Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NOC2L	26155	broad.mit.edu	37	1	880485	880485	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:880485C>T	uc001abz.3	-	18	2154	c.2095G>A	c.(2095-2097)GAT>AAT	p.D699N	NOC2L_uc001aby.3_Missense_Mutation_p.D496N|NOC2L_uc009vjq.2_Missense_Mutation_p.D699N	NM_015658	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog	699	Asp/Glu-rich (acidic).					nucleolus	protein binding			ovary(1)|skin(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		tcctcttcatcgtcttccacc	0.468													9	13	---	---	---	---	PASS
VWA1	64856	broad.mit.edu	37	1	1374667	1374667	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1374667G>A	uc001afs.2	+	3	1058	c.838G>A	c.(838-840)GAC>AAC	p.D280N	VWA1_uc001afr.2_Missense_Mutation_p.D68N	NM_022834	NP_073745	Q6PCB0	VWA1_HUMAN	von Willebrand factor A domain containing 1	280	Fibronectin type-III 1.					basement membrane					0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CACGGACTACGACGTGGCGCT	0.741													4	8	---	---	---	---	PASS
TAS1R1	80835	broad.mit.edu	37	1	6634783	6634783	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6634783G>A	uc001ant.2	+	3	591	c.591G>A	c.(589-591)GAG>GAA	p.E197E	TAS1R1_uc001anu.2_Intron|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_Silent_p.E197E	NM_138697	NP_619642	Q7RTX1	TS1R1_HUMAN	sweet taste receptor T1r isoform b	197	Extracellular (Potential).				sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		ACCAGGTGGAGACCATGGTGC	0.587													9	40	---	---	---	---	PASS
TNFRSF8	943	broad.mit.edu	37	1	12164562	12164562	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12164562C>T	uc001atq.2	+	4	617	c.395C>T	c.(394-396)CCG>CTG	p.P132L	TNFRSF8_uc010obc.1_Missense_Mutation_p.P21L	NM_001243	NP_001234	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily,	132	TNFR-Cys 3.|Extracellular (Potential).				cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGTCTGTCCGGCAGGGATG	0.577													9	21	---	---	---	---	PASS
FBLIM1	54751	broad.mit.edu	37	1	16111108	16111108	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16111108C>G	uc001axd.1	+	10	1517	c.1074C>G	c.(1072-1074)CTC>CTG	p.L358L	FBLIM1_uc001axe.1_Silent_p.L358L|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axh.1_Silent_p.L261L|FBLIM1_uc001axi.1_Silent_p.L261L	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a	358	PLEKHC1-binding.|LIM zinc-binding 3.				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		ACAACCATCTCTTCTGCAAGC	0.637													6	75	---	---	---	---	PASS
FBLIM1	54751	broad.mit.edu	37	1	16111144	16111144	+	Silent	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16111144G>T	uc001axd.1	+	10	1553	c.1110G>T	c.(1108-1110)GCG>GCT	p.A370A	FBLIM1_uc001axe.1_Silent_p.A370A|FBLIM1_uc001axf.2_RNA|FBLIM1_uc001axh.1_Silent_p.A273A|FBLIM1_uc001axi.1_Silent_p.A273A	NM_017556	NP_060026	Q8WUP2	FBLI1_HUMAN	filamin-binding LIM protein-1 isoform a	370	PLEKHC1-binding.|LIM zinc-binding 3.				cell adhesion|cell junction assembly|regulation of cell shape	cell cortex|cytoskeleton|cytosol|focal adhesion|intracellular membrane-bounded organelle	zinc ion binding			skin(1)	1		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		GGAGTGCTGCGGGGTGCTGCT	0.612													4	70	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16641903	16641903	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16641903G>A	uc001ayg.2	-	2	227	c.11C>T	c.(10-12)TCC>TTC	p.S4F	FBXO42_uc001ayf.2_5'UTR|FBXO42_uc001ayh.2_Missense_Mutation_p.S4F	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	4										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		ACTGTCCGAGGAGCTGGCCAT	0.458													10	65	---	---	---	---	PASS
SPATA21	374955	broad.mit.edu	37	1	16727277	16727277	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16727277C>T	uc001ayn.2	-	11	1595	c.1112G>A	c.(1111-1113)AGC>AAC	p.S371N	SPATA21_uc001ayl.1_RNA|SPATA21_uc010occ.1_Missense_Mutation_p.S348N	NM_198546	NP_940948	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21	371							calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		AACTTCTGAGCTCTCTTCTTG	0.592													17	209	---	---	---	---	PASS
HP1BP3	50809	broad.mit.edu	37	1	21103139	21103139	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21103139C>T	uc001bdw.1	-	4	441	c.301G>A	c.(301-303)GAG>AAG	p.E101K	HP1BP3_uc001bdv.1_Missense_Mutation_p.E63K|HP1BP3_uc010odh.1_Missense_Mutation_p.E63K|HP1BP3_uc001bdy.1_Missense_Mutation_p.E101K|HP1BP3_uc001bdz.2_RNA|HP1BP3_uc001bea.2_Missense_Mutation_p.E100K|HP1BP3_uc001beb.2_Missense_Mutation_p.E101K	NM_016287	NP_057371	Q5SSJ5	HP1B3_HUMAN	HP1-BP74	101					nucleosome assembly	nucleosome|nucleus	DNA binding			central_nervous_system(1)|skin(1)	2		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TCTTCATTCTCAGGTTCCCCC	0.403													65	147	---	---	---	---	PASS
CELA3A	10136	broad.mit.edu	37	1	22336318	22336318	+	Missense_Mutation	SNP	C	G	G	rs148724731		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22336318C>G	uc001bfl.2	+	7	782	c.763C>G	c.(763-765)CGA>GGA	p.R255G		NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	255	Peptidase S1.				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						GGTGTTCACTCGAGTCTCCGC	0.592													11	55	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27101309	27101309	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27101309G>T	uc001bmv.1	+	18	4964	c.4591G>T	c.(4591-4593)GAA>TAA	p.E1531*	ARID1A_uc001bmt.1_Nonsense_Mutation_p.E1530*|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Nonsense_Mutation_p.E1148*|ARID1A_uc001bmx.1_Nonsense_Mutation_p.E377*|ARID1A_uc009vsm.1_Intron|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1531					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCGAACAGATGAAATGCTGCA	0.612			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								5	63	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27102121	27102121	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27102121G>C	uc001bmv.1	+	19	5420	c.5047G>C	c.(5047-5049)GAG>CAG	p.E1683Q	ARID1A_uc001bmt.1_Missense_Mutation_p.E1682Q|ARID1A_uc001bmu.1_Missense_Mutation_p.E1466Q|ARID1A_uc001bmx.1_Missense_Mutation_p.E529Q|ARID1A_uc009vsm.1_Missense_Mutation_p.E11Q|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1683					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCTCCTGGCAGAGAGCACATG	0.522			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								7	27	---	---	---	---	PASS
SPOCD1	90853	broad.mit.edu	37	1	32280503	32280503	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32280503C>G	uc001bts.1	-	2	490	c.432G>C	c.(430-432)GAG>GAC	p.E144D	SPOCD1_uc001btu.2_Missense_Mutation_p.E144D|SPOCD1_uc001btv.2_Intron	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	144					transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CCAGAGCTCTCTCTGGGAGGC	0.592													36	92	---	---	---	---	PASS
LCK	3932	broad.mit.edu	37	1	32742252	32742252	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32742252C>A	uc001bux.2	+	9	967	c.829C>A	c.(829-831)CAG>AAG	p.Q277K	LCK_uc001buy.2_Missense_Mutation_p.Q277K|LCK_uc001buz.2_Missense_Mutation_p.Q277K|LCK_uc010ohc.1_Missense_Mutation_p.Q321K|LCK_uc001bva.2_Missense_Mutation_p.Q284K	NM_005356	NP_005347	P06239	LCK_HUMAN	lymphocyte-specific protein tyrosine kinase	277	Protein kinase.				activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)	GAGCCTGAAGCAGGGCAGCAT	0.637			T	TRB@	T-ALL								16	58	---	---	---	---	PASS
RNF220	55182	broad.mit.edu	37	1	45115332	45115332	+	Splice_Site	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45115332G>A	uc001clv.1	+	13	1806	c.1446_splice	c.e13-1	p.K482_splice	RNF220_uc001clw.1_Splice_Site_p.K482_splice|RNF220_uc010oky.1_Splice_Site_p.K269_splice|RNF220_uc010okz.1_Splice_Site_p.K224_splice|RNF220_uc001clx.1_Splice_Site_p.K198_splice|RNF220_uc001cly.1_Splice_Site_p.K162_splice|RNF220_uc001clz.1_Splice_Site_p.K161_splice|RNF220_uc001cma.1_Splice_Site_p.K161_splice|TMEM53_uc001cmb.1_Intron	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						CCTTTTTACAGAATCACCGAA	0.338													8	124	---	---	---	---	PASS
TMEM53	79639	broad.mit.edu	37	1	45120204	45120204	+	3'UTR	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45120204G>C	uc001cmc.2	-	3					TMEM53_uc001cmb.1_Intron|TMEM53_uc001cmd.2_3'UTR|TMEM53_uc009vxh.1_3'UTR|TMEM53_uc010ola.1_3'UTR	NM_024587	NP_078863	Q6P2H8	TMM53_HUMAN	transmembrane protein 53							integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					TTTATTTCTGGAGCAGAGGTG	0.552													12	64	---	---	---	---	PASS
TMEM53	79639	broad.mit.edu	37	1	45120468	45120468	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45120468G>C	uc001cmc.2	-	3	633	c.597C>G	c.(595-597)TTC>TTG	p.F199L	TMEM53_uc001cmb.1_Intron|TMEM53_uc001cmd.2_Missense_Mutation_p.F126L|TMEM53_uc009vxh.1_Missense_Mutation_p.F82L|TMEM53_uc010ola.1_Missense_Mutation_p.F82L	NM_024587	NP_078863	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	199						integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					GCCTGTCATAGAAGTGGGTGT	0.617													10	41	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52704276	52704276	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52704276C>T	uc001cto.2	+	4	1359	c.1187C>T	c.(1186-1188)TCT>TTT	p.S396F	ZFYVE9_uc001ctn.2_Missense_Mutation_p.S396F|ZFYVE9_uc001ctp.2_Missense_Mutation_p.S396F	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	396					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						TTCTCTGAATCTCAGGACATG	0.368													25	126	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52704805	52704805	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52704805C>T	uc001cto.2	+	4	1888	c.1716C>T	c.(1714-1716)ATC>ATT	p.I572I	ZFYVE9_uc001ctn.2_Silent_p.I572I|ZFYVE9_uc001ctp.2_Silent_p.I572I	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	572					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						TGCCATCTATCAGTGTTCCTT	0.393													15	87	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52704876	52704876	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52704876C>T	uc001cto.2	+	4	1959	c.1787C>T	c.(1786-1788)TCA>TTA	p.S596L	ZFYVE9_uc001ctn.2_Missense_Mutation_p.S596L|ZFYVE9_uc001ctp.2_Missense_Mutation_p.S596L	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	596					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						AAGCCATTATCAGACCATTTA	0.378													12	77	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52705008	52705008	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52705008C>G	uc001cto.2	+	4	2091	c.1919C>G	c.(1918-1920)TCT>TGT	p.S640C	ZFYVE9_uc001ctn.2_Missense_Mutation_p.S640C|ZFYVE9_uc001ctp.2_Missense_Mutation_p.S640C	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	640					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						GGAAACATCTCTAATGTCGAT	0.378													25	113	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52705108	52705108	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52705108C>T	uc001cto.2	+	4	2191	c.2019C>T	c.(2017-2019)CTC>CTT	p.L673L	ZFYVE9_uc001ctn.2_Silent_p.L673L|ZFYVE9_uc001ctp.2_Silent_p.L673L	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	673					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						ATAATGATCTCAGAGCTGGTC	0.468													21	126	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52940613	52940613	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52940613G>T	uc001ctx.2	-	13	2852	c.2618C>A	c.(2617-2619)TCT>TAT	p.S873Y	ZCCHC11_uc001cty.2_Missense_Mutation_p.S873Y|ZCCHC11_uc001ctz.2_Missense_Mutation_p.S873Y|ZCCHC11_uc009vze.1_Missense_Mutation_p.S873Y|ZCCHC11_uc009vzf.1_Missense_Mutation_p.S632Y|ZCCHC11_uc001cub.2_Missense_Mutation_p.S873Y	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	873					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						GCAGTTGCAAGAGGTAGCAGA	0.413													10	72	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52940833	52940833	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52940833G>T	uc001ctx.2	-	13	2632	c.2398C>A	c.(2398-2400)CTT>ATT	p.L800I	ZCCHC11_uc001cty.2_Missense_Mutation_p.L800I|ZCCHC11_uc001ctz.2_Missense_Mutation_p.L800I|ZCCHC11_uc009vze.1_Missense_Mutation_p.L800I|ZCCHC11_uc009vzf.1_Missense_Mutation_p.L559I|ZCCHC11_uc001cub.2_Missense_Mutation_p.L800I	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	800					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						CTGGTAGAAAGAGATGAAGAG	0.363													13	218	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52940841	52940841	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52940841G>C	uc001ctx.2	-	13	2624	c.2390C>G	c.(2389-2391)TCT>TGT	p.S797C	ZCCHC11_uc001cty.2_Missense_Mutation_p.S797C|ZCCHC11_uc001ctz.2_Missense_Mutation_p.S797C|ZCCHC11_uc009vze.1_Missense_Mutation_p.S797C|ZCCHC11_uc009vzf.1_Missense_Mutation_p.S556C|ZCCHC11_uc001cub.2_Missense_Mutation_p.S797C	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	797					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						AAGAGATGAAGAGTCCTGTCC	0.358													13	225	---	---	---	---	PASS
EXTL2	2135	broad.mit.edu	37	1	101339508	101339508	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101339508C>G	uc001dtk.1	-	5	1320	c.983G>C	c.(982-984)AGA>ACA	p.R328T	EXTL2_uc001dtl.1_Missense_Mutation_p.R328T|EXTL2_uc010ouk.1_Missense_Mutation_p.R315T|EXTL2_uc001dtm.1_Missense_Mutation_p.R327T	NM_001439	NP_001430	Q9UBQ6	EXTL2_HUMAN	exostoses-like 2	328	Lumenal (Potential).				N-acetylglucosamine metabolic process|UDP-N-acetylgalactosamine metabolic process	extracellular region|integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,4-N-acetylgalactosaminyltransferase activity|glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1		all_epithelial(167;2.48e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0425)|all cancers(265;0.0628)|COAD - Colon adenocarcinoma(174;0.148)|Colorectal(144;0.167)|Lung(183;0.195)		TTATATTTTTCTTTTGTAGTT	0.299													11	97	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149906110	149906110	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149906110G>A	uc001etl.3	-	7	908	c.657C>T	c.(655-657)GTC>GTT	p.V219V	MTMR11_uc001etm.1_Silent_p.V147V|MTMR11_uc010pbm.1_Silent_p.V191V|MTMR11_uc010pbn.1_Silent_p.V61V	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	219	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			ACCTCTCGTTGACCGTGCTGA	0.572													12	106	---	---	---	---	PASS
OTUD7B	56957	broad.mit.edu	37	1	149936124	149936124	+	Intron	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149936124C>T	uc001etn.2	-						OTUD7B_uc001eto.2_Missense_Mutation_p.R173H	NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			GGAAACAAGGCGCTCCCACCC	0.512													30	59	---	---	---	---	PASS
PRPF3	9129	broad.mit.edu	37	1	150325402	150325402	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150325402G>A	uc001eum.3	+	16	2161	c.1999G>A	c.(1999-2001)GAA>AAA	p.E667K	PRPF3_uc010pca.1_Missense_Mutation_p.E626K|PRPF3_uc010pcb.1_Missense_Mutation_p.E618K	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog	667					nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		GCATGGGGCTGAACACTACTG	0.488													11	135	---	---	---	---	PASS
MRPL9	65005	broad.mit.edu	37	1	151735364	151735364	+	Intron	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151735364C>T	uc001eyv.2	-						MRPL9_uc009wmz.2_Intron|MRPL9_uc010pdk.1_Intron|MRPL9_uc009wna.1_3'UTR	NM_031420	NP_113608	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9 precursor						translation	mitochondrial ribosome	structural constituent of ribosome			ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGGATTGTTTCCACAAAGAAA	0.468													9	70	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152082180	152082180	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152082180G>C	uc001ezp.2	-	2	3513	c.3513C>G	c.(3511-3513)CGC>CGG	p.R1171R	TCHH_uc009wne.1_Silent_p.R1171R	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1171	4-9.|10 X 30 AA tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			cctcttcctcGCGGTATTGCC	0.179													6	55	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152085383	152085383	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152085383C>T	uc001ezp.2	-	2	310	c.310G>A	c.(310-312)GAC>AAC	p.D104N	TCHH_uc009wne.1_Missense_Mutation_p.D104N	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	104					keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTTTCCGTCACACCGGGCT	0.522													20	170	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152275916	152275916	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152275916C>G	uc001ezu.1	-	3	11482	c.11446G>C	c.(11446-11448)GAG>CAG	p.E3816Q		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3816	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTGTTCCTCATTACGTGTT	0.577									Ichthyosis				8	612	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285757	152285757	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285757C>T	uc001ezu.1	-	3	1641	c.1605G>A	c.(1603-1605)TCG>TCA	p.S535S	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	535	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCTATTTACCGATTGCTCGT	0.582									Ichthyosis				89	479	---	---	---	---	PASS
OR6K6	128371	broad.mit.edu	37	1	158724630	158724630	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158724630C>G	uc001fsw.1	+	1	25	c.25C>G	c.(25-27)CAA>GAA	p.Q9E		NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K,	9	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_hematologic(112;0.0378)					AGTGGGTAATCAACATTCCAA	0.393													21	128	---	---	---	---	PASS
MNDA	4332	broad.mit.edu	37	1	158813830	158813830	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158813830G>A	uc001fsz.1	+	4	688	c.488G>A	c.(487-489)GGA>GAA	p.G163E		NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	163					B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					GGTCCCTCAGGAGCCAGCACA	0.483													10	143	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169993598	169993598	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169993598C>G	uc001ggv.2	-	9	1252	c.981G>C	c.(979-981)TTG>TTC	p.L327F	KIFAP3_uc010plx.1_Missense_Mutation_p.L29F	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	327					blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGAGTTTCTTCAAGAATGACA	0.323													4	103	---	---	---	---	PASS
FMO3	2328	broad.mit.edu	37	1	171083188	171083188	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171083188C>T	uc001ghi.2	+	7	980	c.869C>T	c.(868-870)GCA>GTA	p.A290V	FMO3_uc001ghh.2_Missense_Mutation_p.A290V|FMO3_uc010pmb.1_Missense_Mutation_p.A270V|FMO3_uc010pmc.1_Missense_Mutation_p.A227V	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	290					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GAGCTCCCAGCAAGCATTCTG	0.433													26	61	---	---	---	---	PASS
MIR199A2	406977	broad.mit.edu	37	1	172113717	172113717	+	RNA	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172113717C>A	hsa-mir-199a-2|MI0000281	-			c.68C>A			DNM3_uc009wwb.2_Intron|DNM3_uc001gie.2_Intron|DNM3_uc001gif.2_Intron																	0						GACTACTGTACAACGGCATTG	0.517													3	59	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179989859	179989859	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179989859G>A	uc001gnt.2	+	12	3333	c.2950G>A	c.(2950-2952)GAA>AAA	p.E984K	CEP350_uc009wxl.2_Missense_Mutation_p.E983K|CEP350_uc001gnu.2_Missense_Mutation_p.E818K	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	984						centrosome|nucleus|spindle				ovary(4)	4						TTCAGTCAGTGAAGGGCCTCT	0.428													11	182	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179989968	179989968	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179989968G>C	uc001gnt.2	+	12	3442	c.3059G>C	c.(3058-3060)GGA>GCA	p.G1020A	CEP350_uc009wxl.2_Missense_Mutation_p.G1019A|CEP350_uc001gnu.2_Missense_Mutation_p.G854A	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1020						centrosome|nucleus|spindle				ovary(4)	4						TTTTGTCCTGGAGAAAGAAAT	0.408													8	77	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186088322	186088322	+	Splice_Site	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186088322G>A	uc001grq.1	+	78	12078	c.11849_splice	c.e78-1	p.G3950_splice		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TTCATTTTTAGGAGCAATTGA	0.373													36	109	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186319407	186319407	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186319407G>C	uc001grv.2	-	21	3021	c.2724C>G	c.(2722-2724)CTC>CTG	p.L908L		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	908	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CCATATTACTGAGGTGCTGTT	0.318			T	NTRK1	papillary thyroid								19	100	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198701513	198701513	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198701513C>T	uc001gur.1	+	19	2233	c.2053C>T	c.(2053-2055)CTT>TTT	p.L685F	PTPRC_uc001gus.1_Missense_Mutation_p.L637F|PTPRC_uc001gut.1_Missense_Mutation_p.L524F|PTPRC_uc009wzf.1_Missense_Mutation_p.L573F|PTPRC_uc010ppg.1_Missense_Mutation_p.L621F	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	685	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TGTTGACATTCTTCCTTGTGA	0.358													6	72	---	---	---	---	PASS
SLC26A9	115019	broad.mit.edu	37	1	205884398	205884398	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205884398C>T	uc001hdq.2	-	21					SLC26A9_uc001hdm.2_Silent_p.S9S|SLC26A9_uc001hdn.2_Silent_p.S9S|SLC26A9_uc001hdo.2_3'UTR|SLC26A9_uc001hdp.2_Intron	NM_052934	NP_443166	Q7LBE3	S26A9_HUMAN	solute carrier family 26, member 9 isoform a							integral to membrane	chloride channel activity|secondary active sulfate transmembrane transporter activity			ovary(1)|skin(1)	2	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TTCCTCCGCCCGACACCCCCT	0.458													9	62	---	---	---	---	PASS
IL20	50604	broad.mit.edu	37	1	207039849	207039849	+	Silent	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207039849C>A	uc001her.2	+	3	290	c.246C>A	c.(244-246)CTC>CTA	p.L82L	IL20_uc010pry.1_Silent_p.L153L|IL20_uc009xby.2_Silent_p.L82L	NM_018724	NP_061194	Q9NYY1	IL20_HUMAN	interleukin 20 precursor	82					positive regulation of keratinocyte differentiation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of inflammatory response	extracellular space	cytokine activity|interleukin-20 receptor binding				0	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)		GATGCTGCCTCCTGCGCCATT	0.512													30	541	---	---	---	---	PASS
LAMB3	3914	broad.mit.edu	37	1	209823311	209823311	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209823311C>G	uc001hhg.2	-	2	571	c.181G>C	c.(181-183)GAG>CAG	p.E61Q	LAMB3_uc009xco.2_Missense_Mutation_p.E61Q|LAMB3_uc001hhh.2_Missense_Mutation_p.E61Q|LAMB3_uc010psl.1_RNA|LAMB3_uc009xcp.1_Missense_Mutation_p.E61Q	NM_001017402	NP_001017402	Q13751	LAMB3_HUMAN	laminin, beta 3 precursor	61	Laminin N-terminal.				cell adhesion|epidermis development|hemidesmosome assembly		structural molecule activity			central_nervous_system(2)|skin(2)|large_intestine(1)|ovary(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		GGGCCTACCTCGCCATACTGG	0.483													3	55	---	---	---	---	PASS
KCNK2	3776	broad.mit.edu	37	1	215256745	215256745	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215256745C>G	uc001hkq.2	+	1	186	c.17C>G	c.(16-18)TCG>TGG	p.S6W	KCNK2_uc001hko.2_Intron|KCNK2_uc009xdm.2_Intron|KCNK2_uc001hkp.2_Intron|KCNK2_uc010pua.1_RNA|KCNK2_uc001hkr.3_Intron	NM_001017425	NP_001017425	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2 isoform	6	Cytoplasmic (Potential).						outward rectifier potassium channel activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)	CCCAGCGCCTCGCGGGAGAGA	0.547													5	85	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215963529	215963529	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215963529C>T	uc001hku.1	-	51	10441	c.10054G>A	c.(10054-10056)GAC>AAC	p.D3352N		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3352	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGCACCGGGTCATTCTTTTTA	0.403										HNSCC(13;0.011)			8	170	---	---	---	---	PASS
CABC1	56997	broad.mit.edu	37	1	227171276	227171276	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227171276C>G	uc001hqm.1	+	14	4523	c.1104C>G	c.(1102-1104)ATC>ATG	p.I368M	CABC1_uc001hqn.1_Missense_Mutation_p.I368M|CABC1_uc009xeq.1_Missense_Mutation_p.I316M|CABC1_uc010pvq.1_Missense_Mutation_p.I89M|CABC1_uc010pvr.1_Missense_Mutation_p.I42M|CABC1_uc001hqo.1_Missense_Mutation_p.I89M|CABC1_uc009xer.1_Translation_Start_Site	NM_020247	NP_064632	Q8NI60	ADCK3_HUMAN	chaperone, ABC1 activity of bc1 complex like	368	Protein kinase.				cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)				CCCAGAGCATCAACAGTGATG	0.622													6	73	---	---	---	---	PASS
COG2	22796	broad.mit.edu	37	1	230795210	230795210	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230795210G>A	uc001htw.2	+	2	224	c.73G>A	c.(73-75)GAA>AAA	p.E25K	COG2_uc001htx.2_Missense_Mutation_p.E25K|COG2_uc010pwc.1_5'UTR	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform	25					Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TATTTTTCAGGAAGATTTCGA	0.378													10	103	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247053281	247053281	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247053281C>G	uc001ibu.1	-	16	2138	c.2131G>C	c.(2131-2133)GAG>CAG	p.E711Q	AHCTF1_uc001ibv.1_Missense_Mutation_p.E720Q|AHCTF1_uc009xgs.1_5'UTR	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	711	Necessary for cytoplasmic localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GATAAACGCTCAAACTTCTGT	0.338													19	221	---	---	---	---	PASS
OR2L1P	26247	broad.mit.edu	37	1	248154318	248154318	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248154318A>G	uc001idv.1	+	1	750	c.506A>G	c.(505-507)TAC>TGC	p.Y169C	OR2L13_uc001ids.2_Intron	NR_002145				RecName: Full=Olfactory receptor 2L5; AltName: Full=Olfactory receptor OR1-53;												0						GTGACTTTCTACTATGCACCC	0.517													11	109	---	---	---	---	PASS
LPIN1	23175	broad.mit.edu	37	2	11911647	11911647	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11911647G>A	uc010yjn.1	+	5	712	c.438G>A	c.(436-438)CCG>CCA	p.P146P	LPIN1_uc010yjm.1_Silent_p.P195P|LPIN1_uc002rbt.2_Silent_p.P146P|LPIN1_uc002rbs.2_Silent_p.P146P	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	146					fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GCGAGACGCCGTCAAGCAGCT	0.537													14	23	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228021	21228021	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228021C>T	uc002red.2	-	26	11847	c.11719G>A	c.(11719-11721)GAT>AAT	p.D3907N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3907					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TCAACATAATCTGCTTTGTTT	0.428													44	129	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25990452	25990452	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25990452T>A	uc002rgs.2	-	7	996	c.775A>T	c.(775-777)AGA>TGA	p.R259*	ASXL2_uc002rgt.1_5'UTR	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	259					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAAACTTACTGGTATGGAGT	0.373													28	73	---	---	---	---	PASS
CENPA	1058	broad.mit.edu	37	2	27016087	27016087	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27016087C>G	uc002rhr.2	+	4	546	c.363C>G	c.(361-363)CTC>CTG	p.L121L	CENPA_uc002rht.2_RNA|CENPA_uc002rhs.2_Silent_p.L95L	NM_001809	NP_001800	P49450	CENPA_HUMAN	centromere protein A isoform a	121	H3-like.				CenH3-containing nucleosome assembly at centromere|establishment of mitotic spindle orientation|interspecies interaction between organisms|kinetochore assembly|mitotic prometaphase|protein localization to chromosome, centromeric region	condensed nuclear chromosome kinetochore|cytosol|nucleoplasm|nucleosome	chromatin binding|DNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGTTACTCTCTTCCCAAAGG	0.542													56	310	---	---	---	---	PASS
C2orf53	339779	broad.mit.edu	37	2	27360613	27360613	+	Silent	SNP	G	A	A	rs137967723	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27360613G>A	uc002rjb.2	-	3	1165	c.585C>T	c.(583-585)TGC>TGT	p.C195C		NM_178553	NP_848648	Q53SZ7	CB053_HUMAN	hypothetical protein LOC339779	195											0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGCTTGGCACGCATCTCTCCA	0.657													10	51	---	---	---	---	PASS
SUPT7L	9913	broad.mit.edu	37	2	27884232	27884232	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27884232G>A	uc002rlh.1	-	3	381	c.38C>T	c.(37-39)TCA>TTA	p.S13L	SUPT7L_uc002rli.1_Missense_Mutation_p.S13L|SUPT7L_uc010ymf.1_Intron|SUPT7L_uc002rlj.1_Missense_Mutation_p.S11L|SUPT7L_uc010ezh.1_Missense_Mutation_p.S11L|SLC4A1AP_uc002rlk.3_5'Flank	NM_014860	NP_055675	O94864	ST65G_HUMAN	SPTF-associated factor 65 gamma	13					histone H3 acetylation|maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					CTGGCTTGATGATATTGGTAT	0.448													9	102	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37287790	37287790	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37287790C>G	uc002rpp.1	-	12	1879	c.1783G>C	c.(1783-1785)GAG>CAG	p.E595Q		NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	595							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				CGGGCCTTCTCAGCTTCCAAT	0.448													13	130	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43519295	43519295	+	Missense_Mutation	SNP	G	C	C	rs34600960		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43519295G>C	uc002rsw.3	-	33	5237	c.4885C>G	c.(4885-4887)CTG>GTG	p.L1629V	THADA_uc010far.2_Missense_Mutation_p.L824V|THADA_uc002rsx.3_Missense_Mutation_p.L1629V|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1629							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TTTGGGGTCAGATGGACACAG	0.488													3	17	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50779755	50779755	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50779755G>A	uc010fbq.2	-	9	3326	c.1849C>T	c.(1849-1851)CAT>TAT	p.H617Y	NRXN1_uc002rxb.3_Missense_Mutation_p.H249Y|NRXN1_uc002rxe.3_Missense_Mutation_p.H577Y|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AAGTCCACATGATACCATTCT	0.458													8	173	---	---	---	---	PASS
ETAA1	54465	broad.mit.edu	37	2	67637048	67637048	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67637048G>C	uc002sdz.1	+	6	2798	c.2659G>C	c.(2659-2661)GAA>CAA	p.E887Q		NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN	ETAA16 protein	887	Poly-Glu.					cytoplasm|nucleus				ovary(3)|large_intestine(1)	4						TTTAGAGGAAGAAGAGAAAAA	0.333													13	199	---	---	---	---	PASS
HTRA2	27429	broad.mit.edu	37	2	74757145	74757145	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74757145G>A	uc002smi.1	+	1	614	c.12G>A	c.(10-12)CCG>CCA	p.P4P	AUP1_uc002sme.2_5'Flank|AUP1_uc002smf.2_5'Flank|AUP1_uc002smg.2_5'Flank|AUP1_uc002smh.2_5'Flank|AUP1_uc010yrx.1_5'Flank|AUP1_uc010yry.1_5'Flank|HTRA2_uc002smj.1_Silent_p.P4P|HTRA2_uc002smk.1_Silent_p.P4P|HTRA2_uc002sml.1_Silent_p.P4P|HTRA2_uc002smm.1_Intron|HTRA2_uc002smn.1_Intron|HTRA2_uc010ffl.2_5'Flank	NM_013247	NP_037379	O43464	HTRA2_HUMAN	HtrA serine peptidase 2 isoform 1 preproprotein	4					apoptosis|proteolysis|response to stress	CD40 receptor complex|endoplasmic reticulum membrane|internal side of plasma membrane|mitochondrial intermembrane space|mitochondrial membrane|nucleus	serine-type endopeptidase activity|unfolded protein binding			ovary(1)	1						TGGCTGCGCCGAGGGCGGGGC	0.741													3	24	---	---	---	---	PASS
REV1	51455	broad.mit.edu	37	2	100019387	100019387	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100019387G>A	uc002tad.2	-	20	3561	c.3349C>T	c.(3349-3351)CTA>TTA	p.L1117L	REV1_uc002tac.2_Silent_p.L1116L	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	1117					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						TCATGTTTTAGAAACCCATCA	0.408								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					12	154	---	---	---	---	PASS
DBI	1622	broad.mit.edu	37	2	120124606	120124606	+	5'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120124606G>A	uc002tlv.2	+	1					C2orf76_uc002tls.2_5'Flank|C2orf76_uc010flf.1_5'Flank|C2orf76_uc010yyg.1_5'Flank|C2orf76_uc002tlt.2_5'Flank|C2orf76_uc002tlu.2_5'Flank|DBI_uc010yyh.1_5'UTR|DBI_uc010yyi.1_5'UTR|DBI_uc010yyj.1_RNA|DBI_uc010yyk.1_5'UTR|DBI_uc010yyl.1_5'UTR|DBI_uc010yym.1_5'UTR|DBI_uc010yyn.1_5'UTR|DBI_uc002tlw.2_5'UTR|DBI_uc010yyo.1_RNA|DBI_uc002tlx.2_5'Flank|DBI_uc010yyp.1_5'Flank	NM_001079862	NP_001073331	P07108	ACBP_HUMAN	diazepam binding inhibitor isoform 3						transport		benzodiazepine receptor binding|fatty-acyl-CoA binding				0						TGTCTCCCTGGAGTTCTTGCA	0.677													3	21	---	---	---	---	PASS
MAP3K2	10746	broad.mit.edu	37	2	128066317	128066317	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128066317G>C	uc002toj.1	-	15	1543	c.1478C>G	c.(1477-1479)TCA>TGA	p.S493*		NM_006609	NP_006600	Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase	493	Protein kinase.				activation of JUN kinase activity|cellular response to mechanical stimulus	nucleus	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein kinase binding			lung(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)		GTTGCCTGTTGAATCTCGCAG	0.433													13	146	---	---	---	---	PASS
R3HDM1	23518	broad.mit.edu	37	2	136433011	136433011	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136433011G>C	uc002tuo.2	+	19	2527	c.2157G>C	c.(2155-2157)CAG>CAC	p.Q719H	R3HDM1_uc010fni.2_Missense_Mutation_p.Q718H|R3HDM1_uc002tup.2_Missense_Mutation_p.Q664H|R3HDM1_uc010zbh.1_Missense_Mutation_p.Q467H	NM_015361	NP_056176	Q15032	R3HD1_HUMAN	R3H domain containing 1	719							nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)		TTGGAAATCAGATTCAAGGAG	0.423													10	135	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157492	145157492	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157492C>T	uc002tvu.2	-	8	1742	c.1262G>A	c.(1261-1263)GGA>GAA	p.G421E	ZEB2_uc002tvv.2_Missense_Mutation_p.G415E|ZEB2_uc010zbm.1_Missense_Mutation_p.G392E|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.G450E	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	421						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GCTGGTGGCTCCAAGCCCACC	0.453													17	99	---	---	---	---	PASS
TANC1	85461	broad.mit.edu	37	2	160035372	160035372	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160035372C>T	uc002uag.2	+	14	2482	c.2208C>T	c.(2206-2208)CTC>CTT	p.L736L	TANC1_uc010fol.1_Silent_p.L630L|TANC1_uc010zcm.1_Silent_p.L728L|TANC1_uc010fom.1_Silent_p.L542L|TANC1_uc002uai.1_RNA	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	736						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3						TCTCTGAGCTCTATTTGCTTC	0.552													29	268	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160295645	160295645	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160295645C>T	uc002uao.2	-	7	1127	c.775G>A	c.(775-777)GGC>AGC	p.G259S	BAZ2B_uc002uap.2_Missense_Mutation_p.G257S|BAZ2B_uc002uas.1_Missense_Mutation_p.G196S|BAZ2B_uc002uau.1_Missense_Mutation_p.G257S|BAZ2B_uc002uaq.1_Missense_Mutation_p.G187S|BAZ2B_uc002uat.3_Missense_Mutation_p.G196S|BAZ2B_uc010fop.1_Missense_Mutation_p.G257S	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	259	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CTACTAATGCCTTCACTTGAG	0.348													35	235	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170502533	170502533	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170502533G>C	uc002ufe.2	-	9	1571	c.1477C>G	c.(1477-1479)CTT>GTT	p.L493V		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	493											0						GCTTTTACAAGAGGGTAAATA	0.433													71	174	---	---	---	---	PASS
KLHL23	151230	broad.mit.edu	37	2	170597983	170597983	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170597983C>A	uc002ufh.1	+	5	1640	c.1302C>A	c.(1300-1302)GAC>GAA	p.D434E	KLHL23_uc002ufi.1_Missense_Mutation_p.D434E	NM_144711	NP_653312	Q8NBE8	KLH23_HUMAN	kelch-like 23	434	Kelch 4.										0						GCACCTATGACAAAGTTCAGA	0.438													5	106	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179397871	179397871	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179397871C>G	uc010zfg.1	-	307	95991	c.95767G>C	c.(95767-95769)GAA>CAA	p.E31923Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E25618Q|TTN_uc010zfi.1_Missense_Mutation_p.E25551Q|TTN_uc010zfj.1_Missense_Mutation_p.E25426Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32850							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTACACTTTCAGTTCCAGAA	0.433													15	206	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179477688	179477688	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179477688A>G	uc010zfg.1	-	214	42280	c.42056T>C	c.(42055-42057)GTC>GCC	p.V14019A	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V7714A|TTN_uc010zfi.1_Missense_Mutation_p.V7647A|TTN_uc010zfj.1_Missense_Mutation_p.V7522A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14946							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTTCAATGACATAAGACTC	0.478													8	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186670315	186670315	+	Intron	SNP	A	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186670315A>C	uc002upm.2	+						uc010zfu.1_5'Flank					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		AAACACCTTTACACAAATAAG	0.378													10	148	---	---	---	---	PASS
GLS	2744	broad.mit.edu	37	2	191818302	191818302	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191818302G>C	uc002usf.2	+	15	1926	c.1662G>C	c.(1660-1662)GTG>GTC	p.V554V	GLS_uc002ush.2_Silent_p.V215V|GLS_uc010zgi.1_Silent_p.V125V|GLS_uc010zgj.1_Silent_p.V59V	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor	554					cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TAAAGTCAGTGATAAATCTTT	0.388													4	310	---	---	---	---	PASS
SUMO1	7341	broad.mit.edu	37	2	203071900	203071900	+	Intron	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203071900G>C	uc002uyz.1	-						SUMO1_uc002uza.1_3'UTR	NM_001005781	NP_001005781	P63165	SUMO1_HUMAN	SMT3 suppressor of mif two 3 homolog 1 isoform a						DNA repair|interferon-gamma-mediated signaling pathway|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|palate development|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein complex assembly|protein sumoylation|regulation of interferon-gamma-mediated signaling pathway|regulation of protein localization	cytoplasm|nuclear membrane|nuclear pore|nuclear speck	ubiquitin protein ligase binding				0						ATTCCGTTTTGAACACCACAT	0.303													17	48	---	---	---	---	PASS
DNER	92737	broad.mit.edu	37	2	230312236	230312236	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230312236C>T	uc002vpv.2	-	8	1429	c.1282G>A	c.(1282-1284)GAA>AAA	p.E428K	DNER_uc010zly.1_Missense_Mutation_p.E156K	NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing	428	Extracellular (Potential).|EGF-like 5.				central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		ACCTTTTCTTCACAAGCAGAT	0.483													4	31	---	---	---	---	PASS
NCL	4691	broad.mit.edu	37	2	232321175	232321175	+	Intron	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232321175C>G	uc002vru.2	-						SNORA75_uc002vrv.1_5'Flank|SNORD20_uc002vrw.1_RNA	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		ACTTGACTATCTAGAGGAATT	0.418													9	97	---	---	---	---	PASS
PTMA	5757	broad.mit.edu	37	2	232577877	232577877	+	3'UTR	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232577877A>G	uc002vsc.3	+	5					PTMA_uc002vsb.3_3'UTR|PTMA_uc010zmf.1_RNA|MIR1244_hsa-mir-1244-1|MI0006379_5'Flank	NM_001099285	NP_001092755	P06454	PTMA_HUMAN	prothymosin, alpha isoform 1						transcription, DNA-dependent	nucleus					0		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		AGGGTCAGCCATTTTTAATGA	0.343													3	24	---	---	---	---	PASS
RBM44	375316	broad.mit.edu	37	2	238726510	238726510	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238726510G>C	uc002vxi.3	+	3	1083	c.951G>C	c.(949-951)TTG>TTC	p.L317F		NM_001080504	NP_001073973	Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	316							nucleotide binding|RNA binding			ovary(4)	4		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GTGGTTCCTTGAGCCCTCAAA	0.318													6	48	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1418703	1418703	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1418703C>T	uc003boz.2	+	17	2377	c.2110C>T	c.(2110-2112)CCA>TCA	p.P704S	CNTN6_uc011asj.1_Missense_Mutation_p.P632S|CNTN6_uc003bpa.2_Missense_Mutation_p.P704S	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	704	Fibronectin type-III 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TGTTGTGGCACCAGTAAACAT	0.378													8	211	---	---	---	---	PASS
HRH1	3269	broad.mit.edu	37	3	11301597	11301597	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11301597G>A	uc010hdr.2	+	2	1216	c.874G>A	c.(874-876)GAG>AAG	p.E292K	HRH1_uc010hds.2_Missense_Mutation_p.E292K|HRH1_uc010hdt.2_Missense_Mutation_p.E292K|HRH1_uc003bwb.3_Missense_Mutation_p.E292K	NM_001098213	NP_001091683	P35367	HRH1_HUMAN	histamine receptor H1	292	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	CTTCAGCCAAGAGGATGATAG	0.493													8	127	---	---	---	---	PASS
IQSEC1	9922	broad.mit.edu	37	3	12977699	12977699	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12977699C>T	uc003bxt.2	-	3	868	c.859G>A	c.(859-861)GGC>AGC	p.G287S	IQSEC1_uc003bxu.3_Missense_Mutation_p.G165S|IQSEC1_uc011auw.1_Missense_Mutation_p.G273S	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	287					regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						TGGTCCATGCCGTGCAGGGCT	0.662													12	97	---	---	---	---	PASS
FGD5	152273	broad.mit.edu	37	3	14861786	14861786	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14861786G>C	uc003bzc.2	+	1	1318	c.1208G>C	c.(1207-1209)GGA>GCA	p.G403A	FGD5_uc011avk.1_Missense_Mutation_p.G403A	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	403					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CTACAGGGTGGAGCGGCCGAG	0.632													3	27	---	---	---	---	PASS
HACL1	26061	broad.mit.edu	37	3	15642996	15642996	+	5'UTR	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15642996C>G	uc003caf.2	-	1					HACL1_uc011avr.1_RNA|HACL1_uc011avs.1_5'UTR|HACL1_uc011avt.1_5'UTR|HACL1_uc003cag.2_5'UTR|HACL1_uc011avu.1_5'UTR|HACL1_uc010hep.2_5'UTR|BTD_uc011avv.1_5'Flank|BTD_uc003cah.2_5'Flank|BTD_uc011avw.1_5'Flank|BTD_uc011avx.1_5'Flank	NM_012260	NP_036392	Q9UJ83	HACL1_HUMAN	2-hydroxyphytanoyl-CoA lyase						fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0						TCTAAGCACTCACGCAGCCGG	0.577													11	56	---	---	---	---	PASS
HACL1	26061	broad.mit.edu	37	3	15643075	15643075	+	5'UTR	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15643075C>G	uc003caf.2	-	1					HACL1_uc011avr.1_RNA|HACL1_uc011avs.1_5'UTR|HACL1_uc011avt.1_5'UTR|HACL1_uc003cag.2_5'UTR|HACL1_uc011avu.1_5'UTR|HACL1_uc010hep.2_5'UTR|BTD_uc011avv.1_5'Flank|BTD_uc003cah.2_5'Flank|BTD_uc011avw.1_5'Flank|BTD_uc011avx.1_5'Flank	NM_012260	NP_036392	Q9UJ83	HACL1_HUMAN	2-hydroxyphytanoyl-CoA lyase						fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0						TACTGCACCTCTGACGGACAG	0.562													4	15	---	---	---	---	PASS
SUSD5	26032	broad.mit.edu	37	3	33194715	33194715	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33194715G>C	uc003cfo.1	-	5	1827	c.1409C>G	c.(1408-1410)TCA>TGA	p.S470*		NM_015551	NP_056366	O60279	SUSD5_HUMAN	sushi domain containing 5 precursor	470	Extracellular (Potential).				cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2						GGGTAGAGTTGACTGGTACTT	0.517													3	61	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36874809	36874809	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36874809C>T	uc003cgj.2	-	12	4785	c.4483G>A	c.(4483-4485)GAA>AAA	p.E1495K		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	2045					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						AGGAGGATTTCCAAGCCCCCT	0.532													6	91	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47158213	47158213	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47158213G>A	uc003cqs.2	-	4	4539	c.4486C>T	c.(4486-4488)CGA>TGA	p.R1496*	SETD2_uc003cqv.2_Nonsense_Mutation_p.R1485*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1496	AWS.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CACTGCATTCGCTTAATATCT	0.313			N|F|S|Mis		clear cell renal carcinoma								12	139	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48609570	48609570	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48609570C>T	uc003ctz.2	-	90	7014	c.7013G>A	c.(7012-7014)CGA>CAA	p.R2338Q		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2338	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTTCTCGCCTCGCGGCCCTGG	0.612													7	30	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48612870	48612870	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48612870C>A	uc003ctz.2	-	73	6083	c.6082G>T	c.(6082-6084)GGG>TGG	p.G2028W		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2028	Triple-helical region.		G -> A (in DDEB).|G -> R (in DDEB and EBP).		cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCGGAAGGCCCGGGGGGGCCC	0.716													3	34	---	---	---	---	PASS
ZMYND10	51364	broad.mit.edu	37	3	50379109	50379109	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50379109C>T	uc003dag.1	-	11	1289	c.1143G>A	c.(1141-1143)CTG>CTA	p.L381L	RASSF1_uc003dad.1_5'Flank|RASSF1_uc003dae.1_5'Flank|RASSF1_uc010hlk.1_5'Flank|RASSF1_uc003daf.1_5'Flank|RASSF1_uc011bdq.1_5'Flank|ZMYND10_uc010hll.1_Silent_p.L376L	NM_015896	NP_056980	O75800	ZMY10_HUMAN	zinc finger, MYND domain-containing 10	381						cytoplasm	protein binding|zinc ion binding			lung(4)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTAGCACATCCAGCCTGTAGG	0.612										TSP Lung(30;0.18)			12	67	---	---	---	---	PASS
STAB1	23166	broad.mit.edu	37	3	52547984	52547984	+	Missense_Mutation	SNP	G	T	T	rs149300853		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52547984G>T	uc003dej.2	+	32	3508	c.3434G>T	c.(3433-3435)CGG>CTG	p.R1145L		NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1145	FAS1 4.|Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		AGCCTCTTCCGGGAATTGCTG	0.652													11	171	---	---	---	---	PASS
PDE12	201626	broad.mit.edu	37	3	57543244	57543244	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57543244G>A	uc003diw.3	+	1	1264	c.1138G>A	c.(1138-1140)GAA>AAA	p.E380K	PDE12_uc003div.2_Missense_Mutation_p.E380K	NM_177966	NP_808881	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	380							hydrolase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		CAAGCAGCACGAAGGCCTGGC	0.537													4	74	---	---	---	---	PASS
FLNB	2317	broad.mit.edu	37	3	57994493	57994493	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57994493C>G	uc003djj.2	+	1	367	c.202C>G	c.(202-204)CAG>GAG	p.Q68E	FLNB_uc010hne.2_Missense_Mutation_p.Q68E|FLNB_uc003djk.2_Missense_Mutation_p.Q68E|FLNB_uc010hnf.2_Missense_Mutation_p.Q68E	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	68	Actin-binding.|CH 1.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CAAGTACCATCAGCGGCCCAC	0.617													5	124	---	---	---	---	PASS
PXK	54899	broad.mit.edu	37	3	58377546	58377546	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58377546G>A	uc003djz.1	+	7	686	c.587G>A	c.(586-588)TGT>TAT	p.C196Y	PXK_uc003djx.1_Missense_Mutation_p.C196Y|PXK_uc003djy.1_Missense_Mutation_p.C179Y|PXK_uc003dka.1_Missense_Mutation_p.C196Y|PXK_uc003dkb.1_Missense_Mutation_p.C113Y|PXK_uc003dkc.1_Missense_Mutation_p.C179Y|PXK_uc011bfe.1_Missense_Mutation_p.C163Y|PXK_uc010hnj.1_Missense_Mutation_p.C163Y|PXK_uc003dkd.1_Missense_Mutation_p.C59Y|PXK_uc010hnk.1_Intron	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase	196	Protein kinase.				cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		GATTTTCAGTGTCTAATCAAA	0.383													20	233	---	---	---	---	PASS
ACOX2	8309	broad.mit.edu	37	3	58508267	58508267	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58508267C>T	uc003dkl.2	-	12	1763	c.1588G>A	c.(1588-1590)GAG>AAG	p.E530K		NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2	530					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		TTCCAAGCCTCGTGCTGGTCA	0.532													23	75	---	---	---	---	PASS
ATXN7	6314	broad.mit.edu	37	3	63938123	63938123	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63938123C>T	uc003dlw.3	+	5	1016	c.463C>T	c.(463-465)CAG>TAG	p.Q155*	ATXN7_uc003dlv.2_Nonsense_Mutation_p.Q155*|ATXN7_uc010hnv.2_Nonsense_Mutation_p.Q155*	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	155					cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		CGACTGTAATCAGGTTGTCAA	0.373													14	175	---	---	---	---	PASS
ATXN7	6314	broad.mit.edu	37	3	63975994	63975994	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63975994G>A	uc003dlw.3	+	10	2057	c.1504G>A	c.(1504-1506)GAG>AAG	p.E502K	ATXN7_uc003dlv.2_Missense_Mutation_p.E502K|ATXN7_uc010hnv.2_Missense_Mutation_p.E502K|ATXN7_uc011bfn.1_Missense_Mutation_p.E357K	NM_000333	NP_000324	O15265	ATX7_HUMAN	ataxin 7 isoform a	502					cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		TGACAAAGAAGAGTCTGTTGA	0.552													5	103	---	---	---	---	PASS
C3orf64	285203	broad.mit.edu	37	3	69027583	69027583	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69027583G>A	uc003dnl.2	-	17	1743	c.1338C>T	c.(1336-1338)TAC>TAT	p.Y446Y	C3orf64_uc003dnj.2_Silent_p.Y125Y|C3orf64_uc003dnk.2_Silent_p.Y362Y|C3orf64_uc011bfw.1_RNA	NM_173654	NP_775925	Q5NDL2	AER61_HUMAN	AER61 glycosyltransferase	446						extracellular region	transferase activity, transferring glycosyl groups			ovary(1)	1		Lung NSC(201;0.126)		BRCA - Breast invasive adenocarcinoma(55;4.61e-05)|Epithelial(33;0.000291)|LUSC - Lung squamous cell carcinoma(21;0.0127)|KIRC - Kidney renal clear cell carcinoma(39;0.216)		CTTCACAGTTGTACCTAAGGA	0.453													12	138	---	---	---	---	PASS
FOXP1	27086	broad.mit.edu	37	3	71050197	71050197	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71050197C>G	uc003dol.2	-	9	1311	c.988G>C	c.(988-990)GAG>CAG	p.E330Q	FOXP1_uc003dom.2_Missense_Mutation_p.E254Q|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Missense_Mutation_p.E330Q|FOXP1_uc003dop.2_Missense_Mutation_p.E330Q|FOXP1_uc003doq.1_Missense_Mutation_p.E329Q|FOXP1_uc003doi.2_Missense_Mutation_p.E230Q|FOXP1_uc003doj.2_Missense_Mutation_p.E230Q|FOXP1_uc003dok.2_Missense_Mutation_p.E143Q|FOXP1_uc003dor.1_Missense_Mutation_p.E108Q	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	330	C2H2-type.				cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		AGCGCATGCTCACTGTTGAGA	0.353			T	PAX5	ALL								9	123	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98188798	98188798	+	Silent	SNP	A	C	C	rs112214721		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98188798A>C	uc003dsm.2	+	1	378	c.378A>C	c.(376-378)ATA>ATC	p.I126I		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						ATGTGGCCATATGCAACCCAC	0.468													31	247	---	---	---	---	PASS
OR5K2	402135	broad.mit.edu	37	3	98216586	98216586	+	Missense_Mutation	SNP	C	T	T	rs143260385	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98216586C>T	uc011bgx.1	+	1	62	c.62C>T	c.(61-63)CCT>CTT	p.P21L		NM_001004737	NP_001004737	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						ACAGATCACCCTGAGCTGAAG	0.413													14	256	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108129603	108129603	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108129603G>C	uc003dxa.1	-	32	4439	c.4382C>G	c.(4381-4383)TCT>TGT	p.S1461C		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1461	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						GGCCTTGCCAGACTGCAGCTG	0.632													5	67	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109050829	109050829	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109050829C>T	uc003dxq.3	-	3	283	c.228G>A	c.(226-228)CAG>CAA	p.Q76Q	DPPA4_uc011bho.1_Silent_p.Q76Q|DPPA4_uc011bhp.1_Silent_p.Q76Q	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	76						nucleus	protein binding			upper_aerodigestive_tract(1)	1						GTATCTTCTTCTGAGGTCTGG	0.458													35	228	---	---	---	---	PASS
CD200R1L	344807	broad.mit.edu	37	3	112564630	112564630	+	5'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112564630C>T	uc003dzi.1	-	1					CD200R1L_uc011bhw.1_5'UTR|CD200R1L_uc010hqf.1_5'UTR	NM_001008784	NP_001008784	Q6Q8B3	MO2R2_HUMAN	CD200 cell surface glycoprotein receptor 2							integral to membrane	receptor activity			ovary(1)	1						CACTTTAAATCAATCAACAGA	0.338													5	129	---	---	---	---	PASS
GTPBP8	29083	broad.mit.edu	37	3	112719848	112719848	+	3'UTR	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112719848A>G	uc003dzn.2	+	6					GTPBP8_uc011bhy.1_RNA|GTPBP8_uc003dzp.2_RNA|GTPBP8_uc003dzo.2_3'UTR	NM_014170	NP_054889	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 isoform 1						barrier septum formation		GTP binding				0						AAGAATTTCAACATTGTTTTA	0.348													4	57	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112968604	112968604	+	5'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112968604C>T	uc003dzx.2	+	3					BOC_uc010hqi.2_5'UTR|BOC_uc003dzy.2_5'UTR|BOC_uc003dzz.2_5'UTR|BOC_uc003dzw.1_5'UTR|BOC_uc003eaa.1_5'UTR	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor						cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			CTTTGTGTGACCCTGGCGGCT	0.567													3	39	---	---	---	---	PASS
NDUFB4	4710	broad.mit.edu	37	3	120315170	120315170	+	5'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120315170G>A	uc003edu.2	+	1					NDUFB4_uc003edt.2_5'UTR	NM_004547	NP_004538	O95168	NDUB4_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta						mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0				GBM - Glioblastoma multiforme(114;0.14)	NADH(DB00157)	AAGGGCCTCAGAATCGCGCAG	0.587													4	20	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121412961	121412961	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121412961C>G	uc003eei.3	-	13	6520	c.6394G>C	c.(6394-6396)GAG>CAG	p.E2132Q	GOLGB1_uc010hrc.2_Missense_Mutation_p.E2137Q|GOLGB1_uc003eej.3_Missense_Mutation_p.E2098Q|GOLGB1_uc011bjm.1_Missense_Mutation_p.E2018Q|GOLGB1_uc010hrd.1_Missense_Mutation_p.E2096Q	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2132	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		AGGTGCTTCTCTTCTGCCTGT	0.398													72	577	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121413280	121413280	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121413280C>T	uc003eei.3	-	13	6201	c.6075G>A	c.(6073-6075)CAG>CAA	p.Q2025Q	GOLGB1_uc010hrc.2_Silent_p.Q2030Q|GOLGB1_uc003eej.3_Silent_p.Q1991Q|GOLGB1_uc011bjm.1_Silent_p.Q1911Q|GOLGB1_uc010hrd.1_Silent_p.Q1989Q	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2025	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TGCAGTCCTTCTGTAGCTGCT	0.358													31	363	---	---	---	---	PASS
KPNA1	3836	broad.mit.edu	37	3	122186201	122186201	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122186201C>T	uc003efd.1	-	3	241	c.205G>A	c.(205-207)GAG>AAG	p.E69K	KPNA1_uc011bjr.1_5'UTR|KPNA1_uc010hrh.2_5'UTR|KPNA1_uc003efe.2_Missense_Mutation_p.E69K	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1	69					DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		ATCTGAGCCTCATGAAAGCCT	0.363													8	95	---	---	---	---	PASS
PDIA5	10954	broad.mit.edu	37	3	122811201	122811201	+	Splice_Site	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122811201G>A	uc003egc.1	+	3	226	c.170_splice	c.e3-1	p.E57_splice	PDIA5_uc003egd.1_Splice_Site	NM_006810	NP_006801	Q14554	PDIA5_HUMAN	protein disulfide isomerase A5 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)		TTTTTTTACAGAGGTGGCAGC	0.502													10	104	---	---	---	---	PASS
RAB7A	7879	broad.mit.edu	37	3	128516892	128516892	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128516892G>C	uc003eks.1	+	3	392	c.160G>C	c.(160-162)GAC>CAC	p.D54H	RAB7A_uc010hsv.1_Missense_Mutation_p.D54H|RAB7A_uc003ekt.2_Missense_Mutation_p.D30H	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family	54					endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		GATGGTGGATGACAGGCTAGT	0.428													3	140	---	---	---	---	PASS
PLSCR5	389158	broad.mit.edu	37	3	146311797	146311797	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146311797C>T	uc003ewb.2	-	4	1367	c.363G>A	c.(361-363)CTG>CTA	p.L121L	PLSCR5_uc010hvb.2_Silent_p.L109L|PLSCR5_uc010hvc.2_Silent_p.L121L	NM_001085420	NP_001078889	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	121											0						CTGTGATCCTCAGGGTGCAAG	0.453													11	223	---	---	---	---	PASS
SAMD7	344658	broad.mit.edu	37	3	169644760	169644760	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169644760C>T	uc003fgd.2	+	6	977	c.710C>T	c.(709-711)TCA>TTA	p.S237L	SAMD7_uc003fge.2_Missense_Mutation_p.S237L|SAMD7_uc011bpo.1_Missense_Mutation_p.S138L	NM_182610	NP_872416	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	237										skin(1)	1	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			AACCAGAAGTCAAGTGAAACG	0.498													22	124	---	---	---	---	PASS
SPATA16	83893	broad.mit.edu	37	3	172643146	172643146	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172643146C>G	uc003fin.3	-	7	1376	c.1218G>C	c.(1216-1218)CCG>CCC	p.P406P		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	406					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			CTGTGAATATCGGCAGCTTCC	0.373													3	92	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179448467	179448467	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179448467C>G	uc003fkh.2	+	10	1305	c.1224C>G	c.(1222-1224)CTC>CTG	p.L408L	USP13_uc003fkf.2_Silent_p.L408L	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	408					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			AATCTGAACTCATTGAACAGG	0.468													8	95	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179526147	179526147	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179526147C>G	uc003fki.1	-	13	1561	c.1431G>C	c.(1429-1431)CAG>CAC	p.Q477H	PEX5L_uc011bqd.1_Missense_Mutation_p.Q434H|PEX5L_uc011bqe.1_Missense_Mutation_p.Q285H|PEX5L_uc011bqf.1_Missense_Mutation_p.Q369H|PEX5L_uc003fkj.1_Missense_Mutation_p.Q442H|PEX5L_uc010hxd.1_Missense_Mutation_p.Q475H|PEX5L_uc011bqg.1_Missense_Mutation_p.Q453H|PEX5L_uc011bqh.1_Missense_Mutation_p.Q418H	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	477	TPR 3.				protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CTAGACCTGTCTGCAGGTCTG	0.443													11	159	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183217456	183217456	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183217456C>G	uc003flr.2	-	4	1127	c.1069G>C	c.(1069-1071)GAG>CAG	p.E357Q	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Intron	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	357	Kelch 1.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			AGCTCATGCTCTGTTAGCGGG	0.552													15	218	---	---	---	---	PASS
PARL	55486	broad.mit.edu	37	3	183585733	183585733	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183585733G>T	uc003fmd.2	-	2	300	c.241C>A	c.(241-243)CCT>ACT	p.P81T	PARL_uc003fme.2_Missense_Mutation_p.P81T	NM_018622	NP_061092	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like isoform 1	81	Mitochondrial matrix (Potential).				proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity				0	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TCCACAGGAGGAATCAAAGCA	0.423													7	236	---	---	---	---	PASS
TRA2B	6434	broad.mit.edu	37	3	185636158	185636158	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185636158G>A	uc003fpv.2	-	8	1127	c.851C>T	c.(850-852)TCA>TTA	p.S284L	TRA2B_uc003fpt.2_RNA|TRA2B_uc003fpu.2_RNA|TRA2B_uc010hym.2_Missense_Mutation_p.S184L|TRA2B_uc003fpw.2_Missense_Mutation_p.S264L	NM_004593	NP_004584	P62995	TRA2B_HUMAN	splicing factor, arginine/serine-rich 10	284	Arg/Ser-rich (RS2 domain).				nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)	2						CTTACGAGGTGAGTATGATCG	0.378													8	167	---	---	---	---	PASS
ZNF595	152687	broad.mit.edu	37	4	87139	87139	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87139A>G	uc003fzv.1	+	6	1901	c.1745A>G	c.(1744-1746)CAT>CGT	p.H582R	ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc011bus.1_Missense_Mutation_p.H350R|ZNF595_uc011but.1_Missense_Mutation_p.H350R	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	582					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CTTACTAAACATAAGAGAATT	0.373													19	49	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1980413	1980413	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1980413C>T	uc003gdz.3	+	22	4051	c.3875C>T	c.(3874-3876)TCG>TTG	p.S1292L	WHSC1_uc003geb.3_Missense_Mutation_p.S1292L|WHSC1_uc003gec.3_Missense_Mutation_p.S1292L|WHSC1_uc003ged.3_Missense_Mutation_p.S1292L|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gei.3_Missense_Mutation_p.S511L|WHSC1_uc011bvh.1_Missense_Mutation_p.S353L|WHSC1_uc010icf.2_Missense_Mutation_p.S640L	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	1292					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GGCAAACCTTCGACTTCATTT	0.542			T	IGH@	MM								12	89	---	---	---	---	PASS
KIAA0232	9778	broad.mit.edu	37	4	6873346	6873346	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6873346G>A	uc003gjr.3	+	8	4310	c.3847G>A	c.(3847-3849)GAA>AAA	p.E1283K	KIAA0232_uc003gjq.3_Missense_Mutation_p.E1283K	NM_014743	NP_055558	Q92628	K0232_HUMAN	hypothetical protein LOC9778	1283							ATP binding			ovary(2)	2						TAGAAGTCAAGAAAAACAGAC	0.353													15	107	---	---	---	---	PASS
TLR6	10333	broad.mit.edu	37	4	38831092	38831092	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38831092C>T	uc003gtm.2	-	1	69	c.3G>A	c.(1-3)ATG>ATA	p.M1I	TLR6_uc010ifg.1_Missense_Mutation_p.M1I	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	1					activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						TGTCTTTGGTCATGATGTTGC	0.343													5	165	---	---	---	---	PASS
PDS5A	23244	broad.mit.edu	37	4	39905710	39905710	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39905710C>T	uc003guv.3	-	12	1875	c.1335G>A	c.(1333-1335)TGG>TGA	p.W445*	PDS5A_uc010ifo.2_Nonsense_Mutation_p.W405*|PDS5A_uc003guw.3_Nonsense_Mutation_p.W445*	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	445					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						TGTCCTTTATCCAGCTGACTT	0.383													3	34	---	---	---	---	PASS
PAICS	10606	broad.mit.edu	37	4	57325748	57325748	+	3'UTR	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57325748C>G	uc003hbs.1	+	10					PAICS_uc011cac.1_3'UTR|PAICS_uc003hbt.1_3'UTR|PAICS_uc003hbu.1_3'UTR|PAICS_uc010ihd.1_3'UTR	NM_006452	NP_006443	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase,						'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|identical protein binding|phosphoribosylaminoimidazole carboxylase activity|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity				0	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	CTACAAATTTCTAATTTAGCT	0.289													4	31	---	---	---	---	PASS
PF4V1	5197	broad.mit.edu	37	4	74719041	74719041	+	5'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74719041C>T	uc003hhg.1	+	1						NM_002620	NP_002611	P10720	PF4V_HUMAN	platelet factor 4 variant 1						immune response	extracellular region	chemokine activity|heparin binding				0	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GCCCGACTTTCCCTGCGCACT	0.642													3	19	---	---	---	---	PASS
PPBP	5473	broad.mit.edu	37	4	74853297	74853297	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74853297G>A	uc003hhj.2	-	2	301	c.221C>T	c.(220-222)CCC>CTC	p.P74L		NM_002704	NP_002695	P02775	CXCL7_HUMAN	pro-platelet basic protein precursor	74					chemotaxis|defense response to bacterium|immune response|platelet activation|platelet degranulation|positive regulation of cell division	extracellular space|platelet alpha granule lumen	chemokine activity|glucose transmembrane transporter activity|growth factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			GATGTTTTTGGGATGAATTCC	0.393													27	72	---	---	---	---	PASS
CNOT6L	246175	broad.mit.edu	37	4	78663304	78663304	+	Missense_Mutation	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78663304T>C	uc011ccd.1	-	8	994	c.863A>G	c.(862-864)AAA>AGA	p.K288R	CNOT6L_uc003hks.2_Missense_Mutation_p.K288R|CNOT6L_uc003hkt.1_Missense_Mutation_p.K131R|CNOT6L_uc011cce.1_3'UTR	NM_144571	NP_653172	Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	288					nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding			large_intestine(1)	1						CTTTTCTGTTTTGAAGAATAT	0.338													6	31	---	---	---	---	PASS
BMP3	651	broad.mit.edu	37	4	81967324	81967324	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81967324C>T	uc003hmg.3	+	2	1069	c.749C>T	c.(748-750)TCT>TTT	p.S250F		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	250					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						GCCGCCATTTCTGAGCCAGAA	0.473													15	114	---	---	---	---	PASS
COPS4	51138	broad.mit.edu	37	4	83996452	83996452	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83996452C>T	uc003hoa.2	+	10	1229	c.1090C>T	c.(1090-1092)CGA>TGA	p.R364*	COPS4_uc003hob.2_Missense_Mutation_p.T413M|COPS4_uc010ijw.2_Nonsense_Mutation_p.R396*|COPS4_uc010ijx.2_Silent_p.H335H	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	364					cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				CCCCTTAGCACGAGAAGCCCT	0.363													5	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	88813610	88813610	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88813610C>G	uc010iko.1	+	2	554	c.554C>G	c.(553-555)TCT>TGT	p.S185C						SubName: Full=Heat shock protein 90kDa alpha (Cytosolic), class B member 1, isoform CRA_a; SubName: Full=cDNA, FLJ92550, Homo sapiens heat shock 90kDa protein 1, beta (HSPCB), mRNA;																		AAGAAGCATTCTCAGTTCATA	0.353													4	75	---	---	---	---	PASS
ZNF330	27309	broad.mit.edu	37	4	142147922	142147922	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142147922G>A	uc003iiq.3	+	5	433	c.213G>A	c.(211-213)GGG>GGA	p.G71G	ZNF330_uc011chl.1_Silent_p.G11G	NM_014487	NP_055302	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	71	C4-type 2 (Potential).					chromosome, centromeric region|midbody|nucleolus	protein binding|zinc ion binding				0	all_hematologic(180;0.162)					CTTCATTAGGGAAAACAAAGT	0.393													24	109	---	---	---	---	PASS
PLRG1	5356	broad.mit.edu	37	4	155458505	155458505	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155458505G>C	uc003iny.2	-	14	1481	c.1418C>G	c.(1417-1419)TCT>TGT	p.S473C	PLRG1_uc003inz.2_Missense_Mutation_p.S464C	NM_002669	NP_002660	O43660	PLRG1_HUMAN	pleiotropic regulator 1 (PRL1 homolog,	473	WD 7.					catalytic step 2 spliceosome|nuclear speck	protein binding|signal transducer activity|transcription corepressor activity				0	all_hematologic(180;0.215)	Renal(120;0.0854)				TCGACTTTCAGACTGATCAAA	0.408													15	41	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155507881	155507881	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155507881G>C	uc003iod.1	-	5	758	c.700C>G	c.(700-702)CCC>GCC	p.P234A	FGA_uc003ioe.1_Missense_Mutation_p.P234A|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	234	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AAATTTCCGGGAACCAAGTCT	0.458													3	137	---	---	---	---	PASS
HMGB2	3148	broad.mit.edu	37	4	174254744	174254744	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174254744G>A	uc011ckc.1	-	1	177	c.57C>T	c.(55-57)TTC>TTT	p.F19F	HMGB2_uc003ita.3_Silent_p.F19F|HMGB2_uc003itb.2_Silent_p.F19F|HMGB2_uc003itc.2_Silent_p.F19F	NM_001130689	NP_001124161	P26583	HMGB2_HUMAN	high-mobility group box 2	19	HMG box 1.				base-excision repair, DNA ligation|cell chemotaxis|cellular response to lipopolysaccharide|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|negative regulation of transcription, DNA-dependent|nucleosome assembly|phosphatidylinositol-mediated signaling|positive regulation of DNA binding|positive regulation of endothelial cell proliferation|positive regulation of erythrocyte differentiation|positive regulation of megakaryocyte differentiation|positive regulation of nuclease activity|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	condensed chromosome|extracellular space|nucleolus|nucleoplasm|perinuclear region of cytoplasm|protein complex	chemoattractant activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding|transcription regulatory region DNA binding				0		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		AGGTCTGCACGAAGAAGGCGT	0.582													7	70	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183675804	183675804	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183675804G>C	uc003ivd.1	+	21	4321	c.4284G>C	c.(4282-4284)CGG>CGC	p.R1428R	ODZ3_uc003ive.1_Silent_p.R841R	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1428	Extracellular (Potential).|NHL 4.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		AAATTAACCGGATAAGGCAGG	0.478													3	36	---	---	---	---	PASS
SNX25	83891	broad.mit.edu	37	4	186278863	186278863	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186278863C>T	uc003ixh.2	+	16	2320	c.2131C>T	c.(2131-2133)CAG>TAG	p.Q711*	SNX25_uc010ish.2_Nonsense_Mutation_p.Q427*|SNX25_uc003ixi.2_Nonsense_Mutation_p.Q215*	NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25	711					cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TGCCCTCGTTCAGGTCACTTT	0.368													10	104	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13865914	13865914	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13865914C>G	uc003jfd.2	-	27	4260	c.4218G>C	c.(4216-4218)AAG>AAC	p.K1406N		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1406	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTAGTTGCTTCTTTATTTCAA	0.343									Kartagener_syndrome				19	113	---	---	---	---	PASS
FAM105A	54491	broad.mit.edu	37	5	14607518	14607518	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14607518C>A	uc003jfj.2	+	6	691	c.578C>A	c.(577-579)TCG>TAG	p.S193*		NM_019018	NP_061891	Q9NUU6	F105A_HUMAN	hypothetical protein LOC54491	193										ovary(1)	1	Lung NSC(4;0.00592)					TATACAGGCTCGAATGTGTTT	0.388													3	91	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37045560	37045560	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37045560T>A	uc003jkl.3	+	37	6858	c.6359T>A	c.(6358-6360)TTA>TAA	p.L2120*	NIPBL_uc003jkk.3_Nonsense_Mutation_p.L2120*	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2120					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			ATTTCAAAATTAAAAAGTCAA	0.303													51	151	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37703084	37703084	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37703084C>G	uc003jkv.2	+	13	1369	c.1311C>G	c.(1309-1311)CTC>CTG	p.L437L		NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70	437	WD 6.									ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATGATAAGCTCATAGTCACTG	0.413													8	130	---	---	---	---	PASS
LIFR	3977	broad.mit.edu	37	5	38484884	38484884	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38484884G>A	uc010ive.1	-	18	2916	c.2584C>T	c.(2584-2586)CGA>TGA	p.R862*	LIFR_uc003jli.2_Nonsense_Mutation_p.R862*	NM_001127671	NP_001121143	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor	862	Cytoplasmic (Potential).				positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)					TACCATTCTCGTTTCCGATAG	0.363			T	PLAG1	salivary adenoma								4	29	---	---	---	---	PASS
ZNF131	7690	broad.mit.edu	37	5	43161885	43161885	+	Silent	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43161885A>G	uc011cpw.1	+	5	942	c.906A>G	c.(904-906)GCA>GCG	p.A302A	ZNF131_uc010ivl.1_Silent_p.A268A|ZNF131_uc003jnj.3_Silent_p.A23A|ZNF131_uc003jnk.2_Silent_p.A268A|ZNF131_uc003jnn.3_Silent_p.A23A|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131	302	C2H2-type 2.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GAGAGAGCGCATGGAAACAGC	0.373													21	65	---	---	---	---	PASS
FST	10468	broad.mit.edu	37	5	52778823	52778823	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52778823G>C	uc003jpd.2	+	2	226	c.199G>C	c.(199-201)GAG>CAG	p.E67Q	FST_uc003jpc.2_Missense_Mutation_p.E67Q	NM_013409	NP_037541	P19883	FST_HUMAN	follistatin isoform FST344 precursor	67	TB.				hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity				0		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				CTCGTGGACCGAGGAGGACGT	0.587											OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	28	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54579357	54579357	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54579357C>T	uc003jpx.2	-	11	1759	c.1639G>A	c.(1639-1641)GAA>AAA	p.E547K	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	547							ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CTAACAGGTTCCAAATCTTCC	0.398													16	224	---	---	---	---	PASS
DHX29	54505	broad.mit.edu	37	5	54579455	54579455	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54579455C>G	uc003jpx.2	-	11	1661	c.1541G>C	c.(1540-1542)AGA>ACA	p.R514T	DHX29_uc010ivw.2_RNA	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	514	Potential.						ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				AGAGTTTTCTCTCTTATTTTC	0.378													21	165	---	---	---	---	PASS
TAF9	6880	broad.mit.edu	37	5	68661350	68661350	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68661350C>T	uc003jwc.1	-	2	547	c.215G>A	c.(214-216)CGA>CAA	p.R72Q	TAF9_uc003jwa.2_Intron|TAF9_uc003jwb.2_Intron|TAF9_uc003jwd.1_Missense_Mutation_p.R72Q|TAF9_uc003jwe.1_Missense_Mutation_p.R72Q|TAF9_uc003jwf.1_Missense_Mutation_p.R72Q	NM_003187	NP_003178	Q16594	TAF9_HUMAN	TAF9 RNA polymerase II, TATA box binding	72					histone H3 acetylation|negative regulation of apoptosis|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of cell growth|positive regulation of response to cytokine stimulus|positive regulation of transcription from RNA polymerase II promoter|response to interleukin-1|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	MLL1 complex|PCAF complex|pre-snoRNP complex|STAGA complex|transcription factor TFIID complex|transcription factor TFTC complex	activating transcription factor binding|C2H2 zinc finger domain binding|p53 binding|transcription coactivator activity|transcription regulatory region DNA binding				0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.1e-56)|Epithelial(20;9.54e-53)|all cancers(19;2.2e-48)|Lung(70;0.0176)		GATTGCCAATCGCACATCATC	0.418													14	144	---	---	---	---	PASS
POLK	51426	broad.mit.edu	37	5	74869692	74869692	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74869692G>C	uc003kdw.2	+	5	634	c.538G>C	c.(538-540)GAG>CAG	p.E180Q	POLK_uc003kdx.2_RNA|POLK_uc003kdy.2_RNA|POLK_uc003kea.2_Missense_Mutation_p.E180Q|POLK_uc003keb.2_Missense_Mutation_p.E180Q|POLK_uc010izq.2_Missense_Mutation_p.E180Q|POLK_uc003kec.2_Missense_Mutation_p.E90Q|POLK_uc010izr.2_RNA|POLK_uc010izs.2_RNA|POLK_uc003ked.2_Missense_Mutation_p.E90Q|POLK_uc003kee.2_Missense_Mutation_p.E180Q|POLK_uc003kef.2_Missense_Mutation_p.E90Q	NM_016218	NP_057302	Q9UBT6	POLK_HUMAN	DNA-directed DNA polymerase kappa	180	UmuC.				DNA replication|nucleotide-excision repair, DNA gap filling	nucleus	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding			ovary(2)|kidney(2)	4		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TGTGAGTAAAGAGGTAAGTTA	0.458								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	69	---	---	---	---	PASS
POC5	134359	broad.mit.edu	37	5	74970317	74970317	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74970317G>C	uc003keh.3	-	12	1868	c.1671C>G	c.(1669-1671)ACC>ACG	p.T557T	POC5_uc010izu.2_Silent_p.T381T|POC5_uc003keg.3_Silent_p.T532T	NM_001099271	NP_001092741	Q8NA72	POC5_HUMAN	proteome of centriole 5 isoform 1	557					cell cycle	centriole				lung(1)	1						GAGCTGATCTGGTTCCAAGTG	0.433													43	185	---	---	---	---	PASS
LOC100133050	100133050	broad.mit.edu	37	5	99715528	99715528	+	RNA	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99715528C>T	uc011cuw.1	-	4		c.382G>A				NR_027503				Homo sapiens glucuronidase, beta pseudogene (LOC100133050), non-coding RNA.												0						AGCGGACAGTCGAAGCCCTTC	0.607													3	3	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127609548	127609548	+	Silent	SNP	G	A	A	rs28763922	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127609548G>A	uc003kuu.2	-	61	8263	c.7824C>T	c.(7822-7824)ACC>ACT	p.T2608T		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2608	EGF-like 44; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGTTCAGTCCGGTGGCATCAA	0.393													4	66	---	---	---	---	PASS
FNIP1	96459	broad.mit.edu	37	5	131007915	131007915	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131007915G>A	uc003kvs.1	-	14	2364	c.2222C>T	c.(2221-2223)TCA>TTA	p.S741L	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.S713L|FNIP1_uc010jdm.1_Missense_Mutation_p.S696L	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	741					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)|skin(1)	2		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		ACAAGAAAATGAAGCAGGCAC	0.453													21	199	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140605521	140605521	+	3'UTR	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140605521G>C	uc003ljb.2	+	1					PCDHB14_uc011dal.1_3'UTR	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGGCAAGCTGATGGTACTTT	0.303													3	41	---	---	---	---	PASS
SLC25A2	83884	broad.mit.edu	37	5	140683215	140683215	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140683215G>A	uc003ljf.2	-	1	398	c.218C>T	c.(217-219)GCC>GTC	p.A73V		NM_031947	NP_114153	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 member 2	73	Helical; Name=2; (Potential).|Solcar 1.				mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	GGCGACGTAGGCCATAAGTGC	0.572													5	78	---	---	---	---	PASS
GRXCR2	643226	broad.mit.edu	37	5	145239353	145239353	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145239353C>T	uc003lns.1	-	3	690	c.690G>A	c.(688-690)CTG>CTA	p.L230L		NM_001080516	NP_001073985	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	230											0						CAGGGCACCTCAGGGCCCGAT	0.547													7	66	---	---	---	---	PASS
GPR151	134391	broad.mit.edu	37	5	145894520	145894520	+	Missense_Mutation	SNP	A	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145894520A>T	uc003lod.1	-	1	1157	c.1157T>A	c.(1156-1158)GTA>GAA	p.V386E		NM_194251	NP_919227	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	386	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAACTGCTCTACGTCAGGAAG	0.502													23	49	---	---	---	---	PASS
G3BP1	10146	broad.mit.edu	37	5	151169904	151169904	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151169904C>T	uc003lun.2	+	3	287	c.116C>T	c.(115-117)TCT>TTT	p.S39F	G3BP1_uc010jhy.1_Missense_Mutation_p.S39F|G3BP1_uc003lum.2_Missense_Mutation_p.S39F|G3BP1_uc011dcu.1_5'UTR|G3BP1_uc010jhz.2_5'UTR	NM_005754	NP_005745	Q13283	G3BP1_HUMAN	Ras-GTPase-activating protein SH3-domain-binding	39	NTF2.				Ras protein signal transduction|transport	cytosol|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|endonuclease activity|protein binding|RNA binding			skin(3)|ovary(1)	4		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			AAGAACTCTTCTTATGTCCAT	0.368													5	50	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170669901	170669901	+	Intron	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170669901A>G	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc003mbd.2_3'UTR|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TATTGAGACTATCATCCTACA	0.333			T	TRD@	ALL								3	106	---	---	---	---	PASS
FOXQ1	94234	broad.mit.edu	37	6	1313343	1313343	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1313343C>T	uc003mtl.3	+	1	669	c.404C>T	c.(403-405)TCG>TTG	p.S135L		NM_033260	NP_150285	Q9C009	FOXQ1_HUMAN	forkhead box Q1	135	Fork-head.				DNA fragmentation involved in apoptotic nuclear change|embryo development|hair follicle morphogenesis|pattern specification process|positive regulation of caspase activity|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	caspase regulator activity|DNA bending activity|double-stranded DNA binding|estrogen receptor binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin conjugating enzyme binding				0	Ovarian(93;0.0733)	Breast(5;0.052)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.0954)|BRCA - Breast invasive adenocarcinoma(62;0.18)		ATCCGCGACTCGGCGGGCGGG	0.592													8	9	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17669713	17669713	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17669713G>T	uc003ncd.1	-	6	1117	c.917C>A	c.(916-918)TCA>TAA	p.S306*	NUP153_uc011dje.1_Nonsense_Mutation_p.S306*|NUP153_uc010jpl.1_Nonsense_Mutation_p.S306*	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	306					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CCGAGCTGTTGAACTGGTCAC	0.373													4	115	---	---	---	---	PASS
ALDH5A1	7915	broad.mit.edu	37	6	24503595	24503595	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24503595C>T	uc003neg.2	+	3	571	c.543C>T	c.(541-543)ACC>ACT	p.T181T	ALDH5A1_uc003nef.2_Silent_p.T181T	NM_001080	NP_001071	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5A1 isoform 2 precursor	181					acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)	TTATCCACACCCCGGCAAAGG	0.572													3	35	---	---	---	---	PASS
BTN2A1	11120	broad.mit.edu	37	6	26468591	26468591	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26468591G>A	uc003nib.1	+	8	1610	c.1398G>A	c.(1396-1398)ATG>ATA	p.M466I	BTN2A1_uc003nic.1_3'UTR|BTN2A1_uc003nid.1_Missense_Mutation_p.M314I|BTN2A1_uc011dko.1_Missense_Mutation_p.M405I|BTN2A1_uc010jqk.1_Missense_Mutation_p.M226I	NM_007049	NP_008980	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1 isoform 1	466	Cytoplasmic (Potential).|B30.2/SPRY.				lipid metabolic process	integral to plasma membrane				ovary(1)|skin(1)	2						TCTACAACATGAGGGACAGAT	0.552													5	163	---	---	---	---	PASS
OR2B6	26212	broad.mit.edu	37	6	27925387	27925387	+	Missense_Mutation	SNP	T	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27925387T>A	uc011dkx.1	+	1	369	c.369T>A	c.(367-369)TTT>TTA	p.F123L		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	123	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TTGATAGGTTTGTAGCTATTT	0.473													40	155	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33391253	33391253	+	Splice_Site	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33391253G>C	uc011dri.1	+	2	263	c.68_splice	c.e2-1	p.D23_splice	SYNGAP1_uc003oeo.1_Splice_Site_p.D8_splice|SYNGAP1_uc010juy.2_Splice_Site_p.D8_splice	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						CTGTCCTCCAGATGTACGGGG	0.522													63	185	---	---	---	---	PASS
C6orf142	90523	broad.mit.edu	37	6	54025594	54025594	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54025594C>G	uc003pcg.3	+	7	1004	c.891C>G	c.(889-891)GTC>GTG	p.V297V	C6orf142_uc003pcf.2_Silent_p.V821V|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Silent_p.V832V	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	297						nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)					CTGACACAGTCAAAGTATGTA	0.179													7	85	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70639365	70639365	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70639365C>G	uc003pfc.1	+	6	556	c.439C>G	c.(439-441)CAA>GAA	p.Q147E	COL19A1_uc010kam.1_Missense_Mutation_p.Q43E	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	147	TSP N-terminal.				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						ATTTATGTTTCAAGCCACAGA	0.338													4	66	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76576333	76576333	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76576333G>A	uc003pih.1	+	17	2044	c.1765G>A	c.(1765-1767)GAA>AAA	p.E589K	MYO6_uc003pig.1_Missense_Mutation_p.E589K|MYO6_uc003pii.1_Missense_Mutation_p.E589K	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	589	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AGTGTGCTATGAAACAGTGAG	0.299													8	62	---	---	---	---	PASS
GPR63	81491	broad.mit.edu	37	6	97247160	97247160	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97247160C>T	uc010kcl.2	-	3	926	c.448G>A	c.(448-450)GGG>AGG	p.G150R	GPR63_uc003pou.2_Missense_Mutation_p.G150R	NM_001143957	NP_001137429	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	150	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		AAGAATTTCCCAAAAATCCAT	0.418													22	56	---	---	---	---	PASS
FOXO3	2309	broad.mit.edu	37	6	108985341	108985341	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108985341C>T	uc003psk.2	+	3	1621	c.1305C>T	c.(1303-1305)TTC>TTT	p.F435F	FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Silent_p.F435F|FOXO3_uc011ean.1_Silent_p.F215F|FOXO3_uc010kdj.1_Silent_p.F215F	NM_201559	NP_963853	O43524	FOXO3_HUMAN	forkhead box O3A	435					antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding	p.F435F(1)		central_nervous_system(4)|lung(2)	6		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		GCACGGTGTTCGGACCTTCAT	0.572													4	114	---	---	---	---	PASS
SLC16A10	117247	broad.mit.edu	37	6	111498880	111498880	+	Intron	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111498880C>G	uc003pus.2	+						SLC16A10_uc003pur.3_Silent_p.L318L|SLC16A10_uc003put.2_Intron	NM_018593	NP_061063	Q8TF71	MOT10_HUMAN	solute carrier family 16, member 10						aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)		TGAGTATGCTCCTTCACTGAT	0.378													9	118	---	---	---	---	PASS
C6orf204	387119	broad.mit.edu	37	6	118791768	118791768	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118791768G>C	uc003pxz.1	-	11	2542	c.1954C>G	c.(1954-1956)CAA>GAA	p.Q652E		NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a	652	Potential.					centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		ATCATCTTTTGAGTGGTCAGT	0.308													5	118	---	---	---	---	PASS
VNN2	8875	broad.mit.edu	37	6	133070857	133070857	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133070857G>A	uc003qdt.2	-	6	1359	c.1348C>T	c.(1348-1350)CAT>TAT	p.H450Y	VNN2_uc003qds.2_Missense_Mutation_p.H159Y|VNN2_uc010kgb.2_Missense_Mutation_p.H229Y|VNN2_uc003qdv.2_Missense_Mutation_p.H397Y	NM_004665	NP_004656	O95498	VNN2_HUMAN	vanin 2 isoform 1 precursor	450					cellular component movement|pantothenate metabolic process	anchored to membrane|plasma membrane	pantetheine hydrolase activity				0				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		GGTGACAGATGAATTTCGGTA	0.378													4	60	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136589449	136589449	+	Missense_Mutation	SNP	G	C	C	rs147719127		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136589449G>C	uc003qgx.1	-	10	2501	c.2248C>G	c.(2248-2250)CGA>GGA	p.R750G	BCLAF1_uc011edb.1_Missense_Mutation_p.R78G|BCLAF1_uc003qgw.1_Missense_Mutation_p.R577G|BCLAF1_uc003qgy.1_Missense_Mutation_p.R748G|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R748G	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	750	Poly-Ser.				induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GATGAAGATCGAGAATGATCT	0.338													5	111	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599168	136599168	+	Missense_Mutation	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599168T>C	uc003qgx.1	-	4	1104	c.851A>G	c.(850-852)TAC>TGC	p.Y284C	BCLAF1_uc003qgw.1_Missense_Mutation_p.Y284C|BCLAF1_uc003qgy.1_Missense_Mutation_p.Y282C|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.Y282C	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	284					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AGAAGGACTGTATCGACTAGA	0.453													9	86	---	---	---	---	PASS
VTA1	51534	broad.mit.edu	37	6	142487389	142487389	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142487389G>C	uc003qiw.2	+	2	152	c.137G>C	c.(136-138)GGA>GCA	p.G46A	VTA1_uc011edt.1_RNA|VTA1_uc011edu.1_Intron	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog	46	Interaction with CHMP5.|Interaction with IST1.				cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		ATGCAGACTGGAATGAAGATC	0.289													3	100	---	---	---	---	PASS
LTV1	84946	broad.mit.edu	37	6	144178666	144178666	+	Intron	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144178666G>C	uc003qjs.2	+						LTV1_uc003qju.1_5'UTR|C6orf94_uc010khj.2_Intron	NM_032860	NP_116249	Q96GA3	LTV1_HUMAN	LTV1 homolog											ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		gttacagttggaagagacctt	0.239													11	69	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150005065	150005065	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150005065G>A	uc003qmu.1	-	4	1708	c.1160C>T	c.(1159-1161)TCT>TTT	p.S387F	LATS1_uc010kif.1_Missense_Mutation_p.S282F|LATS1_uc003qmv.1_Missense_Mutation_p.S387F|LATS1_uc003qmw.2_Missense_Mutation_p.S387F|LATS1_uc010kig.1_Missense_Mutation_p.S282F	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	387					cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		TTGTAAAGCAGAAGGGCTTTG	0.453													19	129	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150005361	150005361	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150005361G>C	uc003qmu.1	-	4	1412	c.864C>G	c.(862-864)ATC>ATG	p.I288M	LATS1_uc010kif.1_Missense_Mutation_p.I183M|LATS1_uc003qmv.1_Missense_Mutation_p.I288M|LATS1_uc003qmw.2_Missense_Mutation_p.I288M|LATS1_uc010kig.1_Missense_Mutation_p.I183M	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	288					cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GGACAGGAGAGATTCGGGAGA	0.517													17	159	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21775305	21775305	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21775305G>A	uc003svc.2	+	47	7540	c.7509G>A	c.(7507-7509)ATG>ATA	p.M2503I		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2503	AAA 3 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GATATTTCATGGAGTTGTTGC	0.343									Kartagener_syndrome				5	36	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23810677	23810677	+	Silent	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23810677G>T	uc003sws.3	+	14	1834	c.1767G>T	c.(1765-1767)CTG>CTT	p.L589L	STK31_uc003swt.3_Silent_p.L566L|STK31_uc011jze.1_Silent_p.L589L|STK31_uc010kuq.2_Silent_p.L566L	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	589							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						GTCAAGTACTGCAAAAGATTC	0.338													62	140	---	---	---	---	PASS
HOXA1	3198	broad.mit.edu	37	7	27135406	27135406	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27135406G>A	uc003sye.2	-	1	220	c.126C>T	c.(124-126)GTC>GTT	p.V42V	HOXA1_uc003syd.2_Silent_p.V42V|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	42						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						TGTTGGCGCTGACCGCGCACG	0.522											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	10	104	---	---	---	---	PASS
HOXA6	3203	broad.mit.edu	37	7	27194846	27194846	+	5'Flank	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27194846G>A	uc003syq.1	-						uc003syr.1_3'UTR|HOXA7_uc003sys.2_Intron			P31267	HXA6_HUMAN	Homo sapiens clone Affy08242H09, mRNA sequence.							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						CAGGTCCTGAGAACAGACATG	0.612													15	54	---	---	---	---	PASS
PSMA2	5683	broad.mit.edu	37	7	42957149	42957149	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42957149C>T	uc003thy.2	-	8					C7orf25_uc010kxr.2_Intron|PSMA2_uc010kxt.2_3'UTR	NM_002787	NP_002778	P25787	PSA2_HUMAN	proteasome subunit alpha type 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|response to virus|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity			large_intestine(2)|ovary(1)	3						ATCTGAAATTCTGGATTTTTC	0.328													5	63	---	---	---	---	PASS
ZNF735	730291	broad.mit.edu	37	7	63667599	63667599	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63667599C>T	uc011kdn.1	+	1	19	c.19C>T	c.(19-21)CCC>TCC	p.P7S		NM_001159524	NP_001152996	P0CB33	ZN735_HUMAN	zinc finger protein 735	7					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAGACCGGGACCCCCTGGAAG	0.562													4	50	---	---	---	---	PASS
PPP1R9A	55607	broad.mit.edu	37	7	94915637	94915637	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94915637G>T	uc003unp.2	+	13	3159	c.2877G>T	c.(2875-2877)GAG>GAT	p.E959D	PPP1R9A_uc010lfj.2_Missense_Mutation_p.E1243D|PPP1R9A_uc011kif.1_Missense_Mutation_p.E1165D|PPP1R9A_uc003unq.2_Missense_Mutation_p.E1183D|PPP1R9A_uc011kig.1_Missense_Mutation_p.E959D|PPP1R9A_uc003unr.2_Missense_Mutation_p.E256D	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	959	Interacts with TGN38 (By similarity).					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			CATCAGATGAGGTAATTCCAT	0.458										HNSCC(28;0.073)			4	85	---	---	---	---	PASS
SRRT	51593	broad.mit.edu	37	7	100482607	100482607	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100482607G>A	uc003uwy.2	+	10	1373	c.1105G>A	c.(1105-1107)GAG>AAG	p.E369K	SRRT_uc010lhl.1_Missense_Mutation_p.E369K|SRRT_uc003uxa.2_Missense_Mutation_p.E369K|SRRT_uc003uwz.2_Missense_Mutation_p.E369K	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	369	Glu-rich.				cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						CAGCGTGTCAGAGTCTGAGTC	0.577													6	274	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100731650	100731650	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100731650G>C	uc003uxq.2	+	3	1288	c.1057G>C	c.(1057-1059)GAG>CAG	p.E353Q	TRIM56_uc003uxr.2_Intron	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	353					defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					CCCACAGCTGGAGCTCCATCC	0.662													4	8	---	---	---	---	PASS
SND1	27044	broad.mit.edu	37	7	127341354	127341354	+	Nonsense_Mutation	SNP	C	G	G	rs34667910		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127341354C>G	uc003vmi.2	+	5	792	c.566C>G	c.(565-567)TCA>TGA	p.S189*		NM_014390	NP_055205	Q7KZF4	SND1_HUMAN	staphylococcal nuclease domain containing 1	189					gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3						TTTGTGGACTCACACCACCAG	0.483													6	73	---	---	---	---	PASS
TSGA14	95681	broad.mit.edu	37	7	130067815	130067815	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130067815G>C	uc003vpz.2	-	2	125	c.78C>G	c.(76-78)ATC>ATG	p.I26M	TSGA14_uc010lmf.2_Translation_Start_Site|TSGA14_uc003vqa.2_Missense_Mutation_p.I26M|TSGA14_uc011kpg.1_Missense_Mutation_p.I26M|TSGA14_uc003vqb.1_RNA	NM_018718	NP_061188	Q9BYV8	CEP41_HUMAN	testis specific, 14	26					G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)					GTCTTGATTTGATATGCTGGT	0.313													28	56	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142605898	142605898	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142605898C>T	uc003wby.1	-	15	2236	c.1972G>A	c.(1972-1974)GAT>AAT	p.D658N		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	658	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TCCTGGTCATCCTCCTTGTCT	0.532													6	66	---	---	---	---	PASS
TAS2R60	338398	broad.mit.edu	37	7	143141483	143141483	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143141483C>T	uc011ktg.1	+	1	938	c.938C>T	c.(937-939)TCA>TTA	p.S313L	uc003wda.2_Intron	NM_177437	NP_803186	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	313	Cytoplasmic (Potential).				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity			skin(6)	6	Melanoma(164;0.172)					CGTCGTTCCTCAAGGTGTGGG	0.502													10	118	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701967	143701967	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701967G>A	uc003wdt.1	+	1	878	c.878G>A	c.(877-879)CGA>CAA	p.R293Q		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	293	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					CTAAGAAACCGAGAGGTCAAG	0.433													12	73	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146536942	146536942	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146536942C>G	uc003weu.1	+	3	864	c.348C>G	c.(346-348)CTC>CTG	p.L116L		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	116	F5/8 type C.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACCGGATGCTCTACAGCGACA	0.468										HNSCC(39;0.1)			5	38	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149522395	149522395	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149522395C>T	uc010lpk.2	+	101	14022	c.14022C>T	c.(14020-14022)TTC>TTT	p.F4674F	SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_RNA|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_RNA	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	4674	TIL 6.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			ACACTGTATTCACCCTGGACT	0.637													21	68	---	---	---	---	PASS
GIMAP5	55340	broad.mit.edu	37	7	150439547	150439547	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150439547C>G	uc003whr.1	+	3	672	c.320C>G	c.(319-321)TCT>TGT	p.S107C	GIMAP5_uc010lpu.2_5'UTR	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	107	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TACCTGCTCTCTGCCCCGGGG	0.582													11	88	---	---	---	---	PASS
GIMAP5	55340	broad.mit.edu	37	7	150439620	150439620	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150439620C>G	uc003whr.1	+	3	745	c.393C>G	c.(391-393)ATC>ATG	p.I131M	GIMAP5_uc010lpu.2_Translation_Start_Site	NM_018384	NP_060854	Q96F15	GIMA5_HUMAN	GTPase, IMAP family member 5	131	Cytoplasmic (Potential).					integral to membrane|mitochondrial outer membrane	GTP binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGTGGCCATCAGGAAGGTGA	0.592													9	120	---	---	---	---	PASS
AGAP3	116988	broad.mit.edu	37	7	150840866	150840866	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150840866C>G	uc003wjg.1	+	18	2575	c.2572C>G	c.(2572-2574)CCA>GCA	p.P858A	AGAP3_uc003wje.1_Missense_Mutation_p.P527A|AGAP3_uc003wjj.1_Missense_Mutation_p.P357A|AGAP3_uc003wjk.1_Missense_Mutation_p.P276A	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	822	ANK 3.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						GGGCCTGACTCCACTGGCATA	0.617													6	86	---	---	---	---	PASS
C8orf42	157695	broad.mit.edu	37	8	442608	442608	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:442608C>T	uc003wpd.2	-	3	923	c.349G>A	c.(349-351)GAA>AAA	p.E117K	C8orf42_uc011kwg.1_Missense_Mutation_p.E117K	NM_175075	NP_778250	Q86YL5	CH042_HUMAN	hypothetical protein LOC157695	117											0		Ovarian(12;0.0481)|Colorectal(14;0.0815)|Hepatocellular(245;0.0968)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;5.16e-14)|OV - Ovarian serous cystadenocarcinoma(5;7.35e-07)|BRCA - Breast invasive adenocarcinoma(11;4.17e-06)|COAD - Colon adenocarcinoma(149;0.0255)		GATATGTCTTCAAGAGCAAGT	0.493													7	63	---	---	---	---	PASS
C8orf42	157695	broad.mit.edu	37	8	442629	442629	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:442629C>A	uc003wpd.2	-	3	902	c.328G>T	c.(328-330)GAG>TAG	p.E110*	C8orf42_uc011kwg.1_Nonsense_Mutation_p.E110*	NM_175075	NP_778250	Q86YL5	CH042_HUMAN	hypothetical protein LOC157695	110											0		Ovarian(12;0.0481)|Colorectal(14;0.0815)|Hepatocellular(245;0.0968)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;5.16e-14)|OV - Ovarian serous cystadenocarcinoma(5;7.35e-07)|BRCA - Breast invasive adenocarcinoma(11;4.17e-06)|COAD - Colon adenocarcinoma(149;0.0255)		TTTGGAGGCTCCCAACCTTCA	0.468													9	73	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8175847	8175847	+	Silent	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8175847C>A	uc003wsh.3	-	5	4038	c.4038G>T	c.(4036-4038)ACG>ACT	p.T1346T		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	1346							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						AGTTGTGCAGCGTGCCGCACA	0.677													5	97	---	---	---	---	PASS
MTMR9	66036	broad.mit.edu	37	8	11177193	11177193	+	Intron	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11177193C>G	uc003wtm.2	+						MTMR9_uc010lrx.2_Intron|MTMR9_uc011kxa.1_Intron|uc003wtn.1_RNA	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9							cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		CTTTCTTGATCAGATGTAAGT	0.393													4	102	---	---	---	---	PASS
ESCO2	157570	broad.mit.edu	37	8	27645505	27645505	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27645505G>C	uc003xgg.2	+	6	1200	c.1117G>C	c.(1117-1119)GAC>CAC	p.D373H	ESCO2_uc010luy.1_RNA	NM_001017420	NP_001017420	Q56NI9	ESCO2_HUMAN	establishment of cohesion 1 homolog 2	373					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding			central_nervous_system(1)	1		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		AAAAACAAAAGACCAGCTCAT	0.289									SC_Phocomelia_syndrome				13	107	---	---	---	---	PASS
PURG	29942	broad.mit.edu	37	8	30889612	30889612	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30889612C>T	uc003xin.2	-	1	706	c.687G>A	c.(685-687)ATG>ATA	p.M229I	WRN_uc003xio.3_5'Flank|PURG_uc003xim.1_Missense_Mutation_p.M229I	NM_013357	NP_037489	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G isoform A	229	By similarity.					nucleus	DNA binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		GAAACTCAATCATTCCTTGTG	0.488													15	135	---	---	---	---	PASS
OPRK1	4986	broad.mit.edu	37	8	54147422	54147422	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54147422G>A	uc003xrh.1	-	2	882	c.507C>T	c.(505-507)TTC>TTT	p.F169F	OPRK1_uc003xri.1_Silent_p.F169F|OPRK1_uc010lyc.1_Silent_p.F80F	NM_000912	NP_000903	P41145	OPRK_HUMAN	opioid receptor, kappa 1	169	Cytoplasmic (Potential).				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)	AGGGTGTGCGGAAGTCCAAAG	0.512													5	89	---	---	---	---	PASS
C8orf84	157869	broad.mit.edu	37	8	73979514	73979514	+	3'UTR	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73979514G>T	uc003xzf.2	-	5						NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor						immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						AGGAAACATTGAACATGACTT	0.343													5	32	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76471126	76471126	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76471126A>G	uc003yaq.2	+	9	1106	c.836A>G	c.(835-837)TAT>TGT	p.Y279C	HNF4G_uc003yar.2_Missense_Mutation_p.Y316C	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	279					endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			GATCGGCAGTATGACTCCCGG	0.453													35	89	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110535087	110535087	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110535087C>T	uc003yne.2	+	75	12402	c.12298C>T	c.(12298-12300)CAG>TAG	p.Q4100*		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	4100	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity	p.Q4100Q(1)		ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GCCATTTCCTCAGCAGCCTTC	0.458										HNSCC(38;0.096)			6	13	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	114448989	114448989	+	Missense_Mutation	SNP	A	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114448989A>T	uc003ynu.2	-	1	254	c.95T>A	c.(94-96)TTC>TAC	p.F32Y	CSMD3_uc011lhx.1_Missense_Mutation_p.F32Y|CSMD3_uc010mcx.1_Missense_Mutation_p.F32Y|CSMD3_uc003ynx.3_Missense_Mutation_p.F32Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	32	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CATCAGGATGAAGTCTAGGCG	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			5	178	---	---	---	---	PASS
WDR67	93594	broad.mit.edu	37	8	124095030	124095030	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124095030G>C	uc003ypp.1	+	3	403	c.313G>C	c.(313-315)GAT>CAT	p.D105H	WDR67_uc011lig.1_Missense_Mutation_p.D105H|WDR67_uc011lih.1_Intron|WDR67_uc003ypq.1_Intron|WDR67_uc003ypo.1_Missense_Mutation_p.D105H	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	105						centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GGCATTAGCTGATTATTCTAT	0.348													4	99	---	---	---	---	PASS
C8orf76	84933	broad.mit.edu	37	8	124250182	124250182	+	Splice_Site	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124250182C>G	uc003yqc.1	-	3	245	c.214_splice	c.e3-1	p.K72_splice	C8orf76_uc003yqd.2_Splice_Site_p.K40_splice	NM_032847	NP_116236	Q96K31	CH076_HUMAN	hypothetical protein LOC84933								binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			GCAGTGCTTTCTGGAAATTAT	0.378													7	96	---	---	---	---	PASS
LRRC6	23639	broad.mit.edu	37	8	133623581	133623581	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133623581C>T	uc003ytk.2	-	9	1077	c.1003G>A	c.(1003-1005)GAT>AAT	p.D335N	LRRC6_uc003ytl.2_RNA	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6	335	CS.					cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GGTTGCACATCAACATCGATT	0.308													4	60	---	---	---	---	PASS
KHDRBS3	10656	broad.mit.edu	37	8	136594141	136594141	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136594141C>T	uc003yuv.2	+	6	1026	c.632C>T	c.(631-633)GCC>GTC	p.A211V	KHDRBS3_uc003yuw.2_Missense_Mutation_p.A211V|KHDRBS3_uc010mek.2_RNA	NM_006558	NP_006549	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal	211					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			GGAGTTACAGCCCGGCCAGTT	0.502													18	95	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	145013596	145013596	+	Intron	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145013596C>A	uc003zaf.1	-						PLEC_uc003zab.1_Nonsense_Mutation_p.E12*|PLEC_uc003zac.1_Intron|PLEC_uc003zad.2_Intron|PLEC_uc003zae.1_Intron|PLEC_uc003zag.1_Intron|PLEC_uc003zah.2_Intron|PLEC_uc003zaj.2_Intron	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1						cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCCAGGCCCTCGGGCTGCGGC	0.687													8	17	---	---	---	---	PASS
MGC70857	414919	broad.mit.edu	37	8	145753430	145753430	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145753430C>G	uc003zdp.1	-	2	341	c.183G>C	c.(181-183)AAG>AAC	p.K61N	LRRC24_uc003zdm.2_5'Flank|LRRC24_uc003zdn.2_5'Flank|MGC70857_uc003zdq.1_5'UTR|MGC70857_uc003zdr.1_RNA	NM_001001795	NP_001001795	Q6P1X6	CH082_HUMAN	hypothetical protein LOC414919	61											0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGATGAAATTCTTCATTTTGG	0.582													12	61	---	---	---	---	PASS
IL33	90865	broad.mit.edu	37	9	6252898	6252898	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6252898C>A	uc003zjt.2	+	5	433	c.376C>A	c.(376-378)CTA>ATA	p.L126I	IL33_uc011lmg.1_Intron|IL33_uc011lmh.1_Intron|IL33_uc003zju.1_Missense_Mutation_p.L126I	NM_033439	NP_254274	O95760	IL33_HUMAN	interleukin 33 precursor	126					positive regulation of chemokine secretion|positive regulation of inflammatory response|positive regulation of macrophage activation|positive regulation of transcription from RNA polymerase II promoter	extracellular space	cytokine activity				0		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		TCTTGCTTCTCTAAGCACATA	0.318													38	86	---	---	---	---	PASS
MPDZ	8777	broad.mit.edu	37	9	13113048	13113048	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13113048A>G	uc010mhy.2	-	40	5527	c.5476T>C	c.(5476-5478)TCT>CCT	p.S1826P	MPDZ_uc003zkx.3_Missense_Mutation_p.S91P|MPDZ_uc003zky.3_Missense_Mutation_p.S389P|MPDZ_uc010mib.2_Missense_Mutation_p.S560P|MPDZ_uc010mhx.2_Missense_Mutation_p.S677P|MPDZ_uc011lmm.1_Missense_Mutation_p.S714P|MPDZ_uc003zkz.3_Missense_Mutation_p.S548P|MPDZ_uc010mhz.2_Missense_Mutation_p.S1822P|MPDZ_uc011lmn.1_Missense_Mutation_p.S1793P|MPDZ_uc003zlb.3_Missense_Mutation_p.S1826P	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1855					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		TGTATTTCAGATGCCACTGTA	0.323													2	11	---	---	---	---	PASS
CD72	971	broad.mit.edu	37	9	35612796	35612796	+	Intron	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35612796C>A	uc003zxb.2	-						CD72_uc003zxc.1_Intron|CD72_uc010mkt.1_Intron|CD72_uc010mku.2_3'UTR	NM_001782	NP_001773	P21854	CD72_HUMAN	CD72 molecule						axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GACATATGTCCCTTTACCTAA	0.398													8	217	---	---	---	---	PASS
CD72	971	broad.mit.edu	37	9	35612802	35612802	+	Intron	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35612802C>A	uc003zxb.2	-						CD72_uc003zxc.1_Intron|CD72_uc010mkt.1_Intron|CD72_uc010mku.2_3'UTR	NM_001782	NP_001773	P21854	CD72_HUMAN	CD72 molecule						axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGTCCCTTTACCTAATAGTAC	0.408													7	230	---	---	---	---	PASS
FAM75C1	441452	broad.mit.edu	37	9	90537507	90537507	+	Silent	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90537507C>A	uc010mqi.2	+	4	2714	c.2685C>A	c.(2683-2685)CCC>CCA	p.P895P	FAM75C1_uc004apq.3_Silent_p.P878P	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						CTGTTGTGCCCCATGCTTCAG	0.542													4	159	---	---	---	---	PASS
OGN	4969	broad.mit.edu	37	9	95155527	95155527	+	Splice_Site	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95155527C>T	uc004asa.2	-	4	504	c.269_splice	c.e4-1	p.E90_splice	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|OGN_uc004asb.2_Splice_Site_p.E90_splice|OGN_uc011ltx.1_Splice_Site_p.E108_splice	NM_014057	NP_054776	P20774	MIME_HUMAN	osteoglycin preproprotein							extracellular space|proteinaceous extracellular matrix	growth factor activity				0						GTGGGCATTTCTAAATTGGGA	0.333													6	43	---	---	---	---	PASS
PHF2	5253	broad.mit.edu	37	9	96415473	96415473	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96415473C>T	uc004aub.2	+	6	762	c.615C>T	c.(613-615)TTC>TTT	p.F205F	PHF2_uc011lug.1_Silent_p.F88F	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	205	JmjC.				liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TGTCCAGCTTCGTGGAGCCAC	0.502													6	29	---	---	---	---	PASS
ZNF510	22869	broad.mit.edu	37	9	99522220	99522220	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99522220C>G	uc004awn.1	-	6	1081	c.892G>C	c.(892-894)GAC>CAC	p.D298H	ZNF510_uc004awo.1_Missense_Mutation_p.D298H	NM_014930	NP_055745	Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	298					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				CTCCTGTGGTCAAAGAGAGTT	0.358													8	112	---	---	---	---	PASS
UGCG	7357	broad.mit.edu	37	9	114691868	114691868	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114691868G>A	uc004bft.2	+	6	937	c.647G>A	c.(646-648)AGA>AAA	p.R216K		NM_003358	NP_003349	Q16739	CEGT_HUMAN	ceramide glucosyltransferase	216	Lumenal (Potential).				epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	TGTTTAATGAGAAAAGATGTG	0.393													65	79	---	---	---	---	PASS
GPR21	2844	broad.mit.edu	37	9	125797112	125797112	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125797112C>T	uc011lzk.1	+	1	267	c.267C>T	c.(265-267)CTC>CTT	p.L89L	RABGAP1_uc004bnl.3_Intron|RABGAP1_uc011lzh.1_Intron|RABGAP1_uc011lzj.1_Intron|GPR21_uc011lzi.1_RNA	NM_005294	NP_005285	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	89	Helical; Name=2; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1						CTTTATCACTCCTCCATCACC	0.463													36	44	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135786887	135786887	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135786887G>A	uc004cca.2	-	10	1216	c.982C>T	c.(982-984)CAG>TAG	p.Q328*	TSC1_uc004ccb.3_Nonsense_Mutation_p.Q328*|TSC1_uc011mcq.1_Nonsense_Mutation_p.Q277*|TSC1_uc011mcr.1_Intron|TSC1_uc011mcs.1_Nonsense_Mutation_p.Q207*|TSC1_uc004ccc.1_Nonsense_Mutation_p.Q328*|TSC1_uc004ccd.2_Nonsense_Mutation_p.Q328*|TSC1_uc004cce.1_Nonsense_Mutation_p.Q328*	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	328					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTCAGAGTCTGAGGTAGCTGC	0.502			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				36	72	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137676852	137676852	+	Silent	SNP	C	T	T	rs144775947		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137676852C>T	uc004cfe.2	+	30	2884	c.2502C>T	c.(2500-2502)CCC>CCT	p.P834P		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	834	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TCGGCCCACCCGGTCCCAGGG	0.617													3	45	---	---	---	---	PASS
OBP2A	29991	broad.mit.edu	37	9	138439763	138439763	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138439763C>T	uc004cgb.2	+	4	366	c.324C>T	c.(322-324)GAC>GAT	p.D108D	OBP2A_uc004cgc.2_Silent_p.D108D|OBP2A_uc010nau.2_RNA|OBP2A_uc010nav.2_Nonsense_Mutation_p.R64*	NM_014582	NP_055397	Q9NY56	OBP2A_HUMAN	odorant binding protein 2A precursor	108					response to stimulus|sensory perception of smell	extracellular region	odorant binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		CCGGGACGGACGACTACGTCT	0.612													3	21	---	---	---	---	PASS
PMPCA	23203	broad.mit.edu	37	9	139313052	139313052	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139313052G>A	uc004chl.2	+	9	1041	c.1036G>A	c.(1036-1038)GGA>AGA	p.G346R	PMPCA_uc010nbl.2_Missense_Mutation_p.G246R|PMPCA_uc011mdz.1_Missense_Mutation_p.G215R|PMPCA_uc004chm.1_Missense_Mutation_p.G96R|PMPCA_uc004chn.1_5'Flank	NM_015160	NP_055975	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	346					proteolysis	mitochondrial inner membrane|mitochondrial matrix	metalloendopeptidase activity|zinc ion binding				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		GATGATGGGCGGAGGTGGCTC	0.602													3	45	---	---	---	---	PASS
TUBB2C	10383	broad.mit.edu	37	9	140137426	140137426	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140137426G>T	uc004cmh.1	+	4	858	c.756G>T	c.(754-756)AAG>AAT	p.K252N	TUBB2C_uc004cmg.1_Missense_Mutation_p.K106N	NM_006088	NP_006079	P68371	TBB2C_HUMAN	tubulin, beta, 2	252					'de novo' posttranslational protein folding|cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding|structural molecule activity|unfolded protein binding			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		ACCTGCGGAAGCTGGCTGTGA	0.647													6	25	---	---	---	---	PASS
AKR1C4	1109	broad.mit.edu	37	10	5248277	5248277	+	Missense_Mutation	SNP	A	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5248277A>T	uc001ihw.2	+	5	520	c.487A>T	c.(487-489)ATC>TTC	p.I163F		NM_001818	NP_001809	P17516	AK1C4_HUMAN	aldo-keto reductase family 1, member C4	163					androgen metabolic process|bile acid biosynthetic process	cytosol	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid transmembrane transporter activity|chlordecone reductase activity|electron carrier activity			ovary(1)	1					NADH(DB00157)	GGCCAAGTCCATCGGGGTGTC	0.507													11	126	---	---	---	---	PASS
UPF2	26019	broad.mit.edu	37	10	12071355	12071355	+	Silent	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12071355T>C	uc001ila.2	-	2	1008	c.534A>G	c.(532-534)CTA>CTG	p.L178L	UPF2_uc001ilb.2_Silent_p.L178L|UPF2_uc001ilc.2_Silent_p.L178L|UPF2_uc009xiz.1_Silent_p.L178L	NM_080599	NP_542166	Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog	178	MIF4G 1.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)				TAATAGTTTTTAGTTTCTTGA	0.408													62	157	---	---	---	---	PASS
MRC1	4360	broad.mit.edu	37	10	18112246	18112246	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18112246C>G	uc001ipm.2	+	2	367	c.264C>G	c.(262-264)CTC>CTG	p.L88L		NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor	88	Extracellular (Potential).|Ricin B-type lectin.				receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						CTATCACTCTCTATGCCTGTG	0.398													4	175	---	---	---	---	PASS
LOC387646	387646	broad.mit.edu	37	10	27535561	27535561	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27535561C>T	uc001its.2	-	1						NR_003525				SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;												0						GAAGCTTCATCAGGAGGCCTG	0.488													16	165	---	---	---	---	PASS
LOC387646	387646	broad.mit.edu	37	10	27535663	27535663	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27535663C>T	uc001its.2	-	1						NR_003525				SubName: Full=cDNA FLJ44924 fis, clone BRAMY3014555;												0						TGAGCCTTCTCACATTGTTGT	0.498													34	194	---	---	---	---	PASS
ZNF438	220929	broad.mit.edu	37	10	31138355	31138355	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31138355C>A	uc010qdz.1	-	7	1414	c.979G>T	c.(979-981)GAT>TAT	p.D327Y	ZNF438_uc001ivn.2_Missense_Mutation_p.D278Y|ZNF438_uc010qdy.1_Missense_Mutation_p.D317Y|ZNF438_uc001ivo.3_5'UTR|ZNF438_uc009xlg.2_Missense_Mutation_p.D327Y|ZNF438_uc001ivp.3_Missense_Mutation_p.D317Y|ZNF438_uc010qea.1_Missense_Mutation_p.D327Y|ZNF438_uc010qeb.1_Missense_Mutation_p.D327Y|ZNF438_uc010qec.1_5'UTR	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	327					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				GGTATCTTATCACAGTCGGCC	0.468													11	167	---	---	---	---	PASS
ALOX5	240	broad.mit.edu	37	10	45907638	45907638	+	Splice_Site	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45907638G>A	uc001jce.2	+	4	531	c.432_splice	c.e4-1	p.R144_splice	ALOX5_uc009xmt.2_Splice_Site_p.R144_splice|ALOX5_uc010qfg.1_Splice_Site_p.R144_splice	NM_000698	NP_000689	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding			ovary(1)|pancreas(1)	2		Lung SC(717;0.0257)			Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)	CTCATGCTCAGATGGATGGAG	0.512													23	66	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50857602	50857602	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50857602C>T	uc001jhz.2	+	10	1584	c.1431C>T	c.(1429-1431)CTC>CTT	p.L477L	CHAT_uc001jhv.1_Silent_p.L359L|CHAT_uc001jhx.1_Silent_p.L359L|CHAT_uc001jhy.1_Silent_p.L359L|CHAT_uc001jia.2_Silent_p.L359L|CHAT_uc010qgs.1_Silent_p.L359L	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	477					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	TCAGCGAGCTCCCCGCCCCCC	0.617													4	69	---	---	---	---	PASS
AGAP6	414189	broad.mit.edu	37	10	51748359	51748359	+	5'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51748359C>T	uc001jix.3	+	1						NM_001077665	NP_001071133	Q5VW22	AGAP6_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			skin(1)	1						GGTGGGCAGGCGAGGAGCGGG	0.701													3	9	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55600095	55600095	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55600095C>G	uc001jju.1	-	29	4363	c.3968G>C	c.(3967-3969)AGA>ACA	p.R1323T	PCDH15_uc010qhq.1_Missense_Mutation_p.R1328T|PCDH15_uc010qhr.1_Missense_Mutation_p.R1323T|PCDH15_uc010qhs.1_Missense_Mutation_p.R1335T|PCDH15_uc010qht.1_Missense_Mutation_p.R1330T|PCDH15_uc010qhu.1_Missense_Mutation_p.R1323T|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.R1323T|PCDH15_uc010qhw.1_Missense_Mutation_p.R1286T|PCDH15_uc010qhx.1_Missense_Mutation_p.R1252T|PCDH15_uc010qhy.1_Missense_Mutation_p.R1328T|PCDH15_uc010qhz.1_Missense_Mutation_p.R1323T|PCDH15_uc010qia.1_Missense_Mutation_p.R1301T|PCDH15_uc010qib.1_Missense_Mutation_p.R1301T	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1323	Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				AAGCTCATTTCTATCGATGGC	0.408										HNSCC(58;0.16)			44	117	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68040318	68040318	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68040318C>T	uc009xpn.1	-	13	1917	c.1794G>A	c.(1792-1794)TTG>TTA	p.L598L	CTNNA3_uc001jmw.2_Silent_p.L598L	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	598					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						CCAACACATTCAATGAGCTTT	0.343													11	140	---	---	---	---	PASS
AIFM2	84883	broad.mit.edu	37	10	71880898	71880898	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71880898C>A	uc010qjg.1	-	3	377	c.364G>T	c.(364-366)GTT>TTT	p.V122F	AIFM2_uc001jqp.1_Missense_Mutation_p.V122F	NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like	122					apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1						TGGCTGGAAACCTCATTAAAC	0.542													4	63	---	---	---	---	PASS
CCDC109A	90550	broad.mit.edu	37	10	74619017	74619017	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74619017C>G	uc001jtc.2	+	3	324	c.303C>G	c.(301-303)CTC>CTG	p.L101L	CCDC109A_uc009xqp.1_RNA|CCDC109A_uc009xqq.1_RNA|CCDC109A_uc010qjy.1_RNA|CCDC109A_uc009xqr.2_Silent_p.L101L|CCDC109A_uc001jtd.2_Silent_p.L52L	NM_138357	NP_612366	Q8NE86	MCU_HUMAN	coiled-coil domain containing 109A	101	Mitochondrial matrix (Potential).				elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)					AGTTCACACTCAAGCCTATCT	0.443													10	194	---	---	---	---	PASS
MYST4	23522	broad.mit.edu	37	10	76744917	76744917	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76744917A>G	uc001jwn.1	+	12	2946	c.2453A>G	c.(2452-2454)TAT>TGT	p.Y818C	MYST4_uc001jwm.1_Missense_Mutation_p.Y526C|MYST4_uc001jwo.1_Missense_Mutation_p.Y526C|MYST4_uc001jwp.1_Missense_Mutation_p.Y635C	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	818	Catalytic.|Interaction with BRPF1.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)					AAAACGTTGTATTATGATGTC	0.383			T	CREBBP	AML								16	101	---	---	---	---	PASS
ANXA11	311	broad.mit.edu	37	10	81929059	81929059	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81929059C>T	uc001kbq.1	-	6	1052	c.227G>A	c.(226-228)GGG>GAG	p.G76E	ANXA11_uc010qlx.1_Missense_Mutation_p.G176E|ANXA11_uc001kbr.1_Missense_Mutation_p.G76E|ANXA11_uc001kbs.1_Missense_Mutation_p.G76E|ANXA11_uc001kbt.1_Missense_Mutation_p.G76E|ANXA11_uc010qly.1_Missense_Mutation_p.G43E|ANXA11_uc009xsq.1_Missense_Mutation_p.G76E|ANXA11_uc001kbu.1_Missense_Mutation_p.G76E	NM_145869	NP_665876	P50995	ANX11_HUMAN	annexin A11	76					cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			CCCAGGGGCCCCAGGGTACAG	0.652													5	13	---	---	---	---	PASS
C10orf78	119392	broad.mit.edu	37	10	105882813	105882813	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105882813C>T	uc001kxu.2	+	2	117	c.104C>T	c.(103-105)TCA>TTA	p.S35L	C10orf78_uc001kxs.2_Missense_Mutation_p.S22L|C10orf78_uc001kxt.2_5'UTR|C10orf78_uc001kxv.2_Missense_Mutation_p.S97L	NM_001002759	NP_001002759	Q86XK3	SFR1_HUMAN	hypothetical protein LOC119392 isoform a	35					double-strand break repair via homologous recombination	Swi5-Sfr1 complex	protein binding				0		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;1.31e-09)|all cancers(201;3.84e-08)|BRCA - Breast invasive adenocarcinoma(275;0.014)		GCGAATCCATCATCTCCCTAT	0.398													44	92	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115355468	115355468	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115355468C>T	uc001laj.2	-	38	4614	c.4450G>A	c.(4450-4452)GAT>AAT	p.D1484N	NRAP_uc009xyb.2_Missense_Mutation_p.D273N|NRAP_uc001lak.2_Missense_Mutation_p.D1449N|NRAP_uc001lal.3_Missense_Mutation_p.D1484N	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1484						fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GATTCTGCATCTCCAGATCTA	0.512													10	144	---	---	---	---	PASS
FAM45A	404636	broad.mit.edu	37	10	120879939	120879939	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120879939A>G	uc001ldw.2	+	5	612	c.568A>G	c.(568-570)ATA>GTA	p.I190V	FAM45A_uc010qsv.1_Missense_Mutation_p.I182V|FAM45A_uc010qsw.1_Missense_Mutation_p.I39V|FAM45A_uc010qsx.1_Intron|FAM45A_uc010qsy.1_Missense_Mutation_p.I117V|FAM45A_uc010qsz.1_Missense_Mutation_p.I79V	NM_207009	NP_996892	Q8TCE6	FA45A_HUMAN	hypothetical protein LOC404636	190										ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		TCACCCCAAGATAGAAGCGGT	0.398													5	77	---	---	---	---	PASS
BAG3	9531	broad.mit.edu	37	10	121431904	121431904	+	Silent	SNP	C	T	T	rs138078305	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121431904C>T	uc001lem.2	+	3	951	c.645C>T	c.(643-645)AAC>AAT	p.N215N	BAG3_uc001lel.2_Silent_p.N215N	NM_004281	NP_004272	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	215					anti-apoptosis|apoptosis|protein folding	cytosol				ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		ACGAGCAGAACGTTACCCGGC	0.652													22	70	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129905874	129905874	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129905874G>A	uc001lke.2	-	13	4425	c.4230C>T	c.(4228-4230)CTC>CTT	p.L1410L	MKI67_uc001lkf.2_Silent_p.L1050L|MKI67_uc009yav.1_Silent_p.L985L|MKI67_uc009yaw.1_Silent_p.L560L	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1410	16 X 122 AA approximate repeats.|4.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATGTCTGTGTGAGCTTCTTCA	0.498													43	317	---	---	---	---	PASS
OR51B6	390058	broad.mit.edu	37	11	5372785	5372785	+	Silent	SNP	A	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5372785A>C	uc010qzb.1	+	1	48	c.48A>C	c.(46-48)CCA>CCC	p.P16P	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004750	NP_001004750	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGGCTTCCCAGGCATGGAGA	0.453													6	39	---	---	---	---	PASS
SBF2	81846	broad.mit.edu	37	11	9983445	9983445	+	Intron	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9983445C>G	uc001mib.2	-						SBF2_uc001mif.3_Intron|SBF2_uc001mih.3_Missense_Mutation_p.R169T	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		ACAAAATATTCTGGAAAAATG	0.299													11	46	---	---	---	---	PASS
MICAL2	9645	broad.mit.edu	37	11	12248645	12248645	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12248645C>G	uc001mjz.2	+	15	2250	c.1962C>G	c.(1960-1962)CTC>CTG	p.L654L	MICAL2_uc010rch.1_Silent_p.L654L|MICAL2_uc001mka.2_Silent_p.L654L|MICAL2_uc010rci.1_Silent_p.L654L|MICAL2_uc001mkb.2_Silent_p.L654L|MICAL2_uc001mkc.2_Silent_p.L654L|MICAL2_uc001mkd.2_Silent_p.L483L|MICAL2_uc010rcj.1_Silent_p.L56L	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	654						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		ATAACTATCTCAACCTCACAT	0.443													12	58	---	---	---	---	PASS
COPB1	1315	broad.mit.edu	37	11	14502617	14502617	+	Silent	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14502617T>C	uc001mli.2	-	9	1291	c.984A>G	c.(982-984)GTA>GTG	p.V328V	COPB1_uc001mlg.2_Silent_p.V328V|COPB1_uc001mlh.2_Silent_p.V328V	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	328	HEAT 5.				COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2						GTGTGCTCAATACTCTTAGGA	0.363													19	141	---	---	---	---	PASS
GTF2H1	2965	broad.mit.edu	37	11	18361114	18361114	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18361114G>A	uc001moi.2	+	6	1211	c.517G>A	c.(517-519)GAT>AAT	p.D173N	GTF2H1_uc001moh.2_Missense_Mutation_p.D173N|GTF2H1_uc009yhm.2_Missense_Mutation_p.D57N	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	173					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						GTTTTAGGCTGATGTCCGGCC	0.423								NER					9	92	---	---	---	---	PASS
CCDC34	91057	broad.mit.edu	37	11	27384539	27384539	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27384539G>C	uc001mrh.1	-	1	257	c.203C>G	c.(202-204)TCT>TGT	p.S68C	CCDC34_uc001mri.1_Missense_Mutation_p.S68C	NM_030771	NP_110398	Q96HJ3	CCD34_HUMAN	coiled-coil domain containing 34 isoform 1	68											0						GCCAAGGGGAGACAACAGCGA	0.637													7	95	---	---	---	---	PASS
METT5D1	196074	broad.mit.edu	37	11	28232683	28232683	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28232683C>G	uc001msh.2	+	4	800	c.345C>G	c.(343-345)CTC>CTG	p.L115L	METT5D1_uc001msg.2_Silent_p.L115L|METT5D1_uc001mse.2_Silent_p.L115L	NM_001113528	NP_001107000	A6NJ78	MET15_HUMAN	methyltransferase 5 domain containing 1 isoform	115							methyltransferase activity				0						ATATTGTTCTCTATGCCTTGG	0.378													6	103	---	---	---	---	PASS
EIF3M	10480	broad.mit.edu	37	11	32622318	32622318	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32622318G>C	uc001mtu.2	+	9	926	c.883G>C	c.(883-885)GAC>CAC	p.D295H	EIF3M_uc010ref.1_Missense_Mutation_p.D163H	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,	295	PCI.					eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					AATTTCTTTTGACACAATGCA	0.343													17	156	---	---	---	---	PASS
RAG1	5896	broad.mit.edu	37	11	36596535	36596535	+	Missense_Mutation	SNP	C	A	A	rs104894285		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36596535C>A	uc001mwu.3	+	2	1805	c.1681C>A	c.(1681-1683)CGC>AGC	p.R561S	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	561			R -> C (in OS).|R -> H (in OS).		histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				AAAGAGGTTCCGCTATGATTC	0.468									Familial_Hemophagocytic_Lymphohistiocytosis				3	84	---	---	---	---	PASS
CELF1	10658	broad.mit.edu	37	11	47493672	47493672	+	Intron	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47493672A>G	uc001nfl.2	-						CELF1_uc001nfk.1_5'Flank|CELF1_uc001nfm.2_Intron|CELF1_uc001nfn.2_Intron|CELF1_uc001nfo.1_Intron|CELF1_uc010rhm.1_Intron|CELF1_uc001nfp.2_Intron|CELF1_uc001nfq.1_Intron|CELF1_uc001nfr.1_3'UTR	NM_001025596	NP_001020767	Q92879	CELF1_HUMAN	CUG triplet repeat, RNA-binding protein 1						embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding			central_nervous_system(2)|ovary(1)	3						AGTGGCAGGGATCAGGGTCCA	0.562													10	35	---	---	---	---	PASS
MS4A1	931	broad.mit.edu	37	11	60235949	60235949	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60235949C>T	uc001npp.2	+	8					MS4A1_uc001npq.2_3'UTR|MS4A1_uc009yna.2_3'UTR|MS4A1_uc009ymz.2_3'UTR|MS4A1_uc010rlc.1_3'UTR	NM_152866	NP_690605	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member						B cell activation|immune response	integral to plasma membrane				ovary(3)|lung(2)	5					Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)	TAAGTGATTTCTTCTGTTTTC	0.403													5	40	---	---	---	---	PASS
PRPF19	27339	broad.mit.edu	37	11	60671325	60671325	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60671325C>T	uc001nqf.2	-	2	235	c.28G>A	c.(28-30)GAA>AAA	p.E10K		NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN	PRP19/PSO4 pre-mRNA processing factor 19	10	U-box.				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						TCCGGCACTTCGTTAGAGACT	0.507													18	99	---	---	---	---	PASS
SYT7	9066	broad.mit.edu	37	11	61291406	61291406	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61291406C>T	uc001nrv.2	-	7	806	c.800G>A	c.(799-801)CGA>CAA	p.R267Q	SYT7_uc009ynr.2_Missense_Mutation_p.R342Q	NM_004200	NP_004191	O43581	SYT7_HUMAN	synaptotagmin VII	267	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4						CAGCTCCCCTCGGCTCCCCTG	0.607													13	205	---	---	---	---	PASS
CD248	57124	broad.mit.edu	37	11	66082774	66082774	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66082774G>A	uc001ohm.1	-	1	1742	c.1725C>T	c.(1723-1725)CTC>CTT	p.L575L		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	575	Pro-rich.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	CCTGGGTTCTGAGGACAAGGG	0.607													23	143	---	---	---	---	PASS
B3GNT1	11041	broad.mit.edu	37	11	66113603	66113603	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66113603C>T	uc001ohr.2	-	2	1310	c.1165G>A	c.(1165-1167)GAA>AAA	p.E389K	BRMS1_uc001ohp.1_5'Flank|BRMS1_uc001oho.1_5'Flank	NM_006876	NP_006867	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal	389	Lumenal (Potential).				poly-N-acetyllactosamine biosynthetic process	integral to Golgi membrane	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity				0						TGCTGATTTTCAGCCTCCTTT	0.502													77	140	---	---	---	---	PASS
ACY3	91703	broad.mit.edu	37	11	67410068	67410068	+	3'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67410068G>A	uc001omq.2	-	8						NM_080658	NP_542389	Q96HD9	ACY3_HUMAN	aspartoacylase 3						interspecies interaction between organisms	apical plasma membrane|cytoplasm	hydrolase activity, acting on ester bonds|metal ion binding				0					L-Aspartic Acid(DB00128)	TTGAGGCCAGGGGTTGGGGAG	0.557													11	27	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70318907	70318907	+	3'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70318907G>A	uc001oqc.2	-	22					SHANK2_uc010rqn.1_3'UTR|SHANK2_uc001opz.2_3'UTR|uc009ysn.1_5'Flank|SHANK2_uc001opy.2_3'UTR	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TTGGCATTCAGATGTTTCAGC	0.502													11	37	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70319029	70319029	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70319029C>T	uc001oqc.2	-	22	5573	c.5495G>A	c.(5494-5496)CGA>CAA	p.R1832Q	SHANK2_uc010rqn.1_Missense_Mutation_p.R1244Q|SHANK2_uc001opz.2_Missense_Mutation_p.R1237Q|uc009ysn.1_5'UTR|SHANK2_uc001opy.2_Missense_Mutation_p.R168Q	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1453	SAM.				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GTGCCCGACTCGAGTTACCCC	0.488													74	180	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85447612	85447612	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85447612G>A	uc010rth.1	-	5	791	c.515C>T	c.(514-516)TCA>TTA	p.S172L	SYTL2_uc010rtg.1_Missense_Mutation_p.S173L|SYTL2_uc010rti.1_Missense_Mutation_p.S172L|SYTL2_uc010rtj.1_Missense_Mutation_p.S124L|SYTL2_uc001pbf.3_Missense_Mutation_p.S172L|SYTL2_uc010rtf.1_Missense_Mutation_p.S30L	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	172					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTGTTGTGATGAGTGACCTTC	0.313													4	70	---	---	---	---	PASS
C11orf73	51501	broad.mit.edu	37	11	86048472	86048472	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86048472C>G	uc001pbu.2	+	3	558	c.320C>G	c.(319-321)TCT>TGT	p.S107C	C11orf73_uc001pbt.2_Missense_Mutation_p.S107C|C11orf73_uc010rto.1_RNA|C11orf73_uc010rtp.1_Missense_Mutation_p.S8C|C11orf73_uc001pbv.2_RNA	NM_016401	NP_057485	Q53FT3	CK073_HUMAN	lethal, Chr 7, Rinchik 6	107						cytoplasm					0		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				CGAACTCCATCTGTTGCTCAG	0.403													51	272	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92533128	92533128	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92533128G>C	uc001pdj.3	+	9	6966	c.6949G>C	c.(6949-6951)GAA>CAA	p.E2317Q		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2317	Cadherin 21.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TGCAGACTCAGAAAACAATAA	0.388										TCGA Ovarian(4;0.039)			5	39	---	---	---	---	PASS
MMP27	64066	broad.mit.edu	37	11	102564639	102564639	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102564639C>G	uc001phd.1	-	8	1214	c.1191G>C	c.(1189-1191)TGG>TGC	p.W397C		NM_022122	NP_071405	Q9H306	MMP27_HUMAN	matrix metalloproteinase 27 precursor	397	Hemopexin-like 3.				collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)		AAACTTACCTCCAGCACCAAA	0.353													4	169	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103086469	103086469	+	Missense_Mutation	SNP	A	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103086469A>C	uc001pho.2	+	55	8858	c.8714A>C	c.(8713-8715)AAT>ACT	p.N2905T	DYNC2H1_uc001phn.1_Missense_Mutation_p.N2905T|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2905	Potential.|Stalk (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCTAAACTAAATGAAGCTAAA	0.343													3	19	---	---	---	---	PASS
CARD16	114769	broad.mit.edu	37	11	104915124	104915124	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104915124G>A	uc001pip.1	-	2	296	c.269C>T	c.(268-270)TCA>TTA	p.S90L	CASP1_uc010rve.1_Intron|CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CARD16_uc001pio.1_Missense_Mutation_p.S90L	NM_001017534	NP_001017534	Q5EG05	CAR16_HUMAN	caspase-1 dominant-negative inhibitor pseudo-ICE	90	CARD.				regulation of apoptosis	intracellular	cysteine-type endopeptidase inhibitor activity			skin(1)	1						CTTACCTGCTGAGAGTCCCAG	0.453													50	138	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118374132	118374132	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118374132G>C	uc001pta.2	+	27	7539	c.7516G>C	c.(7516-7518)GAA>CAA	p.E2506Q	MLL_uc001ptb.2_Missense_Mutation_p.E2509Q	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2506					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		CATGCAAGTAGAAGGATCTGC	0.448			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								9	72	---	---	---	---	PASS
OR4D5	219875	broad.mit.edu	37	11	123810416	123810416	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123810416C>A	uc001pzk.1	+	1	93	c.93C>A	c.(91-93)TTC>TTA	p.F31L		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TCACTGTTTTCTCTGCTGTGT	0.463													19	154	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900608	123900608	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900608C>T	uc001pzp.1	+	1	279	c.279C>T	c.(277-279)TTC>TTT	p.F93F		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CTATCTCCTTCCACAGCTGCA	0.522													9	134	---	---	---	---	PASS
KCNJ5	3762	broad.mit.edu	37	11	128781390	128781390	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128781390G>C	uc001qet.2	+	2	536	c.222G>C	c.(220-222)CTG>CTC	p.L74L	KCNJ5_uc009zck.2_Silent_p.L74L|KCNJ5_uc001qew.2_Silent_p.L74L	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	74	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	ACCGGTACCTGAGTGACCTCT	0.577													4	134	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128843971	128843971	+	Intron	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128843971G>A	uc009zcp.2	-						ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Intron	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1						cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						ACACAGGATTGAAGATCCCTC	0.448													9	83	---	---	---	---	PASS
FOXM1	2305	broad.mit.edu	37	12	2968590	2968590	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2968590C>G	uc001qlf.2	-	9	1771	c.1506G>C	c.(1504-1506)TGG>TGC	p.W502C	uc001qld.2_Intron|FOXM1_uc001qle.2_Missense_Mutation_p.W540C|FOXM1_uc001qlg.2_Missense_Mutation_p.W487C|FOXM1_uc009zea.2_Missense_Mutation_p.W487C|FOXM1_uc009zeb.2_Missense_Mutation_p.W486C	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2	502	Glu/Pro/Ser/Thr-rich.				cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			ACGAATCCTCCCAGGAGTGAG	0.547													5	201	---	---	---	---	PASS
NDUFA9	4704	broad.mit.edu	37	12	4796341	4796341	+	3'UTR	SNP	A	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4796341A>T	uc001qnc.2	+	11					NDUFA9_uc010ses.1_3'UTR	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	GCACCCAGCCAGGCGGTCTCT	0.463													3	9	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6680126	6680126	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6680126C>T	uc001qpo.2	-	39	5794	c.5630G>A	c.(5629-5631)CGA>CAA	p.R1877Q	CHD4_uc001qpn.2_Missense_Mutation_p.R1870Q|CHD4_uc001qpp.2_Missense_Mutation_p.R1902Q|NOP2_uc001qph.1_5'Flank|NOP2_uc001qpi.1_5'Flank|NOP2_uc001qpj.1_5'Flank|NOP2_uc001qpk.1_5'Flank|NOP2_uc001qpl.1_5'Flank|NOP2_uc001qpm.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1877	Required for interaction with PCNT.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TGGGGGAATTCGGGCAATGGT	0.537													54	333	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6686986	6686986	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6686986C>G	uc001qpo.2	-	37	5490	c.5326G>C	c.(5326-5328)GAG>CAG	p.E1776Q	CHD4_uc001qpn.2_Missense_Mutation_p.E1769Q|CHD4_uc001qpp.2_Missense_Mutation_p.E1801Q|uc001qpq.1_5'Flank	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1776	Required for interaction with PCNT.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TTCTTGATCTCTAAGAAATTG	0.463													11	163	---	---	---	---	PASS
PRB2	653247	broad.mit.edu	37	12	11546771	11546771	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11546771G>C	uc010shk.1	-	3	276	c.241C>G	c.(241-243)CCA>GCA	p.P81A		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			TGTGGGGGTGGTCCTTGTGGC	0.612													13	391	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22015985	22015985	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22015985C>T	uc001rfi.1	-	18	2261	c.2241G>A	c.(2239-2241)AGG>AGA	p.R747R	ABCC9_uc001rfh.2_Silent_p.R747R|ABCC9_uc001rfj.1_Silent_p.R711R	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	747	Cytoplasmic (Potential).|ABC transporter 1.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGTACCTGTTCCTACTGAAAA	0.323													5	74	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43826585	43826585	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43826585G>T	uc010skx.1	-	20	2750	c.2750C>A	c.(2749-2751)TCA>TAA	p.S917*	ADAMTS20_uc001rno.1_Nonsense_Mutation_p.S71*|ADAMTS20_uc001rnp.1_Nonsense_Mutation_p.S71*	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	917	TSP type-1 3.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACATTGGGATGAACATTCACT	0.368													10	187	---	---	---	---	PASS
BAZ2A	11176	broad.mit.edu	37	12	56995427	56995427	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56995427G>C	uc001slq.1	-	20	4174	c.3980C>G	c.(3979-3981)TCA>TGA	p.S1327*	BAZ2A_uc001slp.1_Nonsense_Mutation_p.S1325*|BAZ2A_uc001slo.1_Nonsense_Mutation_p.S155*|BAZ2A_uc009zov.1_Nonsense_Mutation_p.S297*|BAZ2A_uc009zow.1_Nonsense_Mutation_p.S1295*	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1327	Pro-rich.				chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						CATCTGGGCTGAGATGTTAAA	0.602													51	118	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95604045	95604045	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95604045C>T	uc001tdp.3	-	2	1239	c.1015G>A	c.(1015-1017)GAA>AAA	p.E339K	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	339					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						CCCGGTTCTTCAGTGCTTTCA	0.408													19	235	---	---	---	---	PASS
C12orf48	55010	broad.mit.edu	37	12	102572447	102572447	+	Silent	SNP	C	T	T	rs146074209	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102572447C>T	uc001tjf.2	+	8	1195	c.1083C>T	c.(1081-1083)GAC>GAT	p.D361D	C12orf48_uc001tjg.2_Silent_p.D280D|C12orf48_uc010swa.1_Silent_p.D438D|C12orf48_uc001tjh.2_Silent_p.D280D|C12orf48_uc010swb.1_Intron|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_Silent_p.D76D|C12orf48_uc001tjk.2_Intron|C12orf48_uc009zud.2_Intron	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010	361					response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						TTCTTTTGGACGAAGAAGCAG	0.368													4	87	---	---	---	---	PASS
CKAP4	10970	broad.mit.edu	37	12	106632982	106632982	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106632982G>A	uc001tlk.2	-	2	1713	c.1629C>T	c.(1627-1629)GTC>GTT	p.V543V		NM_006825	NP_006816	Q07065	CKAP4_HUMAN	cytoskeleton-associated protein 4	543	Potential.					ER-Golgi intermediate compartment membrane|integral to membrane|membrane fraction					0						CCACTTGGCTGACTGAGGCTT	0.527													29	128	---	---	---	---	PASS
SSH1	54434	broad.mit.edu	37	12	109182345	109182345	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109182345C>T	uc001tnm.2	-	15	2656	c.2569G>A	c.(2569-2571)GAG>AAG	p.E857K	SSH1_uc001tnl.2_Missense_Mutation_p.E545K	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1	857					actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4						TGGCTCTCCTCGGGGATGCTG	0.667													4	36	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	117923470	117923470	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117923470G>C	uc001two.2	-	15	2214	c.2159C>G	c.(2158-2160)TCC>TGC	p.S720C		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	749	Protein kinase.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTCACAACGGAATAGAGCGT	0.448													16	80	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131484985	131484985	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131484985G>C	uc001uit.3	+	9	1583	c.1024G>C	c.(1024-1026)GAG>CAG	p.E342Q	GPR133_uc010tbm.1_Missense_Mutation_p.E374Q	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	342	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TGCTCTGTCAGAGGTAAGAGA	0.279													11	93	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131488789	131488789	+	Silent	SNP	G	A	A	rs73473278	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131488789G>A	uc001uit.3	+	11	1762	c.1203G>A	c.(1201-1203)CCG>CCA	p.P401P	GPR133_uc010tbm.1_Silent_p.P433P	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	401	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ACCGCTTCCCGGCCCACGGGC	0.632													5	32	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19412981	19412981	+	RNA	SNP	A	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19412981A>T	uc010tcj.1	-	1		c.33129T>A				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						GTACTCAATAAAATAACATAT	0.308													15	80	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20048070	20048070	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20048070G>C	uc001umd.2	-	7	587	c.376C>G	c.(376-378)CGA>GGA	p.R126G	TPTE2_uc009zzk.2_Intron|TPTE2_uc009zzl.2_Intron|TPTE2_uc001ume.2_Missense_Mutation_p.R89G|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	126	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ACAAATACTCGAAGAAGAACA	0.259													9	76	---	---	---	---	PASS
SLC7A1	6541	broad.mit.edu	37	13	30106971	30106971	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30106971G>C	uc001uso.2	-	4	906	c.519C>G	c.(517-519)CTC>CTG	p.L173L		NM_003045	NP_003036	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid	173	Helical; (Potential).				cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	receptor activity				0		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CTGTCAAGATGAGAATTATGA	0.493													7	100	---	---	---	---	PASS
C13orf26	122046	broad.mit.edu	37	13	31543165	31543165	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31543165C>T	uc001uti.2	+	6	809	c.790C>T	c.(790-792)CAG>TAG	p.Q264*		NM_152325	NP_689538	Q8N6G2	CM026_HUMAN	hypothetical protein LOC122046	264										ovary(2)|skin(1)	3		Lung SC(185;0.0281)		all cancers(112;0.0176)|Epithelial(112;0.0768)|OV - Ovarian serous cystadenocarcinoma(117;0.0852)		AGAGTACCTTCAGAGTCTTTC	0.368													7	129	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32914961	32914961	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32914961C>T	uc001uub.1	+	11	6696	c.6469C>T	c.(6469-6471)CAA>TAA	p.Q2157*		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2157					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		ATATCTCTCTCAATTTCAACA	0.318			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			21	52	---	---	---	---	PASS
NAA16	79612	broad.mit.edu	37	13	41910844	41910844	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41910844C>T	uc001uyf.2	+	9	1290	c.966C>T	c.(964-966)TGC>TGT	p.C322C	NAA16_uc010tfg.1_Intron|NAA16_uc001uye.3_Silent_p.C322C|NAA16_uc001uyd.3_Intron	NM_024561	NP_078837	Q6N069	NAA16_HUMAN	NMDA receptor regulated 1-like protein isoform	322					N-terminal protein amino acid acetylation|positive regulation of transcription, DNA-dependent	cytoplasm|transcription factor complex	binding			central_nervous_system(1)	1						GTAAAGGCTGCCCACCCTTGT	0.318													7	100	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50275904	50275904	+	3'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50275904G>A	uc001vdj.2	-	17						NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GCTTCATATTGAATGTGGGAA	0.383													17	238	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101944589	101944589	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101944589C>T	uc001vox.1	-	8	1117	c.928G>A	c.(928-930)GCC>ACC	p.A310T	NALCN_uc001voy.2_Missense_Mutation_p.A25T|NALCN_uc001voz.2_Missense_Mutation_p.A310T|NALCN_uc001vpa.2_Missense_Mutation_p.A310T	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	310	Helical; Name=S6 of repeat I; (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACAAGCCAGGCGAGGAAGAAA	0.458													10	38	---	---	---	---	PASS
C13orf27	93081	broad.mit.edu	37	13	103419691	103419691	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103419691C>A	uc001vpo.2	-	5	614	c.436G>T	c.(436-438)GAA>TAA	p.E146*	C13orf27_uc001vpn.2_Nonsense_Mutation_p.E105*|C13orf27_uc001vpp.2_Nonsense_Mutation_p.E105*	NM_138779	NP_620134	Q5JUR7	CM027_HUMAN	hypothetical protein LOC93081	146											0	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AAGAGGTCTTCATCTCTGAGT	0.408													6	155	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21993519	21993519	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21993519C>T	uc001wbe.2	-	2	625	c.343G>A	c.(343-345)GAG>AAG	p.E115K	SALL2_uc010tly.1_Missense_Mutation_p.E113K|SALL2_uc010tlz.1_Missense_Mutation_p.E113K|SALL2_uc001wbf.3_Missense_Mutation_p.E113K|SALL2_uc010tma.1_Missense_Mutation_p.E115K|SALL2_uc001wbg.1_Missense_Mutation_p.E115K	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	115							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CCTCTCCTCTCTGGGCCCCAG	0.642													5	74	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30105594	30105594	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30105594C>A	uc001wqh.2	-	7	1273	c.1092G>T	c.(1090-1092)ATG>ATT	p.M364I		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	364					cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CATCTTGGACCATTGCTTCTT	0.517													17	151	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32560932	32560932	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32560932C>G	uc001wrl.2	+	2	1296	c.1057C>G	c.(1057-1059)CTA>GTA	p.L353V	ARHGAP5_uc001wrm.2_Missense_Mutation_p.L353V|ARHGAP5_uc001wrn.2_Missense_Mutation_p.L353V|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	353					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTTGCCAAATCTAGAAGAGAT	0.323													18	173	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35228028	35228028	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35228028C>T	uc001wsk.2	-	25	4836	c.4268G>A	c.(4267-4269)CGA>CAA	p.R1423Q	BAZ1A_uc001wsl.2_Missense_Mutation_p.R1391Q	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1423					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding	p.R1423fs*21(1)		lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		AGAACTCCTTCGACCCAGTGT	0.408													7	73	---	---	---	---	PASS
RALGAPA1	253959	broad.mit.edu	37	14	36230213	36230213	+	Splice_Site	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36230213C>A	uc001wti.2	-	6	761	c.370_splice	c.e6-1	p.I124_splice	RALGAPA1_uc001wtj.2_Splice_Site_p.I124_splice|RALGAPA1_uc010tpv.1_Splice_Site_p.I124_splice|RALGAPA1_uc010tpw.1_Splice_Site_p.I124_splice|RALGAPA1_uc001wtk.1_Splice_Site	NM_014990	NP_055805	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4						CCCGCCTAATCTAAAATAAAA	0.323													5	35	---	---	---	---	PASS
KLHDC2	23588	broad.mit.edu	37	14	50246473	50246473	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50246473G>C	uc001wwx.2	+	8	1122	c.722G>C	c.(721-723)AGA>ACA	p.R241T	SDCCAG1_uc010anj.1_Intron|KLHDC2_uc001wwy.2_Missense_Mutation_p.R241T|KLHDC2_uc010anp.2_Missense_Mutation_p.R241T	NM_014315	NP_055130	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	241	Kelch 4.					nucleus	protein binding			ovary(1)	1	all_epithelial(31;0.000959)|Breast(41;0.0117)					TAGGATGCTAGAATGAATGAT	0.318													10	89	---	---	---	---	PASS
C14orf138	79609	broad.mit.edu	37	14	50583166	50583166	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50583166G>A	uc001wxo.1	-	1	132	c.105C>T	c.(103-105)TCC>TCT	p.S35S	C14orf138_uc001wxn.1_5'Flank|C14orf138_uc001wxp.1_Silent_p.S35S|C14orf138_uc001wxq.1_RNA	NM_024558	NP_078834	Q9H867	MT21D_HUMAN	hypothetical protein LOC79609 isoform a	35							methyltransferase activity				0	all_epithelial(31;0.000822)|Breast(41;0.0065)					CCACGCCACCGGAGCTATACT	0.602													5	18	---	---	---	---	PASS
WDHD1	11169	broad.mit.edu	37	14	55448271	55448271	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55448271G>A	uc001xbm.1	-	16	2128	c.2050C>T	c.(2050-2052)CCC>TCC	p.P684S	WDHD1_uc010aom.1_Missense_Mutation_p.P201S|WDHD1_uc001xbn.1_Missense_Mutation_p.P561S	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	684						cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AGTTGCTGGGGATTTTCATGG	0.368													11	114	---	---	---	---	PASS
WDHD1	11169	broad.mit.edu	37	14	55467688	55467688	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55467688G>A	uc001xbm.1	-	9	794	c.716C>T	c.(715-717)TCT>TTT	p.S239F	WDHD1_uc001xbn.1_Missense_Mutation_p.S116F	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	239	WD 6.					cytoplasm|nucleoplasm	DNA binding			skin(1)	1						CCCACAGGGAGACCAGGTTAC	0.308													21	166	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65234536	65234536	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65234536C>G	uc001xht.2	-	29	6118	c.6064G>C	c.(6064-6066)GAG>CAG	p.E2022Q	SPTB_uc001xhr.2_Missense_Mutation_p.E2022Q|SPTB_uc001xhs.2_Missense_Mutation_p.E2022Q|SPTB_uc001xhu.2_Missense_Mutation_p.E2022Q|SPTB_uc010aqi.2_Missense_Mutation_p.E683Q	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	2022	Spectrin 17.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		AGCCACGCCTCAGCCACAGAG	0.607													8	29	---	---	---	---	PASS
RGS6	9628	broad.mit.edu	37	14	72985157	72985157	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72985157C>G	uc001xna.3	+	15	1713	c.1190C>G	c.(1189-1191)CCA>CGA	p.P397R	RGS6_uc010ttn.1_Missense_Mutation_p.P397R|RGS6_uc001xmx.3_Missense_Mutation_p.P397R|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Missense_Mutation_p.P397R|RGS6_uc010ttp.1_Missense_Mutation_p.P328R|RGS6_uc001xmz.1_Missense_Mutation_p.P258R	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	397	RGS.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CCAGGGGCTCCAAGTGCAATC	0.468													9	59	---	---	---	---	PASS
ZNF410	57862	broad.mit.edu	37	14	74360609	74360609	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74360609C>A	uc001xoz.1	+	3	325	c.143C>A	c.(142-144)TCA>TAA	p.S48*	ZNF410_uc001xoy.1_RNA|ZNF410_uc010ary.1_RNA|ZNF410_uc010tuf.1_RNA|ZNF410_uc010tug.1_5'UTR|ZNF410_uc010tuh.1_Nonsense_Mutation_p.S48*|ZNF410_uc010tui.1_RNA|ZNF410_uc010arz.1_Nonsense_Mutation_p.S48*|ZNF410_uc001xpa.1_5'UTR|ZNF410_uc001xpb.1_Nonsense_Mutation_p.S48*|ZNF410_uc001xpc.1_5'UTR	NM_021188	NP_067011	Q86VK4	ZN410_HUMAN	zinc finger protein 410	48					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)		ACTGAAGCCTCAGAATGCAGT	0.418													62	103	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93081784	93081784	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93081784G>C	uc001yap.2	+	4	552	c.400G>C	c.(400-402)GAG>CAG	p.E134Q	RIN3_uc010auk.2_Intron|RIN3_uc001yaq.2_Missense_Mutation_p.E59Q	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	134	SH2.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				TCTTGTGTTTGAGGACATCTT	0.522													11	189	---	---	---	---	PASS
MAGEL2	54551	broad.mit.edu	37	15	23889947	23889947	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23889947G>C	uc001ywj.3	-	1	1229	c.1134C>G	c.(1132-1134)CTC>CTG	p.L378L		NM_019066	NP_061939			MAGE-like protein 2												0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GGCTTTCAGAGAGACCCAGGG	0.647													4	20	---	---	---	---	PASS
SNORD115-20	100033460	broad.mit.edu	37	15	25463621	25463621	+	Intron	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25463621G>A	uc001yzq.1	+						uc001yzt.1_RNA|SNORD115-26_uc001yzw.1_RNA|SNORD115-26_uc001yzv.2_5'Flank|HBII-52-27_uc010ayq.1_5'Flank	NR_003313				Homo sapiens small nucleolar RNA, C/D box 115-15 (SNORD115-15), non-coding RNA.												0						CTTTTCCTGGGCCAGTGTCCA	0.582													15	27	---	---	---	---	PASS
ARHGAP11A	9824	broad.mit.edu	37	15	32917399	32917399	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32917399C>A	uc001zgy.1	+	5	1392	c.670C>A	c.(670-672)CAG>AAG	p.Q224K	ARHGAP11A_uc010ubw.1_Missense_Mutation_p.Q35K|ARHGAP11A_uc001zgw.2_Missense_Mutation_p.Q224K|ARHGAP11A_uc001zgx.2_Missense_Mutation_p.Q224K|ARHGAP11A_uc010ubx.1_Missense_Mutation_p.Q35K	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1	224	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GCTACGATTACAGGCTGCAGT	0.363													53	68	---	---	---	---	PASS
FMN1	342184	broad.mit.edu	37	15	33359049	33359049	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33359049G>C	uc001zhf.3	-	1	1037	c.1037C>G	c.(1036-1038)TCT>TGT	p.S346C	FMN1_uc001zhg.2_Missense_Mutation_p.S346C	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GAGCAGCAGAGAGAGCTGCTC	0.557													10	98	---	---	---	---	PASS
C15orf55	256646	broad.mit.edu	37	15	34649515	34649515	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34649515G>A	uc001zif.2	+	7	3377	c.3222G>A	c.(3220-3222)AAG>AAA	p.K1074K	C15orf55_uc010ucc.1_Silent_p.K1102K|C15orf55_uc010ucd.1_Silent_p.K1092K	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	1074						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		AGTCTGGGAAGCGAGCTCTAG	0.587			T	BRD3|BRD4	lethal midline carcinoma								4	55	---	---	---	---	PASS
SPRED1	161742	broad.mit.edu	37	15	38591726	38591726	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38591726G>A	uc001zka.3	+	2	520	c.185G>A	c.(184-186)GGA>GAA	p.G62E		NM_152594	NP_689807	Q7Z699	SPRE1_HUMAN	sprouty-related protein 1 with EVH-1 domain	62	WH1.				inactivation of MAPK activity|multicellular organismal development	caveola|nucleus	stem cell factor receptor binding			ovary(2)|lung(2)|skin(1)	5		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TTTATCCGTGGAGAGCGACTC	0.388									Legius_syndrome				7	94	---	---	---	---	PASS
RASGRP1	10125	broad.mit.edu	37	15	38808463	38808463	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38808463G>C	uc001zke.3	-	6	788	c.610C>G	c.(610-612)CTG>GTG	p.L204V	RASGRP1_uc010bbe.2_RNA|RASGRP1_uc010bbf.2_Missense_Mutation_p.L66V|RASGRP1_uc010bbg.2_Missense_Mutation_p.L66V|RASGRP1_uc001zkd.3_Missense_Mutation_p.L204V	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a	204					cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TCTGGTTCCAGATGGTCAAAG	0.468													4	98	---	---	---	---	PASS
NUSAP1	51203	broad.mit.edu	37	15	41625174	41625174	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41625174G>C	uc001zns.3	+	1	249	c.19G>C	c.(19-21)GAG>CAG	p.E7Q	OIP5_uc001znp.2_5'Flank|NUSAP1_uc001znq.3_5'UTR|NUSAP1_uc001znr.3_Missense_Mutation_p.E7Q|NUSAP1_uc010bce.2_Missense_Mutation_p.E7Q|NUSAP1_uc001znt.3_Missense_Mutation_p.E7Q|NUSAP1_uc001znv.3_Missense_Mutation_p.E7Q|NUSAP1_uc001znu.3_Missense_Mutation_p.E7Q|NUSAP1_uc010ucw.1_Missense_Mutation_p.E7Q	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	7					cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CCCCTCTCTAGAGGAGCTGGA	0.582													6	21	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41805071	41805071	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41805071C>G	uc001zoa.3	-	3	371	c.193G>C	c.(193-195)GAG>CAG	p.E65Q	LTK_uc001zob.3_Missense_Mutation_p.E65Q|LTK_uc010ucx.1_Missense_Mutation_p.E65Q|LTK_uc010bcg.2_Intron	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	65	Extracellular (Potential).				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CAAGACCCCTCGGTGCCTGAG	0.652										TSP Lung(18;0.14)			3	44	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	41961828	41961828	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41961828C>G	uc001zog.1	+	2	827	c.736C>G	c.(736-738)CAG>GAG	p.Q246E	MGA_uc010ucy.1_Missense_Mutation_p.Q246E|MGA_uc010ucz.1_Missense_Mutation_p.Q246E	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 2	246	T-box.					MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		TCAGATTACTCAGCTGAAAAT	0.418													30	32	---	---	---	---	PASS
CDAN1	146059	broad.mit.edu	37	15	43025297	43025297	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43025297G>A	uc001zql.2	-	9	1572	c.1455C>T	c.(1453-1455)ATC>ATT	p.I485I	CDAN1_uc001zqj.2_5'Flank|CDAN1_uc001zqk.2_5'UTR|CDAN1_uc010bcx.1_RNA	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	485						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GCACCCACCTGATTCTGCTGC	0.552													8	74	---	---	---	---	PASS
CDAN1	146059	broad.mit.edu	37	15	43025301	43025301	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43025301C>T	uc001zql.2	-	9	1568	c.1451G>A	c.(1450-1452)AGA>AAA	p.R484K	CDAN1_uc001zqj.2_5'Flank|CDAN1_uc001zqk.2_5'UTR|CDAN1_uc010bcx.1_RNA	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	484						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		CCACCTGATTCTGCTGCCCAA	0.552													8	76	---	---	---	---	PASS
CASC4	113201	broad.mit.edu	37	15	44695105	44695105	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44695105G>C	uc001zto.1	+	9	1392	c.1093G>C	c.(1093-1095)GAA>CAA	p.E365Q	CASC4_uc001ztp.2_Missense_Mutation_p.E365Q|CASC4_uc001ztq.2_Intron	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a	365	Lumenal (Potential).					integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		TGATGAAAATGAATCCCCTGT	0.453													8	75	---	---	---	---	PASS
DTWD1	56986	broad.mit.edu	37	15	49917332	49917332	+	5'UTR	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49917332G>C	uc001zxq.2	+	3					DTWD1_uc001zxp.3_RNA|DTWD1_uc001zxs.2_5'UTR|DTWD1_uc001zxr.2_5'UTR|DTWD1_uc001zxo.2_5'UTR	NM_020234	NP_064619	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1												0		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		ATGTGTTTTAGAAATAGCCGT	0.289													4	36	---	---	---	---	PASS
SCG3	29106	broad.mit.edu	37	15	51988109	51988109	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51988109C>G	uc002abh.2	+	8	1314	c.906C>G	c.(904-906)ATC>ATG	p.I302M	SCG3_uc010ufz.1_Missense_Mutation_p.I70M	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor	302					platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)		TGATTACTATCATGAAAACAC	0.333													72	110	---	---	---	---	PASS
C15orf44	81556	broad.mit.edu	37	15	65891286	65891286	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65891286C>G	uc002apd.2	-	5	865	c.529G>C	c.(529-531)GAT>CAT	p.D177H	C15orf44_uc010uix.1_Missense_Mutation_p.D213H|C15orf44_uc010uiz.1_Missense_Mutation_p.D141H|C15orf44_uc010uja.1_Missense_Mutation_p.D128H|C15orf44_uc010ujb.1_Missense_Mutation_p.D98H|C15orf44_uc002ape.3_Missense_Mutation_p.D177H|C15orf44_uc010uiy.1_Missense_Mutation_p.D98H	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	177	VWFA.			D -> Y (in Ref. 2; BAB55140).						ovary(1)	1						TTGTTTAAATCTATGAGACGT	0.418													11	123	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	65983838	65983838	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65983838C>T	uc002aph.2	-	22	3340	c.2962G>A	c.(2962-2964)GAG>AAG	p.E988K	DENND4A_uc002api.2_Missense_Mutation_p.E1031K|DENND4A_uc002apj.3_Missense_Mutation_p.E988K	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	988					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						AAGAGCAGCTCAGGTGTGCTT	0.284													16	8	---	---	---	---	PASS
CLK3	1198	broad.mit.edu	37	15	74912488	74912488	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74912488G>A	uc010uln.1	+	3	1196	c.735G>A	c.(733-735)GAG>GAA	p.E245E	CLK3_uc002ayg.3_Silent_p.E97E|CLK3_uc002ayh.3_5'UTR|CLK3_uc010ulm.1_Silent_p.E245E|CLK3_uc002ayj.3_Silent_p.E97E|CLK3_uc002ayk.3_5'UTR	NM_001130028	NP_001123500	P49761	CLK3_HUMAN	CDC-like kinase 3 isoform a	245	Arg-rich.					acrosomal vesicle|nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)	2						GATCGCGGGAGAGGGGGCCAT	0.617													51	75	---	---	---	---	PASS
SH3GL3	6457	broad.mit.edu	37	15	84287050	84287050	+	3'UTR	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84287050C>G	uc002bjw.2	+	9					SH3GL3_uc002bjx.2_3'UTR|SH3GL3_uc002bju.2_3'UTR|SH3GL3_uc002bjv.2_RNA	NM_003027	NP_003018	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3						central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3						ATGTGTAACACAAACTCTGGA	0.423													34	58	---	---	---	---	PASS
POLG	5428	broad.mit.edu	37	15	89873444	89873444	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89873444C>T	uc002bns.3	-	3	1005	c.723G>A	c.(721-723)CCG>CCA	p.P241P	POLG_uc002bnr.3_Silent_p.P241P	NM_002693	NP_002684	P54098	DPOG1_HUMAN	DNA-directed DNA polymerase gamma	241					base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TGAGGTCAGCCGGCGACAGCT	0.617								DNA_polymerases_(catalytic_subunits)					10	47	---	---	---	---	PASS
TTC23	64927	broad.mit.edu	37	15	99759146	99759146	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99759146C>G	uc002bur.2	-	6	943	c.412G>C	c.(412-414)GAG>CAG	p.E138Q	TTC23_uc002bus.2_Missense_Mutation_p.E138Q|TTC23_uc002but.2_Missense_Mutation_p.E138Q|TTC23_uc002buu.2_Missense_Mutation_p.E138Q|TTC23_uc002buv.2_Missense_Mutation_p.E138Q|TTC23_uc002bux.2_Missense_Mutation_p.E138Q|TTC23_uc002buw.2_Missense_Mutation_p.E138Q|TTC23_uc010boq.2_RNA|TTC23_uc002buy.2_Missense_Mutation_p.E138Q|TTC23_uc010bor.2_Missense_Mutation_p.E138Q|TTC23_uc002buz.2_Missense_Mutation_p.E138Q	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	138	TPR 2.						binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TGGAAAAGCTCAATGGAAAAC	0.393													19	216	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1391337	1391337	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1391337C>T	uc002clk.1	+	8	683	c.683C>T	c.(682-684)TCG>TTG	p.S228L	BAIAP3_uc002clj.2_Missense_Mutation_p.S210L|BAIAP3_uc010uuz.1_Missense_Mutation_p.S193L|BAIAP3_uc010uva.1_Missense_Mutation_p.S165L|BAIAP3_uc010uvb.1_Missense_Mutation_p.S245L|BAIAP3_uc010uvc.1_Missense_Mutation_p.S193L	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	228	C2 1.				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				CTGCCTGCCTCGGACGCCACG	0.706													9	29	---	---	---	---	PASS
AMDHD2	51005	broad.mit.edu	37	16	2570828	2570828	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2570828G>A	uc002cqq.2	+	2	239	c.142G>A	c.(142-144)GAG>AAG	p.E48K	AMDHD2_uc002cqp.2_Missense_Mutation_p.E48K|AMDHD2_uc010uwc.1_Missense_Mutation_p.E48K|AMDHD2_uc010uwd.1_Intron	NM_015944	NP_057028	Q9Y303	NAGA_HUMAN	amidohydrolase domain containing 2 isoform 1	48					N-acetylglucosamine metabolic process		N-acetylglucosamine-6-phosphate deacetylase activity			skin(2)|large_intestine(1)|breast(1)	4						GTTCTTTGAGGAGCGGCGCGT	0.711													6	13	---	---	---	---	PASS
ADCY9	115	broad.mit.edu	37	16	4016190	4016190	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4016190C>G	uc002cvx.2	-	11	4187	c.3648G>C	c.(3646-3648)TTG>TTC	p.L1216F		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	1216	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						CCATCTTGCTCAAGACGCGGT	0.572													10	140	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15083033	15083033	+	Intron	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083033C>T	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_Missense_Mutation_p.E11K	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TGAAGCAGCTCCGCCGCTGGC	0.592													12	57	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23640969	23640969	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23640969C>T	uc002dlx.1	-	5	2706	c.2506G>A	c.(2506-2508)GTC>ATC	p.V836I		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	836					double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		ACCTGTTCGACGGAATGTTTA	0.443			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				14	74	---	---	---	---	PASS
SH2B1	25970	broad.mit.edu	37	16	28878108	28878108	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28878108G>A	uc002dri.2	+	4	1132	c.693G>A	c.(691-693)CTG>CTA	p.L231L	uc010vct.1_Intron|SH2B1_uc010vdc.1_Intron|SH2B1_uc002drj.2_Silent_p.L231L|SH2B1_uc002drk.2_Silent_p.L231L|SH2B1_uc002drl.2_Silent_p.L231L|SH2B1_uc010vdd.1_Intron|SH2B1_uc010vde.1_Silent_p.L231L|SH2B1_uc002drm.2_Silent_p.L231L	NM_001145795	NP_001139267	Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1 isoform 1	231	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation) (By similarity).|Required for NGF signaling (By similarity).|Required for nuclear localization (By similarity).				blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity			ovary(2)	2						TTGAGAGGCTGAGACTCAGTC	0.622													11	29	---	---	---	---	PASS
ABCC11	85320	broad.mit.edu	37	16	48264436	48264436	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48264436G>C	uc002eff.1	-	2	498	c.148C>G	c.(148-150)CCT>GCT	p.P50A	ABCC11_uc002efg.1_Missense_Mutation_p.P50A|ABCC11_uc002efh.1_Missense_Mutation_p.P50A|ABCC11_uc010vgl.1_Missense_Mutation_p.P50A	NM_033151	NP_149163	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C, member 11	50	Cytoplasmic (Potential).					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(3)|skin(2)|central_nervous_system(1)	6		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)				GGAGCCTCAGGATTTCTCTCT	0.498									Cerumen_Type				4	44	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49671947	49671947	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49671947G>A	uc002efs.2	-	5	1414	c.1116C>T	c.(1114-1116)CCC>CCT	p.P372P	ZNF423_uc010vgn.1_Silent_p.P255P	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	372					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				CGCTGGAGTCGGGTGTGGCGC	0.677													5	21	---	---	---	---	PASS
HEATR3	55027	broad.mit.edu	37	16	50100305	50100305	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50100305G>A	uc002efw.2	+	2	328	c.166G>A	c.(166-168)GAG>AAG	p.E56K	HEATR3_uc002efx.2_Intron	NM_182922	NP_891552	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	56	HEAT 1.						binding			ovary(1)|skin(1)	2						CGAGGTCCGCGAGTGCGCCTG	0.756													3	5	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57065331	57065331	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57065331C>T	uc002ekk.1	+	11	2658	c.2433C>T	c.(2431-2433)ATC>ATT	p.I811I	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Silent_p.I560I|NLRC5_uc002ekl.2_Silent_p.I616I|NLRC5_uc002ekm.2_Silent_p.I616I|NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_5'Flank	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	811					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				CGGACCTCATCTTCCTTCTTT	0.562													4	48	---	---	---	---	PASS
EDC4	23644	broad.mit.edu	37	16	67909846	67909846	+	Splice_Site	SNP	A	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67909846A>T	uc002eur.2	+	2	249	c.83_splice	c.e2-2	p.G28_splice	EDC4_uc010cer.2_Splice_Site|EDC4_uc010vkg.1_Splice_Site|EDC4_uc010ces.1_5'Flank|EDC4_uc002eus.2_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTTTGTCCCCAGGCCCCAGTG	0.557													46	120	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70065826	70065826	+	Intron	SNP	T	C	C	rs3169319	by1000genomes	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70065826T>C	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						GATCCAAACATAGTGTTACAG	0.453													3	145	---	---	---	---	PASS
VAT1L	57687	broad.mit.edu	37	16	77859262	77859262	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77859262C>T	uc002ffg.1	+	3	580	c.483C>T	c.(481-483)TTC>TTT	p.F161F		NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.	161							oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						CTGCTGCATTCCCCATGAACT	0.537													4	39	---	---	---	---	PASS
PKD1L2	114780	broad.mit.edu	37	16	81249935	81249935	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81249935G>A	uc002fgh.1	-	2	378	c.378C>T	c.(376-378)GAC>GAT	p.D126D	PKD1L2_uc002fgj.2_Silent_p.D126D	NM_052892	NP_443124	Q7Z442	PK1L2_HUMAN	polycystin 1-like 2 isoform a	126	Extracellular (Potential).|C-type lectin.				neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GGCCGCAGGTGTCAGGGGCAG	0.657													14	37	---	---	---	---	PASS
CDH15	1013	broad.mit.edu	37	16	89254631	89254631	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89254631G>A	uc002fmt.2	+	7	993	c.916G>A	c.(916-918)GAT>AAT	p.D306N		NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	306	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		AGGCGACCCCGATGGGCAGTT	0.647													3	21	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1582371	1582371	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1582371G>A	uc002fte.2	-	11	1653	c.1539C>T	c.(1537-1539)CTC>CTT	p.L513L		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	513						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GCAGGTAGTTGAGGTTTTTGC	0.542													26	83	---	---	---	---	PASS
GSG2	83903	broad.mit.edu	37	17	3629671	3629671	+	3'UTR	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3629671G>C	uc002fwp.2	+	1					ITGAE_uc002fwo.3_Intron|ITGAE_uc002fwn.3_5'Flank	NM_031965	NP_114171	Q8TF76	HASP_HUMAN	haspin						cell cycle|chromatin modification|intracellular protein kinase cascade	nucleus	ATP binding|protein serine/threonine kinase activity				0						GACTGGTCTTGAAGCCTCTGG	0.473													7	24	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10432249	10432249	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10432249C>T	uc010coi.2	-	27	3630	c.3502G>A	c.(3502-3504)GAG>AAG	p.E1168K	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.E1168K|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1168	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTGTTCATCTCAATCTGGGCT	0.612													10	106	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10535904	10535904	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10535904G>C	uc002gmq.1	-	33	4922	c.4845C>G	c.(4843-4845)CTC>CTG	p.L1615L		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1615	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity	p.L1615R(1)		ovary(4)|central_nervous_system(2)|pancreas(1)	7						TCTTCTTCTTGAGCCGGATGG	0.587													6	325	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17699982	17699982	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17699982C>G	uc002grm.2	+	3	4189	c.3720C>G	c.(3718-3720)GTC>GTG	p.V1240V	RAI1_uc002grn.1_Silent_p.V1240V	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1240	Nuclear localization signal (Potential).					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		GGAACCTGGTCTTGCGGAGCC	0.632													5	20	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700179	17700179	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700179C>G	uc002grm.2	+	3	4386	c.3917C>G	c.(3916-3918)TCT>TGT	p.S1306C	RAI1_uc002grn.1_Missense_Mutation_p.S1306C	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1306						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		AAGCTCGCCTCTCGGGCAGCC	0.652													16	77	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700285	17700285	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700285C>G	uc002grm.2	+	3	4492	c.4023C>G	c.(4021-4023)CTC>CTG	p.L1341L	RAI1_uc002grn.1_Silent_p.L1341L	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1341						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		CGCCCAGCCTCAAGAAGTTCG	0.632													22	78	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700331	17700331	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700331C>A	uc002grm.2	+	3	4538	c.4069C>A	c.(4069-4071)CTG>ATG	p.L1357M	RAI1_uc002grn.1_Missense_Mutation_p.L1357M	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1357						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		TGGTAATCCTCTGAGCCCATC	0.622													18	94	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700911	17700911	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700911C>T	uc002grm.2	+	3	5118	c.4649C>T	c.(4648-4650)TCT>TTT	p.S1550F	RAI1_uc002grn.1_Missense_Mutation_p.S1550F	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1550						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		AACACCACCTCTTCACCCTGT	0.612													10	64	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17700914	17700914	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17700914C>T	uc002grm.2	+	3	5121	c.4652C>T	c.(4651-4653)TCA>TTA	p.S1551L	RAI1_uc002grn.1_Missense_Mutation_p.S1551L	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1551						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		ACCACCTCTTCACCCTGTAAG	0.607													10	62	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17701368	17701368	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17701368C>T	uc002grm.2	+	3	5575	c.5106C>T	c.(5104-5106)CTC>CTT	p.L1702L	RAI1_uc002grn.1_Silent_p.L1702L	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1702						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		TTGGGGACCTCTGTGGGCCCT	0.592													7	48	---	---	---	---	PASS
WSB1	26118	broad.mit.edu	37	17	25621403	25621403	+	5'UTR	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25621403A>G	uc002gzd.1	+	1					WSB1_uc010vzy.1_5'UTR|WSB1_uc010vzz.1_5'UTR|WSB1_uc010crf.1_5'UTR|WSB1_uc002gze.1_5'UTR|WSB1_uc002gzf.1_RNA	NM_015626	NP_056441	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box-containing 1 isoform 1						intracellular signal transduction	intracellular	protein binding				0	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TATTCCCGGAATCAGACGGTG	0.632													28	100	---	---	---	---	PASS
SLC13A2	9058	broad.mit.edu	37	17	26820718	26820718	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26820718C>T	uc002hbh.2	+	7	1075	c.1008C>T	c.(1006-1008)TTC>TTT	p.F336F	SLC13A2_uc010wal.1_Silent_p.F293F|SLC13A2_uc010wam.1_Silent_p.F292F|SLC13A2_uc010wan.1_Silent_p.F385F|SLC13A2_uc010wao.1_Silent_p.F293F|SLC13A2_uc002hbi.2_Silent_p.F265F	NM_003984	NP_003975	Q13183	S13A2_HUMAN	solute carrier family 13, member 2 isoform b	336	Helical; (Potential).					integral to plasma membrane|membrane fraction	low affinity sodium:dicarboxylate symporter activity				0	all_lung(13;0.000871)|Lung NSC(42;0.0027)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)	Succinic acid(DB00139)	GCATCCTATTCGTCATCCTGG	0.577													7	144	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27000447	27000447	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27000447G>A	uc002hby.2	+	2	118	c.28G>A	c.(28-30)GAG>AAG	p.E10K	SUPT6H_uc010crt.2_Missense_Mutation_p.E10K	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	10	Asp/Glu-rich.				chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					AAGCGAGGCTGAGGAGTCAGA	0.483													8	47	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27421806	27421806	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27421806C>T	uc002hdt.1	-	30	4730	c.4572G>A	c.(4570-4572)CAG>CAA	p.Q1524Q	MYO18A_uc010wbc.1_Silent_p.Q1066Q|MYO18A_uc002hds.2_Silent_p.Q1066Q|MYO18A_uc010csa.1_Silent_p.Q1524Q|MYO18A_uc002hdu.1_Silent_p.Q1524Q	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	1524	Potential.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			AAGAAATGTCCTGGAGCTCTG	0.537													10	264	---	---	---	---	PASS
C17orf42	79736	broad.mit.edu	37	17	29227537	29227537	+	Missense_Mutation	SNP	A	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29227537A>G	uc002hfu.2	-	3	609	c.539T>C	c.(538-540)ATT>ACT	p.I180T	C17orf42_uc002hfv.2_RNA|C17orf42_uc002hfw.2_Missense_Mutation_p.I180T	NM_024683	NP_078959	Q96QE5	TEFM_HUMAN	hypothetical protein LOC79736	180					oxidative phosphorylation|regulation of transcription, DNA-dependent|transcription from mitochondrial promoter	mitochondrial nucleoid|ribonucleoprotein complex	DNA polymerase processivity factor activity|nucleic acid binding|protein binding			ovary(1)	1		all_cancers(10;4.64e-07)|all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				AGCCCAGGCAATTCTTCGAGT	0.338													21	171	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29576080	29576080	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29576080C>G	uc002hgg.2	+	30	4386	c.4053C>G	c.(4051-4053)ATC>ATG	p.I1351M	NF1_uc002hgh.2_Missense_Mutation_p.I1351M|NF1_uc010csn.1_Missense_Mutation_p.I1211M|NF1_uc002hgi.1_Missense_Mutation_p.I384M	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1351	Ras-GAP.				actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATGCCATCATCAGTTCCTCCT	0.388			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			24	260	---	---	---	---	PASS
ZNF830	91603	broad.mit.edu	37	17	33289675	33289675	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33289675G>A	uc002hih.3	+	1	1127	c.1090G>A	c.(1090-1092)GAT>AAT	p.D364N	CCT6B_uc002hig.2_5'Flank|CCT6B_uc010ctg.2_5'Flank|CCT6B_uc010wcc.1_5'Flank	NM_052857	NP_443089	Q96NB3	ZN830_HUMAN	coiled-coil domain containing 16	364					cell division|mitosis	cytoplasm|nucleus	metal ion binding			breast(1)	1		Ovarian(249;0.17)				GTTGTCTCAGGATTGGAGGGT	0.413													4	143	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35512649	35512649	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35512649G>A	uc002hnm.2	-	43	5483	c.5292C>T	c.(5290-5292)CTC>CTT	p.L1764L	ACACA_uc002hnk.2_Silent_p.L1686L|ACACA_uc002hnl.2_Silent_p.L1706L|ACACA_uc002hnn.2_Silent_p.L1764L|ACACA_uc002hno.2_Silent_p.L1801L|ACACA_uc010cuy.2_Silent_p.L409L|ACACA_uc010wdc.1_5'UTR	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1764	Carboxyltransferase.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GGACAGAGTTGAGAGCACTGA	0.358													43	312	---	---	---	---	PASS
TBC1D3	729873	broad.mit.edu	37	17	36288269	36288269	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36288269G>A	uc002hoo.2	+	6	512	c.355G>A	c.(355-357)GAA>AAA	p.E119K	TBC1D3_uc002hop.2_RNA|TBC1D3_uc010wdj.1_Missense_Mutation_p.E39K|TBC1D3_uc010cvf.1_Missense_Mutation_p.E119K|TBC1D3_uc002hoq.2_Missense_Mutation_p.E119K|TBC1D3_uc010wdk.1_Missense_Mutation_p.E180K|uc002hpl.2_5'Flank|uc002hor.2_5'Flank	NM_032258	NP_115634	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3F	119	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAACACTGAGGAAATGAAGTT	0.557													19	678	---	---	---	---	PASS
LASP1	3927	broad.mit.edu	37	17	37046755	37046755	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37046755C>T	uc002hra.2	+	3	578	c.247C>T	c.(247-249)CAG>TAG	p.Q83*	LASP1_uc010wdy.1_Nonsense_Mutation_p.Q83*|LASP1_uc010cvq.2_5'UTR|LASP1_uc010wdz.1_Intron	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	83	Nebulin 1.					cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1						GCTCCAGAGTCAGGTGAGGGG	0.597			T	MLL	AML								13	67	---	---	---	---	PASS
KRT24	192666	broad.mit.edu	37	17	38857538	38857538	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38857538C>G	uc002hvd.2	-	3	766	c.709G>C	c.(709-711)GAG>CAG	p.E237Q		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	237	Rod.|Coil 1B.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				AGACACAGCTCGTTCTCATAC	0.507													6	60	---	---	---	---	PASS
KRTAP4-9	100132386	broad.mit.edu	37	17	39262231	39262231	+	Silent	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39262231C>A	uc010wfp.1	+	1	591	c.591C>A	c.(589-591)TCC>TCA	p.S197S		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	197						keratin filament					0						GTGTCATCTCCAGCTGCCCCC	0.512													6	4	---	---	---	---	PASS
KLHL11	55175	broad.mit.edu	37	17	40011443	40011443	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40011443C>G	uc002hyf.1	-	2	682	c.676G>C	c.(676-678)GAT>CAT	p.D226H		NM_018143	NP_060613	Q9NVR0	KLH11_HUMAN	kelch-like 11 precursor	226	BACK.					extracellular region					0		Breast(137;0.00156)				CGTATCATATCAGCAGCCTTC	0.383													44	162	---	---	---	---	PASS
ACLY	47	broad.mit.edu	37	17	40068681	40068681	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40068681C>T	uc002hyg.2	-	3	437	c.274G>A	c.(274-276)GAA>AAA	p.E92K	ACLY_uc002hyh.2_Missense_Mutation_p.E92K|ACLY_uc002hyi.2_Missense_Mutation_p.E146K|ACLY_uc010wfx.1_Missense_Mutation_p.E146K|ACLY_uc010wfy.1_Missense_Mutation_p.E92K	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	92					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				ACTGTGGCTTCCTGTCCCAGC	0.567													7	111	---	---	---	---	PASS
KAT2A	2648	broad.mit.edu	37	17	40271680	40271680	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40271680C>G	uc002hyx.2	-	5	816	c.756G>C	c.(754-756)CAG>CAC	p.Q252H		NM_021078	NP_066564	Q92830	KAT2A_HUMAN	general control of amino acid synthesis 5-like	252					chromatin remodeling|histone deubiquitination|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	H3 histone acetyltransferase activity|histone deacetylase binding|protein binding|transcription coactivator activity			upper_aerodigestive_tract(1)|lung(1)	2						CGAACATCGTCTGCCGCTCCC	0.547													19	63	---	---	---	---	PASS
LRRC37A4	55073	broad.mit.edu	37	17	43585469	43585469	+	Intron	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43585469C>T	uc002ije.2	-						uc010wjp.1_RNA					Homo sapiens cDNA FLJ34414 fis, clone HEART2003168, highly similar to Homo sapiens c114 SLIT-like testicular protein (LOC474170), mRNA.												0						GGGCTGGGTTCTCCTCCTATG	0.512													5	62	---	---	---	---	PASS
CALCOCO2	10241	broad.mit.edu	37	17	46926617	46926617	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46926617G>A	uc002iof.2	+	5	500	c.421G>A	c.(421-423)GAG>AAG	p.E141K	CALCOCO2_uc010wlp.1_Missense_Mutation_p.E162K|CALCOCO2_uc010wlq.1_Missense_Mutation_p.E69K|CALCOCO2_uc010wlr.1_Missense_Mutation_p.E165K|CALCOCO2_uc010wls.1_Intron	NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	141	Potential.				response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1						TTTGTAGGGAGAGGTGGAAGA	0.463													34	107	---	---	---	---	PASS
SLC35B1	10237	broad.mit.edu	37	17	47780327	47780327	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47780327G>C	uc002iph.1	-	8	896	c.809C>G	c.(808-810)TCC>TGC	p.S270C	SLC35B1_uc002ipi.1_Missense_Mutation_p.S203C|SLC35B1_uc002ipj.1_Missense_Mutation_p.S146C	NM_005827	NP_005818	P78383	S35B1_HUMAN	solute carrier family 35, member B1	270						endoplasmic reticulum membrane|integral to membrane|microsome	UDP-galactose transmembrane transporter activity				0						AGTGATGATGGAGCAGGTCAG	0.502													8	127	---	---	---	---	PASS
MRPL27	51264	broad.mit.edu	37	17	48445522	48445522	+	Silent	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48445522G>C	uc002iqq.2	-	4	409	c.378C>G	c.(376-378)CTC>CTG	p.L126L	MRPL27_uc002iqr.2_3'UTR	NM_016504	NP_057588	Q9P0M9	RM27_HUMAN	mitochondrial ribosomal protein L27	126					translation	mitochondrial large ribosomal subunit	structural constituent of ribosome				0	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;1.73e-07)			AAGTCTTGTAGAGCACAGCAC	0.547													22	57	---	---	---	---	PASS
UTP18	51096	broad.mit.edu	37	17	49374347	49374347	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49374347C>G	uc002its.2	+	13	1717	c.1668C>G	c.(1666-1668)TTC>TTG	p.F556L		NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component	556				GKALMYRLHHYSDF -> ARP (in Ref. 1; AAD34043).	rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			ACTCAGACTTCTAAAGAGACT	0.373													16	167	---	---	---	---	PASS
MPO	4353	broad.mit.edu	37	17	56349051	56349051	+	Silent	SNP	G	A	A	rs141229223	byFrequency	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56349051G>A	uc002ivu.1	-	11	2172	c.1995C>T	c.(1993-1995)ATC>ATT	p.I665I		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	665					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	ACTGGGTACCGATGATGCAGG	0.647													5	46	---	---	---	---	PASS
MPO	4353	broad.mit.edu	37	17	56350157	56350157	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56350157C>G	uc002ivu.1	-	10	1921	c.1744G>C	c.(1744-1746)GAC>CAC	p.D582H		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	582					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)	GCAGGCAGGTCCAGCCCAATC	0.617													12	210	---	---	---	---	PASS
C17orf47	284083	broad.mit.edu	37	17	56620137	56620137	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56620137C>G	uc002iwq.1	-	1	1547	c.1411G>C	c.(1411-1413)GAG>CAG	p.E471Q	SEPT4_uc010wnx.1_5'Flank|SEPT4_uc010wny.1_5'Flank	NM_001038704	NP_001033793	Q8NEP4	CQ047_HUMAN	hypothetical protein LOC284083	471										breast(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTCAGATCCTCACAGAAAGGG	0.493													30	462	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58286164	58286164	+	Missense_Mutation	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58286164T>C	uc002iyo.1	-	23	2910	c.2624A>G	c.(2623-2625)AAT>AGT	p.N875S	USP32_uc002iyn.1_Missense_Mutation_p.N545S	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	875					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AATTGATCTATTTCTTCTTAG	0.348													14	115	---	---	---	---	PASS
FBF1	85302	broad.mit.edu	37	17	73922925	73922925	+	Missense_Mutation	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73922925T>C	uc002jqc.2	-	9	741	c.467A>G	c.(466-468)TAT>TGT	p.Y156C	FBF1_uc002jqa.1_RNA|FBF1_uc010wsp.1_Missense_Mutation_p.Y146C|FBF1_uc002jqd.1_Missense_Mutation_p.Y156C	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	156											0						TCCTTCATCATAGGAGAGAAG	0.512													8	21	---	---	---	---	PASS
PRPSAP1	5635	broad.mit.edu	37	17	74307507	74307507	+	3'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74307507G>A	uc010wta.1	-	10					PRPSAP1_uc010wtb.1_3'UTR	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						GGCAAAAGAAGATATCTAACT	0.468													4	15	---	---	---	---	PASS
PRPSAP1	5635	broad.mit.edu	37	17	74307742	74307742	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74307742G>A	uc010wta.1	-	10	1485	c.1039C>T	c.(1039-1041)CTG>TTG	p.L347L	PRPSAP1_uc010wtb.1_Silent_p.L244L	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate	318					nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						GGACATTGCAGCTTCTGAACC	0.453													19	102	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78343329	78343329	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78343329C>T	uc002jyh.1	+	20	6625	c.6402C>T	c.(6400-6402)TTC>TTT	p.F2134F	uc002jyi.1_Intron|RNF213_uc010dhw.1_Silent_p.F516F	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATGCCCGCTTCCGGCAGATGT	0.493													62	177	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78343399	78343399	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78343399G>A	uc002jyh.1	+	20	6695	c.6472G>A	c.(6472-6474)GAG>AAG	p.E2158K	uc002jyi.1_Intron|RNF213_uc010dhw.1_Missense_Mutation_p.E540K	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CGCTCCGCCTGAGAAGGAAGT	0.517													42	139	---	---	---	---	PASS
NARF	26502	broad.mit.edu	37	17	80439027	80439027	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80439027C>T	uc002kfg.3	+	7	849	c.709C>T	c.(709-711)CAG>TAG	p.Q237*	NARF_uc002kff.3_Nonsense_Mutation_p.Q178*|NARF_uc010wvo.1_Nonsense_Mutation_p.Q192*|NARF_uc010wvp.1_Nonsense_Mutation_p.Q109*|NARF_uc010dit.2_Nonsense_Mutation_p.Q237*|NARF_uc002kfj.3_Nonsense_Mutation_p.Q189*|NARF_uc002kfi.3_RNA|NARF_uc002kfh.3_Nonsense_Mutation_p.Q283*|NARF_uc002kfk.2_RNA	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a	237						lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GGAGGCTCTTCAGGAAAGCCT	0.577													13	182	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7038844	7038844	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7038844C>T	uc002knm.2	-	11	1622	c.1528G>A	c.(1528-1530)GAT>AAT	p.D510N	LAMA1_uc010wzj.1_5'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	510	Laminin EGF-like 5; first part.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTGCAGACATCAGAAACGCCA	0.567													15	179	---	---	---	---	PASS
CEP76	79959	broad.mit.edu	37	18	12702511	12702511	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12702511G>A	uc002kri.2	-	1	193	c.37C>T	c.(37-39)CAG>TAG	p.Q13*	PSMG2_uc002krg.2_Intron|PSMG2_uc002krj.1_5'Flank|PSMG2_uc002krk.2_5'Flank|CEP76_uc002krh.3_5'UTR|CEP76_uc010wzz.1_Nonsense_Mutation_p.Q13*|CEP76_uc010xaa.1_5'Flank|CEP76_uc010xab.1_Nonsense_Mutation_p.Q13*	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	13					G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						TGGATGAGCTGCTTCAGCTCG	0.706													7	23	---	---	---	---	PASS
ELP2	55250	broad.mit.edu	37	18	33738801	33738801	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33738801G>T	uc002kzk.1	+	14	1478	c.1468G>T	c.(1468-1470)GAT>TAT	p.D490Y	ELP2_uc010xcg.1_Missense_Mutation_p.D555Y|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Missense_Mutation_p.D464Y|ELP2_uc010xch.1_Missense_Mutation_p.D485Y|ELP2_uc002kzn.1_Missense_Mutation_p.D420Y|ELP2_uc002kzo.1_Missense_Mutation_p.D420Y	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	490					regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						ATTCTAGCAAGATAGTGATCT	0.308													20	75	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43495477	43495477	+	Missense_Mutation	SNP	T	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43495477T>A	uc002lbm.2	-	20	3792	c.3692A>T	c.(3691-3693)CAG>CTG	p.Q1231L	KIAA1632_uc002lbo.1_Missense_Mutation_p.Q1231L|KIAA1632_uc010xcq.1_5'UTR|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Missense_Mutation_p.Q106L	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1231					autophagy						0						GTTTCCTACCTGAGTGGGCGT	0.418													26	84	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44559494	44559494	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44559494C>T	uc002lcr.1	-	1	2495	c.2142G>A	c.(2140-2142)CTG>CTA	p.L714L	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	714					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						TGCTGCTGCTCAGGCAGGGGT	0.522													20	55	---	---	---	---	PASS
KATNAL2	83473	broad.mit.edu	37	18	44589673	44589673	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44589673C>T	uc002lco.2	+	7	645	c.451C>T	c.(451-453)CTG>TTG	p.L151L	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Silent_p.L111L	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2	223						cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						GCTGAAACCTCTGAGTGCATT	0.468													4	61	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50592482	50592482	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50592482G>A	uc002lfe.1	+	7	1794	c.1207G>A	c.(1207-1209)GAA>AAA	p.E403K	DCC_uc010xdr.1_Missense_Mutation_p.E251K|DCC_uc010dpf.1_Missense_Mutation_p.E58K	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	403	Extracellular (Potential).|Ig-like C2-type 4.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATGTGTGGCTGAAAATGAGGC	0.438													19	150	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74587572	74587572	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74587572C>T	uc002lmi.2	+	6	984	c.786C>T	c.(784-786)TTC>TTT	p.F262F	ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Silent_p.F262F	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	262	C2H2-type 8.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CTGCCGCCTTCTCTCAGAAAG	0.532											OREG0025069	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	137	---	---	---	---	PASS
SLC39A3	29985	broad.mit.edu	37	19	2737188	2737188	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2737188G>C	uc002lwg.2	-	2	322	c.68C>G	c.(67-69)TCC>TGC	p.S23C	SLC39A3_uc010xgy.1_Missense_Mutation_p.S23C|SLC39A3_uc002lwh.2_Missense_Mutation_p.S23C	NM_144564	NP_653165	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter),	23	Helical; (Potential).					integral to membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGAGCAGGGAGCCGAGCAG	0.547													3	27	---	---	---	---	PASS
MATK	4145	broad.mit.edu	37	19	3781668	3781668	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3781668C>T	uc002lyt.2	-	8	1079	c.679G>A	c.(679-681)GGC>AGC	p.G227S	MATK_uc002lyv.2_Missense_Mutation_p.G228S|MATK_uc002lyu.2_Missense_Mutation_p.G186S|MATK_uc010dtq.2_Missense_Mutation_p.G227S	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	227					cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTAACCAGCCCGCTGTGGAG	0.557													3	41	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7174599	7174599	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7174599C>T	uc002mgd.1	-	4	1227	c.1118G>A	c.(1117-1119)GGA>GAA	p.G373E	INSR_uc002mge.1_Missense_Mutation_p.G373E|INSR_uc002mgf.2_Missense_Mutation_p.G373E	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	373					activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTCACTGCCTCCTCGAATGTT	0.602													9	49	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10568641	10568641	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10568641C>A	uc002moj.2	+	8	1072	c.964C>A	c.(964-966)CCC>ACC	p.P322T	PDE4A_uc002mok.2_Missense_Mutation_p.P296T|PDE4A_uc002mol.2_Missense_Mutation_p.P261T|PDE4A_uc002mom.2_Missense_Mutation_p.P83T|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_5'Flank	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	322					signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	CTCCCAGCCGCCCCCGCCCCC	0.522													6	44	---	---	---	---	PASS
ZNF441	126068	broad.mit.edu	37	19	11891441	11891441	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11891441C>G	uc010dyj.2	+	4	996	c.802C>G	c.(802-804)CAA>GAA	p.Q268E	ZNF441_uc002msn.3_Missense_Mutation_p.Q224E	NM_152355	NP_689568	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	268	C2H2-type 4; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTGTTACACTCAACTATATGA	0.383													4	117	---	---	---	---	PASS
NFIX	4784	broad.mit.edu	37	19	13183886	13183886	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13183886C>A	uc010xmx.1	+	3	662	c.609C>A	c.(607-609)AAC>AAA	p.N203K	NFIX_uc002mwd.2_Missense_Mutation_p.N195K|NFIX_uc002mwe.2_Missense_Mutation_p.N187K|NFIX_uc002mwf.2_Missense_Mutation_p.N198K|NFIX_uc002mwg.1_Missense_Mutation_p.N194K			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	195					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			ATAGTTCAAACCAGCAAGGAG	0.557													5	103	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17305659	17305659	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17305659C>G	uc010eak.2	+	22	3575	c.3423C>G	c.(3421-3423)GTC>GTG	p.V1141V	MYO9B_uc002nfi.2_Silent_p.V1141V|MYO9B_uc002nfj.1_Silent_p.V1141V	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1141	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						ACGAGAAAGTCCCCAGCAGCC	0.607													4	26	---	---	---	---	PASS
ANO8	57719	broad.mit.edu	37	19	17440962	17440962	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17440962C>T	uc002ngf.2	-	10	1404	c.1245G>A	c.(1243-1245)AAG>AAA	p.K415K	ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8	415	Helical; (Potential).|Leu-rich.					chloride channel complex	chloride channel activity			ovary(3)	3						TGGCTAGCTTCTTGTAGCCCT	0.627													5	54	---	---	---	---	PASS
ZNF682	91120	broad.mit.edu	37	19	20117297	20117297	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20117297C>T	uc002noq.2	-	4	1137	c.1014G>A	c.(1012-1014)GAG>GAA	p.E338E	ZNF682_uc002noo.2_Silent_p.E306E|ZNF682_uc002nop.2_Silent_p.E306E|ZNF682_uc010eck.2_Silent_p.E262E	NM_033196	NP_149973	O95780	ZN682_HUMAN	zinc finger protein 682 isoform 1	338					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2						TATAGGGTTTCTCTCCCGTAT	0.383													23	114	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	19	23159739	23159739	+	RNA	SNP	T	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23159739T>A	uc002nqy.1	-	3		c.411A>T			uc002nqz.1_Missense_Mutation_p.N70Y					Homo sapiens zinc finger protein 117, mRNA (cDNA clone IMAGE:40112371).																		AAACTCTGGTTAAGCTTATTA	0.313													12	64	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24270011	24270011	+	5'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24270011G>A	uc002nru.2	+	1					ZNF254_uc010xrk.1_Intron|ZNF254_uc002nrt.1_RNA	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				CGCTGTCGCCGGAGTCCCAGG	0.587													6	9	---	---	---	---	PASS
SLC7A9	11136	broad.mit.edu	37	19	33359415	33359415	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33359415C>T	uc002ntv.3	-	2	143	c.26G>A	c.(25-27)CGG>CAG	p.R9Q	SLC7A9_uc002ntt.3_RNA|SLC7A9_uc002ntu.3_Missense_Mutation_p.R9Q|SLC7A9_uc002ntw.3_5'UTR	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9	9	Cytoplasmic (Potential).				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	ATCCTCTCTCCGCTTTCTCAG	0.557													20	148	---	---	---	---	PASS
ZNF793	390927	broad.mit.edu	37	19	38028585	38028585	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38028585G>C	uc010efm.2	+	8	1467	c.1025G>C	c.(1024-1026)AGA>ACA	p.R342T	ZNF793_uc010xts.1_Missense_Mutation_p.R342T|ZNF793_uc010efo.2_Intron	NM_001013659	NP_001013681	Q6ZN11	ZN793_HUMAN	zinc finger protein 793	342	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TATCGTTGCAGAGAATGTGGA	0.453													4	70	---	---	---	---	PASS
SAMD4B	55095	broad.mit.edu	37	19	39868169	39868169	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39868169G>A	uc002olb.2	+	10	2184	c.1149G>A	c.(1147-1149)CTG>CTA	p.L383L	SAMD4B_uc002ola.2_Silent_p.L383L	NM_018028	NP_060498	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	383							protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			TGCAGGAGCTGCAGCAGATCA	0.627													5	75	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43680125	43680125	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43680125G>A	uc002ovu.2	-	3	737	c.606C>T	c.(604-606)CTC>CTT	p.L202L	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Intron|PSG5_uc002ovx.2_Silent_p.L202L|PSG5_uc002ovv.2_Silent_p.L295L|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	202	Ig-like C2-type 1.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				TGGGTAGAATGAGGATCCTGT	0.507													6	277	---	---	---	---	PASS
PLAUR	5329	broad.mit.edu	37	19	44169603	44169603	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44169603C>T	uc002oxf.1	-	3	405	c.175G>A	c.(175-177)GAG>AAG	p.E59K	PLAUR_uc002oxd.1_Missense_Mutation_p.E59K|PLAUR_uc002oxe.1_Missense_Mutation_p.E54K|PLAUR_uc002oxg.1_Missense_Mutation_p.E59K	NM_002659	NP_002650	Q03405	UPAR_HUMAN	plasminogen activator, urokinase receptor	59	UPAR/Ly6 1.				attachment of GPI anchor to protein|blood coagulation|C-terminal protein lipidation|cellular component movement|chemotaxis|fibrinolysis|regulation of proteolysis	anchored to membrane|cell surface|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|extrinsic to membrane|integral to membrane|plasma membrane	enzyme binding|U-plasminogen activator receptor activity			ovary(1)	1		Prostate(69;0.0153)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Urokinase(DB00013)	AGCTCCAGCTCTTCTCCTTCT	0.557													6	89	---	---	---	---	PASS
ZNF285	26974	broad.mit.edu	37	19	44896514	44896514	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44896514G>A	uc002ozd.3	-	3	219	c.132C>T	c.(130-132)CTC>CTT	p.L44L	ZFP112_uc010xwz.1_Intron|ZNF285_uc010xxa.1_Silent_p.L51L	NM_152354	NP_689567	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	44	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(2)	4						TCACTAACATGAGGTTCCTGA	0.428													16	192	---	---	---	---	PASS
CCDC9	26093	broad.mit.edu	37	19	47761620	47761620	+	5'UTR	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47761620G>C	uc010xym.1	+	2						NM_015603	NP_056418	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9												0		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		TTCTGCAGGGGAGGTTTGCTG	0.547													7	67	---	---	---	---	PASS
CCDC9	26093	broad.mit.edu	37	19	47761897	47761897	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47761897G>C	uc010xym.1	+	3	292	c.85G>C	c.(85-87)GAG>CAG	p.E29Q		NM_015603	NP_056418	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	29											0		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		GCGGAAGAATGAGGCCCTCAT	0.552													3	74	---	---	---	---	PASS
VN1R4	317703	broad.mit.edu	37	19	53770061	53770061	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53770061C>G	uc010ydu.1	-	1	858	c.858G>C	c.(856-858)ATG>ATC	p.M286I		NM_173857	NP_776256	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	286	Cytoplasmic (Potential).				response to pheromone	actin cytoskeleton|cytoplasm|integral to membrane|plasma membrane	pheromone receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.00294)		GGTCACAGCTCATGAGAACAA	0.393										HNSCC(26;0.072)			5	82	---	---	---	---	PASS
ZNF813	126017	broad.mit.edu	37	19	53983431	53983431	+	Intron	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53983431G>A	uc002qbu.2	+							NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		ACCTTTACCTGAGGGCTGATC	0.572													10	217	---	---	---	---	PASS
TMC4	147798	broad.mit.edu	37	19	54667458	54667458	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54667458G>A	uc010erf.2	-	8	1425	c.1293C>T	c.(1291-1293)CTC>CTT	p.L431L	TMC4_uc002qdn.2_Nonsense_Mutation_p.Q122*|TMC4_uc002qdo.2_Silent_p.L425L	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1	431	Helical; (Potential).					integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCTGGAACCTGAGCAGGATAA	0.567											OREG0003641	type=REGULATORY REGION|Gene=AK124406|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	74	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55147018	55147018	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55147018G>A	uc002qgj.2	+	14	1948	c.1608G>A	c.(1606-1608)GTG>GTA	p.V536V	LILRB1_uc010erp.1_Silent_p.V151V|LILRB1_uc002qgl.2_Silent_p.V536V|LILRB1_uc002qgk.2_Silent_p.V537V|LILRB1_uc002qgm.2_Silent_p.V537V|LILRB1_uc010erq.2_Silent_p.V520V|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	536	Cytoplasmic (Potential).|ITIM motif 1.				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		ATGCTGCCGTGAAGCACACAC	0.627										HNSCC(37;0.09)			5	137	---	---	---	---	PASS
LRRN4	164312	broad.mit.edu	37	20	6021639	6021639	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6021639C>T	uc002wmo.2	-	5						NM_152611	NP_689824	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4 precursor							integral to membrane				skin(3)	3						AGATCCAGTTCGATGAGACGC	0.547													12	50	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628243	29628243	+	Missense_Mutation	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628243T>C	uc010ztl.1	+	3	187	c.155T>C	c.(154-156)TTG>TCG	p.L52S	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.L4S					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGGCTTTGTTGGCCTCAAAT	0.353													4	136	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29628245	29628245	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628245G>A	uc010ztl.1	+	3	189	c.157G>A	c.(157-159)GCC>ACC	p.A53T	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Missense_Mutation_p.A5T					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGCTTTGTTGGCCTCAAATAG	0.353													4	134	---	---	---	---	PASS
TPX2	22974	broad.mit.edu	37	20	30345274	30345274	+	5'UTR	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30345274G>C	uc002wwp.1	+	3					TPX2_uc010gdv.1_5'UTR	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			CGTTAAGTGGGAGACAATGTC	0.393													5	116	---	---	---	---	PASS
UQCC	55245	broad.mit.edu	37	20	33969816	33969816	+	Missense_Mutation	SNP	T	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33969816T>C	uc002xcd.2	-	4	305	c.238A>G	c.(238-240)AAA>GAA	p.K80E	UQCC_uc010zuy.1_5'UTR|UQCC_uc010zuz.1_Intron|UQCC_uc010zva.1_Intron|UQCC_uc002xce.2_Missense_Mutation_p.K80E|UQCC_uc002xcg.2_5'UTR|UQCC_uc010gfb.2_Missense_Mutation_p.K80E|UQCC_uc010zvb.1_Intron|UQCC_uc002xcf.2_Intron|GDF5_uc010gfc.1_Intron|UQCC_uc002xci.1_Missense_Mutation_p.K34E|UQCC_uc010gfd.1_Missense_Mutation_p.K66E	NM_018244	NP_060714	Q9NVA1	UQCC_HUMAN	basic FGF-repressed Zic binding protein isoform	80						cytoplasmic membrane-bounded vesicle				breast(1)	1			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GGGGAATCTTTGGTAGTAGAA	0.358													91	251	---	---	---	---	PASS
IFT52	51098	broad.mit.edu	37	20	42271258	42271258	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42271258G>C	uc002xkw.2	+	13	1382	c.1260G>C	c.(1258-1260)TTG>TTC	p.L420F	IFT52_uc002xky.2_Missense_Mutation_p.L420F|IFT52_uc002xkx.2_RNA|IFT52_uc010ggn.2_Missense_Mutation_p.L396F|IFT52_uc002xkz.2_Intron	NM_016004	NP_057088	Q9Y366	IFT52_HUMAN	intraflagellar transport 52 homolog	420						intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCAAGAAATTGAACCAGGTAC	0.463													5	60	---	---	---	---	PASS
MMP9	4318	broad.mit.edu	37	20	44640217	44640217	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44640217C>G	uc002xqz.2	+	6	847	c.828C>G	c.(826-828)CTC>CTG	p.L276L		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	276					collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	CCCCAGGACTCTACACCCAGG	0.577											OREG0025989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	66	---	---	---	---	PASS
DDX27	55661	broad.mit.edu	37	20	47841697	47841697	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47841697C>T	uc002xuh.2	+	6	715	c.654C>T	c.(652-654)CTC>CTT	p.L218L		NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	218	Q motif.					nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ATGAAAACCTCTCGTTCCAGG	0.338													17	238	---	---	---	---	PASS
STX16	8675	broad.mit.edu	37	20	57251299	57251299	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57251299C>T	uc002xzi.2	+	9	1665	c.930C>T	c.(928-930)GTC>GTT	p.V310V	STX16_uc010zzq.1_Silent_p.V124V|STX16_uc002xzk.2_Silent_p.V293V|STX16_uc002xzm.2_Silent_p.V306V|STX16_uc002xzj.2_Silent_p.V289V|STX16_uc002xzl.2_Silent_p.V124V	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a	310	Helical; Anchor for type IV membrane protein; (Potential).				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TATTATTTGTCATCATCATTG	0.448													21	185	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61944555	61944555	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61944555C>T	uc011aau.1	+	17	2263	c.2163C>T	c.(2161-2163)TAC>TAT	p.Y721Y	COL20A1_uc011aav.1_Silent_p.Y542Y	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	721	Fibronectin type-III 5.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					TGGCCTACTACAGGGACGGGG	0.657													3	32	---	---	---	---	PASS
CLIC6	54102	broad.mit.edu	37	21	36088774	36088774	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36088774G>A	uc010gmt.1	+	7	2109	c.2109G>A	c.(2107-2109)ATG>ATA	p.M703I	CLIC6_uc002yuf.1_Missense_Mutation_p.M685I	NM_053277	NP_444507	Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	703	GST C-terminal.					chloride channel complex|cytoplasm|plasma membrane	voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2						CAAAAAGAATGAAATGAAGCT	0.373													6	100	---	---	---	---	PASS
PSMG1	8624	broad.mit.edu	37	21	40547517	40547517	+	Nonstop_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40547517C>G	uc002yxi.2	-	7	995	c.866G>C	c.(865-867)TGA>TCA	p.*289S	PSMG1_uc002yxj.2_Nonstop_Mutation_p.*268S|PSMG1_uc010gob.2_Nonstop_Mutation_p.*202S	NM_003720	NP_003711	O95456	PSMG1_HUMAN	Down syndrome critical region protein 2 isoform	289					proteasome assembly	endoplasmic reticulum	protein binding				0		Prostate(19;8.44e-08)				TGTTTAAGATCATGTATAAAT	0.333											OREG0026220	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	77	---	---	---	---	PASS
PSMG1	8624	broad.mit.edu	37	21	40547542	40547542	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40547542C>G	uc002yxi.2	-	7	970	c.841G>C	c.(841-843)GAG>CAG	p.E281Q	PSMG1_uc002yxj.2_Missense_Mutation_p.E260Q|PSMG1_uc010gob.2_Missense_Mutation_p.E194Q	NM_003720	NP_003711	O95456	PSMG1_HUMAN	Down syndrome critical region protein 2 isoform	281					proteasome assembly	endoplasmic reticulum	protein binding				0		Prostate(19;8.44e-08)				CTCTGAATCTCATTTGTTGTC	0.368											OREG0026220	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	84	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41427661	41427661	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41427661C>G	uc002yyq.1	-	29	5478	c.5026G>C	c.(5026-5028)GAG>CAG	p.E1676Q	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1676	Cytoplasmic (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCAATGGTCTCCATCGTGTCT	0.493													20	68	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18022144	18022144	+	Missense_Mutation	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18022144C>G	uc010gqw.1	+	15	2372	c.2246C>G	c.(2245-2247)TCT>TGT	p.S749C	CECR2_uc010gqv.1_Missense_Mutation_p.S608C|CECR2_uc002zml.2_Missense_Mutation_p.S608C	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	791					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		CGAGTACACTCTGCCGTCTGG	0.582													7	43	---	---	---	---	PASS
SERPIND1	3053	broad.mit.edu	37	22	21140347	21140347	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21140347G>T	uc002ztb.1	+	4	1286	c.1219G>T	c.(1219-1221)GAG>TAG	p.E407*	PI4KA_uc002zsz.3_Intron|SERPIND1_uc002ztc.2_Nonsense_Mutation_p.E435*	NM_000185	NP_000176	P05546	HEP2_HUMAN	heparin cofactor II precursor	407					blood coagulation|chemotaxis|regulation of proteolysis	extracellular region	heparin binding|serine-type endopeptidase inhibitor activity				0	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)	CAATCTAGTGGAGTCCCTGAA	0.483													15	198	---	---	---	---	PASS
TFIP11	24144	broad.mit.edu	37	22	26894901	26894901	+	Missense_Mutation	SNP	C	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26894901C>A	uc003acr.2	-	9	1744	c.1370G>T	c.(1369-1371)AGC>ATC	p.S457I	TFIP11_uc003acs.2_Missense_Mutation_p.S457I|TFIP11_uc003act.2_Missense_Mutation_p.S457I	NM_012143	NP_036275	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	457					biomineral tissue development	catalytic step 2 spliceosome|cytoplasm|nuclear speck	DNA binding|sequence-specific DNA binding transcription factor activity				0						CTCTAGGAGGCTTTTCCACTT	0.572													10	253	---	---	---	---	PASS
MTMR3	8897	broad.mit.edu	37	22	30421830	30421830	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30421830C>T	uc003agv.3	+	20					MTMR3_uc003agu.3_3'UTR|MTMR3_uc003agw.3_3'UTR	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c						phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			AGCTGCTGTTCCTATGACAGG	0.567													4	54	---	---	---	---	PASS
SEC14L2	23541	broad.mit.edu	37	22	30806616	30806616	+	Silent	SNP	C	G	G			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30806616C>G	uc003ahr.2	+	8	785	c.612C>G	c.(610-612)CTC>CTG	p.L204L	SEC14L2_uc003ahq.2_Silent_p.L204L|SEC14L2_uc011akx.1_Silent_p.L150L|SEC14L2_uc003ahs.2_Silent_p.L130L|SEC14L2_uc011aky.1_Silent_p.L121L|SEC14L2_uc003aht.2_RNA|SEC14L2_uc003ahu.3_Silent_p.L28L|SEC14L2_uc010gvv.2_RNA|SEC14L2_uc010gvw.1_RNA|MTP18_uc010gvx.1_5'UTR|MTP18_uc003ahv.1_Silent_p.L28L|MTP18_uc010gvy.1_Silent_p.L28L	NM_012429	NP_036561	O76054	S14L2_HUMAN	SEC14-like 2 isoform 1	204	CRAL-TRIO.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	phospholipid binding|transporter activity|vitamin E binding				0					Vitamin E(DB00163)	CCTATAACCTCATCAAACCCT	0.527													3	133	---	---	---	---	PASS
CYP2D6	1565	broad.mit.edu	37	22	42523515	42523515	+	Silent	SNP	G	A	A	rs149686350		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42523515G>A	uc003bce.2	-	7	1197	c.1107C>T	c.(1105-1107)ATC>ATT	p.I369I	uc003bcd.1_Intron|CYP2D6_uc010gyu.2_Silent_p.I63I|CYP2D6_uc003bcf.2_Silent_p.I318I	NM_000106	NP_000097	Q6NWU0	Q6NWU0_HUMAN	cytochrome P450, family 2, subfamily D,	369							electron carrier activity|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen			breast(1)|skin(1)	2						CCAGGGGGACGATGTCCCCAA	0.612													4	41	---	---	---	---	PASS
C22orf9	23313	broad.mit.edu	37	22	45593787	45593787	+	Missense_Mutation	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45593787G>A	uc003bfx.1	-	9	1124	c.1058C>T	c.(1057-1059)TCG>TTG	p.S353L	C22orf9_uc010gzw.1_Missense_Mutation_p.S205L|C22orf9_uc003bfv.1_Missense_Mutation_p.S362L|C22orf9_uc003bfw.1_Missense_Mutation_p.S358L|C22orf9_uc010gzx.2_Missense_Mutation_p.S335L	NM_001009880	NP_001009880	Q6ICG6	K0930_HUMAN	hypothetical protein LOC23313 isoform b	353							protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|READ - Rectum adenocarcinoma(1;0.000617)|Colorectal(1;0.0024)		TCCTGTGCCCGACAGGGACCG	0.607													13	91	---	---	---	---	PASS
ASB9	140462	broad.mit.edu	37	X	15262595	15262595	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15262595C>T	uc004cwl.2	-	7					ASB9_uc004cwk.2_3'UTR|ASB9_uc004cwm.2_3'UTR|ASB9_uc010ner.2_3'UTR	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform						intracellular signal transduction						0	Hepatocellular(33;0.183)					ATAATGTTTTCACATCGTTTG	0.333													7	47	---	---	---	---	PASS
GRPR	2925	broad.mit.edu	37	X	16170863	16170863	+	3'UTR	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16170863C>T	uc004cxj.2	+	3						NM_005314	NP_005305	P30550	GRPR_HUMAN	gastrin-releasing peptide receptor						cell proliferation	integral to plasma membrane	bombesin receptor activity			ovary(3)|lung(1)	4	Hepatocellular(33;0.183)					CTCCAAAGAGCCTTCAGAATG	0.473													18	19	---	---	---	---	PASS
MAGEB6	158809	broad.mit.edu	37	X	26213332	26213332	+	3'UTR	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26213332G>A	uc004dbr.2	+	2					MAGEB6_uc010ngc.1_3'UTR	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6											ovary(3)	3						CAGTATAGTAGAGGCTGGAGG	0.363													20	6	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37955435	37955435	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37955435C>T	uc004ddu.2	+	10	1544	c.1010C>T	c.(1009-1011)TCA>TTA	p.S337L	SYTL5_uc004ddv.2_Missense_Mutation_p.S337L|SYTL5_uc004ddx.2_Missense_Mutation_p.S337L	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	337					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						ACAGAAGACTCAGAGGATACT	0.418													11	57	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48895743	48895743	+	Silent	SNP	G	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48895743G>A	uc004dmb.3	-	4	997	c.759C>T	c.(757-759)ATC>ATT	p.I253I	TFE3_uc004dmc.3_Silent_p.I148I|TFE3_uc004dme.1_RNA	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3	253					humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						AGCTGGACCCGATGGTGAGCA	0.602			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								3	24	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49070628	49070628	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49070628G>C	uc004dnb.2	-	30	3794	c.3732C>G	c.(3730-3732)TTC>TTG	p.F1244L	CACNA1F_uc010nip.2_Missense_Mutation_p.F1233L	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	1244	IV.|Helical; Name=S2 of repeat IV; (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	CCTTGGGCTTGAAGGCGATGA	0.547													6	55	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117788597	117788597	+	Missense_Mutation	SNP	G	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117788597G>C	uc004eqp.2	+	43	4791	c.4728G>C	c.(4726-4728)TTG>TTC	p.L1576F	DOCK11_uc004eqq.2_Missense_Mutation_p.L1355F	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1576	DHR-2.				blood coagulation	cytosol	GTP binding			ovary(3)	3						TCAAAGACTTGACCAAGAGAA	0.423													25	50	---	---	---	---	PASS
ELF4	2000	broad.mit.edu	37	X	129206253	129206253	+	Silent	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129206253C>T	uc004evd.3	-	5	865	c.480G>A	c.(478-480)GAG>GAA	p.E160E	ELF4_uc004eve.3_Silent_p.E160E	NM_001421	NP_001412	Q99607	ELF4_HUMAN	E74-like factor 4	160	RUNX1-binding.				natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGGAGGCCTTCTCCTCCAGAG	0.567			T	ERG	AML								10	88	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130220601	130220601	+	Missense_Mutation	SNP	G	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130220601G>T	uc004evz.2	+	11	1793	c.1448G>T	c.(1447-1449)CGG>CTG	p.R483L	ARHGAP36_uc004ewa.2_Missense_Mutation_p.R471L|ARHGAP36_uc004ewb.2_Missense_Mutation_p.R452L|ARHGAP36_uc004ewc.2_Missense_Mutation_p.R347L	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	483					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						GCTGAAGCCCGGGCTGCTGTC	0.512													40	26	---	---	---	---	PASS
ZNF75D	7626	broad.mit.edu	37	X	134421722	134421722	+	Missense_Mutation	SNP	C	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134421722C>T	uc004eyp.2	-	7	3535	c.880G>A	c.(880-882)GAA>AAA	p.E294K	ZNF75D_uc004eym.2_Intron|ZNF75D_uc004eyn.2_Missense_Mutation_p.E73K|ZNF75D_uc004eyo.2_Missense_Mutation_p.E199K	NM_007131	NP_009062	P51815	ZN75D_HUMAN	zinc finger protein 75	294	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GTTTGTATTTCTGATGTAGAA	0.373													14	105	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16894081	16894082	+	Intron	DEL	AG	-	-	rs35523431		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16894081_16894082delAG	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		acacacacacaGAGTGAGCTCA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	74420081	74420081	+	IGR	DEL	T	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74420081delT								None (None upstream) : LRRIQ3 (71623 downstream)																							ccttcctcccttccttccttc	0.000													4	2	---	---	---	---	
RPAP2	79871	broad.mit.edu	37	1	92846490	92846490	+	Intron	DEL	T	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92846490delT	uc001dot.2	+						RPAP2_uc009wdh.2_Intron	NM_024813	NP_079089	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2							integral to membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)	1		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		ATGTGGATTCTTTTTTTTTTT	0.353													80	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	100088798	100088798	+	IGR	DEL	G	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100088798delG								LPPR4 (313662 upstream) : PALMD (22633 downstream)																							aaaaaaaaaagaaaaagaaag	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	121485005	121485008	+	IGR	DEL	TGTT	-	-	rs28831473		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121485005_121485008delTGTT								LOC647121 (171319 upstream) : None (None downstream)																							ggaaacgctctgtttgtaaagtct	0.000													564	7	---	---	---	---	
ELF3	1999	broad.mit.edu	37	1	201981065	201981066	+	Intron	INS	-	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201981065_201981066insC	uc001gxg.3	+						ELF3_uc001gxi.3_Intron|ELF3_uc001gxh.3_Intron	NM_004433	NP_004424	P78545	ELF3_HUMAN	E74-like factor 3 (ets domain transcription						epidermis development|epithelial cell differentiation|inflammatory response|mammary gland involution|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0						TGAGCCTGTTTCCCTGCCTGGC	0.431													162	11	---	---	---	---	
OBSCN	84033	broad.mit.edu	37	1	228550492	228550493	+	Intron	INS	-	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228550492_228550493insT	uc009xez.1	+						OBSCN_uc001hsr.1_Intron	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				CAAAGACCCCCAGGGATTGACC	0.634													2	4	---	---	---	---	
KAT2B	8850	broad.mit.edu	37	3	20189861	20189862	+	Intron	INS	-	A	A			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20189861_20189862insA	uc003cbq.2	+							NM_003884	NP_003875	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3						ATGGAATTTCCATATTAGATAC	0.421													266	15	---	---	---	---	
RFT1	91869	broad.mit.edu	37	3	53139428	53139431	+	Intron	DEL	CCCG	-	-	rs60969367		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53139428_53139431delCCCG	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		agactctatcCCCGCCCCCCCCCC	0.270													4	3	---	---	---	---	
ARL13B	200894	broad.mit.edu	37	3	93768420	93768421	+	Intron	INS	-	A	A	rs76052585		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93768420_93768421insA	uc003drc.2	+						ARL13B_uc010hop.2_Intron|ARL13B_uc003drd.2_Intron|ARL13B_uc003dre.2_Intron|ARL13B_uc003drf.2_Intron|ARL13B_uc003drg.2_Intron	NM_182896	NP_878899	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 2-like 1 isoform 1								GTP binding				0						AAACAACAGAGAAAAAAAAAAA	0.342													85	7	---	---	---	---	
GTF2E1	2960	broad.mit.edu	37	3	120469352	120469353	+	Intron	INS	-	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120469352_120469353insT	uc003edz.3	+						GTF2E1_uc003edy.2_Intron	NM_005513	NP_005504	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1,						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.159)		CTAATTTTCTGTTTTTTTTTGA	0.381													146	8	---	---	---	---	
POLN	353497	broad.mit.edu	37	4	2214656	2214656	+	Intron	DEL	T	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2214656delT	uc003ger.2	-						POLN_uc011bvi.1_Intron	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			agaacgcctcttttttttttt	0.015								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					8	4	---	---	---	---	
RFC1	5981	broad.mit.edu	37	4	39304919	39304919	+	Intron	DEL	A	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39304919delA	uc003gty.1	-						RFC1_uc003gtx.1_Intron	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit						DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						GTTGTTAAAGAAAAAAAAAAA	0.393													5	3	---	---	---	---	
C4orf21	55345	broad.mit.edu	37	4	113504970	113504970	+	Intron	DEL	A	-	-	rs140732512		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113504970delA	uc003iau.2	-						C4orf21_uc003iav.2_Intron	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		CTATATAATTAAAAAAAAAAA	0.080													4	2	---	---	---	---	
FER	2241	broad.mit.edu	37	5	108133720	108133721	+	Intron	INS	-	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108133720_108133721insT	uc003kop.1	+						FER_uc011cve.1_Intron|FER_uc011cvf.1_Intron|FER_uc003koq.2_Intron|FER_uc011cvg.1_Intron	NM_005246	NP_005237	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		attcagtTGTGTTTTTTTTTTT	0.114													5	3	---	---	---	---	
KDM1B	221656	broad.mit.edu	37	6	18222132	18222132	+	Intron	DEL	T	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18222132delT	uc003nco.1	+						KDM1B_uc003ncn.1_Intron|KDM1B_uc003ncp.1_Intron|KDM1B_uc003ncq.1_Intron	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1						multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1						TGTAATTATGTTTTACAGGCA	0.368													148	8	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68968453	68968454	+	Intron	INS	-	C	C	rs142430798	by1000genomes	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68968453_68968454insC	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TATGTCATGATCCCGGGGGAAA	0.520													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126533987	126533988	+	IGR	INS	-	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126533987_126533988insT								TRIB1 (83345 upstream) : None (None downstream)																							ttccttccttccttccttcctt	0.005													6	3	---	---	---	---	
MOBKL2B	79817	broad.mit.edu	37	9	27359377	27359377	+	Intron	DEL	G	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27359377delG	uc003zqn.2	-							NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		gtgtgtgtgtggggggggggg	0.169													4	2	---	---	---	---	
SEC61B	10952	broad.mit.edu	37	9	101990075	101990075	+	Intron	DEL	T	-	-	rs111986989		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101990075delT	uc004azh.2	+							NM_006808	NP_006799	P60468	SC61B_HUMAN	Sec61 beta subunit						ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)				GCAAAGAAAGTTTTTTTTTTT	0.303													4	2	---	---	---	---	
SLC27A4	10999	broad.mit.edu	37	9	131116022	131116023	+	Intron	INS	-	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131116022_131116023insT	uc004but.2	+						SLC27A4_uc004buu.2_Intron	NM_005094	NP_005085	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0						TTCATTCAttcttttttttttt	0.119													5	3	---	---	---	---	
GRIN1	2902	broad.mit.edu	37	9	140055883	140055883	+	Intron	DEL	G	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140055883delG	uc004clk.2	+						GRIN1_uc004cli.1_Intron|GRIN1_uc004clj.1_Intron|GRIN1_uc004cll.2_Intron|GRIN1_uc004clm.2_Intron|GRIN1_uc004cln.2_Intron|GRIN1_uc004clo.2_Intron	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	NMDA receptor 1 isoform NR1-3 precursor						ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	GCTGGACGGCGGGGGTGGGGA	0.667													4	2	---	---	---	---	
MRC1	4360	broad.mit.edu	37	10	18116345	18116345	+	Intron	DEL	A	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18116345delA	uc001ipm.2	+							NM_002438	NP_002429	P22897	MRC1_HUMAN	mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0						aaaaataaccaaaaaaaaaaa	0.343													9	6	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34964519	34964520	+	Intron	INS	-	T	T	rs112555249		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34964519_34964520insT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				AATACCCCAACTTTTTTTTTTT	0.332													4	2	---	---	---	---	
MBL1P	8512	broad.mit.edu	37	10	81680656	81680656	+	Intron	DEL	A	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81680656delA	uc001kbf.2	+						MBL1P_uc001kbg.1_RNA					Homo sapiens mannose-binding protein-A pseudogene (MBL1P1) mRNA sequence.												0						GCTTTTGGGGAAAAAAAAAAG	0.542													4	2	---	---	---	---	
ZNF259	8882	broad.mit.edu	37	11	116652729	116652729	+	Intron	DEL	A	-	-	rs76506005		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116652729delA	uc001ppp.2	-						ZNF259_uc009yzd.2_Intron|ZNF259_uc001ppq.2_Intron	NM_003904	NP_003895	O75312	ZPR1_HUMAN	zinc finger protein 259						cell proliferation|signal transduction	cytoplasm|nucleolus					0	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		ctctgtctccaaaaaaaaaaa	0.109													6	3	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100790362	100790362	+	Intron	DEL	A	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100790362delA	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						cttcgtctttaaaaaaaaaaa	0.000													6	3	---	---	---	---	
AP1G2	8906	broad.mit.edu	37	14	24034602	24034602	+	Intron	DEL	A	-	-	rs67953844		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24034602delA	uc001wkl.2	-						AP1G2_uc001wkj.2_Intron|AP1G2_uc001wkk.3_Intron|AP1G2_uc001wkn.2_Intron|uc001wko.1_Intron|AP1G2_uc001wkp.1_5'Flank|AP1G2_uc010tnp.1_Intron|AP1G2_uc010aks.2_3'UTR|AP1G2_uc010akt.2_3'UTR|AP1G2_uc010tnq.1_Intron	NM_003917	NP_003908	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2						interspecies interaction between organisms|intracellular protein transport|vesicle-mediated transport	AP-1 adaptor complex|endosome membrane	protein binding|protein transporter activity			ovary(1)	1	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		GGACAGGCTTAAAAAAAAAAT	0.532													2	4	---	---	---	---	
DPP8	54878	broad.mit.edu	37	15	65780198	65780214	+	Intron	DEL	CCAGAGAGTAGTCATAA	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65780198_65780214delCCAGAGAGTAGTCATAA	uc002aov.2	-						DPP8_uc002aow.2_Intron|DPP8_uc010uiv.1_Intron|DPP8_uc002aox.2_Intron|DPP8_uc002aoy.2_Intron|DPP8_uc002aoz.2_Intron|DPP8_uc010bhj.2_Intron|DPP8_uc002apa.2_Intron|DPP8_uc010bhk.1_Intron	NM_130434	NP_569118	Q6V1X1	DPP8_HUMAN	dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1						AAGAATTATTCCAGAGAGTAGTCATAACCAACCGTTC	0.300													87	27	---	---	---	---	
OGFOD1	55239	broad.mit.edu	37	16	56499891	56499892	+	Intron	DEL	TT	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56499891_56499892delTT	uc002ejb.2	+						OGFOD1_uc002ejc.2_Intron	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase								iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)	CTATATTGACTTATTTGTTTAC	0.193													4	2	---	---	---	---	
NDRG4	65009	broad.mit.edu	37	16	58528736	58528737	+	Intron	INS	-	AA	AA			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58528736_58528737insAA	uc002enm.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc010vif.1_Intron	NM_001130487	NP_001123959	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 2						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						accctgtctctaaaaaaaaaaa	0.223													3	3	---	---	---	---	
P2RX1	5023	broad.mit.edu	37	17	3819253	3819254	+	Intron	INS	-	T	T	rs150456468	by1000genomes	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3819253_3819254insT	uc002fww.2	-						P2RX1_uc010ckm.1_5'UTR	NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1						platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		CGCACAGTGGCTTGCCAGGAAG	0.639													4	2	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15500091	15500094	+	Intron	DEL	AGTC	-	-	rs79640825		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15500091_15500094delAGTC	uc002gor.1	-						CDRT1_uc010vvy.1_Intron|CDRT1_uc010vvz.1_Intron|CDRT1_uc002gov.3_Intron|CDRT1_uc002gou.2_Intron|CDRT1_uc010cos.1_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GAGCCCATCAAGTCAGATTCTAGA	0.539													3	3	---	---	---	---	
GRN	2896	broad.mit.edu	37	17	42427695	42427696	+	Frame_Shift_Ins	INS	-	CC	CC			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42427695_42427696insCC	uc002igp.1	+	5	668_669	c.449_450insCC	c.(448-450)TGCfs	p.C150fs	GRN_uc002igq.1_3'UTR|GRN_uc002igr.1_5'Flank	NM_002087	NP_002078	P28799	GRN_HUMAN	granulin precursor	150					signal transduction	extracellular space	cytokine activity|growth factor activity			ovary(2)|central_nervous_system(2)|skin(1)	5		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGGGGGTGCTGCCCCATGCCCC	0.619													225	12	---	---	---	---	
HSF5	124535	broad.mit.edu	37	17	56536567	56536567	+	Intron	DEL	T	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56536567delT	uc002iwi.1	-							NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AAAGTACAGGttttttttttt	0.134													4	2	---	---	---	---	
LOC146880	146880	broad.mit.edu	37	17	62750914	62750914	+	Intron	DEL	T	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62750914delT	uc010wqc.1	-							NR_026899				Homo sapiens cDNA FLJ30780 fis, clone FEBRA2000856.												0						CTGATTATGCttttttttttg	0.179													13	6	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674552	78674554	+	Intron	DEL	TGA	-	-	rs113318500		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674552_78674554delTGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gtggtggtggtgatgatggtgat	0.000													4	2	---	---	---	---	
HGS	9146	broad.mit.edu	37	17	79663194	79663203	+	Intron	DEL	TGCCCTGCCC	-	-	rs145540708		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79663194_79663203delTGCCCTGCCC	uc002kbg.2	+							NM_004712	NP_004703	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			GTGATGACCAtgccctgccctgccctgccc	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	112402	112405	+	Intron	DEL	AACC	-	-	rs111811281		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:112402_112405delAACC	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		CCCTGCCCCGAACCACCCGACCCC	0.711													9	6	---	---	---	---	
MADCAM1	8174	broad.mit.edu	37	19	504758	504758	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:504758delG	uc002los.2	+	5	952	c.942delG	c.(940-942)GCGfs	p.A314fs	MADCAM1_uc002lot.2_Frame_Shift_Del_p.A227fs|MADCAM1_uc010drq.2_Frame_Shift_Del_p.A132fs|C19orf20_uc002lou.2_5'Flank	NM_130760	NP_570116	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion	314	Extracellular (Potential).|Mucin-like.				cell adhesion|immune response|regulation of immune response|signal transduction	integral to membrane|membrane fraction|plasma membrane					0		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAAACCTGCGGGTGACCAGC	0.672													113	15	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153023	7153028	+	Intron	DEL	ACCACA	-	-	rs149041762	by1000genomes	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153023_7153028delACCACA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acacacacacaccacacacacacacc	0.170													6	3	---	---	---	---	
COL5A3	50509	broad.mit.edu	37	19	10078145	10078146	+	Intron	DEL	AC	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10078145_10078146delAC	uc002mmq.1	-							NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein						collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			atacacacaaacacacacacac	0.292													4	2	---	---	---	---	
MEGF8	1954	broad.mit.edu	37	19	42872560	42872560	+	Intron	DEL	C	-	-	rs111406084		TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42872560delC	uc002otl.3	+						MEGF8_uc002otm.3_Intron|MEGF8_uc002otn.3_5'Flank	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8							integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				AAGCTTATTTCCCCATCTCTC	0.572													3	7	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49337709	49337709	+	Intron	DEL	G	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49337709delG	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		aggaggtgctgggggcctgga	0.000													4	4	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32339914	32339915	+	Intron	INS	-	CC	CC	rs144930383	by1000genomes	TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32339914_32339915insCC	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ctgcaagcaagccCCCCCCCCT	0.163													5	3	---	---	---	---	
PCK1	5105	broad.mit.edu	37	20	56136548	56136549	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56136548_56136549insC	uc002xyn.3	+	2	244_245	c.81_82insC	c.(79-84)GTGAGGfs	p.V27fs	PCK1_uc010zzm.1_5'UTR	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	27_28					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCCAGGCAGTGAGGGAGTTTCT	0.569													215	15	---	---	---	---	
CRYZL1	9946	broad.mit.edu	37	21	34994348	34994349	+	Frame_Shift_Ins	INS	-	T	T			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34994348_34994349insT	uc011adw.1	-	4	350_351	c.170_171insA	c.(169-171)AAGfs	p.K57fs	DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Frame_Shift_Ins_p.K81fs|CRYZL1_uc002yss.1_RNA|CRYZL1_uc002yst.1_RNA|CRYZL1_uc002ysu.2_Frame_Shift_Ins_p.K57fs	NM_145858	NP_665857	O95825	QORL1_HUMAN	crystallin, zeta-like 1	57					quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding				0						GAAATAAATCCTTTTTCATCTT	0.327													230	31	---	---	---	---	
NAGA	4668	broad.mit.edu	37	22	42463826	42463827	+	In_Frame_Ins	INS	-	CAACTGGCATCGCGA	CAACTGGCATCGCGA			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42463826_42463827insCAACTGGCATCGCGA	uc003bbx.2	-	4	403_404	c.266_267insTCGCGATGCCAGTTG	c.(265-267)GGC>GGTCGCGATGCCAGTTGC	p.89_90insRDASC	NAGA_uc003bby.2_In_Frame_Ins_p.89_90insRDASC|NAGA_uc003bbw.3_In_Frame_Ins_p.89_90insRDASC	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	89_90					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						GCATCAGGCGGCCACTGGCATC	0.614													185	8	---	---	---	---	
RRP7B	91695	broad.mit.edu	37	22	42970861	42970862	+	Intron	DEL	GC	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42970861_42970862delGC	uc003bcs.2	-						RRP7B_uc003bct.2_Intron					Homo sapiens cDNA FLJ90011 fis, clone HEMBA1000443, highly similar to Gastric cancer antigen Zg14.												0						GGGTCAGACAGCGCGCCCCGGG	0.673													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9368302	9368303	+	IGR	DEL	TG	-	-			TCGA-CF-A1HR-01A-11D-A13W-08	TCGA-CF-A1HR-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9368302_9368303delTG								TSPY1 (20913 upstream) : RBMY3AP (80027 downstream)																							ACTCtgtgtctgtgtgtgtgtg	0.262													4	5	---	---	---	---	
