Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16974243	16974243	+	RNA	SNP	G	C	C	rs142213352	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974243G>C	uc009vow.2	+	5		c.1053G>C			MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_Intron|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_Intron|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_Intron					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						GATCTCAGCTGTCGCTCGGGG	0.652													4	9	---	---	---	---	PASS
RPA2	6118	broad.mit.edu	37	1	28240591	28240591	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28240591G>T	uc001bpe.1	-	2	382	c.100C>A	c.(100-102)CAA>AAA	p.Q34K	RPA2_uc001bpd.1_Missense_Mutation_p.Q42K|RPA2_uc010ofp.1_5'UTR	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa	34					cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TTTTCGGCTTGAGAAGGTGCG	0.493								Direct_reversal_of_damage|NER					5	38	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36932909	36932909	+	Silent	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36932909C>T	uc001caw.1	-	16	2140	c.1962G>A	c.(1960-1962)AGG>AGA	p.R654R	MRPS15_uc001cas.2_5'Flank|CSF3R_uc001cat.1_Silent_p.K216K|CSF3R_uc009vvc.1_Silent_p.R183R|CSF3R_uc001cau.1_Silent_p.R54R|CSF3R_uc001cav.1_Silent_p.R654R|CSF3R_uc001cax.1_Silent_p.R654R|CSF3R_uc001cay.1_Missense_Mutation_p.G623E	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	654	Cytoplasmic (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGGGATTCTTCCTGCTGGAGA	0.602													38	195	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52703253	52703253	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52703253G>C	uc001cto.2	+	4	336	c.164G>C	c.(163-165)AGT>ACT	p.S55T	ZFYVE9_uc001ctn.2_Missense_Mutation_p.S55T|ZFYVE9_uc001ctp.2_Missense_Mutation_p.S55T	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	55					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						ACTTTGGCCAGTGTGAATGAA	0.438													31	133	---	---	---	---	PASS
SCP2	6342	broad.mit.edu	37	1	53460611	53460611	+	Intron	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53460611A>T	uc001cur.1	+						SCP2_uc001cus.1_RNA|SCP2_uc010ono.1_Intron|SCP2_uc010onp.1_Intron|SCP2_uc009vzi.1_Intron	NM_002979	NP_002970	P22307	NLTP_HUMAN	sterol carrier protein 2 isoform 1 proprotein						bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|lipid transport	mitochondrion|nucleus|peroxisomal matrix	propanoyl-CoA C-acyltransferase activity|propionyl-CoA C2-trimethyltridecanoyltransferase activity|protein binding|sterol binding			breast(1)	1						AGAACCTGGGACCATGGACTC	0.517													22	85	---	---	---	---	PASS
BRDT	676	broad.mit.edu	37	1	92470112	92470112	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92470112G>T	uc001dok.3	+	17	2879	c.2530G>T	c.(2530-2532)GAA>TAA	p.E844*	BRDT_uc001dol.3_Nonsense_Mutation_p.E844*|BRDT_uc010osz.1_Nonsense_Mutation_p.E848*|BRDT_uc009wdf.2_Nonsense_Mutation_p.E771*|BRDT_uc010ota.1_Nonsense_Mutation_p.E798*|BRDT_uc010otb.1_Nonsense_Mutation_p.E798*|BRDT_uc001dom.3_Nonsense_Mutation_p.E844*	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	844					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		TCGGACACAGGAACTCATACG	0.393													34	132	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109795801	109795801	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109795801G>A	uc001dxa.3	+	1	3161	c.3100G>A	c.(3100-3102)GTC>ATC	p.V1034I		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1034	Cadherin 9.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CAACAACTATGTCACCAATCG	0.557													34	114	---	---	---	---	PASS
ADAM30	11085	broad.mit.edu	37	1	120437279	120437279	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120437279T>G	uc001eij.2	-	1	1835	c.1681A>C	c.(1681-1683)AAT>CAT	p.N561H		NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein	561	Cys-rich.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GTTTCAACATTTATACACTGT	0.373													55	226	---	---	---	---	PASS
NUDT17	200035	broad.mit.edu	37	1	145588663	145588663	+	Intron	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145588663A>C	uc001eoe.2	-						NBPF10_uc001emp.3_Intron|NUDT17_uc001eof.1_Missense_Mutation_p.I255M	NM_001012758	NP_001012776	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety								hydrolase activity|metal ion binding				0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCAGTAGGTGAATGGTGGTGG	0.502											OREG0013751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	41	---	---	---	---	PASS
ADAM17	6868	broad.mit.edu	37	2	9645471	9645471	+	Silent	SNP	T	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9645471T>C	uc002qzu.2	-	12	1551	c.1368A>G	c.(1366-1368)CAA>CAG	p.Q456Q	ADAM17_uc010ewy.2_Silent_p.Q456Q|ADAM17_uc010ewz.2_Intron	NM_003183	NP_003174	P78536	ADA17_HUMAN	a disintegrin and metalloprotease domain 17	456	Peptidase M12B.|Extracellular (Potential).				B cell differentiation|cell adhesion mediated by integrin|epidermal growth factor receptor signaling pathway|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|germinal center formation|membrane protein intracellular domain proteolysis|negative regulation of interleukin-8 production|nerve growth factor receptor signaling pathway|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of chemokine production|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of protein phosphorylation|positive regulation of T cell chemotaxis|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of mast cell apoptosis|response to drug|response to high density lipoprotein particle stimulus|response to hypoxia|response to lipopolysaccharide|spleen development|T cell differentiation in thymus|wound healing, spreading of epidermal cells	actin cytoskeleton|apical plasma membrane|cell surface|cytoplasm|integral to plasma membrane|membrane raft	integrin binding|interleukin-6 receptor binding|metalloendopeptidase activity|PDZ domain binding|SH3 domain binding|zinc ion binding			lung(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		TATAGATTGATTGTTTACTGC	0.378													8	177	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26698885	26698885	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26698885C>A	uc002rhk.2	-	24	3015	c.2888G>T	c.(2887-2889)CGA>CTA	p.R963L	OTOF_uc010yla.1_5'Flank|OTOF_uc002rhh.2_Missense_Mutation_p.R216L|OTOF_uc002rhi.2_Missense_Mutation_p.R273L|OTOF_uc002rhj.2_Missense_Mutation_p.R216L	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	963	Cytoplasmic (Potential).|C2 3.				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATGTGCGCTCGGAGCTGGAA	0.642													4	27	---	---	---	---	PASS
KHK	3795	broad.mit.edu	37	2	27315220	27315220	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27315220A>G	uc002ril.2	+	2	630	c.113A>G	c.(112-114)CAG>CGG	p.Q38R	KHK_uc002rim.2_Missense_Mutation_p.Q38R|KHK_uc002rin.2_Missense_Mutation_p.Q38R|KHK_uc002rio.2_Intron	NM_000221	NP_000212	P50053	KHK_HUMAN	ketohexokinase isoform a	38					fructose catabolic process	cytosol	ATP binding|ketohexokinase activity|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGAGATGGCAGCGCGGAGGC	0.592													10	117	---	---	---	---	PASS
SNX17	9784	broad.mit.edu	37	2	27598997	27598997	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27598997C>G	uc002rkg.1	+	12	1351	c.1129C>G	c.(1129-1131)CAG>GAG	p.Q377E	SNX17_uc010ylj.1_Missense_Mutation_p.Q357E|SNX17_uc010ylk.1_Missense_Mutation_p.Q163E|SNX17_uc010eza.1_Missense_Mutation_p.Q163E|SNX17_uc002rki.1_RNA|SNX17_uc002rkh.1_Missense_Mutation_p.Q163E|SNX17_uc010yll.1_Missense_Mutation_p.Q163E|SNX17_uc010ylm.1_Missense_Mutation_p.Q163E|SNX17_uc010yln.1_Missense_Mutation_p.Q365E|SNX17_uc010ylo.1_Missense_Mutation_p.Q295E|SNX17_uc010ylp.1_Missense_Mutation_p.Q352E|SNX17_uc010ylq.1_Missense_Mutation_p.Q163E	NM_014748	NP_055563	Q15036	SNX17_HUMAN	sorting nexin 17	377					cell communication|endosome transport|intracellular protein transport|regulation of endocytosis|signal transduction	cytoplasmic vesicle membrane|cytosol|early endosome|Golgi apparatus	low-density lipoprotein particle receptor binding|phosphatidylinositol binding|protein C-terminus binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATCTGCTTGCAGTCCATGGT	0.522													43	184	---	---	---	---	PASS
GALM	130589	broad.mit.edu	37	2	38893235	38893235	+	5'UTR	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38893235G>C	uc002rqy.2	+	1						NM_138801	NP_620156	Q96C23	GALM_HUMAN	galactose mutarotase						hexose metabolic process	cytoplasm	aldose 1-epimerase activity|carbohydrate binding				0		all_hematologic(82;0.248)				GTAAACTTGGGTCGCCTCTAG	0.582													4	8	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48809434	48809434	+	Silent	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48809434G>A	uc010yol.1	+	1	1709	c.1662G>A	c.(1660-1662)CAG>CAA	p.Q554Q	STON1_uc002rwo.3_Silent_p.Q554Q|STON1_uc010fbm.2_Silent_p.Q554Q|STON1-GTF2A1L_uc002rwp.1_Silent_p.Q554Q|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Silent_p.Q554Q	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	554					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CATTGGCGCAGAGGTCATCCT	0.483													37	180	---	---	---	---	PASS
WDR92	116143	broad.mit.edu	37	2	68384457	68384457	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68384457G>C	uc002see.1	-	1	200	c.119C>G	c.(118-120)GCA>GGA	p.A40G	WDR92_uc002sed.1_Intron|WDR92_uc002sef.1_Missense_Mutation_p.A40G|WDR92_uc002seg.1_Intron|PNO1_uc002seh.2_5'Flank	NM_138458	NP_612467	Q96MX6	WDR92_HUMAN	monad	40					apoptosis|histone lysine methylation		methylated histone residue binding				0						GGTGCCCCGTGCGAAGTTGCC	0.602													24	67	---	---	---	---	PASS
CNRIP1	25927	broad.mit.edu	37	2	68520911	68520911	+	3'UTR	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68520911C>A	uc002sek.3	-	3					CNRIP1_uc002sej.3_Intron|CNRIP1_uc002sem.1_RNA|CNRIP1_uc002sel.3_RNA	NM_015463	NP_056278	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1								protein binding			liver(1)	1						AATGGTGTGGCATGCCTTGTT	0.433													6	34	---	---	---	---	PASS
XRCC5	7520	broad.mit.edu	37	2	217001838	217001838	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217001838A>C	uc002vfy.2	+	11	1281	c.1141A>C	c.(1141-1143)ATT>CTT	p.I381L	XRCC5_uc002vfz.2_Missense_Mutation_p.I267L	NM_021141	NP_066964	P13010	XRCC5_HUMAN	ATP-dependent DNA helicase II	381	Ku.				double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding			lung(1)|kidney(1)	2		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		TTCCTCCCTGATTCATGCTTT	0.408								Direct_reversal_of_damage|NHEJ					45	220	---	---	---	---	PASS
TMBIM1	64114	broad.mit.edu	37	2	219146894	219146894	+	Translation_Start_Site	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219146894G>T	uc002vho.1	-	3	697	c.-29C>A	c.(-31--27)AGCTG>AGATG		PNKD_uc002vhn.2_Intron|TMBIM1_uc002vhp.1_Translation_Start_Site|TMBIM1_uc010zjz.1_Intron|TMBIM1_uc010zka.1_Translation_Start_Site	NM_022152	NP_071435	Q969X1	TMBI1_HUMAN	transmembrane BAX inhibitor motif containing 1							integral to membrane					0		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGAACCCCAGCTGCTGGGAC	0.647													5	14	---	---	---	---	PASS
NDUFA10	4705	broad.mit.edu	37	2	240960806	240960806	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240960806C>A	uc002vyn.2	-	3	348	c.268G>T	c.(268-270)GGG>TGG	p.G90W	NDUFA10_uc010fzc.1_Missense_Mutation_p.G90W|NDUFA10_uc002vyo.1_Missense_Mutation_p.G90W|NDUFA10_uc002vyp.2_Missense_Mutation_p.G90W	NM_004544	NP_004535	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	90					mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)	TAATGAATCCCCGCTTCAGGA	0.502											OREG0015348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	66	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14964675	14964675	+	Silent	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14964675G>C	uc003bzc.2	+	16	4040	c.3930G>C	c.(3928-3930)CTG>CTC	p.L1310L	FGD5_uc011avk.1_Silent_p.L1310L|FGD5_uc003bzd.2_Silent_p.L388L	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1310					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						TCCCGGGCCTGATGAGAGGTA	0.607													3	15	---	---	---	---	PASS
CHDH	55349	broad.mit.edu	37	3	53853056	53853056	+	Silent	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53853056C>A	uc003dgz.2	-	8	1715	c.1275G>T	c.(1273-1275)GGG>GGT	p.G425G		NM_018397	NP_060867	Q8NE62	CHDH_HUMAN	choline dehydrogenase precursor	425					alcohol metabolic process		choline dehydrogenase activity|flavin adenine dinucleotide binding			ovary(1)|central_nervous_system(1)	2		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	CCCGCATGGGCCCCACATGTA	0.557													13	64	---	---	---	---	PASS
FLNB	2317	broad.mit.edu	37	3	57994561	57994561	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57994561G>C	uc003djj.2	+	1	435	c.270G>C	c.(268-270)GAG>GAC	p.E90D	FLNB_uc010hne.2_Missense_Mutation_p.E90D|FLNB_uc003djk.2_Missense_Mutation_p.E90D|FLNB_uc010hnf.2_Missense_Mutation_p.E90D	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	90	Actin-binding.|CH 1.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TGGACCGTGAGAGCATCAAGC	0.667													30	87	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123451941	123451941	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123451941T>G	uc003ego.2	-	11	1600	c.1318A>C	c.(1318-1320)ATT>CTT	p.I440L	MYLK_uc011bjw.1_Missense_Mutation_p.I440L|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Missense_Mutation_p.I440L|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Missense_Mutation_p.I264L	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	440	Ig-like C2-type 3.				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GGCTTTGGAATCCCGGAAACT	0.557													9	24	---	---	---	---	PASS
EEFSEC	60678	broad.mit.edu	37	3	127983506	127983506	+	Missense_Mutation	SNP	C	T	T	rs142548867	byFrequency	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127983506C>T	uc003eki.2	+	4	706	c.668C>T	c.(667-669)CCG>CTG	p.P223L	EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756	P57772	SELB_HUMAN	eukaryotic elongation factor,	223						cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1						CCCTCGGGACCGTTCCTCATG	0.562													15	162	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142098968	142098968	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142098968T>A	uc003eus.2	-	23	2738	c.2671A>T	c.(2671-2673)ATT>TTT	p.I891F	XRN1_uc010huu.2_Missense_Mutation_p.I357F|XRN1_uc003eut.2_Missense_Mutation_p.I891F|XRN1_uc003euu.2_Missense_Mutation_p.I891F|XRN1_uc003euv.1_Missense_Mutation_p.I752F	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	891					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						TCACATGGAATGCTGAAAATC	0.318													22	95	---	---	---	---	PASS
DRD5	1816	broad.mit.edu	37	4	9784959	9784959	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9784959C>A	uc003gmb.3	+	1	1702	c.1306C>A	c.(1306-1308)CGC>AGC	p.R436S		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	436	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	TCCTTTCGATCGCATGTTCCA	0.557													20	101	---	---	---	---	PASS
PCDH7	5099	broad.mit.edu	37	4	31144197	31144197	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31144197C>T	uc011bxx.1	+	3	4478	c.3470C>T	c.(3469-3471)CCG>CTG	p.P1157L	PCDH7_uc011bxw.1_Missense_Mutation_p.P1110L	NM_002589	NP_002580	O60245	PCDH7_HUMAN	protocadherin 7 isoform a precursor	Error:Variant_position_missing_in_O60245_after_alignment					homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4						CGCACTTCTCCGGAGAGGAAG	0.562													29	122	---	---	---	---	PASS
C5orf22	55322	broad.mit.edu	37	5	31538433	31538433	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31538433C>G	uc003jhj.3	+	4	571	c.444C>G	c.(442-444)AAC>AAG	p.N148K	C5orf22_uc011cnw.1_Intron|C5orf22_uc003jhk.3_Intron	NM_018356	NP_060826	Q49AR2	CE022_HUMAN	hypothetical protein LOC55322	148										ovary(2)	2						AGCTAGAGAACCAAAAACCTT	0.348													40	220	---	---	---	---	PASS
KIF2A	3796	broad.mit.edu	37	5	61643911	61643911	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61643911C>A	uc003jsy.3	+	3	507	c.196C>A	c.(196-198)CTT>ATT	p.L66I	KIF2A_uc003jsz.3_Missense_Mutation_p.L66I|KIF2A_uc010iwp.2_Missense_Mutation_p.L66I|KIF2A_uc003jsx.3_Missense_Mutation_p.L46I|KIF2A_uc010iwq.2_5'UTR	NM_004520	NP_004511	O00139	KIF2A_HUMAN	kinesin heavy chain member 2 isoform 1	66	Globular (Potential).				blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		TAACCCTGACCTTGTTCCTGA	0.378													31	131	---	---	---	---	PASS
RGNEF	64283	broad.mit.edu	37	5	73193844	73193844	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73193844G>A	uc011csq.1	+	29	3910	c.3899G>A	c.(3898-3900)TGT>TAT	p.C1300Y	RGNEF_uc003kcx.2_Missense_Mutation_p.C1300Y|RGNEF_uc010izf.2_Missense_Mutation_p.C1300Y|RGNEF_uc011csr.1_Missense_Mutation_p.C987Y|RGNEF_uc003kcz.3_Missense_Mutation_p.C264Y|RGNEF_uc003kda.3_Intron	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	1300	Interaction with PTK2; required for regulation of axonal branching and synapse formation (By similarity).				cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		AGTCAATCATGTGAGGACAGT	0.458													5	11	---	---	---	---	PASS
PCDH1	5097	broad.mit.edu	37	5	141243175	141243175	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141243175C>G	uc003llq.2	-	3	2838	c.2721G>C	c.(2719-2721)AAG>AAC	p.K907N	PCDH1_uc003llp.2_Missense_Mutation_p.K907N|PCDH1_uc011dbf.1_Missense_Mutation_p.K885N	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	907	Cytoplasmic (Potential).				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TTTTGTTTCCCTTGGAGGCCT	0.577													42	134	---	---	---	---	PASS
AFAP1L1	134265	broad.mit.edu	37	5	148685923	148685923	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148685923G>T	uc003lqh.2	+	6	622	c.491G>T	c.(490-492)AGC>ATC	p.S164I	AFAP1L1_uc003lqg.3_Missense_Mutation_p.S164I|AFAP1L1_uc010jgy.2_Missense_Mutation_p.S164I	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	164							protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGCAGACAGCAGCTACCCT	0.567													5	25	---	---	---	---	PASS
SLC36A1	206358	broad.mit.edu	37	5	150858952	150858952	+	Missense_Mutation	SNP	C	T	T	rs140356275	byFrequency	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150858952C>T	uc003luc.2	+	10	1278	c.1061C>T	c.(1060-1062)CCG>CTG	p.P354L	GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Missense_Mutation_p.P354L|SLC36A1_uc010jhw.1_Missense_Mutation_p.P354L	NM_078483	NP_510968	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 member 1	354	Helical; Name=8; (Potential).				cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			skin(1)	1		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glycine(DB00145)|L-Alanine(DB00160)	TTCTACGTCCCGGCTGAGATC	0.537													6	176	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20781422	20781422	+	Silent	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20781422G>C	uc003ndc.1	+	8	738	c.564G>C	c.(562-564)CGG>CGC	p.R188R	CDKAL1_uc003ndd.1_Silent_p.R188R|CDKAL1_uc003nde.1_Silent_p.R118R	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	188					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			ATGGAAGGCGGCTTGGGGGAG	0.418													29	121	---	---	---	---	PASS
C6orf168	84553	broad.mit.edu	37	6	99797285	99797285	+	5'UTR	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99797285C>A	uc003ppj.3	-	1						NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553											ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)		TCCCAGGGCCCGCGCCGCCCG	0.512													3	24	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21904264	21904264	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21904264A>C	uc003svc.2	+	71	11537	c.11506A>C	c.(11506-11508)AGT>CGT	p.S3836R		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3836					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TCAGTCATGGAGTGCTATCAA	0.363									Kartagener_syndrome				31	181	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72413614	72413614	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72413614C>G	uc003twk.2	+	11	3082	c.3082C>G	c.(3082-3084)CCT>GCT	p.P1028A	POM121_uc003twj.2_Missense_Mutation_p.P763A|POM121_uc010lam.1_Missense_Mutation_p.P763A	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	1028	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				GCCCATCCATCCTATCTTTGG	0.632													15	128	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87175282	87175282	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87175282G>C	uc003uiz.1	-	16	2202	c.1784C>G	c.(1783-1785)GCT>GGT	p.A595G	ABCB1_uc011khc.1_Missense_Mutation_p.A531G	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	595	ABC transporter 1.|Cytoplasmic (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	GATGACGTCAGCATTACGAAC	0.388													37	152	---	---	---	---	PASS
SLC26A5	375611	broad.mit.edu	37	7	103033397	103033397	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103033397T>G	uc003vbz.2	-	10	1324	c.1088A>C	c.(1087-1089)AAT>ACT	p.N363T	SLC26A5_uc003vbt.1_Missense_Mutation_p.N363T|SLC26A5_uc003vbu.1_Missense_Mutation_p.N363T|SLC26A5_uc003vbv.1_Intron|SLC26A5_uc003vbw.2_Intron|SLC26A5_uc003vbx.2_Missense_Mutation_p.N363T|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	363	Cytoplasmic (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						GCCATGTTTATTTGCTAAGGT	0.423													38	172	---	---	---	---	PASS
OPN1SW	611	broad.mit.edu	37	7	128413772	128413772	+	Silent	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128413772G>T	uc003vnt.3	-	4	858	c.858C>A	c.(856-858)ACC>ACA	p.T286T		NM_001708	NP_001699	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	286	Helical; Name=7; (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to plasma membrane	G-protein coupled receptor activity|photoreceptor activity				0						ATGAAGGAATGGTGACAAGCC	0.478													5	35	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732871	52732871	+	3'UTR	SNP	T	C	C	rs77261625	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732871T>C	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTTCAAGACTAAAGGAATTA	0.313													3	35	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53554925	53554925	+	Silent	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53554925G>A	uc003xre.3	-	18	4881	c.4323C>T	c.(4321-4323)AGC>AGT	p.S1441S	RB1CC1_uc003xrf.3_Silent_p.S1441S	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	1441	Potential.				autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CAGACATCATGCTTGTCTCCA	0.408													48	150	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59514096	59514096	+	Splice_Site	SNP	T	C	C	rs112233809		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59514096T>C	uc003xtt.2	-	15	1340	c.1126_splice	c.e15-1	p.T376_splice	NSMAF_uc011lee.1_Splice_Site_p.T407_splice|NSMAF_uc003xtu.2_Splice_Site_p.T376_splice	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				GTAGCGTGTCTAGAATACAGA	0.338													10	35	---	---	---	---	PASS
LINGO2	158038	broad.mit.edu	37	9	27949564	27949564	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27949564C>T	uc003zqu.1	-	2	1300	c.1106G>A	c.(1105-1107)CGA>CAA	p.R369Q	LINGO2_uc010mjf.1_Missense_Mutation_p.R369Q|LINGO2_uc003zqv.1_Missense_Mutation_p.R369Q	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	369	LRRCT.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GGTGGGCTGTCGCTGCAAGAT	0.547													18	47	---	---	---	---	PASS
DDX58	23586	broad.mit.edu	37	9	32480246	32480246	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32480246A>T	uc003zra.2	-	12	1903	c.1745T>A	c.(1744-1746)ATT>AAT	p.I582N	DDX58_uc010mjj.2_RNA|DDX58_uc010mjk.1_Missense_Mutation_p.I537N|DDX58_uc011lnr.1_Missense_Mutation_p.I379N|DDX58_uc010mji.2_Missense_Mutation_p.I511N	NM_014314	NP_055129	O95786	DDX58_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide	582					detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ATCTTGCTCAATCTCATCGAA	0.433													32	139	---	---	---	---	PASS
ALDOB	229	broad.mit.edu	37	9	104192184	104192184	+	Silent	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104192184G>A	uc004bbk.2	-	3	259	c.177C>T	c.(175-177)TTC>TTT	p.F59F		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	59					fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GGATTTCTCGGAACTGCCGGC	0.557													48	186	---	---	---	---	PASS
SLC2A8	29988	broad.mit.edu	37	9	130167742	130167742	+	Silent	SNP	A	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130167742A>G	uc004bqu.2	+	9	1239	c.1194A>G	c.(1192-1194)TCA>TCG	p.S398S	SLC2A8_uc010mxj.2_Intron|SLC2A8_uc004bqv.2_Silent_p.S70S	NM_014580	NP_055395	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose	398	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	D-glucose transmembrane transporter activity			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						TCCTCATGTCAGAGATCTTCC	0.627													12	53	---	---	---	---	PASS
PRKCQ	5588	broad.mit.edu	37	10	6520965	6520965	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6520965A>C	uc001ijj.1	-	12	1417	c.1342T>G	c.(1342-1344)TTC>GTC	p.F448V	PRKCQ_uc009xim.1_Missense_Mutation_p.F448V|PRKCQ_uc001iji.1_Missense_Mutation_p.F481V|PRKCQ_uc009xin.1_Missense_Mutation_p.F412V|PRKCQ_uc010qax.1_Missense_Mutation_p.F323V	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta	448	Protein kinase.				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						TTGGTCTGGAATGTACAAAAC	0.507													16	73	---	---	---	---	PASS
SYT15	83849	broad.mit.edu	37	10	46961906	46961906	+	3'UTR	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46961906G>T	uc001jea.2	-	8					SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_3'UTR|SYT15_uc010qfp.1_RNA	NM_031912	NP_114118	Q9BQS2	SYT15_HUMAN	synaptotagmin XV isoform a							integral to membrane|plasma membrane					0						TGTGGCTGTGGCTGTCACATG	0.652													13	26	---	---	---	---	PASS
HELLS	3070	broad.mit.edu	37	10	96350261	96350261	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96350261A>C	uc001kjt.2	+	14	1685	c.1580A>C	c.(1579-1581)GAA>GCA	p.E527A	HELLS_uc001kjs.2_Missense_Mutation_p.E511A|HELLS_uc009xul.2_Missense_Mutation_p.E429A|HELLS_uc009xum.2_Missense_Mutation_p.E397A|HELLS_uc009xun.2_Missense_Mutation_p.E403A|HELLS_uc009xuo.2_Missense_Mutation_p.E573A|HELLS_uc001kju.2_Missense_Mutation_p.E166A|HELLS_uc009xup.2_RNA|HELLS_uc009xuq.2_Missense_Mutation_p.E389A|HELLS_uc009xur.2_RNA	NM_018063	NP_060533	Q9NRZ9	HELLS_HUMAN	helicase, lymphoid-specific	527					cell division|centromeric heterochromatin formation|lymphocyte proliferation|maintenance of DNA methylation|methylation-dependent chromatin silencing|mitosis|transcription, DNA-dependent	centromeric heterochromatin|nucleus	ATP binding|DNA binding|helicase activity			ovary(1)|kidney(1)	2		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		TTCCCTAATGAATTGGAAAAA	0.338													40	146	---	---	---	---	PASS
C10orf137	26098	broad.mit.edu	37	10	127426983	127426983	+	Silent	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127426983A>T	uc001liq.1	+	15	2243	c.1950A>T	c.(1948-1950)CTA>CTT	p.L650L	C10orf137_uc001lin.2_Silent_p.L616L|C10orf137_uc001lio.1_Silent_p.L616L|C10orf137_uc001lip.1_Silent_p.L354L|C10orf137_uc001lir.2_Silent_p.L144L|C10orf137_uc001lis.1_5'Flank	NM_015608	NP_056423	Q3B7T1	EDRF1_HUMAN	erythroid differentiation-related factor 1	650					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	binding			ovary(5)|large_intestine(3)|lung(2)	10		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CCGAGGGGCTAGAGAAGCAGA	0.443													21	111	---	---	---	---	PASS
FOXI2	399823	broad.mit.edu	37	10	129536797	129536797	+	Silent	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129536797C>T	uc009yas.2	+	2	525	c.525C>T	c.(523-525)TAC>TAT	p.Y175Y	uc009yar.1_5'Flank	NM_207426	NP_997309	Q6ZQN5	FOXI2_HUMAN	forkhead box I2	175	Fork-head.				epidermal cell fate specification|otic placode formation|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_epithelial(44;0.0021)|all_lung(145;0.0586)|Lung NSC(174;0.0765)|all_neural(114;0.201)|Glioma(114;0.222)				AAGGCAATTACTGGACCCTGG	0.567													5	21	---	---	---	---	PASS
CHID1	66005	broad.mit.edu	37	11	869878	869878	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:869878A>T	uc001lsl.2	-	13	1323	c.1162T>A	c.(1162-1164)TAC>AAC	p.Y388N	CHID1_uc010qwu.1_Missense_Mutation_p.Y418N|CHID1_uc010qwv.1_Missense_Mutation_p.Y449N|CHID1_uc001lsn.2_Missense_Mutation_p.Y413N|CHID1_uc001lsm.2_Missense_Mutation_p.Y388N|CHID1_uc001lso.2_Missense_Mutation_p.Y388N|CHID1_uc001lsp.2_Missense_Mutation_p.Y357N|CHID1_uc010qww.1_Missense_Mutation_p.Y388N	NM_023947	NP_076436	Q9BWS9	CHID1_HUMAN	chitinase domain containing 1 isoform a	388					chitin catabolic process|innate immune response	extracellular region|lysosome	cation binding|chitinase activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.48e-25)|Epithelial(43;3.75e-24)|BRCA - Breast invasive adenocarcinoma(625;4.65e-05)|Lung(200;0.0624)|LUSC - Lung squamous cell carcinoma(625;0.0735)		TCGTAGAAGTAGTCCAGGCCC	0.622													12	76	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46880421	46880421	+	3'UTR	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46880421G>A	uc001ndn.3	-	38					uc001ndl.2_Intron|LRP4_uc001ndm.3_3'UTR	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		TTATGGGGTGGGAGGAGGAGG	0.527													9	20	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46880422	46880422	+	3'UTR	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46880422G>A	uc001ndn.3	-	38					uc001ndl.2_Intron|LRP4_uc001ndm.3_3'UTR	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		TATGGGGTGGGAGGAGGAGGA	0.527													9	20	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6204658	6204658	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6204658A>T	uc001qnn.1	-	6	875	c.625T>A	c.(625-627)TCA>ACA	p.S209T	VWF_uc010set.1_Missense_Mutation_p.S209T|VWF_uc001qno.1_Missense_Mutation_p.S246T	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	209	VWFD 1.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	ATGTTGCATGAGCTGCTGGGA	0.547													44	171	---	---	---	---	PASS
CAPRIN2	65981	broad.mit.edu	37	12	30867961	30867961	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30867961G>C	uc001rji.1	-	15	3333	c.2582C>G	c.(2581-2583)TCT>TGT	p.S861C	CAPRIN2_uc001rjf.1_Missense_Mutation_p.S657C|CAPRIN2_uc001rjg.1_Missense_Mutation_p.S528C|CAPRIN2_uc001rjh.1_Missense_Mutation_p.S811C|CAPRIN2_uc001rjj.1_Missense_Mutation_p.S527C|CAPRIN2_uc001rjk.3_Missense_Mutation_p.S860C|CAPRIN2_uc001rjl.3_Missense_Mutation_p.S805C|CAPRIN2_uc001rjm.1_3'UTR	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	861					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCCTCTAACAGATCCCCGGCT	0.433													13	209	---	---	---	---	PASS
BICD1	636	broad.mit.edu	37	12	32490515	32490515	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32490515T>G	uc001rku.2	+	7	2416	c.2335T>G	c.(2335-2337)TTG>GTG	p.L779V	BICD1_uc001rkv.2_Missense_Mutation_p.L779V|BICD1_uc010skd.1_RNA|BICD1_uc001rkw.1_Missense_Mutation_p.L61V	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1	779	Potential.|Interacts with RAB6A.				anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TCTGAACACTTTGTTACGAAT	0.488													5	111	---	---	---	---	PASS
RND1	27289	broad.mit.edu	37	12	49259538	49259538	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49259538G>C	uc001rsn.2	-	1	116	c.13C>G	c.(13-15)CGG>GGG	p.R5G		NM_014470	NP_055285	Q92730	RND1_HUMAN	GTP-binding protein RHO6 precursor	5					actin filament organization|axon guidance|negative regulation of cell adhesion|neuron remodeling|small GTPase mediated signal transduction	adherens junction|cytoskeleton|cytosol	GTP binding|GTPase activity|receptor binding			ovary(1)	1						TGGGGGGCCCGTCTCTCCTTC	0.587													6	44	---	---	---	---	PASS
LIMA1	51474	broad.mit.edu	37	12	50571732	50571732	+	Nonsense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50571732C>T	uc001rwj.3	-	11	1569	c.1395G>A	c.(1393-1395)TGG>TGA	p.W465*	LIMA1_uc001rwg.3_Nonsense_Mutation_p.W163*|LIMA1_uc001rwh.3_Nonsense_Mutation_p.W304*|LIMA1_uc001rwi.3_Nonsense_Mutation_p.W306*|LIMA1_uc001rwk.3_Nonsense_Mutation_p.W466*|LIMA1_uc010smr.1_RNA|LIMA1_uc010sms.1_RNA	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b	465					actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						TTTTGCTTGCCCATAGATCCT	0.458													64	264	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58004440	58004440	+	5'Flank	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58004440G>T	uc001spb.2	+						GEFT_uc009zpy.2_Nonsense_Mutation_p.E63*|GEFT_uc001soz.1_Missense_Mutation_p.M1I|GEFT_uc001spa.2_5'Flank	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1						regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					TCGCGAACATGAGGTCCTCGC	0.587													5	38	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19414267	19414267	+	RNA	SNP	T	C	C	rs74350188		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19414267T>C	uc010tcj.1	-	1		c.31843A>G				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						TAACATTTGTTTTTTCTTCAT	0.279													3	44	---	---	---	---	PASS
POMP	51371	broad.mit.edu	37	13	29238707	29238707	+	Splice_Site	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29238707G>T	uc001usf.2	+	3	243	c.162_splice	c.e3+1	p.N54_splice		NM_015932	NP_057016	Q9Y244	POMP_HUMAN	proteasome maturation protein						proteasome assembly	cytosol|endoplasmic reticulum|membrane|microsome|nucleus|proteasome complex					0		Lung SC(185;0.0367)		all cancers(112;0.141)|OV - Ovarian serous cystadenocarcinoma(117;0.216)		AGAAAAAAATGTAAGTATATT	0.244													7	48	---	---	---	---	PASS
DZIP1	22873	broad.mit.edu	37	13	96238362	96238362	+	Silent	SNP	T	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96238362T>C	uc001vmk.2	-	21	3099	c.2247A>G	c.(2245-2247)AAA>AAG	p.K749K	DZIP1_uc001vmi.2_5'UTR|DZIP1_uc001vmj.2_Silent_p.K225K|DZIP1_uc001vml.2_Silent_p.K730K|DZIP1_uc001vmm.2_5'Flank	NM_198968	NP_945319	Q86YF9	DZIP1_HUMAN	DAZ interacting protein 1 isoform 2	749					germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TCTTTTCAACTTTTTCAGTAG	0.308													13	99	---	---	---	---	PASS
FNTB	2342	broad.mit.edu	37	14	65417538	65417538	+	Intron	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65417538A>T	uc010tsl.1	+						FNTB_uc010tsm.1_Intron|RAB15_uc010aqk.2_RNA|RAB15_uc001xhz.2_Intron	NM_002028	NP_002019	P49356	FNTB_HUMAN	farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TTCAGGAAAGAAGCTGCTCAC	0.333													7	14	---	---	---	---	PASS
C15orf55	256646	broad.mit.edu	37	15	34647722	34647722	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34647722G>T	uc001zif.2	+	7	1584	c.1429G>T	c.(1429-1431)GAG>TAG	p.E477*	C15orf55_uc010ucc.1_Nonsense_Mutation_p.E505*|C15orf55_uc010ucd.1_Nonsense_Mutation_p.E495*	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	477						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		CTTGGAAGAGGAGGAAGATGC	0.532			T	BRD3|BRD4	lethal midline carcinoma								20	99	---	---	---	---	PASS
DAPK2	23604	broad.mit.edu	37	15	64218210	64218210	+	Nonsense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64218210C>A	uc002amr.2	-	8	773	c.742G>T	c.(742-744)GAG>TAG	p.E248*	DAPK2_uc010uim.1_RNA	NM_014326	NP_055141	Q9UIK4	DAPK2_HUMAN	death-associated kinase 2	248	Protein kinase.				apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)		AAGAATTCCTCATCAAAGTCG	0.502													43	169	---	---	---	---	PASS
CYP1A2	1544	broad.mit.edu	37	15	75042368	75042368	+	Missense_Mutation	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75042368G>A	uc002ayr.1	+	2	353	c.289G>A	c.(289-291)GCC>ACC	p.A97T		NM_000761	NP_000752	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A,	97					alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			ovary(3)|breast(1)	4					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)	CATCCGGCAGGCCCTGGTGCG	0.647													13	32	---	---	---	---	PASS
ANKS3	124401	broad.mit.edu	37	16	4780097	4780097	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4780097C>A	uc002cxj.1	-	3	349	c.54G>T	c.(52-54)TTG>TTT	p.L18F	ANKS3_uc002cxi.1_5'Flank|ANKS3_uc002cxk.2_5'UTR|ANKS3_uc002cxl.2_5'UTR|ANKS3_uc010uxs.1_Intron|ANKS3_uc002cxm.2_5'UTR	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain	18											0						GCCACATGGACAAGCTGCGGT	0.587													18	79	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15711240	15711240	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15711240G>C	uc002ddr.2	-	14	3066	c.2873C>G	c.(2872-2874)TCC>TGC	p.S958C	KIAA0430_uc002ddq.2_Missense_Mutation_p.S792C|KIAA0430_uc010uzv.1_Missense_Mutation_p.S954C|KIAA0430_uc010uzw.1_Missense_Mutation_p.S957C	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	957						peroxisome	nucleotide binding|RNA binding				0						GCAATTCGTGGAGGAGCCGTC	0.527													25	99	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30990969	30990969	+	Missense_Mutation	SNP	C	A	A	rs147948503	byFrequency	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30990969C>A	uc002ead.1	+	14	4548	c.3862C>A	c.(3862-3864)CGC>AGC	p.R1288S		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	1288					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						CGAGGCCGAGCGCCCTAGGCC	0.716													7	42	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31435255	31435255	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31435255T>G	uc002ebv.1	+	27	3184	c.3135T>G	c.(3133-3135)AAT>AAG	p.N1045K	ITGAD_uc010cap.1_Missense_Mutation_p.N1046K	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	1045	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TGAAGGGCAATCTCAGTTTCG	0.637													8	45	---	---	---	---	PASS
PRSS54	221191	broad.mit.edu	37	16	58314590	58314590	+	Silent	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58314590G>A	uc002enf.2	-	7	1121	c.726C>T	c.(724-726)AAC>AAT	p.N242N	PRSS54_uc002eng.2_Silent_p.N242N|PRSS54_uc010vie.1_Silent_p.N143N|CCDC113_uc002ene.2_3'UTR|CCDC113_uc010vid.1_3'UTR	NM_001080492	NP_001073961	Q6PEW0	PRS54_HUMAN	plasma kallikrein-like protein 4 precursor	242	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CACCACCGAAGTTCAGGACTC	0.552													11	50	---	---	---	---	PASS
ATP2A3	489	broad.mit.edu	37	17	3851044	3851044	+	Silent	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3851044G>T	uc002fxb.1	-	8	887	c.736C>A	c.(736-738)CGG>AGG	p.R246R	ATP2A3_uc002fwx.1_Silent_p.R246R|ATP2A3_uc002fwy.1_Silent_p.R246R|ATP2A3_uc002fwz.1_Silent_p.R246R|ATP2A3_uc002fxa.1_Silent_p.R246R|ATP2A3_uc002fxc.1_Silent_p.R246R|ATP2A3_uc002fxd.1_Silent_p.R246R	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b	246	Cytoplasmic (By similarity).				ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		AGCGGCGTCCGCTCGGGCTCG	0.652													11	36	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7661862	7661862	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7661862A>T	uc002giu.1	+	13	2115	c.2101A>T	c.(2101-2103)ATT>TTT	p.I701F		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	701	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAAAGAGCGTATTCGGCTCCT	0.537													73	202	---	---	---	---	PASS
EPN2	22905	broad.mit.edu	37	17	19186485	19186485	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19186485C>T	uc002gvd.3	+	3	501	c.53C>T	c.(52-54)TCA>TTA	p.S18L	EPN2_uc002gvc.2_Missense_Mutation_p.S18L|EPN2_uc010vyn.1_Missense_Mutation_p.S18L|EPN2_uc010cql.1_Intron|EPN2_uc002gve.3_Missense_Mutation_p.S18L|EPN2_uc002gvf.3_Intron|EPN2_uc010vyo.1_Intron|EPN2_uc002gvg.1_Missense_Mutation_p.S18L|EPN2_uc010vyp.1_Missense_Mutation_p.S18L|EPN2_uc010vyq.1_Missense_Mutation_p.S18L|EPN2_uc002gvh.1_Missense_Mutation_p.S18L	NM_014964	NP_055779	O95208	EPN2_HUMAN	epsin 2 isoform b	18	ENTH.				endocytosis		lipid binding			skin(1)	1	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					AACAATTACTCAGAGGCAGAA	0.463													17	72	---	---	---	---	PASS
MMP28	79148	broad.mit.edu	37	17	34093555	34093555	+	Silent	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34093555G>A	uc002hjy.1	-	10	1786	c.1527C>T	c.(1525-1527)GGC>GGT	p.G509G	MMP28_uc002hjw.1_RNA|MMP28_uc002hjz.1_RNA	NM_024302	NP_077278	Q9H239	MMP28_HUMAN	matrix metalloproteinase 28 isoform 1	509	Hemopexin-like 4.				proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CATGCCAGCAGCCCATCCAGG	0.637													8	26	---	---	---	---	PASS
CASKIN2	57513	broad.mit.edu	37	17	73502889	73502889	+	Silent	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73502889G>A	uc002joc.2	-	6	1027	c.477C>T	c.(475-477)GGC>GGT	p.G159G	CASKIN2_uc010wsc.1_Silent_p.G77G|CASKIN2_uc002jod.2_Silent_p.G159G	NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	159	ANK 4.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTTGAGTCGGCCAAATTCAC	0.612													4	59	---	---	---	---	PASS
CCDC40	55036	broad.mit.edu	37	17	78013722	78013722	+	Missense_Mutation	SNP	G	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78013722G>C	uc010dht.2	+	3	232	c.205G>C	c.(205-207)GTC>CTC	p.V69L	CCDC40_uc010wub.1_Missense_Mutation_p.V69L	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	69					axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			Agagggggaggtggagacaga	0.343													13	46	---	---	---	---	PASS
SIRT7	51547	broad.mit.edu	37	17	79875994	79875994	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79875994C>T	uc002kcj.1	-	1	47	c.14G>A	c.(13-15)GGT>GAT	p.G5D	SIRT7_uc002kck.1_5'UTR|SIRT7_uc002kcl.1_5'UTR	NM_016538	NP_057622	Q9NRC8	SIRT7_HUMAN	sirtuin 7	5					chromatin silencing|positive regulation of transcription on exit from mitosis|protein deacetylation|rRNA transcription	cytoplasm|nucleolus organizer region	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides|NAD+ binding|protein binding|zinc ion binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			GCGGCTCAGACCCCCGGCTGC	0.667													7	28	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6870684	6870684	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6870684A>C	uc010wzi.1	+	6	614	c.376A>C	c.(376-378)AAT>CAT	p.N126H	ARHGAP28_uc002knc.2_Missense_Mutation_p.N251H|ARHGAP28_uc002knd.2_Missense_Mutation_p.N144H|ARHGAP28_uc002kne.2_Missense_Mutation_p.N144H|ARHGAP28_uc002knf.2_Missense_Mutation_p.N135H			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;	126					signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				TCTAAAAAGAAATAAACTTAA	0.348													46	170	---	---	---	---	PASS
SLC39A6	25800	broad.mit.edu	37	18	33694147	33694147	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33694147C>T	uc010dmy.2	-	7	2046	c.1756G>A	c.(1756-1758)GAG>AAG	p.E586K	SLC39A6_uc002kzj.2_Missense_Mutation_p.E311K	NM_012319	NP_036451	Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter),	586	Cytoplasmic (Potential).					integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2						TCTTTCAGCTCCTCCCGAGAg	0.308													15	66	---	---	---	---	PASS
ATP5A1	498	broad.mit.edu	37	18	43669480	43669480	+	Intron	SNP	T	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43669480T>A	uc002lbr.1	-						ATP5A1_uc010dnl.1_Intron|ATP5A1_uc002lbs.1_Intron|ATP5A1_uc002lbt.1_Intron|ATP5A1_uc010xct.1_3'UTR	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1						ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						AATATAATCCTTCCATTGAGC	0.338													14	46	---	---	---	---	PASS
PTPRS	5802	broad.mit.edu	37	19	5244419	5244419	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5244419C>A	uc002mbv.2	-	11	1297	c.1063G>T	c.(1063-1065)GGC>TGC	p.G355C	PTPRS_uc002mbu.1_Missense_Mutation_p.G342C|PTPRS_uc010xin.1_Missense_Mutation_p.G342C|PTPRS_uc002mbw.2_Missense_Mutation_p.G342C|PTPRS_uc002mbx.2_Missense_Mutation_p.G346C|PTPRS_uc002mby.2_Missense_Mutation_p.G342C	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	355	Fibronectin type-III 1.|Extracellular (Potential).				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		TCTGGGTTGCCCGAGTCCCAC	0.547													10	78	---	---	---	---	PASS
CYP4F12	66002	broad.mit.edu	37	19	15784434	15784434	+	Missense_Mutation	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15784434C>T	uc002nbl.2	+	2	156	c.95C>T	c.(94-96)GCC>GTC	p.A32V	CYP4F12_uc010xoo.1_Missense_Mutation_p.A32V|CYP4F12_uc010xop.1_Missense_Mutation_p.A32V	NM_023944	NP_076433			cytochrome P450, family 4, subfamily F,											skin(3)|ovary(2)|central_nervous_system(2)	7	Acute lymphoblastic leukemia(2;0.0367)					TGGCTACTCGCCCGCATCCTG	0.627													29	104	---	---	---	---	PASS
PLD3	23646	broad.mit.edu	37	19	40873738	40873738	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40873738G>A	uc002onm.3	+	6	779	c.381G>A	c.(379-381)TGG>TGA	p.W127*	PLD3_uc002onj.3_Nonsense_Mutation_p.W127*|PLD3_uc002onk.3_Nonsense_Mutation_p.W127*|PLD3_uc002onl.3_Nonsense_Mutation_p.W127*|PLD3_uc002onn.2_Nonsense_Mutation_p.W127*|PLD3_uc002ono.2_3'UTR	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	phospholipase D3	127	Lumenal (Potential).				lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding			skin(2)|ovary(1)	3			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			CCTTCTACTGGACCCTCACCA	0.677													6	8	---	---	---	---	PASS
SFRS16	11129	broad.mit.edu	37	19	45562555	45562555	+	Missense_Mutation	SNP	C	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45562555C>A	uc002pak.2	+	8	741	c.643C>A	c.(643-645)CAG>AAG	p.Q215K	SFRS16_uc002pal.2_RNA|SFRS16_uc010xxh.1_Missense_Mutation_p.Q153K|SFRS16_uc002pam.2_Missense_Mutation_p.Q215K|SFRS16_uc002pan.1_RNA	NM_007056	NP_008987	Q8N2M8	CLASR_HUMAN	splicing factor, arginine/serine-rich 16	215					mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGAATTGAACCAGGAGCAGGT	0.602											OREG0025548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	16	---	---	---	---	PASS
KLK5	25818	broad.mit.edu	37	19	51453328	51453328	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51453328T>G	uc002pue.2	-	4	336	c.118A>C	c.(118-120)AAC>CAC	p.N40H	KLK5_uc002puf.2_Missense_Mutation_p.N40H|KLK5_uc002pug.2_Missense_Mutation_p.N40H	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein	40				Missing (in Ref. 3; AAG33358).	epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		GGCACGGTGTTAGAGGGGTGG	0.632													9	32	---	---	---	---	PASS
FIZ1	84922	broad.mit.edu	37	19	56104632	56104632	+	Silent	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56104632C>T	uc002qli.3	-	3	765	c.675G>A	c.(673-675)GTG>GTA	p.V225V	FIZ1_uc002qlj.3_Silent_p.V225V	NM_032836	NP_116225	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein kinase binding|receptor binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TGAAGGGCTTCACGTCGGTGT	0.682													3	7	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56370366	56370366	+	Missense_Mutation	SNP	A	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56370366A>G	uc002qmd.3	+	3	2029	c.1607A>G	c.(1606-1608)AAG>AGG	p.K536R	NLRP4_uc002qmf.2_Missense_Mutation_p.K461R|NLRP4_uc010etf.2_Missense_Mutation_p.K367R	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	536							ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CAGTGCCTGAAGAGCTTAGGG	0.453													25	115	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37630475	37630475	+	Missense_Mutation	SNP	T	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37630475T>A	uc002xjh.2	+	9	756	c.745T>A	c.(745-747)TAT>AAT	p.Y249N	DHX35_uc010zwa.1_Missense_Mutation_p.Y94N|DHX35_uc010zwb.1_Missense_Mutation_p.Y94N|DHX35_uc010zwc.1_Missense_Mutation_p.Y218N	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	249						catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GGATATCTTTTATCTACAAAG	0.393													80	316	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37630476	37630476	+	Missense_Mutation	SNP	A	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37630476A>T	uc002xjh.2	+	9	757	c.746A>T	c.(745-747)TAT>TTT	p.Y249F	DHX35_uc010zwa.1_Missense_Mutation_p.Y94F|DHX35_uc010zwb.1_Missense_Mutation_p.Y94F|DHX35_uc010zwc.1_Missense_Mutation_p.Y218F	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	249						catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GATATCTTTTATCTACAAAGG	0.393													81	303	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47887899	47887899	+	Missense_Mutation	SNP	T	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47887899T>G	uc002xui.2	-	3	697	c.450A>C	c.(448-450)GAA>GAC	p.E150D		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	150							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GCAGAAGACTTTCTAAGAACT	0.493													52	195	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41455857	41455857	+	Missense_Mutation	SNP	G	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41455857G>T	uc002yyq.1	-	24	4661	c.4209C>A	c.(4207-4209)GAC>GAA	p.D1403E	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1403	Fibronectin type-III 5.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGCCCCCGTTGTCTCCAGGGA	0.458													6	72	---	---	---	---	PASS
ABCG1	9619	broad.mit.edu	37	21	43711704	43711704	+	Missense_Mutation	SNP	A	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43711704A>C	uc002zaq.2	+	13	1733	c.1627A>C	c.(1627-1629)ATG>CTG	p.M543L	ABCG1_uc002zan.2_Missense_Mutation_p.M533L|ABCG1_uc002zam.2_Missense_Mutation_p.M509L|ABCG1_uc002zao.2_Missense_Mutation_p.M528L|ABCG1_uc002zap.2_Missense_Mutation_p.M531L|ABCG1_uc002zar.2_Missense_Mutation_p.M542L|ABCG1_uc011aev.1_Missense_Mutation_p.M554L|ABCG1_uc010gpb.1_Missense_Mutation_p.H183P	NM_004915	NP_004906	P45844	ABCG1_HUMAN	ATP-binding cassette sub-family G member 1	543	Helical; (Potential).|ABC transmembrane type-2.				amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)	GCTGGGCACCATGACCTCCCT	0.657													11	39	---	---	---	---	PASS
MED15	51586	broad.mit.edu	37	22	20921042	20921042	+	Silent	SNP	T	C	C			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20921042T>C	uc002zsp.2	+	7	1059	c.979T>C	c.(979-981)TTG>CTG	p.L327L	MED15_uc002zso.2_Silent_p.L256L|MED15_uc002zsq.2_Silent_p.L327L|MED15_uc010gso.2_Silent_p.L327L|MED15_uc002zsr.2_Silent_p.L301L|MED15_uc011ahs.1_Silent_p.L301L|MED15_uc002zss.2_Silent_p.L246L|MED15_uc011ahu.1_Silent_p.L53L	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	327	Pro-rich.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			GACCCAGCCTTTGGTGTCACA	0.582													30	113	---	---	---	---	PASS
RAC2	5880	broad.mit.edu	37	22	37640153	37640153	+	Intron	SNP	C	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37640153C>T	uc003arc.2	-							NM_002872	NP_002863	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2						axon guidance|platelet activation|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding|GTPase activity|protein binding			breast(2)|central_nervous_system(1)|skin(1)	4						CAGGTACCTACCCATCTCCCA	0.652													5	35	---	---	---	---	PASS
UXT	8409	broad.mit.edu	37	X	47518230	47518230	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47518230G>A	uc004din.2	-	2	153	c.97C>T	c.(97-99)CGA>TGA	p.R33*	UXT_uc004dim.2_Nonsense_Mutation_p.R45*|LOC100133957_uc011mls.1_5'Flank|LOC100133957_uc011mlt.1_5'Flank	NM_004182	NP_004173	Q9UBK9	UXT_HUMAN	ubiquitously-expressed transcript isoform 2	33					centrosome organization|mitochondrion transport along microtubule|protein folding	centrosome|nucleus|prefoldin complex	beta-tubulin binding|microtubule binding|unfolded protein binding				0						GTCACTCACCGCAAGTCCCGC	0.647													3	15	---	---	---	---	PASS
PJA1	64219	broad.mit.edu	37	X	68382325	68382325	+	Missense_Mutation	SNP	C	G	G			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68382325C>G	uc004dxh.2	-	2	1043	c.757G>C	c.(757-759)GAA>CAA	p.E253Q	PJA1_uc011mpi.1_5'UTR|PJA1_uc004dxg.2_Intron|PJA1_uc004dxi.2_Missense_Mutation_p.E198Q	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN	praja 1 isoform a	253							zinc ion binding				0						ACCACAGGTTCCTCTGCACTC	0.483													25	37	---	---	---	---	PASS
ZYG11B	79699	broad.mit.edu	37	1	53282449	53282452	+	Intron	DEL	ATTC	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53282449_53282452delATTC	uc001cuj.2	+						ZYG11B_uc010onj.1_Intron|ZYG11B_uc009vzh.2_Intron	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B								protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						AACTTAAGGTAttctttttttttt	0.142													8	4	---	---	---	---	
RABGAP1L	9910	broad.mit.edu	37	1	174221888	174221888	+	Intron	DEL	T	-	-	rs11351373		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174221888delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						Atgtaactggtttcattgaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189223023	189223024	+	IGR	DEL	TT	-	-	rs113290842		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189223023_189223024delTT								None (None upstream) : FAM5C (843773 downstream)																							CCGCTTGCACTTTTTTTTTTTT	0.431													4	2	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766826	206766827	+	Intron	DEL	GA	-	-	rs113332386		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766826_206766827delGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagcgcgagagagagaga	0.213													4	2	---	---	---	---	
VIT	5212	broad.mit.edu	37	2	37032451	37032452	+	Intron	INS	-	A	A	rs67758060		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37032451_37032452insA	uc002rpl.2	+						VIT_uc002rpm.2_Intron|VIT_uc010ezv.2_Intron|VIT_uc010ezw.2_Intron	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin							proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)				tgtctcaaaggaaaaaaaaaaa	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42046112	42046113	+	IGR	INS	-	AGGAAGGGAGGA	AGGAAGGGAGGA			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42046112_42046113insAGGAAGGGAGGA								None (None upstream) : PKDCC (229048 downstream)																							gtggaggggggaggaagggagg	0.005													4	3	---	---	---	---	
IMMT	10989	broad.mit.edu	37	2	86373498	86373499	+	Intron	INS	-	T	T	rs112351810		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86373498_86373499insT	uc002sqz.3	-						IMMT_uc002sqy.3_Intron|IMMT_uc002srb.3_Intron|IMMT_uc002sra.3_Intron|IMMT_uc010ytd.1_Intron|IMMT_uc010yte.1_Intron|IMMT_uc002src.1_Intron	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1							integral to mitochondrial inner membrane	protein binding			skin(1)	1						TATATAATATAttttttttttt	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801335	91801336	+	IGR	INS	-	CAATG	CAATG	rs56326147		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801335_91801336insCAATG								None (None upstream) : LOC654342 (3856 downstream)																							tcatgactaccattagctccca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229212589	229212590	+	IGR	INS	-	TTCC	TTCC			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229212589_229212590insTTCC								SPHKAP (166228 upstream) : PID1 (676100 downstream)																							Cccttccccttttccttccttc	0.045													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242823746	242823759	+	IGR	DEL	GTGTGTGTGTGTGT	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242823746_242823759delGTGTGTGTGTGTGT								C2orf85 (8264 upstream) : LOC728323 (207085 downstream)																							GTGGCCCAGCgtgtgtgtgtgtgtgtgtgtgtgt	0.570													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5124705	5124709	+	IGR	DEL	TTTTT	-	-	rs72175262		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5124705_5124709delTTTTT								BHLHE40 (97842 upstream) : ARL8B (39221 downstream)																							CATTTCAGCCttttttttttttttt	0.459													6	4	---	---	---	---	
VENTXP7	391518	broad.mit.edu	37	3	21447901	21447902	+	RNA	INS	-	CC	CC	rs143568999	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21447901_21447902insCC	uc003ccd.2	+	1		c.684_685insCC				NR_002311				Homo sapiens VENT homeobox (Xenopus laevis) pseudogene 7 (VENTXP7), non-coding RNA.												0						CTGGCATACCACCCCCCACGCC	0.663													5	3	---	---	---	---	
CLASP2	23122	broad.mit.edu	37	3	33614404	33614404	+	Intron	DEL	T	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33614404delT	uc003cfu.2	-						CLASP2_uc003cfs.2_Intron|CLASP2_uc003cft.2_Intron|CLASP2_uc010hgb.2_Intron|CLASP2_uc011axt.1_Intron	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4						GAACaaataattttttttttt	0.209													4	4	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51471278	51471279	+	Intron	INS	-	A	A			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51471278_51471279insA	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		gactccatgtcaaaaaaaaaaa	0.168													3	3	---	---	---	---	
NAA50	80218	broad.mit.edu	37	3	113459588	113459588	+	Intron	DEL	T	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113459588delT	uc003ean.1	-						NAA50_uc010hqm.1_5'Flank|NAA50_uc011bij.1_Intron	NM_025146	NP_079422	Q9GZZ1	NAA50_HUMAN	N-acetyltransferase 13						N-terminal protein amino acid acetylation	cytoplasm	N-acetyltransferase activity|protein binding				0						ACATTTTTTCTTTTTTTTTTT	0.239													4	4	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131436722	131436723	+	Intron	INS	-	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131436722_131436723insT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						tctttcttttctttctttcttt	0.035													4	5	---	---	---	---	
COPB2	9276	broad.mit.edu	37	3	139093141	139093143	+	Intron	DEL	GAT	-	-	rs148039341		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139093141_139093143delGAT	uc003etf.3	-						COPB2_uc011bmv.1_Intron|COPB2_uc010hui.2_Intron|COPB2_uc011bmw.1_3'UTR	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						GAatgatgacgatgatgatgatg	0.212													6	3	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143374524	143374525	+	Intron	DEL	AC	-	-	rs35702068		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143374524_143374525delAC	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						atgcacatgtacacacacacac	0.267													2	8	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180349039	180349040	+	Intron	INS	-	TATAGAATG	TATAGAATG	rs138343088	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180349039_180349040insTATAGAATG	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GACTAGAGGTATATAGAATGAA	0.391													4	2	---	---	---	---	
BMP2K	55589	broad.mit.edu	37	4	79697893	79697897	+	Intron	DEL	GGCTC	-	-	rs67018255		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79697893_79697897delGGCTC	uc003hlk.2	+						BMP2K_uc010ijl.1_Intron|BMP2K_uc003hlj.2_Intron	NM_198892	NP_942595	Q9NSY1	BMP2K_HUMAN	BMP-2 inducible kinase isoform a							nucleus	ATP binding|protein serine/threonine kinase activity			lung(1)	1						CGCCCGGGGAGGCTCGGACAGGCAG	0.659													4	4	---	---	---	---	
CEP170L	645455	broad.mit.edu	37	4	119436576	119436577	+	5'Flank	INS	-	T	T			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119436576_119436577insT	uc003icb.2	+							NR_003135				RecName: Full=Cep170-like protein;												0						TTGGGGGCTCCTTTTTTTTTTT	0.406													8	7	---	---	---	---	
FAM149A	25854	broad.mit.edu	37	4	187077514	187077515	+	Intron	INS	-	T	T	rs149797115	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187077514_187077515insT	uc003iyt.3	+						FAM149A_uc011cla.1_Intron|FAM149A_uc010isj.2_Intron|FAM149A_uc010isk.2_Intron|FAM149A_uc003iyu.3_Intron|FAM149A_uc010isl.2_Intron|FAM149A_uc011clb.1_Intron	NM_015398	NP_056213	A5PLN7	F149A_HUMAN	hypothetical protein LOC25854											breast(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		GGACGCTATTGTTTTTTGTGTT	0.282													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14044832	14044833	+	IGR	DEL	GG	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14044832_14044833delGG								DNAH5 (100243 upstream) : TRIO (98996 downstream)																							aaggaaggaaggaaggaaggaa	0.000													4	5	---	---	---	---	
FAM105B	90268	broad.mit.edu	37	5	14692788	14692789	+	Intron	INS	-	T	T	rs144619199		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14692788_14692789insT	uc003jfk.2	+							NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268											ovary(2)	2	Lung NSC(4;0.00696)					TGATTATCTGCttttttttttt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	78004488	78004488	+	IGR	DEL	T	-	-	rs146198437		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78004488delT								LHFPL2 (59840 upstream) : ARSB (68551 downstream)																							TCAACAAGTCttttttttttt	0.348													3	3	---	---	---	---	
KCNN2	3781	broad.mit.edu	37	5	113698631	113698632	+	In_Frame_Ins	INS	-	GCC	GCC	rs151038013	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113698631_113698632insGCC	uc003kqo.2	+	1	616_617	c.159_160insGCC	c.(157-162)insGCC	p.58_59insA		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	58_59						integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		CTGCAGCCGCTGCCGCCGCCGC	0.658													4	2	---	---	---	---	
RANBP17	64901	broad.mit.edu	37	5	170668309	170668309	+	Intron	DEL	T	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170668309delT	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTATAGTGGCTTTTTTTTTTT	0.338			T	TRD@	ALL								5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174812028	174812047	+	IGR	DEL	AAGGAAAGAAGGAAGGAAGA	-	-	rs111559272		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174812028_174812047delAAGGAAAGAAGGAAGGAAGA								MSX2 (654127 upstream) : DRD1 (55629 downstream)																							ggaaggaaggaaggaaagaaggaaggaagaaaggaaggaa	0.018													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9661051	9661051	+	IGR	DEL	A	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9661051delA								None (None upstream) : TFAP2A (735866 downstream)																							GTGTTACAGCAAAAAAAAAAA	0.299													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	120119243	120119244	+	IGR	INS	-	TTCC	TTCC	rs142572854	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120119243_120119244insTTCC								MAN1A1 (448317 upstream) : None (None downstream)																							tccttccttcattccttccttc	0.109													4	2	---	---	---	---	
IFNGR1	3459	broad.mit.edu	37	6	137518967	137518967	+	3'UTR	DEL	A	-	-	rs75851921		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137518967delA	uc003qho.2	-	7					IFNGR1_uc011edm.1_3'UTR	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTTTTTGTTTAAAAAAAAAAA	0.373													5	3	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139170711	139170711	+	Intron	DEL	T	-	-	rs72395106		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139170711delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						AAAGCGAAGCttttttttttt	0.229													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	159946964	159946964	+	IGR	DEL	T	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159946964delT								FNDC1 (253825 upstream) : SOD2 (153187 downstream)																							ccaatcagggttttttttttt	0.085													3	3	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33977126	33977127	+	Intron	DEL	GT	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33977126_33977127delGT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						GAGAAGTAGGgtgtgtgtgtgt	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		gcccggccCCttttttttttt	0.149													6	3	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114330185	114330185	+	3'UTR	DEL	T	-	-	rs143759073		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114330185delT	uc003vhb.2	+	17					FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_3'UTR|FOXP2_uc003vha.2_3'UTR|FOXP2_uc011kmu.1_3'UTR|FOXP2_uc011kmv.1_3'UTR|FOXP2_uc010ljz.1_3'UTR	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						cttcttcttcttttttttttt	0.289													4	3	---	---	---	---	
ASB15	142685	broad.mit.edu	37	7	123263956	123263959	+	Intron	DEL	GGAA	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123263956_123263959delGGAA	uc003vku.1	+						ASB15_uc003vkv.1_Intron|ASB15_uc003vkw.1_Intron	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15						intracellular signal transduction					skin(2)|lung(1)	3						aagaaagaatggaaggaaggaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	29541426	29541433	+	IGR	DEL	TTCCTTCC	-	-	rs71875157		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29541426_29541433delTTCCTTCC								MIR873 (652473 upstream) : None (None downstream)																							TAATAATATTttccttccttccttcctt	0.168													3	3	---	---	---	---	
FKBP15	23307	broad.mit.edu	37	9	116034972	116034973	+	Intron	DEL	TT	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116034972_116034973delTT	uc010muu.1	-						CDC26_uc004bgw.2_Intron	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa						endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						TTCTAAAGTCtttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117528940	117528941	+	IGR	INS	-	CCTT	CCTT	rs113822880	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117528940_117528941insCCTT								C9orf91 (120244 upstream) : TNFSF15 (22672 downstream)																							tttccttcctaccttccttcct	0.059													2	4	---	---	---	---	
KIAA1462	57608	broad.mit.edu	37	10	30362576	30362577	+	Intron	INS	-	TCCT	TCCT			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362576_30362577insTCCT	uc001iuz.2	-									Q9P266	K1462_HUMAN	RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4						TAGCAAGATTGtccttccttcc	0.158													1	5	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55664679	55664680	+	Intron	DEL	TT	-	-	rs71004495		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55664679_55664680delTT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCAGAACTCTTAGAGTGACAG	0.297										HNSCC(58;0.16)			4	3	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	57298280	57298281	+	Intron	INS	-	CCTC	CCTC			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57298280_57298281insCCTC	uc001jjv.1	-							NM_001142770	NP_001136242	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD2-2 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				tttccttccttcctcccttcct	0.000										HNSCC(58;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	27873428	27873429	+	IGR	INS	-	TTCC	TTCC	rs140965419	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27873428_27873429insTTCC								BDNF (129823 upstream) : KIF18A (168734 downstream)																							tccttccttctttccttccttc	0.000													1	6	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892825	76892825	+	Intron	DEL	G	-	-	rs12787213		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892825delG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						ttttttttttgtttttttttt	0.279													2	4	---	---	---	---	
CNTN5	53942	broad.mit.edu	37	11	99072077	99072082	+	Intron	DEL	TTTCCT	-	-	rs151051937	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99072077_99072082delTTTCCT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ccttccttcctttcctttccttcctt	0.000													4	3	---	---	---	---	
FGD6	55785	broad.mit.edu	37	12	95500974	95500975	+	Intron	INS	-	T	T	rs148392232	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95500974_95500975insT	uc001tdp.3	-						FGD6_uc009zsx.2_Intron|FGD6_uc001tdq.1_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						TACCCAGAATGTTTATTAGAAT	0.287													6	4	---	---	---	---	
DRAM1	55332	broad.mit.edu	37	12	102283259	102283260	+	Intron	INS	-	GAAG	GAAG	rs146359103	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102283259_102283260insGAAG	uc001tix.2	+						DRAM1_uc010svv.1_Intron	NM_018370	NP_060840	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1						apoptosis|autophagy	integral to membrane|lysosomal membrane				ovary(1)	1						tgagaagagaagaaggaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106420386	106420387	+	IGR	DEL	GA	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106420386_106420387delGA								C12orf75 (655091 upstream) : NUAK1 (36738 downstream)																							caaagagatggagagagagaga	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119145988	119145993	+	IGR	DEL	TGGTGA	-	-	rs146473069		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119145988_119145993delTGGTGA								SUDS3 (290149 upstream) : SRRM4 (273403 downstream)																							gtgatggtggtggtgatggtggtggt	0.000													5	3	---	---	---	---	
TPP2	7174	broad.mit.edu	37	13	103257477	103257478	+	Intron	INS	-	CAGTAGTTCA	CAGTAGTTCA	rs145083043	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103257477_103257478insCAGTAGTTCA	uc001vpi.3	+							NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					taacggggttccagtcgccctg	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23211222	23211227	+	IGR	DEL	AGAGAG	-	-	rs59662553	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23211222_23211227delAGAGAG								ABHD4 (129965 upstream) : OXA1L (24504 downstream)																							aaagaaagaaagagagagagagagag	0.024													4	2	---	---	---	---	
GABRG3	2567	broad.mit.edu	37	15	27633349	27633360	+	Intron	DEL	AGGAAGGAAAGG	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27633349_27633360delAGGAAGGAAAGG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		taaggaaggaaggaaggaaaggaggaaggaag	0.000													4	2	---	---	---	---	
DLL4	54567	broad.mit.edu	37	15	41225466	41225467	+	Intron	INS	-	TGTG	TGTG	rs137941404	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41225466_41225467insTGTG	uc001zng.1	+							NM_019074	NP_061947	Q9NR61	DLL4_HUMAN	delta-like 4 protein precursor						blood circulation|cell communication|cell differentiation|Notch receptor processing|Notch signaling pathway	integral to membrane|plasma membrane	calcium ion binding|Notch binding			breast(2)	2		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		AGTCCCtgtgttgtgtgtgtgt	0.460													4	3	---	---	---	---	
OAZ2	4947	broad.mit.edu	37	15	64983838	64983838	+	Intron	DEL	T	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64983838delT	uc002anp.2	-									O95190	OAZ2_HUMAN	Homo sapiens ornithine decarboxylase antizyme 2 (OAZ2) mRNA, complete cds.						polyamine metabolic process|regulation of cellular amino acid metabolic process	cytosol|nucleus	ornithine decarboxylase inhibitor activity|protein binding				0					L-Ornithine(DB00129)	GACTTGACGAttttttttttt	0.244													5	4	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78316386	78316386	+	Intron	DEL	T	-	-	rs1992470	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78316386delT	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						GGAAAAAAAATAAGTGTGCAG	0.483													4	2	---	---	---	---	
SLC12A3	6559	broad.mit.edu	37	16	56904752	56904753	+	Intron	INS	-	T	T	rs71882529		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56904752_56904753insT	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	tttttcttttcttttttttttt	0.292													5	3	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81533877	81533878	+	Intron	INS	-	TCCT	TCCT	rs143054986	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81533877_81533878insTCCT	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						ccttccttccgtccttccttcc	0.134													4	2	---	---	---	---	
TAX1BP3	30851	broad.mit.edu	37	17	3569035	3569036	+	Intron	DEL	CC	-	-	rs11650581	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3569035_3569036delCC	uc002fwc.2	-						P2RX5_uc002fwd.2_Intron|TAX1BP3_uc002fwe.1_Intron	NM_014604	NP_055419	O14907	TX1B3_HUMAN	Tax1 binding protein 3						activation of Cdc42 GTPase activity|negative regulation of protein localization at cell surface|negative regulation of Wnt receptor signaling pathway|Rho protein signal transduction|Wnt receptor signaling pathway	cytoplasm|nucleus	protein C-terminus binding				0				COAD - Colon adenocarcinoma(5;0.0761)		TCTCTGGGCTCCaaaaaaaaaa	0.460													6	3	---	---	---	---	
SLFN12	55106	broad.mit.edu	37	17	33761383	33761383	+	5'Flank	DEL	A	-	-	rs71375409		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33761383delA	uc002hji.3	-						SLFN12_uc002hjj.3_5'Flank|SLFN12_uc010cts.2_5'Flank	NM_018042	NP_060512	Q8IYM2	SLN12_HUMAN	schlafen family member 12								ATP binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		agagagagagaaaggaaggaa	0.000													4	2	---	---	---	---	
NAGLU	4669	broad.mit.edu	37	17	40692731	40692731	+	Intron	DEL	G	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40692731delG	uc002hzv.2	+							NM_000263	NP_000254	P54802	ANAG_HUMAN	alpha-N-acetylglucosaminidase precursor							lysosome	alpha-N-acetylglucosaminidase activity				0		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	aaaaaaaaaagaaagaaaaaG	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	62932555	62932556	+	IGR	DEL	GT	-	-	rs35142297		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62932555_62932556delGT								LRRC37A3 (16969 upstream) : AMZ2P1 (30112 downstream)																							gtgtgtgttcgtgtgtgtgtgt	0.238													1	5	---	---	---	---	
CDH7	1005	broad.mit.edu	37	18	63482006	63482006	+	Intron	DEL	A	-	-	rs146003873		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63482006delA	uc002ljz.2	+						CDH7_uc002lka.2_Intron|CDH7_uc002lkb.2_Intron	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				ATCACCttttaaaaatatttt	0.239													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393730	77393732	+	IGR	DEL	GAC	-	-	rs149066391	by1000genomes	TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393730_77393732delGAC								NFATC1 (104408 upstream) : CTDP1 (46069 downstream)																							tggtggtgatgacggtggtgatg	0.000													4	2	---	---	---	---	
CLPP	8192	broad.mit.edu	37	19	6364742	6364742	+	Intron	DEL	G	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6364742delG	uc002mem.1	+						CLPP_uc002men.1_5'Flank	NM_006012	NP_006003	Q16740	CLPP_HUMAN	caseinolytic peptidase, ATP-dependent,						proteolysis	mitochondrial matrix	ATP binding|protein binding|serine-type endopeptidase activity			ovary(1)	1						GGGAGGGGATGtttttttttt	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	41157518	41157518	+	IGR	DEL	A	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41157518delA								LTBP4 (21793 upstream) : NUMBL (14296 downstream)																							ggaaagaaggaaaggaagggg	0.000													4	3	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22731060	22731063	+	Intron	DEL	AAAC	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22731060_22731063delAAAC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CAGTaaaacaaaacaaaacaaaac	0.368													4	2	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49103825	49103837	+	Intron	DEL	TCCTGACCATCTG	-	-	rs141710021		TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49103825_49103837delTCCTGACCATCTG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GGTGCTAAATTCCTGACCATCTGTCCTGGGGCA	0.620													11	6	---	---	---	---	
PDHA1	5160	broad.mit.edu	37	X	19363864	19363865	+	Intron	DEL	CC	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19363864_19363865delCC	uc004czg.3	+						PDHA1_uc004czh.3_Intron|PDHA1_uc011mjc.1_Intron|PDHA1_uc011mjd.1_Intron|PDHA1_uc010nfk.2_Intron	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor						glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	TTTGCAGGGTCCCCCCCCCCCC	0.470													5	3	---	---	---	---	
KDM5C	8242	broad.mit.edu	37	X	53227064	53227065	+	Intron	INS	-	AGT	AGT			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53227064_53227065insAGT	uc004drz.2	-						KDM5C_uc011moc.1_Intron|KDM5C_uc011mod.1_Intron|KDM5C_uc004dsa.2_Intron	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GGGGGCTATGAAGTATCACATG	0.530			N|F|S		clear cell renal carcinoma								3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	82130969	82130969	+	IGR	DEL	A	-	-			TCGA-B8-5164-01A-01D-1421-08	TCGA-B8-5164-10A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82130969delA								None (None upstream) : POU3F4 (632300 downstream)																							ATTATAAACTAAAAAAAAAAa	0.139													4	2	---	---	---	---	
