Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ESPNP	284729	broad.mit.edu	37	1	17023403	17023403	+	Silent	SNP	G	A	A	rs10907267	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17023403G>A	uc001azn.1	-	9	1545	c.1431C>T	c.(1429-1431)AAC>AAT	p.N477N		NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						GGAACATCACGTTGAAAGACT	0.622													10	48	---	---	---	---	PASS
C1orf175	374977	broad.mit.edu	37	1	55166858	55166858	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55166858C>T	uc010ooe.1	+	19	3472	c.3148C>T	c.(3148-3150)CTG>TTG	p.L1050L	C1orf175_uc001cxq.2_RNA|C1orf175_uc001cxs.2_RNA|C1orf175_uc010ood.1_Silent_p.L568L|C1orf175_uc010oof.1_RNA|C1orf175_uc001cxr.1_RNA|C1orf175_uc009vzq.1_RNA|C1orf175_uc001cxt.1_RNA|C1orf175_uc009vzr.1_Silent_p.L252L	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	1050	HEAT 2.					integral to membrane	binding				0						GGTGAAGGGCCTGAAGAACAT	0.582													15	42	---	---	---	---	PASS
OLFM3	118427	broad.mit.edu	37	1	102302569	102302569	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102302569G>C	uc001duf.2	-	2	213	c.142C>G	c.(142-144)CCT>GCT	p.P48A	OLFM3_uc001dug.2_Missense_Mutation_p.P28A|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_5'UTR|OLFM3_uc001due.2_RNA	NM_058170	NP_477518	Q96PB7	NOE3_HUMAN	olfactomedin 3	48						extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CCTTCTTTAGGACTAATCTGA	0.448													7	46	---	---	---	---	PASS
AHCYL1	10768	broad.mit.edu	37	1	110553967	110553967	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110553967A>C	uc001dyx.2	+	3	731	c.364A>C	c.(364-366)ATT>CTT	p.I122L	AHCYL1_uc010ovw.1_Missense_Mutation_p.I75L|AHCYL1_uc001dyy.2_Missense_Mutation_p.I75L|AHCYL1_uc010ovx.1_Missense_Mutation_p.I75L	NM_006621	NP_006612	O43865	SAHH2_HUMAN	S-adenosylhomocysteine hydrolase-like 1	122					one-carbon metabolic process	endoplasmic reticulum	adenosylhomocysteinase activity			ovary(1)	1		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		GGAGATTGAGATTGCAGAGCA	0.488													11	66	---	---	---	---	PASS
TMCO1	54499	broad.mit.edu	37	1	165712544	165712544	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165712544C>T	uc001gdj.3	-	6	477	c.328G>A	c.(328-330)GAT>AAT	p.D110N	TMCO1_uc001gdl.3_Missense_Mutation_p.D26N|TMCO1_uc001gdm.3_Missense_Mutation_p.D26N|TMCO1_uc001gdk.3_Missense_Mutation_p.D98N|TMCO1_uc001gdn.3_RNA	NM_019026	NP_061899	Q9UM00	TMCO1_HUMAN	transmembrane and coiled-coil domains 1	110	Helical; (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				central_nervous_system(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)					ACTCTACCATCAAATCTAAAA	0.378													10	53	---	---	---	---	PASS
TOR1AIP2	163590	broad.mit.edu	37	1	179833916	179833916	+	Intron	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179833916C>A	uc001gnk.2	-						TOR1AIP2_uc001gnl.2_Intron|TOR1AIP2_uc001gnn.2_Nonstop_Mutation_p.*132Y|TOR1AIP2_uc001gnm.2_Nonstop_Mutation_p.*132Y	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2							endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1						ATTATAGAAGCTATTTGTTTT	0.363													19	149	---	---	---	---	PASS
APOBEC4	403314	broad.mit.edu	37	1	183617328	183617328	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183617328C>A	uc001gqn.2	-	2	861	c.589G>T	c.(589-591)GTT>TTT	p.V197F	RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_203454	NP_982279	Q8WW27	ABEC4_HUMAN	apolipoprotein B	197					mRNA processing		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0						CTGTGGAGAACAGAATGCCAG	0.507													41	62	---	---	---	---	PASS
C1orf26	54823	broad.mit.edu	37	1	185259906	185259906	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185259906T>C	uc001grg.3	+	19	2788	c.2674T>C	c.(2674-2676)TGT>CGT	p.C892R	C1orf26_uc001grh.3_Missense_Mutation_p.C892R	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	892											0						CAGGGGATGGTGTGAAGACAT	0.398													36	54	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248084574	248084574	+	Silent	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248084574C>A	uc010pzc.1	+	1	255	c.255C>A	c.(253-255)ACC>ACA	p.T85T		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACTACTTGACCGGAAGTAAGG	0.582													20	27	---	---	---	---	PASS
OR2T33	391195	broad.mit.edu	37	1	248436862	248436862	+	Silent	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436862G>T	uc010pzi.1	-	1	255	c.255C>A	c.(253-255)ACC>ACA	p.T85T		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	85	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCTTACTTCCGGTCAAGTAGT	0.572													9	163	---	---	---	---	PASS
HNRPLL	92906	broad.mit.edu	37	2	38797055	38797055	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38797055T>C	uc002rqw.2	-	9	1515	c.1105A>G	c.(1105-1107)AAG>GAG	p.K369E	HNRPLL_uc002rqv.2_Missense_Mutation_p.K64E|HNRPLL_uc002rqx.2_Missense_Mutation_p.K364E	NM_138394	NP_612403	Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	369	RRM 3.				mRNA processing|positive regulation of RNA splicing	nucleus|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding			skin(1)	1		all_hematologic(82;0.248)				GGAATGGTCTTCATAAATTTT	0.338													69	154	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39250293	39250293	+	Missense_Mutation	SNP	G	T	T	rs148145528	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39250293G>T	uc002rrk.3	-	10	1317	c.1276C>A	c.(1276-1278)CAG>AAG	p.Q426K	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_Missense_Mutation_p.Q40K|SOS1_uc002rrl.2_Missense_Mutation_p.Q158K	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	426					apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				ATATTCTTCTGAATCTCGTTC	0.373									Noonan_syndrome				43	160	---	---	---	---	PASS
FAM136A	84908	broad.mit.edu	37	2	70529085	70529085	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70529085A>T	uc002sgq.3	-	1	136	c.59T>A	c.(58-60)CTG>CAG	p.L20Q	FAM136A_uc010fdp.2_RNA	NM_032822	NP_116211	Q96C01	F136A_HUMAN	hypothetical protein LOC84908	20						mitochondrion	protein binding				0						CTCTCTTTCCAGACTCTTCAC	0.532											OREG0014676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	8	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80874879	80874879	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80874879C>A	uc010ysh.1	+	18	2749	c.2744C>A	c.(2743-2745)CCC>CAC	p.P915H	CTNNA2_uc010yse.1_Missense_Mutation_p.P867H|CTNNA2_uc010ysf.1_Missense_Mutation_p.P867H|CTNNA2_uc010ysg.1_Missense_Mutation_p.P822H|CTNNA2_uc010ysi.1_Missense_Mutation_p.P499H|CTNNA2_uc010ysj.1_Missense_Mutation_p.P196H	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	915					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton	p.P915H(1)		pancreas(4)|lung(3)|breast(1)|skin(1)	9						GAGAAGAAGCCCCTTGTGAAG	0.468													86	212	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109379898	109379898	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109379898A>G	uc002tem.3	+	20	3029	c.2903A>G	c.(2902-2904)CAG>CGG	p.Q968R		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	968					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						AATGTTCAACAGACAAGCACA	0.428													33	111	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152318926	152318926	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152318926G>T	uc002txm.2	+	29	3439	c.3309G>T	c.(3307-3309)ATG>ATT	p.M1103I	RIF1_uc002txl.2_Missense_Mutation_p.M1103I|RIF1_uc002txn.2_Missense_Mutation_p.M1103I|RIF1_uc002txo.2_Missense_Mutation_p.M1103I|RIF1_uc002txp.2_5'Flank	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	1103					cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		tttatttCAGGGAAATTCCTA	0.279													10	76	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152318927	152318927	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152318927G>A	uc002txm.2	+	29	3440	c.3310G>A	c.(3310-3312)GAA>AAA	p.E1104K	RIF1_uc002txl.2_Missense_Mutation_p.E1104K|RIF1_uc002txn.2_Missense_Mutation_p.E1104K|RIF1_uc002txo.2_Missense_Mutation_p.E1104K|RIF1_uc002txp.2_5'Flank	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	1104					cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		ttatttCAGGGAAATTCCTAC	0.274													10	78	---	---	---	---	PASS
RQCD1	9125	broad.mit.edu	37	2	219447763	219447763	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447763A>G	uc010zkh.1	+	3	274	c.274A>G	c.(274-276)AAT>GAT	p.N92D	RQCD1_uc002vih.1_Missense_Mutation_p.N92D|RQCD1_uc010zki.1_Missense_Mutation_p.N92D	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog	92					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGAGTTTGCAATGCTCTGGC	0.398													6	164	---	---	---	---	PASS
TM4SF20	79853	broad.mit.edu	37	2	228228665	228228665	+	Silent	SNP	A	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228228665A>T	uc002vpb.2	-	4	503	c.465T>A	c.(463-465)ACT>ACA	p.T155T		NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	155	Extracellular (Potential).					integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TATTGAAACCAGTAGGAGGTG	0.398													42	98	---	---	---	---	PASS
IQCA1	79781	broad.mit.edu	37	2	237300665	237300665	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237300665T>G	uc002vvz.1	-	11	1549	c.1367A>C	c.(1366-1368)GAC>GCC	p.D456A	IQCA1_uc002vwb.2_Missense_Mutation_p.D463A|IQCA1_uc002vwa.1_RNA|IQCA1_uc010zni.1_Missense_Mutation_p.D415A	NM_024726	NP_079002	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	456	Lys-rich.						ATP binding			ovary(1)	1						CCTTTCTCTGTCCACAGCTAG	0.458													30	218	---	---	---	---	PASS
CLASP2	23122	broad.mit.edu	37	3	33648252	33648252	+	Splice_Site	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33648252T>C	uc003cfu.2	-	16	1881	c.1527_splice	c.e16-1	p.K509_splice	CLASP2_uc003cft.2_Splice_Site|CLASP2_uc010hgb.2_Splice_Site|CLASP2_uc003cfv.2_Splice_Site_p.K282_splice|CLASP2_uc011axu.1_Splice_Site_p.K286_splice|CLASP2_uc003cfw.2_Splice_Site_p.K282_splice|CLASP2_uc011axt.1_Splice_Site_p.K84_splice	NM_015097	NP_055912	B2RTR1	B2RTR1_HUMAN	CLIP-associating protein 2											ovary(3)|central_nervous_system(1)	4						ATGTATGTCCTGTTAAAAAAA	0.343													13	118	---	---	---	---	PASS
MAP4	4134	broad.mit.edu	37	3	47912403	47912403	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47912403A>T	uc003csb.2	-	13	3285	c.2759T>A	c.(2758-2760)CTC>CAC	p.L920H	MAP4_uc003csc.3_Missense_Mutation_p.L920H|MAP4_uc003crw.2_Missense_Mutation_p.L52H|MAP4_uc003crx.2_Missense_Mutation_p.L180H|MAP4_uc011bbe.1_Missense_Mutation_p.L671H|MAP4_uc003cry.2_Missense_Mutation_p.L655H|MAP4_uc003csa.3_Missense_Mutation_p.L655H|MAP4_uc003crz.3_RNA|MAP4_uc003csd.2_Missense_Mutation_p.L655H	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1	920					negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)		CAGGCGGCTGAGCCGGGGGGT	0.612													27	44	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52623110	52623110	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52623110C>A	uc003des.2	-	18	2953	c.2941G>T	c.(2941-2943)GAA>TAA	p.E981*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.E981*|PBRM1_uc003der.2_Nonsense_Mutation_p.E949*|PBRM1_uc003det.2_Nonsense_Mutation_p.E996*|PBRM1_uc003deu.2_Nonsense_Mutation_p.E996*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.E981*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.E981*|PBRM1_uc003dey.2_Nonsense_Mutation_p.E981*|PBRM1_uc003dez.1_Nonsense_Mutation_p.E980*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.E893*|PBRM1_uc003dfa.1_Nonsense_Mutation_p.E327*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	981	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CACAGTCTTTCAATACAGACG	0.428			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								85	131	---	---	---	---	PASS
PARP14	54625	broad.mit.edu	37	3	122433220	122433220	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122433220T>C	uc003efq.3	+	12	4003	c.3944T>C	c.(3943-3945)TTG>TCG	p.L1315S	PARP14_uc010hrk.2_RNA|PARP14_uc003efr.2_Missense_Mutation_p.L1032S|PARP14_uc003efs.1_Missense_Mutation_p.L1032S	NM_017554	NP_060024	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1315	Macro 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)		TCCTCTGTTTTGCAGGAGTGT	0.408													21	24	---	---	---	---	PASS
IL1RAP	3556	broad.mit.edu	37	3	190366339	190366339	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190366339G>A	uc003fsm.1	+	12	1764	c.1558G>A	c.(1558-1560)GTG>ATG	p.V520M	IL1RAP_uc010hzg.1_Missense_Mutation_p.V520M|IL1RAP_uc003fsn.1_RNA|IL1RAP_uc003fso.1_Missense_Mutation_p.V520M|IL1RAP_uc003fsp.1_RNA|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173	Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein isoform	520	Cytoplasmic (Potential).|TIR.				inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		GGCTAAGACGGTGCTCACGGT	0.488													69	93	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194177901	194177901	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194177901C>T	uc003fty.3	-	6	884	c.482G>A	c.(481-483)GGA>GAA	p.G161E		NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	161					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TTCATCCAGTCCCCTAAATAA	0.333													19	158	---	---	---	---	PASS
SDHAP1	255812	broad.mit.edu	37	3	195692347	195692347	+	Missense_Mutation	SNP	G	A	A	rs62282794	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195692347G>A	uc003fvy.2	-	3	310	c.196C>T	c.(196-198)CAC>TAC	p.H66Y	SDHAP1_uc003fvx.3_RNA					Homo sapiens full length insert cDNA clone ZC24D06.												0						TTCCTCCAGTGCTCCTCAAAG	0.572													6	43	---	---	---	---	PASS
ZNF141	7700	broad.mit.edu	37	4	367443	367443	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:367443G>A	uc003gaa.2	+	5	1395	c.1217G>A	c.(1216-1218)CGG>CAG	p.R406Q	ZNF141_uc003gab.2_Intron	NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141	406	C2H2-type 9.				anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						GCCTTTAGACGGTCCACAGAT	0.403													24	147	---	---	---	---	PASS
HTT	3064	broad.mit.edu	37	4	3208562	3208562	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3208562G>T	uc011bvq.1	+	45	6078	c.5933G>T	c.(5932-5934)TGC>TTC	p.C1978F		NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin	1976					establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ACTCTTCAGTGCTTGGAGGGG	0.458													16	93	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060386	46060386	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060386C>T	uc003gxb.2	-	7	916	c.764G>A	c.(763-765)GGG>GAG	p.G255E		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	255	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		AACATAATCCCCTGTAAGAAA	0.279													21	85	---	---	---	---	PASS
AGXT2L1	64850	broad.mit.edu	37	4	109669293	109669293	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109669293C>G	uc003hzc.2	-	9	1131	c.950G>C	c.(949-951)TGT>TCT	p.C317S	AGXT2L1_uc010imc.2_Missense_Mutation_p.C311S|AGXT2L1_uc011cfm.1_Missense_Mutation_p.C277S|AGXT2L1_uc011cfn.1_Missense_Mutation_p.C244S|AGXT2L1_uc011cfo.1_Missense_Mutation_p.C259S	NM_031279	NP_112569	Q8TBG4	AT2L1_HUMAN	alanine-glyoxylate aminotransferase 2-like 1	317					cellular amino acid metabolic process	mitochondrion	alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000281)		ACCAACAGCACAAGATACTGG	0.363													12	71	---	---	---	---	PASS
C4orf27	54969	broad.mit.edu	37	4	170663225	170663225	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170663225C>T	uc003isl.3	-	5	596	c.531G>A	c.(529-531)ACG>ACA	p.T177T		NM_017867	NP_060337	Q9NWY4	CD027_HUMAN	hypothetical protein LOC54969	177						nucleus				ovary(1)|pancreas(1)	2		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		TCTTTTTATCCGTTATTTCTC	0.363													30	80	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37165738	37165738	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37165738T>C	uc011cpa.1	-	36	7667	c.7436A>G	c.(7435-7437)AAA>AGA	p.K2479R	C5orf42_uc011coy.1_Missense_Mutation_p.K979R|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.K1554R	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2479										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CTCACATCTTTTTTCTTGCAG	0.318													25	175	---	---	---	---	PASS
EMB	133418	broad.mit.edu	37	5	49707293	49707293	+	Intron	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49707293A>G	uc003jom.2	-						EMB_uc003jol.2_5'UTR|EMB_uc011cpy.1_Intron|EMB_uc010ivr.2_Intron	NM_198449	NP_940851	Q6PCB8	EMB_HUMAN	embigin precursor							integral to membrane					0	Lung SC(58;0.218)	Lung NSC(810;0.0795)				TTATATTATTAACAGCAGTGT	0.294													8	39	---	---	---	---	PASS
ANKRD34B	340120	broad.mit.edu	37	5	79855340	79855340	+	Silent	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79855340A>G	uc010jam.2	-	4	849	c.499T>C	c.(499-501)TTA>CTA	p.L167L	ANKRD34B_uc003kgw.2_Silent_p.L167L|ANKRD34B_uc010jan.2_Silent_p.L167L	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	167						cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		GGCATATTTAAGTATTGTTTA	0.443													7	323	---	---	---	---	PASS
XRCC4	7518	broad.mit.edu	37	5	82554530	82554530	+	Intron	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82554530T>C	uc003kib.2	+						XRCC4_uc003kia.1_Intron|XRCC4_uc003kid.2_Intron|XRCC4_uc003kic.2_Intron|XRCC4_uc003kie.2_Intron|XRCC4_uc003kif.1_3'UTR|XRCC4_uc003kig.2_Intron	NM_022406	NP_071801	Q13426	XRCC4_HUMAN	X-ray repair cross complementing protein 4						DNA ligation involved in DNA repair|double-strand break repair via nonhomologous end joining|initiation of viral infection|positive regulation of ligase activity|provirus integration|response to X-ray	cytosol|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|nucleoplasm	DNA binding|protein C-terminus binding			skin(3)	3		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		AGAAGTGAGATGACATTTTTG	0.289								NHEJ					28	61	---	---	---	---	PASS
ATG12	9140	broad.mit.edu	37	5	115177263	115177263	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115177263A>T	uc003krh.2	-	1	237	c.128T>A	c.(127-129)GTG>GAG	p.V43E	AP3S1_uc003krl.2_5'Flank|AP3S1_uc003krk.2_5'Flank|AP3S1_uc003krm.2_5'Flank|ATG12_uc003kri.2_Missense_Mutation_p.V43E|ATG12_uc003krj.2_RNA	NM_004707	NP_004698	O94817	ATG12_HUMAN	APG12 autophagy 12-like	Error:Variant_position_missing_in_O94817_after_alignment					autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		GCTTGGAGACACTCGAGAGCG	0.587													47	119	---	---	---	---	PASS
PCDHB11	56125	broad.mit.edu	37	5	140579545	140579545	+	Silent	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140579545G>C	uc003liy.2	+	1	198	c.198G>C	c.(196-198)GTG>GTC	p.V66V	PCDHB11_uc011daj.1_Intron	NM_018931	NP_061754	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11 precursor	66	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGCTCGGGTGGTCTCTAATG	0.517													51	101	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140774176	140774176	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774176G>T	uc003lkd.1	+	1	2694	c.1796G>T	c.(1795-1797)GGC>GTC	p.G599V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.G599V	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	599	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGACTCGGGCCAGAACGCC	0.706													7	37	---	---	---	---	PASS
LARS	51520	broad.mit.edu	37	5	145524053	145524053	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145524053C>T	uc003lnx.1	-	17	1875	c.1637G>A	c.(1636-1638)TGC>TAC	p.C546Y	LARS_uc011dbq.1_Missense_Mutation_p.C500Y|LARS_uc011dbr.1_Missense_Mutation_p.C492Y|LARS_uc011dbs.1_Missense_Mutation_p.C519Y	NM_020117	NP_064502	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	546					leucyl-tRNA aminoacylation	cytosol	ATP binding|leucine-tRNA ligase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	GTTCTTCAAGCACTGAGATGT	0.363													49	146	---	---	---	---	PASS
HAVCR2	84868	broad.mit.edu	37	5	156536031	156536031	+	5'UTR	SNP	T	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156536031T>G	uc003lwk.1	-	1					HAVCR2_uc003lwl.2_5'UTR	NM_032782	NP_116171	Q8TDQ0	HAVR2_HUMAN	T cell immunoglobulin mucin 3 precursor							integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACACCTCTGTTAGGCACAGTT	0.483													19	38	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32047063	32047063	+	Silent	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32047063G>A	uc003nzl.2	-	11	4324	c.4122C>T	c.(4120-4122)CTC>CTT	p.L1374L		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1461	Fibronectin type-III 7.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GCTCCCCCAGGAGCGGCTCCT	0.637													7	79	---	---	---	---	PASS
TCTE1	202500	broad.mit.edu	37	6	44255550	44255550	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44255550C>T	uc003oxi.2	-	2	169	c.13G>A	c.(13-15)GTA>ATA	p.V5I	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_182539	NP_872345	Q5JU00	TCTE1_HUMAN	t-complex-associated testis expressed 1	5										ovary(2)|skin(2)	4	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GATGTCGTTACGGTATCCTGC	0.562													6	46	---	---	---	---	PASS
ELOVL4	6785	broad.mit.edu	37	6	80635976	80635976	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80635976T>A	uc003pja.3	-	2	542	c.223A>T	c.(223-225)ATG>TTG	p.M75L	ELOVL4_uc011dyt.1_Intron	NM_022726	NP_073563	Q9GZR5	ELOV4_HUMAN	elongation of very long chain fatty acids-like	75					fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups			ovary(1)|skin(1)	2		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	ACTAGACGCATCTGAAAAGGT	0.388													12	92	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82925803	82925803	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82925803G>A	uc003pjl.1	-	11	2118	c.1591C>T	c.(1591-1593)CCT>TCT	p.P531S	IBTK_uc011dyv.1_Missense_Mutation_p.P531S|IBTK_uc011dyw.1_Missense_Mutation_p.P531S|IBTK_uc010kbi.1_Missense_Mutation_p.P225S|IBTK_uc003pjm.2_Missense_Mutation_p.P531S	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	531					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		CTTGTTTTAGGATCTGACTGC	0.348													53	54	---	---	---	---	PASS
TAB2	23118	broad.mit.edu	37	6	149691195	149691195	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149691195C>G	uc003qmj.2	+	2	240	c.62C>G	c.(61-63)CCT>CGT	p.P21R	TAB2_uc011eec.1_Intron|TAB2_uc010kia.1_Missense_Mutation_p.P21R|TAB2_uc010kib.1_Missense_Mutation_p.P21R|TAB2_uc003qmk.3_RNA	NM_015093	NP_055908	Q9NYJ8	TAB2_HUMAN	mitogen-activated protein kinase kinase kinase 7	21	CUE.				activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0						CAAAAATTCCCTGAAGTACCT	0.383													79	45	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48312183	48312183	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48312183G>A	uc003toq.2	+	17	2945	c.2920G>A	c.(2920-2922)GAA>AAA	p.E974K	ABCA13_uc010kyr.2_Missense_Mutation_p.E477K	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	974					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						ATATATTTATGAATTATTGAA	0.294													8	101	---	---	---	---	PASS
SEMA3D	223117	broad.mit.edu	37	7	84694820	84694820	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84694820G>C	uc003uic.2	-	6	678	c.638C>G	c.(637-639)ACT>AGT	p.T213S	SEMA3D_uc010led.2_Missense_Mutation_p.T213S|SEMA3D_uc010lee.1_Missense_Mutation_p.T213S	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	213	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						AGTGAATGCAGTATCTTTGCC	0.423													20	67	---	---	---	---	PASS
IQUB	154865	broad.mit.edu	37	7	123142671	123142671	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123142671G>A	uc003vkn.2	-	6	1580	c.1003C>T	c.(1003-1005)CAT>TAT	p.H335Y	IQUB_uc003vko.2_Missense_Mutation_p.H335Y|IQUB_uc010lkt.2_RNA|IQUB_uc003vkp.1_Missense_Mutation_p.H335Y|IQUB_uc003vkq.2_3'UTR	NM_178827	NP_849149	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	335										ovary(3)|large_intestine(1)	4						CTTTGAGCATGGTATTCTGCT	0.353													16	102	---	---	---	---	PASS
WASL	8976	broad.mit.edu	37	7	123346339	123346339	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123346339C>G	uc003vkz.2	-	4	756	c.428G>C	c.(427-429)AGG>ACG	p.R143T		NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein	143					actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						ACCAGATTTCCTTTGTCGACG	0.224													12	84	---	---	---	---	PASS
CREB3L2	64764	broad.mit.edu	37	7	137597645	137597645	+	Intron	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137597645C>T	uc003vtw.2	-						CREB3L2_uc003vtx.1_Intron|CREB3L2_uc003vty.3_Silent_p.L225L|CREB3L2_uc003vtv.2_Intron	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160						ATCTGTGGTACAAACTCATCC	0.398			T	FUS	fibromyxoid sarcoma								3	11	---	---	---	---	PASS
ZC3HAV1	56829	broad.mit.edu	37	7	138764442	138764442	+	Silent	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138764442G>A	uc003vun.2	-	4	1633	c.1245C>T	c.(1243-1245)GGC>GGT	p.G415G	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Silent_p.G415G	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	415					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						TTCCACTTTTGCCATTGATGA	0.473													49	142	---	---	---	---	PASS
TAS2R38	5726	broad.mit.edu	37	7	141672669	141672669	+	Missense_Mutation	SNP	C	T	T	rs139085046	byFrequency	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141672669C>T	uc003vwx.1	-	1	905	c.821G>A	c.(820-822)CGC>CAC	p.R274H		NM_176817	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	274	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			kidney(1)|skin(1)	2	Melanoma(164;0.0171)					TATTTTGTCGCGCCACAGAAT	0.502													24	65	---	---	---	---	PASS
IDO1	3620	broad.mit.edu	37	8	39775606	39775606	+	Splice_Site	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39775606G>A	uc003xnm.2	+	3	298	c.184_splice	c.e3-1	p.L62_splice	IDO1_uc003xnn.2_Splice_Site	NM_002164	NP_002155	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1						female pregnancy|tryptophan catabolic process	cytosol	electron carrier activity|heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			central_nervous_system(2)	2					L-Tryptophan(DB00150)	TTTGTTTTCAGTTAAACATGC	0.398													78	66	---	---	---	---	PASS
SLC7A13	157724	broad.mit.edu	37	8	87242198	87242198	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87242198C>T	uc003ydq.1	-	1	407	c.309G>A	c.(307-309)CTG>CTA	p.L103L	SLC7A13_uc003ydr.1_Silent_p.L103L	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid	103	Helical; Name=3; (Potential).					integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						CCCCTGACCCCAGAAACAAGG	0.473													29	38	---	---	---	---	PASS
TMEM67	91147	broad.mit.edu	37	8	94767208	94767208	+	Silent	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94767208G>A	uc011lgk.1	+	1	137	c.66G>A	c.(64-66)GTG>GTA	p.V22V	TMEM67_uc010mau.2_Silent_p.V22V|TMEM67_uc010mav.2_Silent_p.V22V|TMEM67_uc010mat.1_Intron|TMEM67_uc010maw.2_Silent_p.V22V|TMEM67_uc003yga.3_Intron	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1	22	Helical; (Potential).				cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			CCCGGGCCGTGACCGCGTTCC	0.622													6	178	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100533198	100533198	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100533198A>C	uc003yiv.2	+	30	4891	c.4780A>C	c.(4780-4782)AAT>CAT	p.N1594H	VPS13B_uc003yiw.2_Missense_Mutation_p.N1569H	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1594					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCAGGCTGACAATCCCCTTGG	0.398													75	101	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116599767	116599767	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116599767G>C	uc003ynz.2	-	4	2581	c.2122C>G	c.(2122-2124)CTG>GTG	p.L708V	TRPS1_uc011lhy.1_Missense_Mutation_p.L712V|TRPS1_uc003yny.2_Missense_Mutation_p.L721V|TRPS1_uc010mcy.2_Missense_Mutation_p.L708V	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	708	C2H2-type 5.|Mediates interaction with GLI3.				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AAGTGCTCCAGTAGTGACTGA	0.507									Langer-Giedion_syndrome				13	164	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144995815	144995815	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144995815G>A	uc003zaf.1	-	32	8755	c.8585C>T	c.(8584-8586)ACG>ATG	p.T2862M	PLEC_uc003zab.1_Missense_Mutation_p.T2725M|PLEC_uc003zac.1_Missense_Mutation_p.T2729M|PLEC_uc003zad.2_Missense_Mutation_p.T2725M|PLEC_uc003zae.1_Missense_Mutation_p.T2693M|PLEC_uc003zag.1_Missense_Mutation_p.T2703M|PLEC_uc003zah.2_Missense_Mutation_p.T2711M|PLEC_uc003zaj.2_Missense_Mutation_p.T2752M	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2862	Plectin 1.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GATGAGGGCCGTGCCGGGACT	0.662													4	31	---	---	---	---	PASS
KIAA1984	84960	broad.mit.edu	37	9	139701099	139701099	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139701099T>C	uc004cjf.2	+	11	1301	c.1253T>C	c.(1252-1254)ATG>ACG	p.M418T	C9orf86_uc004cjm.2_5'Flank|C9orf86_uc004cjh.2_5'Flank|C9orf86_uc004cjj.1_5'Flank|C9orf86_uc004cjk.1_5'Flank|C9orf86_uc004cji.1_5'Flank|C9orf86_uc010nbr.1_5'Flank|LOC100131193_uc004cjg.1_Intron	NM_001039374	NP_001034463	Q5T5S1	K1984_HUMAN	hypothetical protein LOC84960	418										ovary(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GTCCGGCTGATGGGCATTAAC	0.622													14	17	---	---	---	---	PASS
ALOX5	240	broad.mit.edu	37	10	45935891	45935891	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45935891C>T	uc001jce.2	+	8	1094	c.995C>T	c.(994-996)CCG>CTG	p.P332L	ALOX5_uc009xmt.2_Missense_Mutation_p.P332L|ALOX5_uc010qfg.1_Missense_Mutation_p.P332L	NM_000698	NP_000689	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	332	Lipoxygenase.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding			ovary(1)|pancreas(1)	2		Lung SC(717;0.0257)			Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)	AACCAAATCCCGGGAGATGAG	0.483													9	106	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69881502	69881502	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69881502G>C	uc001jnm.3	+	3	492	c.307G>C	c.(307-309)GAT>CAT	p.D103H	MYPN_uc001jnl.1_Missense_Mutation_p.D103H|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.D103H|MYPN_uc001jnp.1_Missense_Mutation_p.D103H|MYPN_uc009xps.2_Missense_Mutation_p.D103H|MYPN_uc009xpt.2_Missense_Mutation_p.D103H|MYPN_uc010qit.1_5'UTR|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	103	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						ACTTTCTCCTGATCAGATGAA	0.443													17	81	---	---	---	---	PASS
PLAC9	219348	broad.mit.edu	37	10	81904026	81904026	+	Silent	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81904026G>C	uc001kbp.1	+	3	471	c.210G>C	c.(208-210)CTG>CTC	p.L70L		NM_001012973	NP_001012991	Q5JTB6	PLAC9_HUMAN	placenta-specific 9 precursor	70						extracellular region					0	Prostate(51;0.0095)|all_epithelial(25;0.175)		Colorectal(32;0.109)			TGAAAGGCCTGCTGGGCCTGC	0.627											OREG0020321	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	50	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95148802	95148802	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95148802C>A	uc001kin.2	-	18	1689	c.1566G>T	c.(1564-1566)GAG>GAT	p.E522D	MYOF_uc001kio.2_Missense_Mutation_p.E509D	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	522	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						CAGTATTCAGCTCATCATAGG	0.413													28	138	---	---	---	---	PASS
ABLIM1	3983	broad.mit.edu	37	10	116444218	116444218	+	5'UTR	SNP	A	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116444218A>T	uc010qsh.1	-	1					ABLIM1_uc010qsi.1_5'UTR|ABLIM1_uc009xyp.2_5'UTR|ABLIM1_uc001lbz.1_Intron	NM_001003408	NP_001003408	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform c						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TCCTCCCAGGAGTCTGTGGGC	0.597													3	13	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	129202630	129202630	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129202630C>T	uc001ljt.2	+	40	4060	c.3996C>T	c.(3994-3996)ATC>ATT	p.I1332I	DOCK1_uc010qun.1_Silent_p.I1353I|DOCK1_uc009yaq.2_Silent_p.I327I	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1332	DHR-2.				apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TCAAAGTGATCAGGCCCAAGC	0.438													5	24	---	---	---	---	PASS
SCUBE2	57758	broad.mit.edu	37	11	9048918	9048918	+	Silent	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9048918C>A	uc001mhh.1	-	19	2687	c.2607G>T	c.(2605-2607)CGG>CGT	p.R869R	SCUBE2_uc001mhi.1_Silent_p.R841R|SCUBE2_uc001mhj.1_Intron	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein precursor	869	CUB.					extracellular region	calcium ion binding			ovary(1)|skin(1)	2				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CACAGGTTTTCCGCATCACCA	0.592													6	20	---	---	---	---	PASS
DCDC1	341019	broad.mit.edu	37	11	31284477	31284477	+	3'UTR	SNP	A	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31284477A>C	uc001msv.2	-	9					DCDC1_uc001msu.1_Intron	NM_181807	NP_861523	P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction					skin(1)	1	Lung SC(675;0.225)					AGCTGGCATAAGCTTTTATAA	0.403													10	17	---	---	---	---	PASS
PRDM11	56981	broad.mit.edu	37	11	45246528	45246528	+	3'UTR	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45246528G>A	uc001myo.2	+	8						NM_020229	NP_064614	Q9NQV5	PRD11_HUMAN	PR domain containing 11											upper_aerodigestive_tract(1)	1						GGCTACCTCCGTGGGTGGGAG	0.587													3	10	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62300776	62300776	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62300776C>A	uc001ntl.2	-	5	1413	c.1113G>T	c.(1111-1113)AAG>AAT	p.K371N	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	371					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TTTGGGGGCCCTTCAGCTTCC	0.597													8	86	---	---	---	---	PASS
PCNXL3	399909	broad.mit.edu	37	11	65386188	65386188	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65386188G>A	uc001oey.2	+	6	1355	c.1355G>A	c.(1354-1356)TGC>TAC	p.C452Y		NM_032223	NP_115599	Q9H6A9	PCX3_HUMAN	pecanex-like 3	452	Ser-rich.					integral to membrane					0						TCTACTTCCTGCTACTCCCCT	0.647													16	18	---	---	---	---	PASS
PPP2R1B	5519	broad.mit.edu	37	11	111625729	111625729	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111625729C>T	uc001plx.1	-	7	1017	c.933G>A	c.(931-933)CGG>CGA	p.R311R	PPP2R1B_uc001plw.1_Silent_p.R311R|PPP2R1B_uc010rwi.1_Silent_p.R247R|PPP2R1B_uc010rwj.1_Silent_p.R150R|PPP2R1B_uc010rwk.1_Silent_p.R311R|PPP2R1B_uc010rwl.1_Silent_p.R184R	NM_002716	NP_002707	P30154	2AAB_HUMAN	beta isoform of regulatory subunit A, protein	311	HEAT 8.						protein binding				0		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		CAGCAGCTGCCCGGACTTCAG	0.408													7	112	---	---	---	---	PASS
C11orf1	64776	broad.mit.edu	37	11	111754535	111754535	+	Silent	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111754535T>C	uc001pmd.2	+	4	721	c.384T>C	c.(382-384)CCT>CCC	p.P128P	C11orf1_uc001pme.2_Silent_p.P168P	NM_022761	NP_073598	Q9H5F2	CK001_HUMAN	hypothetical protein LOC64776	128						nucleus					0		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		GACATCAACCTGAACTGGATC	0.408													23	75	---	---	---	---	PASS
TREH	11181	broad.mit.edu	37	11	118531943	118531943	+	Silent	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118531943G>A	uc001pty.1	-	8	828	c.783C>T	c.(781-783)AAC>AAT	p.N261N	TREH_uc009zaj.1_Silent_p.N230N|TREH_uc001ptz.1_Silent_p.N138N|TREH_uc009zak.2_Silent_p.N261N	NM_007180	NP_009111	O43280	TREA_HUMAN	trehalase precursor	261					polysaccharide digestion|trehalose catabolic process	anchored to plasma membrane	alpha,alpha-trehalase activity			pancreas(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.16e-05)		AGACAGTCCTGTTCTTGGTCC	0.547													33	54	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	8995734	8995734	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8995734A>G	uc001quz.3	+	12	1351	c.1253A>G	c.(1252-1254)AAG>AGG	p.K418R	A2ML1_uc001qva.1_5'UTR|A2ML1_uc010sgm.1_5'Flank	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	262						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						TCTCAGGGAAAGTTTCAAATG	0.448													8	100	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20874910	20874910	+	Silent	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20874910G>A	uc001rej.3	+	9	1303	c.948G>A	c.(946-948)AAG>AAA	p.K316K	SLCO1C1_uc010sii.1_Silent_p.K316K|SLCO1C1_uc010sij.1_Silent_p.K267K|SLCO1C1_uc009zip.2_Silent_p.K150K|SLCO1C1_uc001rei.2_Silent_p.K316K|SLCO1C1_uc010sik.1_Silent_p.K198K	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	316	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					AGAAATCCAAGTTTATTATAG	0.368													4	107	---	---	---	---	PASS
ALG10B	144245	broad.mit.edu	37	12	38710783	38710783	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38710783G>T	uc001rln.3	+	1	227	c.88G>T	c.(88-90)GCG>TCG	p.A30S	ALG10B_uc001rlo.3_5'UTR|ALG10B_uc010skk.1_5'UTR	NM_001013620	NP_001013642	Q5I7T1	AG10B_HUMAN	asparagine-linked glycosylation 10 homolog B	30	Extracellular (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane|plasma membrane	dolichyl-phosphate-glucose-glycolipid alpha-glucosyltransferase activity			ovary(2)|skin(1)	3	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				CTTCAGCCGGGCGCTGCGAGA	0.607											OREG0021733	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	196	258	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80752068	80752068	+	5'UTR	SNP	T	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80752068T>A	uc009zsg.1	+	3					uc001szd.2_Missense_Mutation_p.D30E					RecName: Full=Uncharacterized protein C12orf64;																		TATGTCATGATGGGGAATTTC	0.338													6	52	---	---	---	---	PASS
TMTC2	160335	broad.mit.edu	37	12	83290181	83290181	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83290181C>G	uc001szt.2	+	3	1671	c.1239C>G	c.(1237-1239)TTC>TTG	p.F413L	TMTC2_uc001szr.1_Missense_Mutation_p.F413L|TMTC2_uc001szs.1_Missense_Mutation_p.F413L|TMTC2_uc010suk.1_Missense_Mutation_p.F168L	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	413	Helical; (Potential).					endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						ACCTGTTTTTCTATGTCGGCT	0.418													30	319	---	---	---	---	PASS
IRS2	8660	broad.mit.edu	37	13	110437883	110437883	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110437883C>G	uc001vqv.2	-	1	1032	c.518G>C	c.(517-519)GGC>GCC	p.G173A		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	173					fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|skin(1)|ovary(1)|kidney(1)	8	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			gccggcagagccgcccagggc	0.313													5	5	---	---	---	---	PASS
DHRS4	10901	broad.mit.edu	37	14	24475265	24475265	+	3'UTR	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24475265T>C	uc001wlc.3	+	8					DHRS4L2_uc001wld.3_3'UTR|DHRS4L2_uc001wle.3_3'UTR|DHRS4L2_uc001wlg.3_RNA|DHRS4L2_uc001wlh.3_RNA|DHRS4L2_uc001wli.3_3'UTR|DHRS4L2_uc010alb.2_3'UTR	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	GTGCTGTTCCTGCATTCACCC	0.592													3	13	---	---	---	---	PASS
DCAF11	80344	broad.mit.edu	37	14	24590705	24590705	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24590705T>A	uc001wlv.2	+	13	1658	c.1378T>A	c.(1378-1380)TGC>AGC	p.C460S	DCAF11_uc001wlw.2_Missense_Mutation_p.C460S|DCAF11_uc001wlz.2_Missense_Mutation_p.C360S|DCAF11_uc001wly.2_Missense_Mutation_p.C416S|DCAF11_uc001wme.2_Missense_Mutation_p.C420S|DCAF11_uc010tny.1_Missense_Mutation_p.C327S|DCAF11_uc001wmd.2_Missense_Mutation_p.C460S|DCAF11_uc001wmc.2_Missense_Mutation_p.C360S|DCAF11_uc001wmb.3_Missense_Mutation_p.C434S|DCAF11_uc001wma.3_Missense_Mutation_p.C460S	NM_001163484	NP_001156956	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11 isoform 1	460	WD 6.					CUL4 RING ubiquitin ligase complex	protein binding				0						CTACAGTGGCTGCTCCACTGG	0.567													6	52	---	---	---	---	PASS
RIPK3	11035	broad.mit.edu	37	14	24808452	24808452	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24808452C>T	uc001wpb.2	-	3	450	c.240G>A	c.(238-240)GAG>GAA	p.E80E	RIPK3_uc001wpa.2_5'Flank|RIPK3_uc010alq.2_RNA|RIPK3_uc010toi.1_5'UTR|RIPK3_uc010toj.1_Silent_p.E80E	NM_006871	NP_006862	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	80	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals	cytoplasm	ATP binding|protein binding|transcription coactivator activity			central_nervous_system(2)|ovary(1)|lung(1)	4				GBM - Glioblastoma multiforme(265;0.0181)		AGTTCACCTTCTCGATAACCC	0.577													45	55	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58471390	58471390	+	3'UTR	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58471390C>T	uc001xdc.2	-	8					C14orf37_uc010tro.1_3'UTR	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor							integral to membrane	binding				0						TTTTTTTTTTCTGCTCCAAAA	0.393													12	71	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35196564	35196564	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35196564C>T	uc001ziv.2	-	19	2155	c.1974G>A	c.(1972-1974)AGG>AGA	p.R658R		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	658						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TTGGTTTTCTCCTCATTATTA	0.289													15	104	---	---	---	---	PASS
DISP2	85455	broad.mit.edu	37	15	40662245	40662245	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40662245A>C	uc001zlk.1	+	8	4021	c.3932A>C	c.(3931-3933)GAT>GCT	p.D1311A		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	1311					smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CGTGTACCAGATTCCGTGGGT	0.627													36	62	---	---	---	---	PASS
RCN2	5955	broad.mit.edu	37	15	77241529	77241529	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77241529T>G	uc002bcd.2	+	7	1141	c.920T>G	c.(919-921)CTC>CGC	p.L307R	RCN2_uc002bce.2_Missense_Mutation_p.L379R|RCN2_uc010bks.2_Missense_Mutation_p.L260R	NM_002902	NP_002893	Q14257	RCN2_HUMAN	reticulocalbin 2 precursor	307						endoplasmic reticulum lumen	calcium ion binding				0						GGCAGACAGCTCCATGATGAC	0.403													45	100	---	---	---	---	PASS
C15orf58	390637	broad.mit.edu	37	15	90785079	90785079	+	Silent	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90785079G>T	uc002bpc.2	+	4	1118	c.939G>T	c.(937-939)CTG>CTT	p.L313L		NM_001013657	NP_001013679	Q6ZNW5	VTC2_HUMAN	hypothetical protein LOC390637	313					glucose metabolic process	cytoplasm	GDP-D-glucose phosphorylase activity				0						GAGTAATTCTGTGGGCCCGGA	0.552													25	91	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9943692	9943692	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9943692C>T	uc002czo.3	-	5	1797	c.1249G>A	c.(1249-1251)GTC>ATC	p.V417I	GRIN2A_uc010uym.1_Missense_Mutation_p.V417I|GRIN2A_uc010uyn.1_Missense_Mutation_p.V260I|GRIN2A_uc002czr.3_Missense_Mutation_p.V417I	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	417	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCCACGATGACGAATGGGGCC	0.577													25	101	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27788272	27788272	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27788272C>G	uc002dow.2	+	25	4497	c.4473C>G	c.(4471-4473)TTC>TTG	p.F1491L	KIAA0556_uc010vco.1_5'UTR	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1491										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						ATGTGATTTTCGATCTGCCTA	0.498													14	334	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	31973456	31973456	+	RNA	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31973456G>T	uc002ect.2	+	1		c.48G>T								Homo sapiens IGH mRNA for immunoglobulin heavy chain VHDJ region, partial cds, clone:H186.																		AGCCTGGGGGGTCCCTGAGAC	0.582													4	66	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7681680	7681680	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7681680A>G	uc002giu.1	+	34	5448	c.5434A>G	c.(5434-5436)ACC>GCC	p.T1812A		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1812	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAAGACCGAGACCGTCAAGGA	0.577													14	124	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11593618	11593618	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11593618G>C	uc002gne.2	+	20	4547	c.4479G>C	c.(4477-4479)GAG>GAC	p.E1493D	DNAH9_uc010coo.2_Missense_Mutation_p.E787D	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1493	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCTTCTTGGAGGAGGTGTCGG	0.493													52	171	---	---	---	---	PASS
MPRIP	23164	broad.mit.edu	37	17	17078669	17078669	+	Silent	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17078669C>A	uc002gqu.1	+	19	2708	c.2652C>A	c.(2650-2652)GGC>GGA	p.G884G	MPRIP_uc002gqv.1_Silent_p.G884G|MPRIP_uc002gqw.1_Silent_p.G639G|MPRIP_uc002gqx.1_Silent_p.G1113G|MPRIP_uc002gqy.1_Silent_p.G1113G|MPRIP_uc010cpl.1_Intron|MPRIP_uc010cpm.1_Intron	NM_201274	NP_958431	Q6WCQ1	MPRIP_HUMAN	myosin phosphatase-Rho interacting protein	884	Potential.					cytoplasm|cytoskeleton	actin binding				0						CTGGGGACGGCGGTGGGGAGG	0.627													12	35	---	---	---	---	PASS
CYTSB	92521	broad.mit.edu	37	17	20107798	20107798	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20107798C>A	uc002gwq.2	+	4	581	c.436C>A	c.(436-438)CAC>AAC	p.H146N	CYTSB_uc010cqx.2_Missense_Mutation_p.H146N|CYTSB_uc002gwr.2_Missense_Mutation_p.H146N|CYTSB_uc002gws.2_Missense_Mutation_p.H146N|CYTSB_uc002gwv.2_Missense_Mutation_p.H65N|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_5'UTR|CYTSB_uc002gwt.2_Missense_Mutation_p.H65N|CYTSB_uc002gwu.2_Missense_Mutation_p.H65N	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b	146						nucleus					0						TCCTACGAAACACCTGAGGAC	0.527													32	203	---	---	---	---	PASS
PHF12	57649	broad.mit.edu	37	17	27233901	27233901	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27233901T>A	uc002hdg.1	-	14	3183	c.2653A>T	c.(2653-2655)ATT>TTT	p.I885F	PHF12_uc010wbb.1_Missense_Mutation_p.I867F	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	885					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TTGGCAACAATACTGCTTGGG	0.522													41	121	---	---	---	---	PASS
MYO1D	4642	broad.mit.edu	37	17	30986192	30986192	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30986192C>T	uc002hho.1	-	17	2298	c.2286G>A	c.(2284-2286)TGG>TGA	p.W762*	MYO1D_uc002hhp.1_Nonsense_Mutation_p.W762*	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID	762						myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			GAGGGCTTGGCCACTTCACGT	0.542											OREG0024311	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	149	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42636502	42636502	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42636502C>T	uc002igx.1	+	1	1578	c.1446C>T	c.(1444-1446)TAC>TAT	p.Y482Y		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	482	Helical; Name=6; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCTACTTCTACGAGCAGGCCT	0.652													7	39	---	---	---	---	PASS
VEZF1	7716	broad.mit.edu	37	17	56058037	56058037	+	Silent	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56058037G>T	uc002ivf.1	-	4	1046	c.903C>A	c.(901-903)ATC>ATA	p.I301I	VEZF1_uc010dcn.1_Silent_p.I151I	NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	301	C2H2-type 6.				cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						AGTGGCTGGTGATGTATGCTG	0.463													34	103	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61621018	61621018	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61621018T>G	uc002jay.2	+	10	2310	c.2230T>G	c.(2230-2232)TCA>GCA	p.S744A	KCNH6_uc010wpl.1_Missense_Mutation_p.S621A|KCNH6_uc010wpm.1_Missense_Mutation_p.S744A|KCNH6_uc002jaz.1_Missense_Mutation_p.S691A	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	744	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	TGACAACCAGTCAGGTGAGCA	0.647													6	78	---	---	---	---	PASS
SMURF2	64750	broad.mit.edu	37	17	62541851	62541851	+	3'UTR	SNP	A	G	G	rs59188589		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62541851A>G	uc002jep.1	-	19					SMURF2_uc002jeq.1_3'UTR|SMURF2_uc002jer.1_3'UTR	NM_022739	NP_073576	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2						BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|membrane raft|nucleus|plasma membrane|ubiquitin ligase complex	identical protein binding|SMAD binding|ubiquitin-protein ligase activity			skin(3)|lung(1)	4	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			AAAAAAAAAAAGGGGGGGGGG	0.393													3	5	---	---	---	---	PASS
LLGL2	3993	broad.mit.edu	37	17	73565078	73565078	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73565078C>T	uc002joh.2	+	13	1496	c.1342C>T	c.(1342-1344)CGG>TGG	p.R448W	LLGL2_uc002joi.2_Missense_Mutation_p.R448W|LLGL2_uc010dgg.1_Missense_Mutation_p.R448W|LLGL2_uc002joj.2_Missense_Mutation_p.R437W|LLGL2_uc010wsd.1_Missense_Mutation_p.R75W	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	448	WD 8.				cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CGGCACGGTGCGGTTCTGGGA	0.662													4	18	---	---	---	---	PASS
PRPSAP1	5635	broad.mit.edu	37	17	74326133	74326133	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74326133G>C	uc010wta.1	-	6	1072	c.626C>G	c.(625-627)GCT>GGT	p.A209G	PRPSAP1_uc010wtb.1_Missense_Mutation_p.A106G	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate	180					nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						CCTCTTTGCAGCATCAGGAGA	0.423													8	269	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32409025	32409025	+	Intron	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32409025G>T	uc010dmn.1	+						DTNA_uc002kxu.2_Missense_Mutation_p.G372V|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron|DTNA_uc002kxw.2_Intron|DTNA_uc002kxx.2_Missense_Mutation_p.G369V|DTNA_uc010dmj.2_Intron|DTNA_uc002kxz.2_Intron|DTNA_uc002kxy.2_Intron|DTNA_uc010dmk.1_RNA|DTNA_uc010dml.2_Intron|DTNA_uc002kyb.3_Intron|DTNA_uc010dmm.2_Intron|DTNA_uc010xby.1_Intron|DTNA_uc010dmo.2_Intron|DTNA_uc002kyd.3_Intron|DTNA_uc010xbz.1_Intron|DTNA_uc010xca.1_Intron|DTNA_uc002kye.2_Intron	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						GCTTTTGGTGGATGCGTCTAG	0.428													23	103	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9067640	9067640	+	Silent	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9067640A>G	uc002mkp.2	-	3	20010	c.19806T>C	c.(19804-19806)TCT>TCC	p.S6602S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6604	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						ATTCCTTTTCAGAAGTGGTGG	0.428													82	134	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10476537	10476537	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10476537T>C	uc002moc.3	-	7	1045	c.667A>G	c.(667-669)ATC>GTC	p.I223V	TYK2_uc010dxe.2_Missense_Mutation_p.I38V|TYK2_uc002mod.2_Missense_Mutation_p.I223V	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	223	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			TGCTGCCGGATATGCCGGCGG	0.493													7	9	---	---	---	---	PASS
POLR2I	5438	broad.mit.edu	37	19	36605736	36605736	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36605736T>A	uc002ode.2	-	1	471	c.23A>T	c.(22-24)GAG>GTG	p.E8V	POLR2I_uc002odf.2_RNA|TBCB_uc002odg.1_5'Flank|TBCB_uc002odh.1_5'Flank	NM_006233	NP_006224	P36954	RPB9_HUMAN	DNA directed RNA polymerase II polypeptide I	8					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|zinc ion binding				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GAAGCCCGGCTCGTAAGTCCC	0.687													73	112	---	---	---	---	PASS
SNRNP70	6625	broad.mit.edu	37	19	49601705	49601705	+	Missense_Mutation	SNP	A	G	G	rs138012907		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49601705A>G	uc002pmk.2	+	5	726	c.287A>G	c.(286-288)AAT>AGT	p.N96S	SNRNP70_uc002pmh.1_RNA|SNRNP70_uc002pmi.1_Missense_Mutation_p.N96S|SNRNP70_uc002pml.2_5'UTR|SNRNP70_uc002pmm.2_RNA	NM_003089	NP_003080	P08621	RU17_HUMAN	U1 small nuclear ribonucleoprotein 70 kDa	96					nuclear mRNA splicing, via spliceosome|regulation of RNA splicing	nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0						AATGATCCCAATGCTCAGGGG	0.542											OREG0025616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	288	---	---	---	---	PASS
PTOV1	53635	broad.mit.edu	37	19	50358129	50358129	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50358129T>C	uc002pqf.1	+	4	604	c.434T>C	c.(433-435)ATC>ACC	p.I145T	PTOV1_uc010ybf.1_Missense_Mutation_p.I113T|PTOV1_uc002ppz.3_RNA|PTOV1_uc002pqb.3_Missense_Mutation_p.I113T|PTOV1_uc002pqa.2_RNA|PTOV1_uc002pqc.1_RNA|PTOV1_uc002pqd.2_RNA|PTOV1_uc002pqe.1_RNA	NM_017432	NP_059128	Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	145					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|plasma membrane					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		ATGCAGCTGATCCCTCAGCAG	0.657													12	19	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53668435	53668435	+	Silent	SNP	G	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53668435G>T	uc010eqm.1	-	4	1408	c.1308C>A	c.(1306-1308)GGC>GGA	p.G436G		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	371	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		TAAAGGCTTTGCCACACTCAT	0.408													48	115	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3211240	3211240	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3211240A>G	uc002wig.2	-	11	1432	c.1384T>C	c.(1384-1386)TGG>CGG	p.W462R	SLC4A11_uc010zqe.1_Missense_Mutation_p.W489R|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.W446R	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	462	Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						AGGCCCGTCCATGCGTAGAAG	0.567													13	128	---	---	---	---	PASS
RBM11	54033	broad.mit.edu	37	21	15599655	15599655	+	3'UTR	SNP	C	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15599655C>A	uc002yjo.3	+	5					RBM11_uc002yjn.3_3'UTR|RBM11_uc002yjp.3_3'UTR	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11								nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		GATCTTAGTTCTCTTATGAAA	0.323													8	30	---	---	---	---	PASS
DOPEY2	9980	broad.mit.edu	37	21	37603371	37603371	+	Silent	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37603371C>T	uc002yvg.2	+	14	2368	c.2289C>T	c.(2287-2289)TTC>TTT	p.F763F	DOPEY2_uc011aeb.1_Silent_p.F763F	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like	763					endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						GTGCCACTTTCCCTGTCTACC	0.612													13	109	---	---	---	---	PASS
ZNF295	49854	broad.mit.edu	37	21	43413025	43413025	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43413025C>T	uc002zab.3	-	3	1394	c.1180G>A	c.(1180-1182)GCC>ACC	p.A394T	ZNF295_uc002yzz.3_Missense_Mutation_p.A394T|ZNF295_uc002yzy.3_Missense_Mutation_p.A394T|ZNF295_uc002zaa.3_Missense_Mutation_p.A394T|ZNF295_uc010gov.1_Missense_Mutation_p.A394T|ZNF295_uc002zac.2_Missense_Mutation_p.A394T	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	394					negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3						TCATCTAGGGCTGTTTTTTCA	0.488													7	66	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659578	24659578	+	RNA	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659578A>G	uc002zzs.3	+	7		c.3310A>G			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						TGCGCAGGCCAACACTCACTG	0.617													5	15	---	---	---	---	PASS
POM121L9P	29774	broad.mit.edu	37	22	24659591	24659591	+	RNA	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24659591A>G	uc002zzs.3	+	7		c.3323A>G			uc011ajp.1_5'Flank	NR_003714				Homo sapiens mRNA; cDNA DKFZp434P211 (from clone DKFZp434P211).												0						ACTCACTGACATCGAAGGCTG	0.632													3	15	---	---	---	---	PASS
MAPK8IP2	23542	broad.mit.edu	37	22	51042064	51042064	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51042064A>C	uc003bmx.2	+	4	574	c.457A>C	c.(457-459)AAC>CAC	p.N153H	MAPK8IP2_uc003bmy.2_Missense_Mutation_p.N126H|MAPK8IP2_uc011asc.1_5'Flank	NM_012324	NP_036456	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting	153	JNK-binding domain (JBD).				behavioral fear response|dendrite morphogenesis|MAPKKK cascade|nonassociative learning|positive regulation of anti-apoptosis|regulation of excitatory postsynaptic membrane potential|regulation of JNK cascade|regulation of receptor activity|regulation of synaptic transmission, glutamatergic|signal complex assembly|social behavior	cytoplasm|postsynaptic density	beta-amyloid binding|kinesin binding|MAP-kinase scaffold activity|protein kinase activator activity|protein kinase binding			large_intestine(2)|central_nervous_system(1)	3		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGACTCCCTAAACAACAACGG	0.667													4	8	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69510208	69510208	+	Intron	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69510208G>A	uc004dyg.2	+						KIF4A_uc010nkw.2_5'UTR|PDZD11_uc004dyd.1_5'Flank|PDZD11_uc004dye.1_5'Flank|KIF4A_uc004dyf.1_Intron	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4						anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						GCTGAGGAGGGTCGGAACCGG	0.607													11	6	---	---	---	---	PASS
LOC643486	643486	broad.mit.edu	37	X	95592534	95592534	+	RNA	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95592534C>T	uc010nmx.2	-	1		c.368G>A				NR_003539				Homo sapiens cDNA FLJ42288 fis, clone TLIVE2006236.												0						CAAATGTCTCCGTACAGTTCC	0.388													5	42	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123197044	123197044	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123197044C>T	uc004etz.3	+	18	2149	c.1810C>T	c.(1810-1812)CGA>TGA	p.R604*	STAG2_uc004eua.2_Nonsense_Mutation_p.R604*|STAG2_uc004eub.2_Nonsense_Mutation_p.R604*|STAG2_uc004euc.2_Nonsense_Mutation_p.R604*|STAG2_uc004eud.2_Nonsense_Mutation_p.R604*|STAG2_uc004eue.2_Nonsense_Mutation_p.R604*	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	604					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TACCACTGGACGATTAGAAAA	0.289													43	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	1844	1844	+	5'Flank	SNP	A	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:1844A>G	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		ACTAACCCCTATACCTTCTGC	0.398													2	12	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2636	2636	+	5'Flank	SNP	G	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2636G>A	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		cctgtatgaatggctccacga	0.174													3	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	9440383	9440392	+	IGR	DEL	GGAGGAGGAG	-	-	rs60563844		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9440383_9440392delGGAGGAGGAG								SPSB1 (10795 upstream) : SLC25A33 (159136 downstream)																							aggaggaggaggaggaggagggaagaagaa	0.100													2	4	---	---	---	---	
MST1P2	11209	broad.mit.edu	37	1	16974141	16974141	+	RNA	DEL	G	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974141delG	uc009vow.2	+	5		c.951delG			CROCCL1_uc001azg.1_5'Flank|CROCCL1_uc001azi.1_5'Flank|MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_Intron|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_Intron|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_Intron|MST1P2_uc001azm.3_Intron					Homo sapiens cDNA FLJ53774 complete cds, moderately similar to Hepatocyte growth factor-like protein precursor.												0						TGGCTTGGCCGGGGAGGTCAG	0.667													5	4	---	---	---	---	
PABPC4	8761	broad.mit.edu	37	1	40035438	40035438	+	Intron	DEL	T	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40035438delT	uc010oiv.1	-						PABPC4_uc001cdl.2_Intron|PABPC4_uc001cdm.2_Intron|SNORA55_uc001cdo.1_5'Flank	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2						blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTCTGGAAACTCACTTGAAGC	0.448													55	42	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161570233	161570233	+	IGR	DEL	T	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161570233delT								FCGR2C (202 upstream) : HSPA7 (5616 downstream)																							gtattttttattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161716275	161716278	+	IGR	DEL	TTTC	-	-	rs71519230		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716275_161716278delTTTC								FCRLB (18343 upstream) : DUSP12 (3303 downstream)																							tctttctctttttctttctttctt	0.000													3	3	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766820	206766823	+	Intron	DEL	GAGC	-	-	rs141098886		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766820_206766823delGAGC	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			gagagagagagagcgcgagagaga	0.211													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293381	12293382	+	Intron	INS	-	TCCC	TCCC			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293381_12293382insTCCC	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		ccttccctccttccttccttcc	0.000													6	3	---	---	---	---	
DHX57	90957	broad.mit.edu	37	2	39085574	39085575	+	Intron	DEL	TG	-	-	rs144247886		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39085574_39085575delTG	uc002rrf.2	-						DHX57_uc002rre.2_Intron|DHX57_uc002rrg.2_Intron	NM_198963	NP_945314	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		all_hematologic(82;0.248)				CACATGACTCTGAGACTATTTG	0.327													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67812175	67812176	+	IGR	DEL	AG	-	-	rs2861649		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67812175_67812176delAG								ETAA1 (174642 upstream) : C1D (457157 downstream)																							acacacacacagacacaaaatc	0.000													3	3	---	---	---	---	
MCM6	4175	broad.mit.edu	37	2	136610223	136610223	+	Intron	DEL	A	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136610223delA	uc002tuw.2	-							NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	GCTGTTCCAGAAAAAAAAAAA	0.284													10	5	---	---	---	---	
MCM6	4175	broad.mit.edu	37	2	136624366	136624366	+	Intron	DEL	T	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136624366delT	uc002tuw.2	-							NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	ATAATCTAAATTAAATACCAC	0.353													45	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156126552	156126552	+	IGR	DEL	A	-	-	rs77418096		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156126552delA								KCNJ3 (413538 upstream) : None (None downstream)																							ccataatggcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
MARCH7	64844	broad.mit.edu	37	2	160616014	160616015	+	Intron	INS	-	T	T	rs34264670		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160616014_160616015insT	uc002uax.2	+						MARCH7_uc010foq.2_Intron|MARCH7_uc010zcn.1_Intron|MARCH7_uc010for.2_Intron|MARCH7_uc002uay.2_Intron	NM_022826	NP_073737	Q9H992	MARH7_HUMAN	axotrophin								ligase activity|zinc ion binding				0						GAATTTCataattttttttttt	0.277													7	6	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197122805	197122805	+	Intron	DEL	G	-	-	rs34136527		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197122805delG	uc002utm.1	-						HECW2_uc002utl.1_Intron|uc002utn.1_5'Flank	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						ttgccttcaaggggGGGGATC	0.219													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216402777	216402778	+	IGR	INS	-	CTA	CTA	rs138976228	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216402777_216402778insCTA								FN1 (101986 upstream) : MREG (404537 downstream)																							cttccttccttccttccttcct	0.188													10	6	---	---	---	---	
IL17RC	84818	broad.mit.edu	37	3	9969632	9969633	+	Intron	INS	-	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9969632_9969633insA	uc003bua.2	+						CIDEC_uc003bto.2_Intron|IL17RC_uc011ato.1_Intron|IL17RC_uc010hcs.2_Intron|IL17RC_uc003btz.2_Intron|IL17RC_uc011atp.1_Intron|IL17RC_uc003bud.2_Intron|IL17RC_uc003bub.2_Intron|IL17RC_uc010hct.2_Intron|IL17RC_uc010hcu.2_Intron|IL17RC_uc010hcv.2_Intron|IL17RC_uc011atq.1_Intron|IL17RC_uc003buc.2_Intron|IL17RC_uc003bue.2_5'Flank	NM_153461	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2						gactctatctcaaaaaaaaaaa	0.188													3	3	---	---	---	---	
TOP2B	7155	broad.mit.edu	37	3	25661230	25661231	+	Intron	DEL	AA	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25661230_25661231delAA	uc011awn.1	-						TOP2B_uc003cdj.2_Intron|TOP2B_uc011awm.1_Intron|TOP2B_uc010hff.1_Intron	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme						DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						GCAGGATGGGAAAAAAAAAAAA	0.356													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149701114	149701114	+	IGR	DEL	G	-	-	rs34404328		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149701114delG								PFN2 (12373 upstream) : TSC22D2 (425674 downstream)																							CCAGAGAGCCGGCCCCGGTAG	0.577													3	3	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171759174	171759175	+	Intron	DEL	TT	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171759174_171759175delTT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		tctttctttctttttctttctt	0.149													4	2	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173863884	173863903	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCC	-	-	rs72105654		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173863884_173863903delTTCCTTCCTTCCTTCCTTCC	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TTCTACTCTTttccttccttccttccttccttccttcctt	0.150													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117300449	117300449	+	IGR	DEL	T	-	-	rs34804858		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117300449delT								MIR1973 (79525 upstream) : TRAM1L1 (704267 downstream)																							CAGGCGCCAGTTTTTTTTTTT	0.473													4	3	---	---	---	---	
CCT5	22948	broad.mit.edu	37	5	10254505	10254505	+	Intron	DEL	T	-	-	rs140671145		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10254505delT	uc003jeq.2	+						CCT5_uc011cmq.1_Intron|CCT5_uc003jer.2_Intron|CCT5_uc010its.2_Intron|CCT5_uc011cmr.1_Intron|CCT5_uc011cms.1_Intron|CCT5_uc011cmt.1_Intron	NM_012073	NP_036205	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)						'de novo' posttranslational protein folding|response to virus	microtubule organizing center|nucleolus	ATP binding|unfolded protein binding			ovary(2)	2						AGGTCGGACCTTTTTTTTTTT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	10348953	10348954	+	IGR	INS	-	CACA	CACA	rs144328316	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10348953_10348954insCACA								CMBL (40785 upstream) : MARCH6 (4874 downstream)																							GTGTGTGTTGTcacacacacac	0.307													4	2	---	---	---	---	
MSH3	4437	broad.mit.edu	37	5	79950727	79950728	+	In_Frame_Ins	INS	-	CAGCGCCCC	CAGCGCCCC	rs1574197		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79950727_79950728insCAGCGCCCC	uc003kgz.2	+	1	434_435	c.181_182insCAGCGCCCC	c.(181-183)GCA>GCAGCGCCCCCA	p.67_68insAPP	DHFR_uc011ctl.1_5'Flank|DHFR_uc011ctm.1_5'Flank|DHFR_uc010jap.1_5'Flank|DHFR_uc003kgx.1_Intron|DHFR_uc003kgy.1_5'UTR	NM_002439	NP_002430	P20585	MSH3_HUMAN	mutS homolog 3	67_68					maintenance of DNA repeat elements|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|somatic recombination of immunoglobulin gene segments	MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|enzyme binding|loop DNA binding|Y-form DNA binding			lung(2)|ovary(1)|breast(1)	4		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		cgcagcggccgcagcgCCCCCA	0.584								MMR					12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	173747916	173747941	+	IGR	DEL	CTTCCTTCCTTCCTCCCCCCTTCCTT	-	-	rs62394091		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173747916_173747941delCTTCCTTCCTTCCTCCCCCCTTCCTT								HMP19 (211735 upstream) : MSX2 (403634 downstream)																							tccttccttgcttccttccttcctccccccttccttcttcctccct	0.049													4	2	---	---	---	---	
BTN2A1	11120	broad.mit.edu	37	6	26463977	26463979	+	Intron	DEL	TTG	-	-	rs71925201		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26463977_26463979delTTG	uc003nib.1	+						BTN2A1_uc003nic.1_Intron|BTN2A1_uc003nid.1_Intron|BTN2A1_uc011dko.1_Intron|BTN2A1_uc010jqk.1_5'Flank	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1						lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						AAACCtgtttttgttgttgttgt	0.315													4	2	---	---	---	---	
HLA-DPB1	3115	broad.mit.edu	37	6	33052581	33052592	+	Intron	DEL	AAAGAAAGAATG	-	-	rs9280308		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33052581_33052592delAAAGAAAGAATG	uc003ocu.1	+						HLA-DPB1_uc011dqo.1_Intron|HLA-DPB1_uc011dqp.1_Intron|HLA-DPB1_uc011dqq.1_Intron	NM_002121	NP_002112	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex				ovary(1)	1						atctcaaCAAaaagaaagaatgaaagaaagaa	0.052													5	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51854699	51854700	+	Intron	INS	-	A	A	rs144773405	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51854699_51854700insA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					aggaaggagggaggaaggaagg	0.119													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	73308509	73308510	+	IGR	INS	-	G	G			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73308509_73308510insG								RIMS1 (196002 upstream) : KCNQ5 (23061 downstream)																							CAGAAAATCGAGGGTTTTTTTT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	108418444	108418444	+	IGR	DEL	A	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108418444delA								OSTM1 (22503 upstream) : NR2E1 (68771 downstream)																							gaccctatctaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CDK19	23097	broad.mit.edu	37	6	111028019	111028020	+	Intron	INS	-	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111028019_111028020insA	uc003puh.1	-						CDK19_uc003pui.1_Intron	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						TTGATGTCTACAATATCACCTT	0.371													12	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	147225592	147225593	+	Intron	DEL	GT	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147225592_147225593delGT	uc003qls.1	-						uc003qlt.1_Intron|uc003qlu.1_Intron|uc003qlv.2_Intron					Homo sapiens cDNA FLJ34275 fis, clone FEBRA2003454.																		TTCTGTATCCgtgtgtgtgtgt	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	26119846	26119850	+	IGR	DEL	AAAGA	-	-	rs10591687		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26119846_26119850delAAAGA								MIR148A (130240 upstream) : NFE2L3 (71997 downstream)																							gaaaggaggGaaagaaaagaaaaga	0.298													4	2	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36465193	36465194	+	Intron	INS	-	TTAA	TTAA	rs144494427	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36465193_36465194insTTAA	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						gtgagccactgctcccggcTAA	0.104													4	5	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71571847	71571850	+	Intron	DEL	AGGA	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71571847_71571850delAGGA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				ggaaggaaggaggaaggaaggaag	0.000													4	2	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128317558	128317559	+	Intron	INS	-	AAAAA	AAAAA	rs10659136		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128317558_128317559insAAAAA	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						gactccgtctcaaaaaaaaaaa	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143126405	143126406	+	Intron	INS	-	TTT	TTT			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143126405_143126406insTTT	uc003wda.2	+											Homo sapiens mRNA; cDNA DKFZp686O0656 (from clone DKFZp686O0656).																		ATATCTTGTGGttttttttttt	0.153													4	3	---	---	---	---	
SORBS3	10174	broad.mit.edu	37	8	22426860	22426860	+	Intron	DEL	T	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22426860delT	uc003xbv.2	+						SORBS3_uc003xbw.3_Intron	NM_005775	NP_005766	O60504	VINEX_HUMAN	sorbin and SH3 domain containing 3 isoform 1						muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		CTAAAAACAGttttttttttt	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	55243464	55243464	+	IGR	DEL	A	-	-	rs35886430		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55243464delA								MRPL15 (182390 upstream) : SOX17 (127031 downstream)																							GTTTAGTTTGAAAAAAAAAAA	0.139													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	129986676	129986677	+	IGR	DEL	TG	-	-	rs78980975		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129986676_129986677delTG								MIR1208 (824242 upstream) : GSDMC (773766 downstream)																							GTGTATAGTTtgtgtgtgtgtg	0.238													4	3	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141843275	141843275	+	Intron	DEL	A	-	-	rs141534503		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141843275delA	uc003yvu.2	-						PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CAACTCCATTAAAAAAAAAAG	0.209													4	2	---	---	---	---	
ASTN2	23245	broad.mit.edu	37	9	119822864	119822865	+	Intron	INS	-	AGGA	AGGA	rs10983484		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119822864_119822865insAGGA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						ggaaagaaggcaggaaggaagg	0.015													2	7	---	---	---	---	
RAB14	51552	broad.mit.edu	37	9	123955710	123955710	+	Intron	DEL	A	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123955710delA	uc004blc.2	-							NM_016322	NP_057406	P61106	RAB14_HUMAN	GTPase Rab14						embryo development|fibroblast growth factor receptor signaling pathway|Golgi to endosome transport|neurotransmitter secretion|protein transport|small GTPase mediated signal transduction	cytosol|early endosome membrane|Golgi membrane|Golgi stack|late endosome|lysosome|membrane fraction|nuclear outer membrane-endoplasmic reticulum membrane network|perinuclear region of cytoplasm|rough endoplasmic reticulum|trans-Golgi network transport vesicle	GDP binding|GTP binding|GTPase activity				0						AAAAACAAAGAAATCTCTGTT	0.318													22	26	---	---	---	---	
C9orf171	389799	broad.mit.edu	37	9	135374262	135374263	+	Intron	INS	-	GCTGGAGGCA	GCTGGAGGCA			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135374262_135374263insGCTGGAGGCA	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300	Q6ZQR2	CI171_HUMAN	hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5						TGACCTAGCTCGCTGCTTGGCA	0.629													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36597752	36597752	+	IGR	DEL	A	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36597752delA								FZD8 (667390 upstream) : ANKRD30A (817033 downstream)																							gaaactctgtaaaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77089189	77089196	+	Intron	DEL	CTTCCTTT	-	-	rs4746286		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77089189_77089196delCTTCCTTT	uc001jxd.1	+											Homo sapiens cDNA FLJ13383 fis, clone PLACE1001024.																		tccttccttccttcctttctttctttct	0.000													4	2	---	---	---	---	
SBF2	81846	broad.mit.edu	37	11	10014370	10014371	+	Intron	INS	-	TG	TG	rs142364187	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10014370_10014371insTG	uc001mib.2	-						SBF2_uc001mif.3_Intron	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CTAAGATATTATGAGTTCCATA	0.238													4	2	---	---	---	---	
LRRC4C	57689	broad.mit.edu	37	11	40567635	40567638	+	Intron	DEL	CCTT	-	-	rs142316655	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40567635_40567638delCCTT	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				ttccttcctaccttccttccttcc	0.162													6	3	---	---	---	---	
SLC29A2	3177	broad.mit.edu	37	11	66131975	66131976	+	Intron	DEL	TT	-	-	rs34482391		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66131975_66131976delTT	uc001oht.2	-						SLC29A2_uc001ohs.2_Intron|SLC29A2_uc010rpb.1_Intron|SLC29A2_uc009yrf.2_Intron|SLC29A2_uc001ohu.2_Intron|SLC29A2_uc001ohv.2_Intron	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside						cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1						CATAGAGTACtttttttttttt	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	10392080	10392081	+	IGR	INS	-	CTT	CTT	rs143361134		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10392080_10392081insCTT								GABARAPL1 (16358 upstream) : KLRD1 (64969 downstream)																							ttccttccttccttcttccttc	0.045													4	2	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12317063	12317063	+	Intron	DEL	A	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317063delA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				gacaccgtttaaaaaaaaaaa	0.179													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	47145043	47145046	+	IGR	DEL	GAAA	-	-	rs10599924		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47145043_47145046delGAAA								SLC38A2 (378398 upstream) : SLC38A4 (13498 downstream)																							aggaaggaaggaaaggagggaggg	0.201													4	2	---	---	---	---	
VDR	7421	broad.mit.edu	37	12	48253630	48253649	+	Intron	DEL	TTCCTTCCTTCCTTCCTTCT	-	-	rs60761635		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48253630_48253649delTTCCTTCCTTCCTTCCTTCT	uc001rqm.2	-						VDR_uc001rql.2_Intron|VDR_uc001rqn.2_Intron|VDR_uc010slq.1_Intron	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor						decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	tttcccttccttccttccttccttccttctttccttcctt	0.036													8	4	---	---	---	---	
TARBP2	6895	broad.mit.edu	37	12	53895601	53895602	+	Intron	INS	-	C	C	rs138441746	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53895601_53895602insC	uc001sdo.2	+						MAP3K12_uc001sdm.1_5'Flank|MAP3K12_uc001sdn.1_5'Flank|TARBP2_uc009znb.2_Intron|TARBP2_uc001sdp.2_Intron|TARBP2_uc001sdq.2_Intron|TARBP2_uc001sdr.2_Intron|TARBP2_uc001sds.2_Intron|TARBP2_uc001sdt.2_Intron|TARBP2_uc001sdu.2_Intron|TARBP2_uc001sdv.2_Intron	NM_134323	NP_599150	Q15633	TRBP2_HUMAN	TAR RNA binding protein 2 isoform a						miRNA loading onto RISC involved in gene silencing by miRNA|negative regulation of defense response to virus by host|negative regulation of protein kinase activity|positive regulation of viral genome replication|pre-miRNA processing|production of siRNA involved in RNA interference|regulation of transcription from RNA polymerase II promoter|regulation of translation|regulation of viral transcription|targeting of mRNA for destruction involved in RNA interference	cytosol|nucleus|perinuclear region of cytoplasm|RNA-induced silencing complex	double-stranded RNA binding|protein homodimerization activity|siRNA binding			central_nervous_system(1)	1						AATGCATTCTTCCCCCCTTGCT	0.564													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	76082490	76082491	+	IGR	INS	-	T	T	rs141632958		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76082490_76082491insT								KRR1 (177072 upstream) : PHLDA1 (336737 downstream)																							cattctTTTTCTTTTTTTTTTT	0.218													9	4	---	---	---	---	
IKBIP	121457	broad.mit.edu	37	12	99008211	99008211	+	Intron	DEL	T	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99008211delT	uc001tfv.2	-						IKBIP_uc001tfw.2_Intron	NM_201612	NP_963906	Q70UQ0	IKIP_HUMAN	IKK interacting protein isoform 2						induction of apoptosis|response to X-ray	endoplasmic reticulum membrane|integral to membrane	protein binding				0						ttaattttaattttttttttg	0.085													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106420386	106420387	+	IGR	DEL	GA	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106420386_106420387delGA								C12orf75 (655091 upstream) : NUAK1 (36738 downstream)																							caaagagatggagagagagaga	0.000													6	3	---	---	---	---	
OAS3	4940	broad.mit.edu	37	12	113376543	113376544	+	Intron	INS	-	CAAAGGG	CAAAGGG	rs150451191	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113376543_113376544insCAAAGGG	uc001tug.2	+						OAS3_uc001tue.2_Intron|OAS3_uc001tuf.2_Intron	NM_006187	NP_006178	Q9Y6K5	OAS3_HUMAN	2'-5'oligoadenylate synthetase 3						interferon-gamma-mediated signaling pathway|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|type I interferon-mediated signaling pathway	microsome	ATP binding|nucleotidyltransferase activity|RNA binding			central_nervous_system(1)	1						CTTTATGTGTCCAAAGGGGAGT	0.594													4	2	---	---	---	---	
CCDC60	160777	broad.mit.edu	37	12	119957682	119957683	+	Intron	DEL	TA	-	-	rs71900111	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119957682_119957683delTA	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		tgtgtgtgtgtatacctgtgtg	0.168													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	57442685	57442688	+	IGR	DEL	CCTT	-	-	rs36154882		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57442685_57442688delCCTT								OTX2 (165501 upstream) : EXOC5 (226508 downstream)																							ATGTATTTAGccttccttccttcc	0.176													4	2	---	---	---	---	
CLMN	79789	broad.mit.edu	37	14	95657758	95657759	+	3'UTR	INS	-	C	C	rs60112171		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95657758_95657759insC	uc001yef.2	-	13						NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)		AAAAAAAAAAACCACAATAGCG	0.446													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	73723875	73723876	+	IGR	INS	-	CTTT	CTTT	rs113067423	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73723875_73723876insCTTT								HCN4 (62270 upstream) : C15orf60 (11623 downstream)																							ttccttccttcctttctttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	12021296	12021298	+	IGR	DEL	TGG	-	-	rs60347225		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12021296_12021298delTGG								GSPT1 (10777 upstream) : TNFRSF17 (37666 downstream)																							cgggtgatgatggttccacctca	0.158													4	2	---	---	---	---	
MYH11	4629	broad.mit.edu	37	16	15812999	15813000	+	Intron	INS	-	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15812999_15813000insT	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Intron|NDE1_uc002ddz.1_5'Flank	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						aaatttaaaaaataaaaTGGGG	0.287			T	CBFB	AML								9	13	---	---	---	---	
FAM18B	51030	broad.mit.edu	37	17	18682677	18682678	+	5'Flank	INS	-	T	T			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18682677_18682678insT	uc002gum.2	+							NM_016078	NP_057162	Q9NYZ1	F18B1_HUMAN	hypothetical protein LOC51030							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (53;0.0872)|READ - Rectum adenocarcinoma(1115;0.0967)		GCTATTTGGCCTTTTTTTTTTT	0.347													4	2	---	---	---	---	
TBC1D3P2	440452	broad.mit.edu	37	17	60347260	60347260	+	Intron	DEL	T	-	-	rs71934275		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60347260delT	uc002izq.2	-						TBC1D3P2_uc010woz.1_Intron|uc010wpa.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0						CTCTGAATGATTTTTTTTTTT	0.448													3	3	---	---	---	---	
GAA	2548	broad.mit.edu	37	17	78084941	78084941	+	Intron	DEL	C	-	-	rs12945868	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78084941delC	uc002jxo.2	+						GAA_uc002jxp.2_Intron|GAA_uc002jxq.2_Intron	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein						cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	GGGAAAGGGGCGGGGGGGGGA	0.632													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45293754	45293754	+	IGR	DEL	A	-	-	rs12457164		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45293754delA								IER3IP1 (591009 upstream) : SMAD2 (65713 downstream)																							agaaagaaagaaaggaaggaa	0.000													4	4	---	---	---	---	
ILVBL	10994	broad.mit.edu	37	19	15233202	15233210	+	Intron	DEL	GAGGAGGAA	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15233202_15233210delGAGGAGGAA	uc002nam.2	-						ILVBL_uc010dzw.2_Intron	NM_006844	NP_006835	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like							integral to membrane	magnesium ion binding|thiamine pyrophosphate binding|transferase activity			ovary(2)	2						aaggaagagggaggaggaagaggaggaag	0.067													4	2	---	---	---	---	
GDF1	2657	broad.mit.edu	37	19	18990120	18990122	+	In_Frame_Del	DEL	TCA	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18990120_18990122delTCA	uc002nki.1	-	5	900_902	c.828_830delTGA	c.(826-831)CCTGAC>CCC	p.D277del	LASS1_uc002nkj.2_In_Frame_Del_p.D277del|LASS1_uc010ebx.2_In_Frame_Del_p.D179del	NM_021267	NP_067090	P27539	GDF1_HUMAN	LAG1 homolog, ceramide synthase 1 isoform 1	Error:Variant_position_missing_in_P27539_after_alignment					growth	extracellular space	cytokine activity|growth factor activity				0						GAAGGGGATGTCAGGCACCGTGC	0.601													9	4	---	---	---	---	
SLC7A9	11136	broad.mit.edu	37	19	33351376	33351377	+	Intron	INS	-	A	A	rs5827823		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33351376_33351377insA	uc002ntv.3	-						SLC7A9_uc002ntt.3_Intron|SLC7A9_uc002ntu.3_Intron|SLC7A9_uc002ntw.3_5'UTR	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	gactctgtctcaaaaaaaaaaa	0.208													6	3	---	---	---	---	
CGB	1082	broad.mit.edu	37	19	49550508	49550508	+	Intron	DEL	T	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49550508delT	uc010yad.1	-							NM_033183	NP_149439	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 8						apoptosis|cell-cell signaling|cellular nitrogen compound metabolic process|female gamete generation|hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Choriogonadotropin alfa(DB00097)	tctttctttcttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53703995	53703995	+	IGR	DEL	T	-	-	rs113703393		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53703995delT								ZNF665 (7376 upstream) : ZNF677 (34643 downstream)																							TGTTTCCCCCttttttttttt	0.229													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31551795	31551800	+	IGR	DEL	TTCTCC	-	-			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31551795_31551800delTTCTCC								MAPRE1 (113585 upstream) : SUN5 (19782 downstream)																							ccttcctcctttctccttctccttct	0.000													4	5	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	52079973	52079984	+	Intron	DEL	GGAGGGAGGGAG	-	-	rs3971379	by1000genomes	TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52079973_52079984delGGAGGGAGGGAG	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			aaggaaggaaggagggagggagggaaggaagg	0.193													4	2	---	---	---	---	
PIGP	51227	broad.mit.edu	37	21	38439272	38439281	+	Intron	DEL	GTGTGTGTGT	-	-	rs112008084		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38439272_38439281delGTGTGTGTGT	uc002yvw.1	-						PIGP_uc002yvy.1_Intron|PIGP_uc002yvx.1_Intron	NM_153681	NP_710148	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity				0		Myeloproliferative disorder(46;0.0412)				TTTACTGTCCgtgtgtgtgtgtgtgtgtgt	0.133													3	5	---	---	---	---	
REPS2	9185	broad.mit.edu	37	X	17165779	17165780	+	3'UTR	INS	-	A	A			TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17165779_17165780insA	uc004cxv.1	+	18					REPS2_uc004cxw.1_3'UTR|REPS2_uc011miw.1_3'UTR	NM_004726	NP_004717	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					TACTGTGGTGGAAAAAATACTT	0.351													3	7	---	---	---	---	
APOO	79135	broad.mit.edu	37	X	23854742	23854743	+	Intron	INS	-	T	T	rs137891693		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23854742_23854743insT	uc004dax.2	-						APOO_uc004daw.2_Intron|APOO_uc004day.3_Intron	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor						lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0						AGCCTAATTTCTTTTTTTTTTT	0.183													4	3	---	---	---	---	
PAGE1	8712	broad.mit.edu	37	X	49458625	49458626	+	Intron	DEL	AC	-	-	rs72312865		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49458625_49458626delAC	uc004dom.2	-							NM_003785	NP_003776	O75459	GAGB1_HUMAN	P antigen family, member 1						cellular defense response					skin(1)	1	Ovarian(276;0.236)					AATGCATGAGacacacacacac	0.366													5	3	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101093049	101093049	+	Intron	DEL	A	-	-	rs66689050		TCGA-BP-4985-01A-01D-1462-08	TCGA-BP-4985-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093049delA	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ACCTGTGGGGAAAGCAGTGAG	0.577													4	6	---	---	---	---	
