR1 (185163 upstream) : None (None downstream)																							AATATGTCTCCTTTCAGGATTT	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3568334	3568335	+	IGR	INS	-	T	T	rs112290116		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3568334_3568335insT								C19orf28 (10763 upstream) : HMG20B (4608 downstream)																							CGTTAAAAAAAttttttttttt	0.163													4	2	---	---	---	---	
SLC25A41	284427	broad.mit.edu	37	19	6426272	6426277	+	3'UTR	DEL	CAGCCT	-	-	rs140041202		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6426272_6426277delCAGCCT	uc010dus.2	-	7					KHSRP_uc002mer.3_5'Flank|SLC25A41_uc010dut.2_3'UTR	NM_173637	NP_775908	Q8N5S1	S2541_HUMAN	solute carrier family 25, member 41						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						CCCCCACCCCCAGCCTGCTTTTGCCA	0.626													11	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7730845	7730845	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7730845delT								STXBP2 (18087 upstream) : RETN (3127 downstream)																							cttttttttattttttttgag	0.194													5	3	---	---	---	---	
CC2D1A	54862	broad.mit.edu	37	19	14030491	14030491	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14030491delA	uc002mxo.2	+						CC2D1A_uc002mxn.2_Intron|CC2D1A_uc002mxp.2_Intron|CC2D1A_uc010dzh.2_Intron|CC2D1A_uc002mxq.1_Intron	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			atcctgtctcaaaaaaaaaaa	0.174													6	3	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33616310	33616310	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33616310delT	uc002nug.1	+						GPATCH1_uc002nuh.1_Intron	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					GCCCCCCCGCttttttttttt	0.189													6	3	---	---	---	---	
CLC	1178	broad.mit.edu	37	19	40226844	40226844	+	Intron	DEL	G	-	-	rs367156	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40226844delG	uc002omh.2	-							NM_001828	NP_001819	Q05315	LPPL_HUMAN	Charcot-Leyden crystal protein						lipid catabolic process|multicellular organismal development		carboxylesterase activity|lysophospholipase activity|sugar binding				0	all_cancers(60;2.99e-06)|all_lung(34;4.7e-08)|Lung NSC(34;5.46e-08)|Ovarian(47;0.06)	Renal(1328;0.000147)|Hepatocellular(1079;0.0202)|Myeloproliferative disorder(2;0.0255)	Epithelial(26;6.43e-25)|OV - Ovarian serous cystadenocarcinoma(5;1.07e-24)|all cancers(26;8.38e-23)	GBM - Glioblastoma multiforme(1328;4.97e-06)|STAD - Stomach adenocarcinoma(1328;0.00655)		AAAAAAAAAAGAAAGAAAGAA	0.249													5	3	---	---	---	---	
ARHGEF1	9138	broad.mit.edu	37	19	42420570	42420571	+	Intron	DEL	CA	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42420570_42420571delCA	uc002osc.2	+									Q92888	ARHG1_HUMAN	SubName: Full=ARHGEF1 protein; SubName: Full=Rho guanine nucleotide exchange factor (GEF) 1, isoform CRA_g;						cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		ctgtcacagtcacacacacaca	0.163													6	3	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													5	8	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50779898	50779898	+	Intron	DEL	A	-	-	rs77206276		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50779898delA	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGAGGAGCATAACATGAGGCC	0.383													8	5	---	---	---	---	
MYBPC2	4606	broad.mit.edu	37	19	50951732	50951732	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50951732delT	uc002psf.2	+							NM_004533	NP_004524	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type						cell adhesion|muscle filament sliding	cytosol|myosin filament	actin binding|structural constituent of muscle			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		cccccatttattttttttttt	0.174													12	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51077096	51077096	+	IGR	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51077096delT								LRRC4B (5794 upstream) : SNAR-F (31124 downstream)																							tattgcccgcttgtctggttt	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19752690	19752691	+	IGR	INS	-	G	G	rs148471148	by1000genomes	TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19752690_19752691insG								SLC24A3 (49150 upstream) : RIN2 (117519 downstream)																							atagaacagatgcgcgctctca	0.000													5	3	---	---	---	---	
SYCP2	10388	broad.mit.edu	37	20	58456722	58456722	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58456722delT	uc002yaz.2	-							NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			AATAGAATAGTTTTTTTTTTC	0.254													5	3	---	---	---	---	
C2CD2	25966	broad.mit.edu	37	21	43332611	43332612	+	Intron	INS	-	A	A	rs11387061		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43332611_43332612insA	uc002yzw.2	-						C2CD2_uc002yzu.2_Intron|C2CD2_uc002yzv.2_Intron|C2CD2_uc002yzx.1_Intron	NM_015500	NP_056315	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2 isoform							cytosol|extracellular region|nucleus				ovary(1)	1						tatttttttttttttttgagac	0.173													6	3	---	---	---	---	
LSS	4047	broad.mit.edu	37	21	47623416	47623416	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47623416delG	uc002zij.2	-						LSS_uc011afv.1_Intron|LSS_uc002zil.2_Intron|LSS_uc002zik.2_Intron	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1						cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					CTTCTTCTTTGCGCTTCTCTG	0.438													4	2	---	---	---	---	
SDF2L1	23753	broad.mit.edu	37	22	21997738	21997738	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21997738delC	uc002zvf.2	+							NM_022044	NP_071327	Q9HCN8	SDF2L_HUMAN	stromal cell-derived factor 2-like 1 precursor							endoplasmic reticulum lumen|membrane					0	Colorectal(54;0.105)					agagagacttcccaggccagc	0.159											OREG0026342	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
AP1B1	162	broad.mit.edu	37	22	29743199	29743200	+	Intron	DEL	AC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29743199_29743200delAC	uc003afj.2	-						AP1B1_uc003afi.2_Intron|AP1B1_uc003afk.2_Intron|AP1B1_uc003afl.2_Intron|AP1B1_uc011ako.1_Intron	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						AGAGCATGCTACCCACACTTGC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35529834	35529837	+	IGR	DEL	GGGT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35529834_35529837delGGGT								ISX (46456 upstream) : HMGXB4 (123608 downstream)																							agagggagaggggtgaggaaagag	0.113													4	2	---	---	---	---	
TXN2	25828	broad.mit.edu	37	22	36863675	36863676	+	3'UTR	DEL	CT	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36863675_36863676delCT	uc003apk.1	-	4					TXN2_uc003apl.1_RNA	NM_012473	NP_036605	Q99757	THIOM_HUMAN	thioredoxin 2 precursor						cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	mitochondrion|nucleolus	electron carrier activity				0						CACCACCATCCTCTGATGGCCC	0.644													4	2	---	---	---	---	
CSF2RB	1439	broad.mit.edu	37	22	37332004	37332004	+	Intron	DEL	G	-	-	rs3833916		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37332004delG	uc003aqa.3	+						CSF2RB_uc003aqc.3_Intron	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta						respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)	ggctcacagagggggttcctg	0.264													1	5	---	---	---	---	
ZC3H7B	23264	broad.mit.edu	37	22	41747815	41747819	+	Intron	DEL	ATTTT	-	-	rs71803158		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41747815_41747819delATTTT	uc003azw.2	+						ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B						interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						GTTGTGTCTCattttattttatttt	0.171													6	3	---	---	---	---	
MOV10L1	54456	broad.mit.edu	37	22	50572743	50572744	+	Intron	INS	-	ATTC	ATTC	rs67162661		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50572743_50572744insATTC	uc003bjj.2	+						MOV10L1_uc003bjk.3_Intron|MOV10L1_uc011arp.1_Intron|MOV10L1_uc011arq.1_Intron|MOV10L1_uc010hao.1_Intron	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1						germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TCATAAATGTAATTTATGAATT	0.282													4	3	---	---	---	---	
SAPS2	9701	broad.mit.edu	37	22	50831641	50831641	+	Intron	DEL	C	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50831641delC	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		AGACCTAGTGCCCAGTTGGTG	0.577													4	2	---	---	---	---	
WWC3	55841	broad.mit.edu	37	X	10095848	10095849	+	Intron	INS	-	T	T	rs112603848		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10095848_10095849insT	uc004csx.3	+						WWC3_uc010nds.2_Intron|WWC3_uc010ndt.2_Intron	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3											ovary(4)	4						gtcttgctctgttgcccaggct	0.010													5	3	---	---	---	---	
ASB9	140462	broad.mit.edu	37	X	15270680	15270680	+	Intron	DEL	G	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15270680delG	uc004cwl.2	-						ASB9_uc004cwk.2_Intron|ASB9_uc004cwm.2_Intron|ASB9_uc010ner.2_Intron|ASB9_uc004cwn.2_Intron	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform						intracellular signal transduction						0	Hepatocellular(33;0.183)					acaggtttttgtgaaaaatgg	0.139													4	2	---	---	---	---	
CXorf36	79742	broad.mit.edu	37	X	45021020	45021022	+	Intron	DEL	GAG	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45021020_45021022delGAG	uc004dgg.2	-							NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN	hypothetical protein LOC79742 isoform 1							extracellular region				lung(1)	1						GGCTGTTGGTGAGAAGAAAGGAG	0.374													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48164542	48164542	+	Intron	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48164542delA	uc010nib.1	-							NM_174962	NP_777622			synovial sarcoma, X breakpoint 9																		AGCAGCCTTGAGTCTTTGGGA	0.507													12	6	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101097274	101097277	+	Intron	DEL	TTCC	-	-	rs6621225		TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101097274_101097277delTTCC	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						gtctctctctttccttccttcctt	0.083													6	3	---	---	---	---	
KCNE1L	23630	broad.mit.edu	37	X	108870833	108870834	+	5'Flank	DEL	AC	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108870833_108870834delAC	uc004eoh.2	-							NM_012282	NP_036414	Q9UJ90	KCE1L_HUMAN	potassium voltage-gated channel, Isk-related						regulation of heart contraction	voltage-gated potassium channel complex					0						taactgtcctacccttggctct	0.000													4	2	---	---	---	---	
RHOXF1	158800	broad.mit.edu	37	X	119247054	119247054	+	Intron	DEL	T	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119247054delT	uc004esk.1	-						uc004esi.1_Intron	NM_139282	NP_644811	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1						gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						gagaaataccttttttttttt	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	151115020	151115020	+	IGR	DEL	A	-	-			TCGA-B8-4154-01A-01D-1251-10	TCGA-B8-4154-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151115020delA								MAGEA4 (21380 upstream) : GABRE (6577 downstream)																							catggcctttatcttccaatc	0.000													4	2	---	---	---	---	
