Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16918783	16918783	+	5'UTR	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16918783C>T	uc009vos.1	-	6					NBPF1_uc010oce.1_5'UTR	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GTGAGGTAGACTGTGGCCAGC	0.507													3	10	---	---	---	---	PASS
CNR2	1269	broad.mit.edu	37	1	24201824	24201824	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24201824T>A	uc001bif.2	-	2	411	c.284A>T	c.(283-285)CAT>CTT	p.H95L		NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	95	Extracellular (Potential).				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)	ATGGAAAACATGGAAATTCAC	0.552													34	107	---	---	---	---	PASS
C1orf122	127687	broad.mit.edu	37	1	38274864	38274864	+	3'UTR	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38274864C>A	uc001ccd.2	+	3					YRDC_uc001cca.1_5'Flank|C1orf122_uc001ccb.1_3'UTR|C1orf122_uc010oii.1_3'UTR	NM_198446	NP_940848	Q6ZSJ8	CA122_HUMAN	hypothetical protein LOC127687 isoform 1												0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0393)				ACTTGGCTCTCAGCCTGGAGT	0.572													3	51	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39908131	39908131	+	Silent	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39908131C>A	uc010oiu.1	+	42	14456	c.14325C>A	c.(14323-14325)GCC>GCA	p.A4775A	MACF1_uc010ois.1_Silent_p.A4273A	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCCAGCATGCCTTAGAGGAAC	0.443													20	108	---	---	---	---	PASS
AK3L1	205	broad.mit.edu	37	1	65690445	65690445	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65690445A>G	uc001dby.2	+	5	696	c.449A>G	c.(448-450)GAC>GGC	p.D150G	AK3L1_uc009wan.2_Missense_Mutation_p.D98G|AK3L1_uc001dbz.2_Missense_Mutation_p.D150G|AK3L1_uc001dca.2_Missense_Mutation_p.D150G	NM_203464	NP_982289	P27144	KAD4_HUMAN	adenylate kinase 3-like 1 isoform 7	150						mitochondrial matrix	adenylate kinase activity|ATP binding|GTP binding				0						GGTATTGATGACGTCACTGGT	0.413													3	161	---	---	---	---	PASS
LPAR3	23566	broad.mit.edu	37	1	85331338	85331338	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85331338C>T	uc001dkl.2	-	1	505	c.466G>A	c.(466-468)GCC>ACC	p.A156T	LPAR3_uc009wcj.1_Missense_Mutation_p.A156T	NM_012152	NP_036284	Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	156	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane|intracellular membrane-bounded organelle				lung(3)|ovary(2)	5						ATAAAAATGGCGATGGCCCAG	0.542													6	316	---	---	---	---	PASS
SETDB1	9869	broad.mit.edu	37	1	150933321	150933321	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150933321G>A	uc001evu.2	+	16	2973	c.2783G>A	c.(2782-2784)CGG>CAG	p.R928Q	SETDB1_uc001evv.2_Missense_Mutation_p.R928Q|SETDB1_uc009wmg.1_Missense_Mutation_p.R928Q	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	928	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			TATGCTACCCGGAGGCAGACC	0.542													5	155	---	---	---	---	PASS
THEM4	117145	broad.mit.edu	37	1	151847232	151847232	+	3'UTR	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151847232G>A	uc001ezj.1	-	6					THEM4_uc001ezk.1_RNA	NM_053055	NP_444283	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4						insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|ruffle membrane					0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTTGTATTCAGAAGGCTGTTT	0.433													14	69	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183195848	183195848	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183195848A>C	uc001gqa.2	+	9	1396	c.1082A>C	c.(1081-1083)GAC>GCC	p.D361A	LAMC2_uc001gpz.3_Missense_Mutation_p.D361A|LAMC2_uc010poa.1_Missense_Mutation_p.D61A	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	361	Laminin IV type A.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						GGGTACATTGACAATGTGACC	0.478													44	161	---	---	---	---	PASS
EDEM3	80267	broad.mit.edu	37	1	184686148	184686148	+	Splice_Site	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184686148T>C	uc010pok.1	-	13	1507	c.1246_splice	c.e13-1	p.A416_splice	EDEM3_uc010pol.1_Splice_Site|EDEM3_uc010pom.1_Splice_Site_p.A416_splice	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1						TCCTGTAGCCTATTAAAAAGG	0.244													3	133	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241886621	241886621	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241886621G>T	uc001hze.1	+	9	1254	c.1047G>T	c.(1045-1047)TTG>TTT	p.L349F	WDR64_uc001hzf.1_Missense_Mutation_p.L69F			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;	349	WD 3.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TCATCCGGTTGTGGCACCCCA	0.443													36	74	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40657013	40657013	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40657013G>C	uc002rrx.2	-	1	432	c.408C>G	c.(406-408)AAC>AAG	p.N136K	SLC8A1_uc002rry.2_Missense_Mutation_p.N136K|SLC8A1_uc002rrz.2_Missense_Mutation_p.N136K|SLC8A1_uc002rsa.2_Missense_Mutation_p.N136K|SLC8A1_uc002rsd.3_Missense_Mutation_p.N136K|SLC8A1_uc002rsb.1_Missense_Mutation_p.N136K|SLC8A1_uc010fan.1_Missense_Mutation_p.N136K|SLC8A1_uc002rsc.1_Missense_Mutation_p.N136K	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	136	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TCAAGGTCAGGTTAGAAACTG	0.443													5	238	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44145201	44145201	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44145201T>A	uc002rtr.2	-	29	3169	c.3111A>T	c.(3109-3111)AAA>AAT	p.K1037N	LRPPRC_uc010yob.1_Missense_Mutation_p.K937N	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	1037	PPR 15.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCAATATATCTTTCTGGAAAT	0.413													31	60	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44187700	44187700	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44187700A>T	uc002rtr.2	-	13	1620	c.1562T>A	c.(1561-1563)TTA>TAA	p.L521*	LRPPRC_uc010yob.1_Nonsense_Mutation_p.L421*	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	521					mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TACAAAGTCTAAGTTCCCATT	0.363													5	254	---	---	---	---	PASS
NPHP1	4867	broad.mit.edu	37	2	110926096	110926096	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110926096G>T	uc002tfn.3	-	6	651	c.557C>A	c.(556-558)CCT>CAT	p.P186H	NPHP1_uc002tfm.3_Missense_Mutation_p.P186H|NPHP1_uc002tfl.3_Missense_Mutation_p.P186H|NPHP1_uc002tfo.3_Missense_Mutation_p.P124H|NPHP1_uc010ywx.1_Missense_Mutation_p.P186H|NPHP1_uc010fjv.1_Missense_Mutation_p.P186H	NM_207181	NP_997064	O15259	NPHP1_HUMAN	nephrocystin 1 isoform 2	186	SH3.				actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2						CCAACCATCAGGTTTTTTTTC	0.343													23	197	---	---	---	---	PASS
ARHGEF4	50649	broad.mit.edu	37	2	131704249	131704249	+	Intron	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131704249C>T	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc010fmx.1_Intron|ARHGEF4_uc002trz.1_Silent_p.I802I	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TACTCTGGATCCTGGCATGAA	0.522													16	92	---	---	---	---	PASS
ARHGAP15	55843	broad.mit.edu	37	2	143913197	143913197	+	Silent	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143913197C>T	uc002tvm.3	+	2	289	c.138C>T	c.(136-138)CTC>CTT	p.L46L	ARHGAP15_uc010zbl.1_Silent_p.L46L	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	46					regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		CCATGATCCTCACCGATGTCG	0.428													11	86	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155555946	155555946	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155555946A>C	uc002tyv.1	+	1	854	c.659A>C	c.(658-660)AAC>ACC	p.N220T	KCNJ3_uc010zce.1_Missense_Mutation_p.N220T	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	220	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	AACCTGCGCAACAGCCACATG	0.632													6	27	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168099752	168099752	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168099752C>A	uc002udx.2	+	8	1868	c.1850C>A	c.(1849-1851)ACC>AAC	p.T617N	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T442N|XIRP2_uc010fpq.2_Missense_Mutation_p.T395N|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	442	Xin 3.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GTGAAATATACCACATGGATG	0.438													44	62	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179634604	179634604	+	Nonsense_Mutation	SNP	C	A	A	rs143767300		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179634604C>A	uc010zfg.1	-	37	8928	c.8704G>T	c.(8704-8706)GAG>TAG	p.E2902*	TTN_uc010zfh.1_Nonsense_Mutation_p.E2856*|TTN_uc010zfi.1_Nonsense_Mutation_p.E2856*|TTN_uc010zfj.1_Nonsense_Mutation_p.E2856*|TTN_uc002unb.2_Nonsense_Mutation_p.E2902*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2902							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTCACACTCAAAAGAGGCA	0.388													27	208	---	---	---	---	PASS
BMPR2	659	broad.mit.edu	37	2	203407042	203407042	+	Missense_Mutation	SNP	G	T	T	rs146957466		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203407042G>T	uc002uzf.3	+	10	2433	c.1285G>T	c.(1285-1287)GTA>TTA	p.V429L	BMPR2_uc010ftr.2_Missense_Mutation_p.V429L	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II	429	Protein kinase.|Cytoplasmic (Potential).				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						AGGGGAATCCGTACCAGAGTA	0.393													35	101	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	6903262	6903262	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6903262A>C	uc003bqm.2	+	1	461	c.187A>C	c.(187-189)AGC>CGC	p.S63R	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.S63R|GRM7_uc003bql.2_Missense_Mutation_p.S63R	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	63	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	CAAGGGTCCCAGCGGAGTGCC	0.662													3	11	---	---	---	---	PASS
MTMR14	64419	broad.mit.edu	37	3	9724925	9724925	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9724925G>A	uc003brz.2	+	10	1085	c.961G>A	c.(961-963)GAT>AAT	p.D321N	MTMR14_uc003bsa.2_Missense_Mutation_p.D321N|MTMR14_uc003bsb.2_Missense_Mutation_p.D321N|MTMR14_uc011ath.1_RNA|MTMR14_uc010hcl.2_Missense_Mutation_p.D75N|MTMR14_uc003bsc.2_RNA	NM_001077525	NP_001070993	Q8NCE2	MTMRE_HUMAN	jumpy isoform 2	321						perinuclear region of cytoplasm|ruffle	phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(99;0.227)					AGTTAACAGTGATGGTGAGTC	0.478													24	39	---	---	---	---	PASS
CRTAP	10491	broad.mit.edu	37	3	33165912	33165912	+	Nonsense_Mutation	SNP	C	T	T	rs137853944		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33165912C>T	uc003cfl.3	+	3	754	c.634C>T	c.(634-636)CGA>TGA	p.R212*	CRTAP_uc010hfz.2_Nonsense_Mutation_p.R212*|CRTAP_uc003cfm.2_Nonsense_Mutation_p.R33*|CRTAP_uc003cfn.2_Nonsense_Mutation_p.R33*	NM_006371	NP_006362	O75718	CRTAP_HUMAN	cartilage associated protein precursor	212						proteinaceous extracellular matrix	binding				0						CCTGTTCATCCGAGCAGTGCG	0.537													6	84	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65346763	65346763	+	Intron	SNP	T	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65346763T>G	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_3'UTR|MAGI1_uc003dmp.2_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GAGAGGCTGGTAAGACACTGG	0.458													5	7	---	---	---	---	PASS
PVRL3	25945	broad.mit.edu	37	3	110837556	110837556	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110837556A>T	uc003dxt.1	+	3	556	c.556A>T	c.(556-558)AAT>TAT	p.N186Y	PVRL3_uc003dxu.1_Missense_Mutation_p.N163Y	NM_015480	NP_056295	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3 precursor	186	Extracellular (Potential).|Ig-like C2-type 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane	cell adhesion molecule binding|protein homodimerization activity			upper_aerodigestive_tract(2)	2						TGATGGAGGAAATGAAACAGT	0.378													17	37	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125876295	125876295	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125876295C>A	uc003eim.1	-	4	609	c.419G>T	c.(418-420)GGT>GTT	p.G140V	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'Flank|ALDH1L1_uc010hsf.1_Missense_Mutation_p.G166V|ALDH1L1_uc003eip.1_Missense_Mutation_p.G49V|ALDH1L1_uc011bkj.1_5'UTR	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	140	GART.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GGTGTCCAGACCATCATCCGC	0.572													3	116	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	126916008	126916008	+	Silent	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126916008T>C	uc003eji.1	+	2	720	c.480T>C	c.(478-480)ACT>ACC	p.T160T						RecName: Full=Putative uncharacterized protein C3orf56;																		GATGCTGGACTCCAGCCAGCT	0.617													7	36	---	---	---	---	PASS
PLOD2	5352	broad.mit.edu	37	3	145788846	145788846	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145788846C>T	uc003evs.1	-	18	2547	c.2041G>A	c.(2041-2043)GTG>ATG	p.V681M	PLOD2_uc003evq.1_Missense_Mutation_p.V362M|PLOD2_uc011bnm.1_Missense_Mutation_p.V647M|PLOD2_uc003evr.1_Missense_Mutation_p.V702M	NM_000935	NP_000926	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	681	Fe2OG dioxygenase.				protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)	TCTTCTCCCACGTTATTAAGT	0.343													19	56	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505830	195505830	+	Silent	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505830G>C	uc011bto.1	-	3	12697	c.12237C>G	c.(12235-12237)ACC>ACG	p.T4079T	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	970	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGCGTGAC	0.602													3	7	---	---	---	---	PASS
MAPK10	5602	broad.mit.edu	37	4	86985418	86985418	+	Splice_Site	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86985418C>T	uc003hpq.2	-	10	1177	c.1110_splice	c.e10+1	p.A370_splice	MAPK10_uc010ikg.2_Splice_Site_p.A332_splice|MAPK10_uc003hpr.2_Splice_Site_p.A332_splice|MAPK10_uc003hps.2_Splice_Site_p.A370_splice|MAPK10_uc003hpt.2_Splice_Site_p.A370_splice|MAPK10_uc003hpu.2_Splice_Site_p.A370_splice|MAPK10_uc003hpv.2_Splice_Site_p.A225_splice|MAPK10_uc003hpn.2_Splice_Site_p.A118_splice|MAPK10_uc003hpo.2_Splice_Site_p.A225_splice|MAPK10_uc011ccw.1_Splice_Site_p.A256_splice|MAPK10_uc003hpp.2_Splice_Site_p.A225_splice	NM_138982	NP_620448	P53779	MK10_HUMAN	mitogen-activated protein kinase 10 isoform 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		CTATTTCTTACCGCCTCCACT	0.428													7	180	---	---	---	---	PASS
MEPE	56955	broad.mit.edu	37	4	88766718	88766718	+	Missense_Mutation	SNP	C	A	A	rs141792959		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88766718C>A	uc003hqy.2	+	4	737	c.698C>A	c.(697-699)CCC>CAC	p.P233H	MEPE_uc010ikn.2_Missense_Mutation_p.P120H	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN	matrix, extracellular phosphoglycoprotein with	233					skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			ovary(1)|lung(1)|skin(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		AAAAAAATCCCCAGTGATTTT	0.418													4	124	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104053939	104053939	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104053939G>T	uc003hxb.1	-	42	6925	c.6835C>A	c.(6835-6837)CGT>AGT	p.R2279S	CENPE_uc003hxc.1_Missense_Mutation_p.R2158S	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	2279	Kinetochore-binding domain.|Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATATCAAAACGAGTATTTAAC	0.299													4	148	---	---	---	---	PASS
MYO10	4651	broad.mit.edu	37	5	16701663	16701663	+	Silent	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16701663G>A	uc003jft.3	-	25	3309	c.2841C>T	c.(2839-2841)TTC>TTT	p.F947F	MYO10_uc011cnc.1_5'Flank|MYO10_uc011cnd.1_Silent_p.F304F|MYO10_uc011cne.1_Silent_p.F304F|MYO10_uc010itx.2_Silent_p.F570F	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X	947					axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						CGATCTCGTCGAAATTGAGGG	0.632													19	33	---	---	---	---	PASS
ERCC8	1161	broad.mit.edu	37	5	60170366	60170366	+	3'UTR	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60170366T>C	uc003jsm.3	-	12					ERCC8_uc003jsk.2_RNA|ERCC8_uc003jsl.3_3'UTR|ERCC8_uc011cqp.1_3'UTR	NM_000082	NP_000073	Q13216	ERCC8_HUMAN	excision repair cross-complementing rodent						positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				CTGTCAGGAATAGACCATACA	0.323								Direct_reversal_of_damage|NER					5	33	---	---	---	---	PASS
WDR36	134430	broad.mit.edu	37	5	110434508	110434508	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110434508T>G	uc003kpd.2	+	4	665	c.548T>G	c.(547-549)ATT>AGT	p.I183S	WDR36_uc010jbu.2_RNA	NM_139281	NP_644810	Q8NI36	WDR36_HUMAN	WD repeat domain 36	183	WD 1.				response to stimulus|rRNA processing|visual perception	small-subunit processome				ovary(1)|skin(1)	2		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		ACTGATGGCATTCTTATTATT	0.313													26	155	---	---	---	---	PASS
PCDHA12	56137	broad.mit.edu	37	5	140256882	140256882	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140256882T>C	uc003lic.2	+	1	1952	c.1825T>C	c.(1825-1827)TAC>CAC	p.Y609H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc011daf.1_Missense_Mutation_p.Y609H	NM_018903	NP_061726	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12 isoform 1 precursor	609	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGGCTGTCCTACGAGTTGCA	0.667													14	67	---	---	---	---	PASS
DIAPH1	1729	broad.mit.edu	37	5	140954549	140954549	+	Silent	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140954549G>T	uc003llb.3	-	15	1767	c.1626C>A	c.(1624-1626)TCC>TCA	p.S542S	DIAPH1_uc003llc.3_Silent_p.S533S|DIAPH1_uc010jgc.1_5'Flank	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1	542	Potential.				regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTGAGCTGGGACACCTCTG	0.502													38	134	---	---	---	---	PASS
SLC36A1	206358	broad.mit.edu	37	5	150847399	150847399	+	Silent	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150847399G>A	uc003luc.2	+	7	853	c.636G>A	c.(634-636)AGG>AGA	p.R212R	GM2A_uc011dcs.1_Intron|SLC36A1_uc003lub.1_Silent_p.R212R|SLC36A1_uc010jhw.1_Silent_p.R212R	NM_078483	NP_510968	Q7Z2H8	S36A1_HUMAN	solute carrier family 36 member 1	212	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|ion transport	endoplasmic reticulum|integral to membrane|lysosomal membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			skin(1)	1		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)|all_neural(839;0.138)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Glycine(DB00145)|L-Alanine(DB00160)	TTTTCATCAGGAACCTCCGAG	0.532													4	148	---	---	---	---	PASS
ADAM19	8728	broad.mit.edu	37	5	156923994	156923994	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156923994A>T	uc003lwz.2	-	14	1566	c.1502T>A	c.(1501-1503)ATG>AAG	p.M501K	ADAM19_uc003lww.1_Missense_Mutation_p.M234K|ADAM19_uc003lwy.2_Missense_Mutation_p.M100K|ADAM19_uc011ddr.1_Missense_Mutation_p.M432K	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	501	Disintegrin.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGTACCATCCATCTGGTAGAA	0.637													5	35	---	---	---	---	PASS
MGAT4B	11282	broad.mit.edu	37	5	179225513	179225513	+	Silent	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179225513G>A	uc003mks.2	-	12	1791	c.1422C>T	c.(1420-1422)GAC>GAT	p.D474D	MGAT4B_uc003mkp.2_Silent_p.D328D|MGAT4B_uc003mkq.2_Nonsense_Mutation_p.Q250*|MGAT4B_uc003mkr.2_Silent_p.D489D|MIR1229_hsa-mir-1229|MI0006319_5'Flank	NM_014275	NP_055090	Q9UQ53	MGT4B_HUMAN	alpha-1,3-mannosyl-glycoprotein	474	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding				0	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGAACTTACGTCGAAGGGCA	0.607													18	49	---	---	---	---	PASS
FANCE	2178	broad.mit.edu	37	6	35423912	35423912	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35423912G>A	uc003oko.1	+	2	822	c.637G>A	c.(637-639)GGG>AGG	p.G213R	FANCE_uc010jvw.1_Missense_Mutation_p.G213R	NM_021922	NP_068741	Q9HB96	FANCE_HUMAN	Fanconi anemia, complementation group E	213	Interaction with FANCC.				DNA repair	nucleoplasm	protein binding			ovary(1)|lung(1)|skin(1)	3						CAGTCCTGAGGGGAAGAGGGT	0.557			N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				30	54	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74516670	74516670	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74516670A>C	uc003php.2	+	25	3489	c.3064A>C	c.(3064-3066)AAA>CAA	p.K1022Q	CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.K1022Q|CD109_uc010kba.2_Missense_Mutation_p.K945Q	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	1022						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						AGGACATCAGAAATCCAACGG	0.383													8	89	---	---	---	---	PASS
HECA	51696	broad.mit.edu	37	6	139488074	139488074	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139488074A>G	uc003qin.2	+	2	1210	c.925A>G	c.(925-927)AAG>GAG	p.K309E		NM_016217	NP_057301	Q9UBI9	HDC_HUMAN	headcase	309					respiratory tube development						0				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		GCCTCACAAGAAGGCCATGGC	0.602													3	109	---	---	---	---	PASS
UNC93A	54346	broad.mit.edu	37	6	167728871	167728871	+	Silent	SNP	C	T	T	rs138727128		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167728871C>T	uc003qvq.2	+	8	1480	c.1305C>T	c.(1303-1305)AAC>AAT	p.N435N	UNC93A_uc003qvr.2_Silent_p.N393N	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	435						integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGTCCAAGAACCCGATCAGAC	0.542													12	495	---	---	---	---	PASS
HIBADH	11112	broad.mit.edu	37	7	27570888	27570888	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27570888G>T	uc003szf.2	-	7	970	c.775C>A	c.(775-777)CCT>ACT	p.P259T	HIBADH_uc003szg.2_Missense_Mutation_p.P210T|HIBADH_uc003szh.2_Missense_Mutation_p.P158T	NM_152740	NP_689953	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase precursor	259					branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)	CCAGGTACAGGATTATAAGTG	0.443													42	92	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72398925	72398925	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72398925G>A	uc003twk.2	+	4	1025	c.1025G>A	c.(1024-1026)CGC>CAC	p.R342H	POM121_uc003twj.2_Missense_Mutation_p.R77H|POM121_uc010lam.1_Missense_Mutation_p.R77H	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	342	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				TGTCGCAGGCGCCATGATAGC	0.448													161	394	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100607872	100607872	+	RNA	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100607872G>A	uc003uxk.1	+	4		c.2403G>A			uc003uxl.1_Silent_p.A573A|uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		GCCAGGATGCGAACAGCTGCC	0.672													4	57	---	---	---	---	PASS
EMID2	136227	broad.mit.edu	37	7	101006350	101006350	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101006350T>G	uc010lhy.1	+	1	229	c.37T>G	c.(37-39)TGC>GGC	p.C13G	EMID2_uc003uyo.1_Missense_Mutation_p.C13G	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2	13						collagen				ovary(1)	1	Lung NSC(181;0.215)					GGCGTGTTGCTGCCTCTGCGG	0.751													2	1	---	---	---	---	PASS
KIAA1147	57189	broad.mit.edu	37	7	141364002	141364002	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141364002T>C	uc003vwk.2	-	8	1142	c.1142A>G	c.(1141-1143)TAC>TGC	p.Y381C		NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189	381										ovary(1)	1	Melanoma(164;0.0171)					ACAAGGGTTGTAGTCTTCTTC	0.572													3	13	---	---	---	---	PASS
MTMR9	66036	broad.mit.edu	37	8	11142463	11142463	+	Silent	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11142463C>T	uc003wtm.2	+	1	464	c.66C>T	c.(64-66)TAC>TAT	p.Y22Y	MTMR9_uc010lrx.2_5'UTR|MTMR9_uc011kxa.1_5'Flank	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	22						cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		GGCCTTTCTACCCGGCTGTCG	0.647													9	43	---	---	---	---	PASS
LONRF1	91694	broad.mit.edu	37	8	12598452	12598452	+	Silent	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12598452G>A	uc003wwd.1	-	3	957	c.894C>T	c.(892-894)GCC>GCT	p.A298A	LONRF1_uc010lsp.1_5'UTR	NM_152271	NP_689484	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger	298	TPR 4.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			ovary(1)	1				READ - Rectum adenocarcinoma(644;0.236)		AGAGTTGTAAGGCATCACCTA	0.363													8	308	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41791574	41791574	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41791574C>G	uc010lxb.2	-	18	4708	c.4164G>C	c.(4162-4164)CAG>CAC	p.Q1388H	MYST3_uc010lxc.2_Missense_Mutation_p.Q1388H|MYST3_uc003xon.3_Missense_Mutation_p.Q1388H	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1388					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			ACCCAGCCATCTGCTCTGACA	0.483													3	134	---	---	---	---	PASS
LRP12	29967	broad.mit.edu	37	8	105507335	105507335	+	Silent	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105507335A>T	uc003yma.2	-	6	1778	c.1683T>A	c.(1681-1683)GTT>GTA	p.V561V	LRP12_uc003ymb.2_Silent_p.V542V|LRP12_uc003ylz.2_5'UTR	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12	561	Cytoplasmic (Potential).				endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAAAATCTTCAACTGGTGGAA	0.358													46	160	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113323219	113323219	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323219G>A	uc003ynu.2	-	50	8032	c.7873C>T	c.(7873-7875)CCT>TCT	p.P2625S	CSMD3_uc003yns.2_Missense_Mutation_p.P1827S|CSMD3_uc003ynt.2_Missense_Mutation_p.P2585S|CSMD3_uc011lhx.1_Missense_Mutation_p.P2521S|CSMD3_uc003ynw.1_Missense_Mutation_p.P336S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2625	Extracellular (Potential).|Sushi 14.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TGACAGGCAGGGACTGGCGCA	0.433										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			26	114	---	---	---	---	PASS
CD274	29126	broad.mit.edu	37	9	5463001	5463001	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5463001G>A	uc003zje.2	+	4	614	c.562G>A	c.(562-564)GAG>AAG	p.E188K	C9orf46_uc003zjd.2_Intron|CD274_uc011lmb.1_Intron|CD274_uc010mhn.2_Intron|CD274_uc003zjf.2_Missense_Mutation_p.E74K	NM_014143	NP_054862	Q9NZQ7	PD1L1_HUMAN	CD274 molecule precursor	188	Ig-like C2-type.|Extracellular (Potential).				cell proliferation|cell surface receptor linked signaling pathway|immune response|T cell costimulation	endomembrane system|integral to membrane	receptor activity			lung(1)|central_nervous_system(1)	2	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		CAAGAGAGAGGAGAAGCTTTT	0.463			T	CIITA	PMBL|Hodgkin Lymphona|								6	116	---	---	---	---	PASS
PCSK5	5125	broad.mit.edu	37	9	78790192	78790192	+	Intron	SNP	C	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78790192C>G	uc004ajz.2	+						PCSK5_uc004ajy.2_Missense_Mutation_p.R683G|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3						ggaatggaatcgaatcgaatc	0.129													2	8	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79999563	79999563	+	Intron	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79999563T>C	uc004akr.2	+						VPS13A_uc004akq.3_Silent_p.D3084D|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						atgatgatgatgatgatgatg	0.269													19	63	---	---	---	---	PASS
CORO2A	7464	broad.mit.edu	37	9	100899899	100899899	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100899899G>C	uc004ayl.2	-	3	539	c.273C>G	c.(271-273)AAC>AAG	p.N91K	CORO2A_uc004aym.2_Missense_Mutation_p.N91K	NM_003389	NP_003380	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	91	WD 1.				actin cytoskeleton organization|intracellular signal transduction	actin cytoskeleton|transcriptional repressor complex	actin filament binding			skin(2)|ovary(1)|pancreas(1)	4		Acute lymphoblastic leukemia(62;0.0559)				CATCAAAAGGGTTCCACTTGA	0.557													37	160	---	---	---	---	PASS
PIP5KL1	138429	broad.mit.edu	37	9	130687392	130687392	+	Missense_Mutation	SNP	G	C	C	rs149767177	byFrequency	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130687392G>C	uc011mao.1	-	9	956	c.911C>G	c.(910-912)ACG>AGG	p.T304R	PIP5KL1_uc004bsu.2_Missense_Mutation_p.T101R	NM_001135219	NP_001128691	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	304	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			lung(1)|kidney(1)	2						TCACCTGGCCGTGCGGAAGAT	0.617													18	82	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73499530	73499530	+	Splice_Site	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73499530G>T	uc001jrx.3	+	34	4865	c.4488_splice	c.e34+1	p.Q1496_splice	C10orf105_uc001jsb.1_5'Flank|CDH23_uc001jsc.1_Splice_Site_p.Q303_splice	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CATCCTCCAGGTGGGGCCTGG	0.592													3	37	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134012456	134012456	+	Silent	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134012456C>A	uc009ybb.2	+	8	946	c.792C>A	c.(790-792)ATC>ATA	p.I264I		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	264					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CCGACGCCATCGCTCAGGCCA	0.672													5	42	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33565157	33565157	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33565157C>A	uc001mup.3	+	1	1281	c.1157C>A	c.(1156-1158)ACA>AAA	p.T386K	C11orf41_uc001mun.1_Missense_Mutation_p.T386K	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	386						integral to membrane				ovary(2)	2						GATTCCTTAACAATAGGAGAC	0.458											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	46	---	---	---	---	PASS
SSRP1	6749	broad.mit.edu	37	11	57102692	57102692	+	5'UTR	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57102692C>T	uc001njt.2	-	2					SSRP1_uc010rjq.1_5'UTR	NM_003146	NP_003137	Q08945	SSRP1_HUMAN	structure specific recognition protein 1						DNA repair|DNA replication|positive regulation of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|cytoplasm|nucleoplasm	DNA binding|protein binding			ovary(2)	2						AGTGGGTGTGCGGATGCTCAG	0.582													4	169	---	---	---	---	PASS
RSF1	51773	broad.mit.edu	37	11	77412360	77412360	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77412360A>T	uc001oyn.2	-	6	2034	c.1914T>A	c.(1912-1914)TGT>TGA	p.C638*	RSF1_uc001oym.2_Nonsense_Mutation_p.C386*	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	638					CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CTAGTTTCTCACAGTGGTCAA	0.438													115	237	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92531032	92531032	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92531032C>T	uc001pdj.3	+	9	4870	c.4853C>T	c.(4852-4854)CCG>CTG	p.P1618L		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	1618	Cadherin 15.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAGATCGAACCGGTCCTAGGC	0.423										TCGA Ovarian(4;0.039)			14	131	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	32976979	32976979	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32976979C>G	uc001rlj.3	-	8	1921	c.1806G>C	c.(1804-1806)AAG>AAC	p.K602N	PKP2_uc001rlk.3_Missense_Mutation_p.K558N|PKP2_uc010skj.1_Missense_Mutation_p.K558N	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	602	ARM 4.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CTTGAATTACCTTGTCATCTG	0.398													26	96	---	---	---	---	PASS
FKBP11	51303	broad.mit.edu	37	12	49315838	49315838	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49315838T>A	uc001rsp.2	-	6	654	c.535A>T	c.(535-537)AAG>TAG	p.K179*	FKBP11_uc010sma.1_Nonsense_Mutation_p.K77*|FKBP11_uc001rsq.3_3'UTR	NM_016594	NP_057678	Q9NYL4	FKB11_HUMAN	FK506 binding protein 11 isoform 1 precursor	179					protein folding	integral to membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						CTATTGGCCTTTCTGTATAGG	0.418													64	169	---	---	---	---	PASS
YEATS4	8089	broad.mit.edu	37	12	69764550	69764550	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69764550C>G	uc001sux.2	+	5	619	c.398C>G	c.(397-399)ACA>AGA	p.T133R		NM_006530	NP_006521	O95619	YETS4_HUMAN	glioma-amplified sequence-41	133					histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			GGGAAAAAGACAGTGGTTTCA	0.343													29	74	---	---	---	---	PASS
CCDC41	51134	broad.mit.edu	37	12	94772632	94772632	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94772632C>T	uc001tdd.2	-	7	1322	c.736G>A	c.(736-738)GAA>AAA	p.E246K	CCDC41_uc001tde.2_Missense_Mutation_p.E246K|CCDC41_uc009zsw.1_RNA|CCDC41_uc001tdf.2_Missense_Mutation_p.E246K	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	238	Potential.										0						TGGGCATTTTCCACCTGAGCC	0.433													48	277	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19433013	19433013	+	RNA	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19433013G>A	uc010tcj.1	-	1		c.13097C>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						CATGGAAAATGCTTGGGAGCA	0.353													28	101	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25284712	25284712	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25284712T>A	uc001upp.2	+	20	3065	c.2878T>A	c.(2878-2880)TTC>ATC	p.F960I	ATP12A_uc010aaa.2_Missense_Mutation_p.F966I	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	960	Cytoplasmic (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	GAATTCCATCTTCCAGCAGGG	0.423													51	149	---	---	---	---	PASS
OR4Q3	441669	broad.mit.edu	37	14	20216035	20216035	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20216035G>T	uc010tkt.1	+	1	449	c.449G>T	c.(448-450)TGG>TTG	p.W150L		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTTGCCTGCTGGTGTGGGGGT	0.498													19	102	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23886383	23886383	+	Missense_Mutation	SNP	G	A	A	rs45544633		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23886383G>A	uc001wjx.2	-	32	4604	c.4498C>T	c.(4498-4500)CGG>TGG	p.R1500W		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1500	Potential.		R -> P (in MPD1).		adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTGTTCTCCCGCTTGAAGGTC	0.597													6	256	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71462626	71462626	+	Silent	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71462626T>C	uc001xmo.2	+	8	3059	c.2613T>C	c.(2611-2613)AGT>AGC	p.S871S	PCNX_uc001xmn.3_Intron|PCNX_uc010are.1_Intron	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	871						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GCGGTAGCAGTTTGCACGATG	0.443													20	63	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92958092	92958092	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92958092C>T	uc001yak.2	+	15	1594	c.1570C>T	c.(1570-1572)CAG>TAG	p.Q524*	SLC24A4_uc001yai.2_Nonsense_Mutation_p.Q477*|SLC24A4_uc010twm.1_Nonsense_Mutation_p.Q522*|SLC24A4_uc001yaj.2_Nonsense_Mutation_p.Q505*|SLC24A4_uc010auj.2_Nonsense_Mutation_p.Q413*|SLC24A4_uc010twn.1_Nonsense_Mutation_p.Q297*|SLC24A4_uc001yan.2_Nonsense_Mutation_p.Q235*	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	541	Helical; (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GTGGGGCCTGCAGACCATGGT	0.512													16	107	---	---	---	---	PASS
ARHGAP11B	89839	broad.mit.edu	37	15	30938483	30938483	+	RNA	SNP	T	C	C	rs145453249	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30938483T>C	uc010azv.1	+	11		c.1293T>C			ARHGAP11B_uc001zeu.2_RNA			Q3KRB8	RHGBB_HUMAN	Homo sapiens cDNA, FLJ17072.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CCACCAGGCTTCTCCTTTCCC	0.463													5	32	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41815528	41815528	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41815528G>T	uc001zod.2	-	18	2585	c.2461C>A	c.(2461-2463)CTC>ATC	p.L821I	RPAP1_uc001zoc.2_5'UTR	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	821						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATGTCCTGGAGCCAATCCTCC	0.577													5	49	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48782117	48782117	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48782117C>A	uc001zwx.1	-	25	3341	c.3013G>T	c.(3013-3015)GAG>TAG	p.E1005*		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1005	TB 5.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CACAGCTCCTCGTACTCAGGA	0.537													25	136	---	---	---	---	PASS
SLC24A1	9187	broad.mit.edu	37	15	65945161	65945161	+	Intron	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65945161A>T	uc010ujf.1	+						SLC24A1_uc010ujd.1_3'UTR|SLC24A1_uc010uje.1_Intron|SLC24A1_uc010ujg.1_Intron|SLC24A1_uc010ujh.1_Intron|SLC24A1_uc010uji.1_Intron	NM_004727	NP_004718	O60721	NCKX1_HUMAN	solute carrier family 24						response to light intensity|visual perception	integral to plasma membrane|membrane fraction|outer membrane	calcium, potassium:sodium antiporter activity|protein binding|symporter activity				0						GTGGCAATGTAACTTTCTAAG	0.423													23	125	---	---	---	---	PASS
ZSCAN2	54993	broad.mit.edu	37	15	85147434	85147434	+	Silent	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85147434A>T	uc002bkr.2	+	2	502	c.276A>T	c.(274-276)GTA>GTT	p.V92V	ZSCAN2_uc002bkp.2_Silent_p.V92V|ZSCAN2_uc002bkq.2_Silent_p.V92V|ZSCAN2_uc010bmz.1_Silent_p.V91V|ZSCAN2_uc010bna.2_Intron|ZSCAN2_uc010uox.1_Silent_p.V91V|ZSCAN2_uc010uoy.1_Silent_p.V91V|ZSCAN2_uc010uoz.1_Silent_p.V91V	NM_181877	NP_870992	Q7Z7L9	ZSCA2_HUMAN	zinc finger protein 29 isoform 1	92	SCAN box.				cell differentiation|multicellular organismal development|spermatogenesis|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		GACCAGAGGTACACACCAAGG	0.642													3	24	---	---	---	---	PASS
RUNDC2A	84127	broad.mit.edu	37	16	12146122	12146122	+	3'UTR	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12146122G>A	uc002dbw.1	+	8					SNX29_uc002dby.3_Intron	NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A											ovary(1)	1						cccccaggctggagtgccgtg	0.189			T	CIITA	PMBL|Hodgkin Lymphona|								3	22	---	---	---	---	PASS
SYT17	51760	broad.mit.edu	37	16	19236053	19236053	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19236053C>A	uc002dfw.2	+	7	1452	c.1121C>A	c.(1120-1122)ACC>AAC	p.T374N	SYT17_uc002dfx.2_Missense_Mutation_p.T313N|SYT17_uc002dfy.2_Missense_Mutation_p.T370N|SYT17_uc002dfv.1_Missense_Mutation_p.T313N	NM_016524	NP_057608	Q9BSW7	SYT17_HUMAN	B/K protein	374	C2 2.					membrane|synaptic vesicle	transporter activity			ovary(1)	1						CTTGTGAAAACCAAGAAGACG	0.423													4	188	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27523128	27523128	+	Silent	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27523128T>C	uc002dov.1	-	7	1108	c.1068A>G	c.(1066-1068)ACA>ACG	p.T356T	GTF3C1_uc002dou.2_Silent_p.T356T	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	356						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						CTGGAGGCACTGTCTTGGAGA	0.527													39	92	---	---	---	---	PASS
ZNF267	10308	broad.mit.edu	37	16	31927436	31927436	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31927436T>G	uc002ecs.3	+	4	2075	c.1866T>G	c.(1864-1866)CAT>CAG	p.H622Q		NM_003414	NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	622	C2H2-type 11.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						TTATTCAGCATCGGAGAATTC	0.423													32	95	---	---	---	---	PASS
DUS2L	54920	broad.mit.edu	37	16	68109279	68109279	+	Silent	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68109279C>A	uc002evi.2	+	14	1103	c.954C>A	c.(952-954)GCC>GCA	p.A318A	DUS2L_uc002evj.2_Silent_p.A318A|DUS2L_uc010vkk.1_Silent_p.A283A|DUS2L_uc010cez.2_Silent_p.A231A	NM_017803	NP_060273	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2-like, SMM1 homolog	318					tRNA processing	endoplasmic reticulum	double-stranded RNA binding|flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0131)|Epithelial(162;0.0564)		GCCTTGGTGCCTTCTATGAGG	0.592													30	96	---	---	---	---	PASS
ZNF19	7567	broad.mit.edu	37	16	71509286	71509286	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71509286A>T	uc010cgc.1	-	6	1670	c.1164T>A	c.(1162-1164)GAT>GAA	p.D388E	ZNF23_uc002fai.2_Intron|ZNF19_uc002fak.1_Missense_Mutation_p.D376E|ZNF19_uc002fal.1_Missense_Mutation_p.D376E|ZNF19_uc002fam.1_Missense_Mutation_p.D388E	NM_006961	NP_008892	P17023	ZNF19_HUMAN	zinc finger protein 19	388	C2H2-type 9.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(137;0.00965)		BRCA - Breast invasive adenocarcinoma(221;0.0161)|Kidney(780;0.0598)		TTCCACACTCATCACATACAT	0.408													5	203	---	---	---	---	PASS
CCDC144NL	339184	broad.mit.edu	37	17	20768623	20768623	+	3'UTR	SNP	A	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768623A>G	uc002gyf.2	-	4						NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						CAGTTTAATAAAAGAGTTCAT	0.308													3	18	---	---	---	---	PASS
USP22	23326	broad.mit.edu	37	17	20911265	20911265	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20911265C>T	uc002gym.3	-	9	1352	c.1148G>A	c.(1147-1149)TGC>TAC	p.C383Y	USP22_uc002gyn.3_Missense_Mutation_p.C371Y|USP22_uc002gyl.3_Missense_Mutation_p.C278Y	NM_015276	NP_056091	Q9UPT9	UBP22_HUMAN	ubiquitin thiolesterase 22	383					cell cycle|embryo development|histone deubiquitination|histone H4 acetylation|histone ubiquitination|positive regulation of mitotic cell cycle|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	SAGA complex	ligand-dependent nuclear receptor transcription coactivator activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)	1						GCAACCGCTGCACTTGATCTT	0.483													33	102	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32954049	32954049	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32954049G>A	uc002hif.2	+	3	1029	c.701G>A	c.(700-702)AGC>AAC	p.S234N		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	234	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		TCGCCCTCCAGCCCCAGCGTG	0.602													21	91	---	---	---	---	PASS
PEX12	5193	broad.mit.edu	37	17	33905215	33905215	+	5'UTR	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33905215G>A	uc002hjp.2	-	1						NM_000286	NP_000277	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12						protein import into peroxisome matrix	integral to peroxisomal membrane	protein C-terminus binding|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAAAAGACCTGGAGGCCGAGG	0.443													7	5	---	---	---	---	PASS
WIPF2	147179	broad.mit.edu	37	17	38420931	38420931	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38420931C>T	uc002hug.1	+	5	743	c.503C>T	c.(502-504)ACG>ATG	p.T168M	WIPF2_uc002huh.1_Missense_Mutation_p.T18M|WIPF2_uc010cww.1_Missense_Mutation_p.T18M|WIPF2_uc002hui.1_Missense_Mutation_p.T168M|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Missense_Mutation_p.T168M	NM_133264	NP_573571	Q8TF74	WIPF2_HUMAN	WIRE protein	168						cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3						ACCAGCAGTACGGGCATGAAG	0.647										HNSCC(43;0.11)			23	135	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42333125	42333125	+	Silent	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42333125G>A	uc002igf.3	-	14	1865	c.1716C>T	c.(1714-1716)CTC>CTT	p.L572L		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member	572	Involved in anion transport.|Membrane (anion exchange).|Helical; (Potential).				bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CAAGGGAGAGGAGGGCTGTGT	0.537													40	207	---	---	---	---	PASS
POLG2	11232	broad.mit.edu	37	17	62479086	62479086	+	Missense_Mutation	SNP	T	C	C	rs146731596		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62479086T>C	uc002jei.2	-	6	1224	c.1141A>G	c.(1141-1143)ATT>GTT	p.I381V		NM_007215	NP_009146	Q9UHN1	DPOG2_HUMAN	DNA polymerase subunit gamma-2, mitochondrial	381					DNA repair|DNA-dependent DNA replication|glycyl-tRNA aminoacylation	mitochondrial chromosome	ATP binding|DNA-directed DNA polymerase activity|glycine-tRNA ligase activity|identical protein binding|single-stranded DNA binding			central_nervous_system(1)	1	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			GCAACCTTAATAGGGGCTAAA	0.348													28	119	---	---	---	---	PASS
NOL11	25926	broad.mit.edu	37	17	65718733	65718733	+	Missense_Mutation	SNP	T	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65718733T>G	uc002jgd.1	+	5	502	c.499T>G	c.(499-501)TTA>GTA	p.L167V	NOL11_uc010wql.1_Intron|NOL11_uc010deu.1_5'UTR	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	167						nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			ACATCCTGTTTTAATTTTTAT	0.249													17	68	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76831407	76831407	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76831407G>C	uc002jvz.1	-	4	755	c.430C>G	c.(430-432)CCA>GCA	p.P144A	USP36_uc002jwa.1_Missense_Mutation_p.P144A|USP36_uc002jwd.1_Missense_Mutation_p.P144A	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	144					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GCTAGAGGTGGTGTGTAGGTC	0.582													4	65	---	---	---	---	PASS
ABHD3	171586	broad.mit.edu	37	18	19236788	19236788	+	Intron	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19236788C>A	uc002ktl.2	-						ABHD3_uc002ktm.2_Intron|ABHD3_uc002ktk.2_Intron|ABHD3_uc002ktn.2_3'UTR	NM_138340	NP_612213	Q8WU67	ABHD3_HUMAN	alpha/beta hydrolase domain containing protein							integral to membrane	carboxylesterase activity			central_nervous_system(1)	1						AAAGTTGATTCATGTCAAAAT	0.264													5	56	---	---	---	---	PASS
TTC39C	125488	broad.mit.edu	37	18	21698098	21698098	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21698098G>A	uc002kuw.2	+	8	1540	c.1088G>A	c.(1087-1089)AGC>AAC	p.S363N	TTC39C_uc002kuu.2_Missense_Mutation_p.S302N	NM_001135993	NP_001129465	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C isoform 1	363	TPR 2.						binding			ovary(1)	1						GGTTGGTGCAGCATGATAGAG	0.423													3	102	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2229790	2229790	+	Nonstop_Mutation	SNP	A	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2229790A>C	uc002lvb.3	+	28	4649	c.4613A>C	c.(4612-4614)TAG>TCG	p.*1538S	DOT1L_uc002lvc.1_3'UTR	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	1538						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGGTAACTAGGATTTCTAC	0.677													40	157	---	---	---	---	PASS
ZNF77	58492	broad.mit.edu	37	19	2933523	2933523	+	Silent	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2933523C>T	uc002lws.3	-	4	1733	c.1602G>A	c.(1600-1602)TCG>TCA	p.S534S		NM_021217	NP_067040	Q15935	ZNF77_HUMAN	zinc finger protein 77	534	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGCTTGAAGCGATGCGAGAT	0.483													5	252	---	---	---	---	PASS
RANBP3	8498	broad.mit.edu	37	19	5957974	5957974	+	Silent	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5957974G>C	uc002mdw.2	-	2	260	c.33C>G	c.(31-33)GCC>GCG	p.A11A	RANBP3_uc002mdx.2_Silent_p.A11A|RANBP3_uc002mdy.2_Silent_p.A11A|RANBP3_uc002mdz.2_Silent_p.A11A|RANBP3_uc010duq.2_5'UTR|RANBP3_uc002mea.2_Intron|RANBP3_uc010xix.1_Intron	NM_007322	NP_015561	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3 isoform RANBP3-d	11					intracellular transport|protein transport	cytoplasm|nucleus	Ran GTPase binding			breast(1)	1						GCGGAGCAATGGCAGGCTTTT	0.378													10	143	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17003921	17003921	+	Nonstop_Mutation	SNP	A	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17003921A>C	uc002nfb.2	-	42	5829	c.5797T>G	c.(5797-5799)TAA>GAA	p.*1933E	CPAMD8_uc010xpj.1_3'UTR|CPAMD8_uc002nfd.1_3'UTR	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1933						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						ttgtaggattatctcaaGGTG	0.274													6	23	---	---	---	---	PASS
MAP1S	55201	broad.mit.edu	37	19	17845254	17845254	+	3'UTR	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17845254C>A	uc002nhe.1	+	7					MAP1S_uc010eba.1_Intron|MAP1S_uc002nhf.1_3'UTR|MAP1S_uc010xpv.1_3'UTR	NM_018174	NP_060644	Q66K74	MAP1S_HUMAN	BPY2 interacting protein 1						apoptosis|brain development|microtubule bundle formation|mitochondrion transport along microtubule|neuron projection morphogenesis	cytosol|dendrite|microtubule|neuronal cell body|nucleus|perinuclear region of cytoplasm|spindle|synapse	actin filament binding|beta-tubulin binding|DNA binding|microtubule binding			central_nervous_system(1)	1						CGCCGACACGCCCCCCACTCA	0.592													9	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	20975384	20975384	+	RNA	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20975384G>C	uc002npe.2	+	2		c.245G>C								Homo sapiens zinc finger protein 66, mRNA (cDNA clone MGC:87430 IMAGE:5270688), complete cds.																		CCTGGACATGGCACAGCGGAA	0.388													57	118	---	---	---	---	PASS
RTN2	6253	broad.mit.edu	37	19	45997672	45997672	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45997672T>C	uc002pcb.2	-	4	794	c.566A>G	c.(565-567)GAC>GGC	p.D189G	RTN2_uc002pcc.2_Missense_Mutation_p.D189G|RTN2_uc002pcd.2_RNA	NM_005619	NP_005610	O75298	RTN2_HUMAN	reticulon 2 isoform A	189						integral to endoplasmic reticulum membrane	signal transducer activity			ovary(3)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		GAGTCGTAGGTCCAGTTCTGA	0.622													13	110	---	---	---	---	PASS
ZNF841	284371	broad.mit.edu	37	19	52570738	52570738	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52570738C>A	uc002pyl.1	-	5	601	c.49G>T	c.(49-51)GAA>TAA	p.E17*	ZNF841_uc010ydh.1_Nonsense_Mutation_p.E133*|ZNF841_uc010epk.1_Nonsense_Mutation_p.E17*	NM_001136499	NP_001129971	Q6ZN19	ZN841_HUMAN	zinc finger protein 841	17					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCCGGATTTCCCTGAAGTAA	0.368													5	19	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52618234	52618234	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52618234C>T	uc002pym.2	-	4	2466	c.2183G>A	c.(2182-2184)CGG>CAG	p.R728Q	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	728	C2H2-type 20.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		GGAAAACAACCGCCCAAAGGC	0.408													74	243	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57325778	57325778	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57325778G>C	uc002qnu.2	-	7	4383	c.4032C>G	c.(4030-4032)AGC>AGG	p.S1344R	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.S1315R|PEG3_uc002qnv.2_Missense_Mutation_p.S1344R|PEG3_uc002qnw.2_Missense_Mutation_p.S1220R|PEG3_uc002qnx.2_Missense_Mutation_p.S1218R|PEG3_uc010etr.2_Missense_Mutation_p.S1344R	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1344	C2H2-type 10.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGAGGACTGTGCTATGAATAA	0.373													22	134	---	---	---	---	PASS
PABPC1L	80336	broad.mit.edu	37	20	43545506	43545506	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43545506G>A	uc010ggv.1	+	3	579	c.497G>A	c.(496-498)CGC>CAC	p.R166H	PABPC1L_uc010zwq.1_RNA	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	166	RRM 2.						nucleotide binding|RNA binding			ovary(1)	1						CTGAATGACCGCAAAGTGTGA	0.592													4	180	---	---	---	---	PASS
ZNFX1	57169	broad.mit.edu	37	20	47887879	47887879	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47887879G>C	uc002xui.2	-	3	717	c.470C>G	c.(469-471)CCT>CGT	p.P157R		NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	157							metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CACCTCAGAAGGGTCTTTCTG	0.488													61	211	---	---	---	---	PASS
C20orf106	200232	broad.mit.edu	37	20	55101052	55101052	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55101052C>T	uc002xxx.2	+	2	522	c.442C>T	c.(442-444)CGA>TGA	p.R148*	GCNT7_uc010zzg.1_5'Flank|C20orf107_uc010zzh.1_Intron	NM_001012971	NP_001012989	Q5JX71	CT106_HUMAN	hypothetical protein LOC200232 precursor	148	Cytoplasmic (Potential).					integral to membrane					0			Colorectal(105;0.202)			CCTCAGGCTTCGAAAGTCAGA	0.453													25	124	---	---	---	---	PASS
TCEA2	6919	broad.mit.edu	37	20	62703549	62703549	+	3'UTR	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62703549T>C	uc011abs.1	+	10					TCEA2_uc011abr.1_3'UTR|TCEA2_uc010gks.2_3'UTR	NM_003195	NP_003186	Q15560	TCEA2_HUMAN	transcription elongation factor A protein 2						regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription elongation, DNA-dependent	transcription elongation factor complex	DNA binding|protein binding|translation elongation factor activity|zinc ion binding				0	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					CGTGTAGATGTGCTGCAGCCT	0.642													27	154	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21075676	21075676	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21075676C>T	uc002zsz.3	-	43	5083	c.4852G>A	c.(4852-4854)GCA>ACA	p.A1618T	PI4KA_uc010gsp.2_Missense_Mutation_p.A11T|PI4KA_uc002zsy.3_Missense_Mutation_p.A428T	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1618					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TTAGACGCTGCCCACAGAATA	0.532													49	171	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37462221	37462221	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37462221C>G	uc003aqs.1	-	18	2449	c.2335G>C	c.(2335-2337)GGG>CGG	p.G779R	TMPRSS6_uc003aqt.1_Missense_Mutation_p.G792R	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	779	Peptidase S1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						CTGACCAGCCCCGCCAGGAAC	0.622													15	31	---	---	---	---	PASS
NAGA	4668	broad.mit.edu	37	22	42456227	42456227	+	3'UTR	SNP	G	A	A			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42456227G>A	uc003bbx.2	-	10					NAGA_uc003bby.2_3'UTR|NAGA_uc003bbw.3_3'UTR	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor						glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						GGCATGCCAAGGCTCCATGGT	0.582													36	78	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13215	13215	+	RNA	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13215T>C	uc004cox.3	+	1		c.879T>C			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		GTCTGCGCCCTTACACAAAAT	0.458													4	1	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15774	15774	+	3'UTR	SNP	T	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15774T>C	uc004coy.2	+	1					uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		AGGACAACCAGTAAGCTACCC	0.398													2	6	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31531828	31531829	+	Intron	INS	-	AATG	AATG			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31531828_31531829insAATG	uc001bsi.1	-						PUM1_uc001bsh.1_Intron|PUM1_uc001bsj.1_Intron|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Intron|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		actctgtctcaaatgaatgaat	0.119													4	3	---	---	---	---	
RAB3B	5865	broad.mit.edu	37	1	52398850	52398850	+	Intron	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52398850delT	uc001cth.2	-							NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						TATAAAACAATACACACAGAT	0.318													41	23	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57537755	57537755	+	Intron	DEL	C	-	-	rs12718424	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57537755delC	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						aaaaaaaaaacagaaaaaaCT	0.333													6	3	---	---	---	---	
FAM63A	55793	broad.mit.edu	37	1	150972560	150972560	+	Intron	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150972560delT	uc001ewf.2	-						FAM63A_uc001ewc.2_Intron|FAM63A_uc010pcm.1_Intron|FAM63A_uc001ewd.2_Intron|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Intron|FAM63A_uc001ewg.2_Intron	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1								protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCCTAAACACTTTTTTTTTTT	0.254													3	3	---	---	---	---	
TIA1	7072	broad.mit.edu	37	2	70441765	70441773	+	Intron	DEL	AAAAAAAAA	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70441765_70441773delAAAAAAAAA	uc002sgj.3	-						TIA1_uc002sgk.3_Intron|TIA1_uc002sgl.3_Intron	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding						apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						GTTGACTGCTaaaaaaaaaaaaaaaaaaa	0.306													4	2	---	---	---	---	
GGCX	2677	broad.mit.edu	37	2	85787730	85787730	+	Intron	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85787730delA	uc002sps.2	-						GGCX_uc010yss.1_5'Flank|GGCX_uc010yst.1_Intron	NM_000821	NP_000812	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase isoform 1						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification	endoplasmic reticulum membrane|integral to membrane|membrane fraction	gamma-glutamyl carboxylase activity			ovary(1)	1					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|L-Glutamic Acid(DB00142)|Menadione(DB00170)|Phytonadione(DB01022)	ccgtctaaggaaaaaaaaaaa	0.174													4	2	---	---	---	---	
USP39	10713	broad.mit.edu	37	2	85871847	85871847	+	Intron	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85871847delT	uc002sqe.2	+						USP39_uc002sqb.2_Intron|USP39_uc010ysu.1_Intron|USP39_uc010ysv.1_Intron|USP39_uc010fgn.1_Intron|USP39_uc002sqf.2_Intron|USP39_uc002sqg.2_Intron|USP39_uc010fgo.2_Intron	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39						spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						cCTGTCATTCTTTTTTTTTTT	0.199													4	2	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179480965	179480965	+	Intron	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179480965delT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGTAGGGAATTTTTTTTTTT	0.368													4	2	---	---	---	---	
NCL	4691	broad.mit.edu	37	2	232325998	232325998	+	Intron	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325998delA	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		aaaaaaatttaaaaaaaaaaa	0.119													9	4	---	---	---	---	
SETD2	29072	broad.mit.edu	37	3	47084168	47084175	+	Frame_Shift_Del	DEL	TTATTTGT	-	-	rs114833216	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47084168_47084175delTTATTTGT	uc003cqs.2	-	17	7167_7174	c.7114_7121delACAAATAA	c.(7114-7122)ACAAATAATfs	p.T2372fs	SETD2_uc003cqv.2_Frame_Shift_Del_p.T2439fs|SETD2_uc003cqr.2_5'UTR	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2372_2374					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATCCAAGAGATTATTTGTCACAACCATT	0.413			N|F|S|Mis		clear cell renal carcinoma								166	81	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52623121	52623122	+	Frame_Shift_Del	DEL	AT	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52623121_52623122delAT	uc003des.2	-	18	2941_2942	c.2929_2930delAT	c.(2929-2931)ATCfs	p.I977fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.I977fs|PBRM1_uc003der.2_Frame_Shift_Del_p.I945fs|PBRM1_uc003det.2_Frame_Shift_Del_p.I992fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.I992fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.I977fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.I977fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.I977fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.I976fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.I889fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.I323fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	977	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AATACAGACGATATGTGGTTGT	0.426			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								165	143	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	115529069	115529070	+	IGR	DEL	TC	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115529069_115529070delTC								LSAMP (5051 upstream) : LOC285194 (899565 downstream)																							GTCTCCCCCAtctctctctctc	0.228													4	2	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494432	195494434	+	Intron	DEL	TTG	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494432_195494434delTTG	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		accattaccattgccaccaccat	0.000													5	3	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41689701	41689701	+	Intron	DEL	A	-	-	rs5857811		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41689701delA	uc003gvu.3	+						LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_Intron|LIMCH1_uc003gvz.3_Intron|LIMCH1_uc011byu.1_Intron|LIMCH1_uc003gwc.3_Intron|LIMCH1_uc003gwd.3_Intron|LIMCH1_uc011byv.1_Intron|LIMCH1_uc011byw.1_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						TTTGTTCATTAAAAAAAAAAA	0.289													4	2	---	---	---	---	
TBCK	93627	broad.mit.edu	37	4	107092559	107092560	+	Intron	INS	-	A	A	rs142249370	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107092559_107092560insA	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						AAAATGTCAGTAAAAAAAACAA	0.233													4	7	---	---	---	---	
CLTB	1212	broad.mit.edu	37	5	175820062	175820063	+	Intron	INS	-	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175820062_175820063insC	uc003meh.2	-						CLTB_uc003mei.2_Intron|CLTB_uc011dfn.1_Intron	NM_007097	NP_009028	P09497	CLCB_HUMAN	clathrin, light polypeptide isoform b						intracellular protein transport|vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle	protein binding|structural molecule activity				0	all_cancers(89;0.00522)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.098)		CCAGCCTTGTGCCCCCCTGACT	0.441													42	20	---	---	---	---	
LAMA2	3908	broad.mit.edu	37	6	129468410	129468410	+	Intron	DEL	T	-	-	rs66939550		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129468410delT	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TAGTTTTTCCTTTTTTTTTTT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57274473	57274476	+	IGR	DEL	TCTT	-	-	rs150621884		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57274473_57274476delTCTT								ZNF479 (66902 upstream) : ZNF716 (235407 downstream)																							ttccttcctctctttctttctccc	0.064													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142013698	142013699	+	Intron	DEL	CT	-	-	rs36111580		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013698_142013699delCT	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGAGTGTGACTCTGCCCCGTC	0.307													4	3	---	---	---	---	
DEFB134	613211	broad.mit.edu	37	8	11853467	11853468	+	Intron	INS	-	A	A	rs34837269		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11853467_11853468insA	uc011kxn.1	-							NM_001033019	NP_001028191	Q4QY38	DB134_HUMAN	beta-defensin 134 precursor						defense response to bacterium	extracellular region					0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.159)		TCAGTTCAGCCAAAAAAAAAAa	0.059													7	4	---	---	---	---	
UBE2W	55284	broad.mit.edu	37	8	74737352	74737352	+	Intron	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74737352delA	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769	Q96B02	UBE2W_HUMAN	ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)			CTAAAAATACAAAAAAAAAAA	0.274													4	2	---	---	---	---	
ANKRD46	157567	broad.mit.edu	37	8	101535129	101535136	+	Intron	DEL	ACACATAT	-	-	rs35233405	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101535129_101535136delACACATAT	uc003yjm.2	-						ANKRD46_uc003yjn.1_Intron|ANKRD46_uc003yjo.1_Intron|ANKRD46_uc003yjp.1_Intron	NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			acacacacacacacatatatatatatac	0.207													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110509659	110509659	+	Intron	DEL	C	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110509659delC	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AAAAACCGttctttttttttt	0.224										HNSCC(38;0.096)			4	2	---	---	---	---	
TG	7038	broad.mit.edu	37	8	133918919	133918919	+	Intron	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133918919delT	uc003ytw.2	+						TG_uc010mdw.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ACGGCTCCACTTTCCTTCTCC	0.637													35	31	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68455229	68455230	+	IGR	INS	-	AC	AC			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68455229_68455230insAC								FAM27B (661040 upstream) : MIR1299 (547009 downstream)																							GGGAGACTTCTGTGCAGAGGCT	0.584													5	3	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45634780	45634780	+	Intron	DEL	C	-	-	rs141209668		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45634780delC	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						AAAAAAAAAACAAAATTTGTA	0.164													4	2	---	---	---	---	
SAPS3	55291	broad.mit.edu	37	11	68305521	68305522	+	Intron	INS	-	T	T	rs147520180	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68305521_68305522insT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			CATTCTAGCAGTAAGTCCAGGG	0.406													4	3	---	---	---	---	
LOC653113	653113	broad.mit.edu	37	12	8386700	8386701	+	Intron	INS	-	C	C	rs139204651	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8386700_8386701insC	uc010sgk.1	-							NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0						CCTGCCGCAAGACCCCATGCCC	0.520													4	2	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31255056	31255056	+	Intron	DEL	C	-	-	rs145143657		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31255056delC	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron|DDX11_uc009zjo.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGAGGATTTCCCCCAAAGTC	0.607										Multiple Myeloma(12;0.14)			7	4	---	---	---	---	
LRIG3	121227	broad.mit.edu	37	12	59268041	59268041	+	Frame_Shift_Del	DEL	A	-	-	rs143823251		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59268041delA	uc001sqr.2	-	18	3157	c.2911delT	c.(2911-2913)TACfs	p.Y971fs	LRIG3_uc009zqh.2_Frame_Shift_Del_p.Y911fs|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	971						integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			GAACATGGGTAGCACTCCTTT	0.433													127	70	---	---	---	---	
CAB39L	81617	broad.mit.edu	37	13	49906340	49906340	+	Intron	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49906340delA	uc001vcw.2	-						CAB39L_uc001vcx.2_Intron|CAB39L_uc010adf.2_Intron	NM_030925	NP_112187	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		TGGTGTTGTGAAAAAAATTAG	0.358													20	10	---	---	---	---	
KLF12	11278	broad.mit.edu	37	13	74338847	74338847	+	Intron	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74338847delA	uc001vjf.2	-						KLF12_uc010aeq.2_Intron	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		CATATCTGTCAAAAAAAAAAG	0.338													4	2	---	---	---	---	
TBC1D4	9882	broad.mit.edu	37	13	75923091	75923094	+	Intron	DEL	GTGT	-	-	rs151307196		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75923091_75923094delGTGT	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		gagagagagagtgtgtgtgtgtgt	0.181													8	7	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79217771	79217772	+	Intron	INS	-	T	T	rs149588375	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79217771_79217772insT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron|uc001xuo.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GCTGCTAATTCTTTTTTTTCTC	0.470													4	2	---	---	---	---	
GOLGA9P	283796	broad.mit.edu	37	15	23258265	23258268	+	Intron	DEL	TCTC	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23258265_23258268delTCTC	uc001yvh.1	+						uc001yvi.2_5'Flank	NR_024074				RecName: Full=Putative golgin subfamily A member 6-like protein 11;												0						TAATGATTGTTCTCTCTACCTCTC	0.603													4	2	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	54004802	54004803	+	Intron	INS	-	A	A	rs112182674		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54004802_54004803insA	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		ACCCCACCGCCAAAAAAAAAAA	0.188													3	3	---	---	---	---	
NDE1	54820	broad.mit.edu	37	16	15758917	15758917	+	Intron	DEL	T	-	-	rs79093814		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15758917delT	uc002ddt.1	+						NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron	NM_017668	NP_060138	Q9NXR1	NDE1_HUMAN	nuclear distribution gene E homolog 1						cell differentiation|cell division|centrosome duplication|establishment of chromosome localization|establishment of mitotic spindle orientation|G2/M transition of mitotic cell cycle|mitotic prometaphase|nervous system development	cleavage furrow|condensed chromosome kinetochore|cytosol|microtubule|spindle pole centrosome	microtubule binding			ovary(1)	1						caggccaggcttttttttttt	0.000													4	2	---	---	---	---	
UBTF	7343	broad.mit.edu	37	17	42284469	42284469	+	3'UTR	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42284469delT	uc002igb.2	-	20					UBTF_uc002igc.2_3'UTR|UBTF_uc010czs.2_3'UTR|UBTF_uc002igd.2_3'UTR|UBTF_uc010czt.2_3'UTR	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CCCCACCGTATTTTTTTTTTT	0.562													5	5	---	---	---	---	
CCDC47	57003	broad.mit.edu	37	17	61841925	61841925	+	Intron	DEL	T	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61841925delT	uc002jbs.3	-						CCDC47_uc010ddx.2_Intron|CCDC47_uc002jbt.2_Intron	NM_020198	NP_064583	Q96A33	CCD47_HUMAN	coiled-coil domain containing 47 precursor							integral to membrane	protein binding				0						TAGGTGTTGATTTTTTTTTTT	0.353													4	2	---	---	---	---	
ABCA9	10350	broad.mit.edu	37	17	67012244	67012247	+	Intron	DEL	TATA	-	-	rs62085386	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67012244_67012247delTATA	uc002jhu.2	-						ABCA9_uc010dez.2_Intron	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9						transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					tgtgtgtgtgtatatatatatata	0.147													4	3	---	---	---	---	
P4HB	5034	broad.mit.edu	37	17	79812762	79812762	+	Intron	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79812762delA	uc002kbn.1	-						P4HB_uc002kbm.1_Intron	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor						cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			ATCATAATTGAAAAAAAAAAA	0.303													4	3	---	---	---	---	
NDUFA7	4701	broad.mit.edu	37	19	8376344	8376344	+	3'UTR	DEL	A	-	-			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8376344delA	uc002mjm.1	-	4						NM_005001	NP_004992	O95182	NDUA7_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	TCCCTGGAGGAAATCCAAGGA	0.428													179	87	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40761345	40761346	+	Intron	INS	-	GT	GT	rs138053162	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40761345_40761346insGT	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			ctcagggtctagtgtgtgtgtg	0.000			A		ovarian|pancreatic 								7	5	---	---	---	---	
NPAS1	4861	broad.mit.edu	37	19	47524456	47524457	+	Intron	INS	-	A	A	rs150309227	by1000genomes	TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47524456_47524457insA	uc002pfw.2	+						NPAS1_uc002pfx.2_Intron|NPAS1_uc002pfy.2_Intron	NM_002517	NP_002508	Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1						central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		cctggccgcgggcccccccccg	0.535													5	3	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													3	4	---	---	---	---	
ZNF320	162967	broad.mit.edu	37	19	53368687	53368688	+	Intron	INS	-	TTTTTA	TTTTTA			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53368687_53368688insTTTTTA	uc010eqh.1	-						ZNF320_uc010eqi.1_Intron			A2RRD8	ZN320_HUMAN	Homo sapiens full length insert cDNA clone ZD42C02.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		GGTCCAGGCTTtatatatatat	0.262													8	7	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54394697	54394698	+	Intron	INS	-	T	T	rs11378432		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54394697_54394698insT	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		cgcccagctaattttttttttt	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085863	11085864	+	Intron	INS	-	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085863_11085864insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		catcaccaccaccaccatcacc	0.000													8	4	---	---	---	---	
ITGB2	3689	broad.mit.edu	37	21	46309030	46309031	+	Intron	DEL	AG	-	-	rs34110149		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46309030_46309031delAG	uc002zgd.2	-						ITGB2_uc002zge.2_Intron|ITGB2_uc002zgf.3_Intron|ITGB2_uc011afl.1_Intron|ITGB2_uc010gpw.2_Intron|ITGB2_uc002zgg.2_Intron	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor						apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	GGAGGGACACAGGGGCACGGCG	0.723													4	4	---	---	---	---	
LGALS1	3956	broad.mit.edu	37	22	38071731	38071732	+	Intron	INS	-	C	C			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38071731_38071732insC	uc003atn.2	+							NM_002305	NP_002296	P09382	LEG1_HUMAN	galectin-1						apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of apoptosis	cytoplasm|extracellular space|proteinaceous extracellular matrix	galactoside binding|signal transducer activity				0	Melanoma(58;0.0574)					GAGTGTGGGGACCCCCCCCCAA	0.376													3	3	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46136597	46136598	+	Intron	INS	-	AT	AT	rs67765053		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46136597_46136598insAT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		cacacacacacacatatatata	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49153144	49153145	+	IGR	INS	-	AGG	AGG			TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49153144_49153145insAGG								FAM19A5 (5402 upstream) : C22orf34 (655031 downstream)																							agaggatgggaaggaggaggag	0.030													5	3	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101093049	101093049	+	Intron	DEL	A	-	-	rs66689050		TCGA-BP-5198-01A-01D-1429-08	TCGA-BP-5198-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093049delA	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ACCTGTGGGGAAAGCAGTGAG	0.577													3	3	---	---	---	---	
