Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA1751	85452	broad.mit.edu	37	1	1920343	1920343	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1920343T>A	uc001aim.1	-	3	293	c.137A>T	c.(136-138)GAC>GTC	p.D46V	KIAA1751_uc009vkz.1_Missense_Mutation_p.D46V|KIAA1751_uc001ain.1_Missense_Mutation_p.D46V	NM_001080484	NP_001073953	Q9C0B2	K1751_HUMAN	hypothetical protein LOC85452	46										pancreas(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;8.79e-39)|OV - Ovarian serous cystadenocarcinoma(86;9.61e-25)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;4.84e-05)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		GTGTCCCGGGTCCACGTCATC	0.333													12	32	---	---	---	---	PASS
CLCN6	1185	broad.mit.edu	37	1	11894635	11894635	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11894635T>G	uc001ate.3	+	17	1894	c.1781T>G	c.(1780-1782)GTG>GGG	p.V594G	CLCN6_uc010oat.1_Missense_Mutation_p.V310G|CLCN6_uc010oau.1_Missense_Mutation_p.V572G	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	594	Cytoplasmic (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GAGACAGAGGTGGAAATGGAC	0.463													14	111	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16945409	16945409	+	RNA	SNP	T	A	A	rs13566		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16945409T>A	uc010ocf.1	-	4		c.748A>T			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						GCGGGATAGCTCGGTGGAGAG	0.612													3	25	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	62961314	62961314	+	Silent	SNP	A	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62961314A>T	uc001daq.2	-	39	4969	c.4935T>A	c.(4933-4935)TCT>TCA	p.S1645S	DOCK7_uc001dan.2_Silent_p.S1506S|DOCK7_uc001dao.2_Silent_p.S1506S|DOCK7_uc001dap.2_Silent_p.S1623S|DOCK7_uc001dam.2_Silent_p.S825S|DOCK7_uc010oov.1_Silent_p.S384S	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1654	DHR-2.				activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						TCACAGTATCAGAAAGAATCA	0.343													110	265	---	---	---	---	PASS
TMEM167B	56900	broad.mit.edu	37	1	109635584	109635584	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109635584C>G	uc001dwn.2	+	2	175	c.83C>G	c.(82-84)CCT>CGT	p.P28R	TMEM167B_uc009weu.2_Intron	NM_020141	NP_064526	Q9NRX6	KISHB_HUMAN	transmembrane protein 167B precursor	28	Extracellular (Potential).					Golgi membrane|integral to membrane					0						AAGAAAGTACCTCGTCTCAAA	0.448													79	554	---	---	---	---	PASS
ATP1A1	476	broad.mit.edu	37	1	116943805	116943805	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116943805C>T	uc001ege.2	+	20	3111	c.2772C>T	c.(2770-2772)GTC>GTT	p.V924V	ATP1A1_uc010owv.1_Silent_p.V893V|ATP1A1_uc010oww.1_Silent_p.V924V|ATP1A1_uc010owx.1_Silent_p.V893V|C1orf203_uc009whb.2_Intron|C1orf203_uc001egg.3_Intron|ATP1A1_uc001egh.2_Silent_p.V66V	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	924	Helical; (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)	CCTTCTTCGTCAGTATCGTGG	0.502													5	126	---	---	---	---	PASS
NUF2	83540	broad.mit.edu	37	1	163317583	163317583	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163317583G>A	uc001gcq.1	+	12	1279	c.979G>A	c.(979-981)GAT>AAT	p.D327N	NUF2_uc001gcr.1_Missense_Mutation_p.D327N|NUF2_uc009wvc.1_Missense_Mutation_p.D280N	NM_145697	NP_663735	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	327	Interaction with the N-terminus of NDC80.|Potential.				cell division|chromosome segregation|mitotic prometaphase	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			ovary(3)|skin(1)	4	all_hematologic(923;0.101)					AATTGAGAGTGATGAGTCAGA	0.308													7	394	---	---	---	---	PASS
C1orf25	81627	broad.mit.edu	37	1	185108635	185108635	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185108635A>C	uc001grf.3	-	9	1458	c.1186T>G	c.(1186-1188)TCA>GCA	p.S396A	C1orf25_uc010pon.1_Missense_Mutation_p.S240A	NM_030934	NP_112196	Q7Z2T5	TRM1L_HUMAN	N2,N2-dimethylguanosine tRNA	396						intracellular	RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding				0						GAAGTCACTGACACTATGCCA	0.383													39	61	---	---	---	---	PASS
CFHR3	10878	broad.mit.edu	37	1	196748941	196748941	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196748941C>T	uc001gtl.2	+	3	355	c.268C>T	c.(268-270)CCT>TCT	p.P90S	CFHR3_uc001gtk.2_Missense_Mutation_p.P90S|CFHR3_uc010poy.1_Missense_Mutation_p.P90S|CFHR1_uc001gtm.2_Intron	NM_021023	NP_066303	Q02985	FHR3_HUMAN	complement factor H-related 3 precursor	90	Sushi 2.					extracellular space					0						ATGTTATTTTCCTTATTTGGA	0.299													6	131	---	---	---	---	PASS
C1orf58	148362	broad.mit.edu	37	1	222901952	222901952	+	Intron	SNP	A	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222901952A>T	uc001hnq.1	+						C1orf58_uc010put.1_Intron|C1orf58_uc010puu.1_Intron|C1orf58_uc010puv.1_Intron|uc001hnr.1_RNA	NM_144695	NP_653296	Q5VW32	BROX_HUMAN	Bro1-domain-containing protein							membrane					0				GBM - Glioblastoma multiforme(131;0.0667)		AGGTGtttttaaaaaaaaatt	0.289													4	73	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232607212	232607212	+	Silent	SNP	T	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232607212T>A	uc001hvg.2	-	6	2306	c.2148A>T	c.(2146-2148)GCA>GCT	p.A716A		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	716	Rap-GAP.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TAAAAGGAAGTGCCCCAGGCT	0.423													92	175	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11706697	11706697	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11706697G>T	uc002rbk.1	+	4	669	c.369G>T	c.(367-369)AAG>AAT	p.K123N	GREB1_uc002rbl.2_Missense_Mutation_p.K123N|GREB1_uc002rbm.2_Missense_Mutation_p.K13N|GREB1_uc002rbn.1_Missense_Mutation_p.K123N	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	123						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TGGGGGTCAAGTCCCCCAGCC	0.587													12	26	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11706699	11706699	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11706699C>A	uc002rbk.1	+	4	671	c.371C>A	c.(370-372)TCC>TAC	p.S124Y	GREB1_uc002rbl.2_Missense_Mutation_p.S124Y|GREB1_uc002rbm.2_Missense_Mutation_p.S14Y|GREB1_uc002rbn.1_Missense_Mutation_p.S124Y	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	124						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GGGGTCAAGTCCCCCAGCCTG	0.582													10	26	---	---	---	---	PASS
LAPTM4A	9741	broad.mit.edu	37	2	20237323	20237323	+	Silent	SNP	T	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20237323T>G	uc002rdm.2	-	3	793	c.285A>C	c.(283-285)TCA>TCC	p.S95S	LAPTM4A_uc002rdn.2_Silent_p.S53S|LAPTM4A_uc010yjx.1_Silent_p.S85S	NM_014713	NP_055528	Q15012	LAP4A_HUMAN	lysosomal protein transmembrane 4 alpha	95	Helical; (Potential).				transport	endomembrane system|Golgi apparatus|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAACCAGCATTGAACTGATTA	0.308													188	397	---	---	---	---	PASS
LOC654342	654342	broad.mit.edu	37	2	91809094	91809094	+	Intron	SNP	G	A	A	rs140976641	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91809094G>A	uc002sts.3	-						LOC654342_uc002stt.2_RNA					Homo sapiens cDNA clone IMAGE:4801360.												0						CAGGATCATGGCAGACATGGA	0.512													3	23	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112625654	112625654	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112625654A>C	uc002thi.2	-	7	878	c.631T>G	c.(631-633)TTC>GTC	p.F211V		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	211					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						AGCATGCTGAACATAGTAGGT	0.308													116	268	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152331761	152331761	+	3'UTR	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152331761G>A	uc002txm.2	+	36					RIF1_uc002txl.2_3'UTR|RIF1_uc002txn.2_3'UTR|RIF1_uc002txo.2_3'UTR|RIF1_uc002txp.2_Intron|uc010fnw.1_5'Flank	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AGTTCATTATGTAAGATCCTT	0.303													4	3	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152553192	152553192	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152553192C>A	uc010fnx.2	-	17	1719	c.1528G>T	c.(1528-1530)GTT>TTT	p.V510F	NEB_uc010fny.1_Missense_Mutation_p.V64F	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	510	Nebulin 12.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGTAGCAGAACAGGAGAGTCT	0.423													260	488	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160205332	160205332	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160205332C>A	uc002uao.2	-	30	5502	c.5150G>T	c.(5149-5151)GGT>GTT	p.G1717V	BAZ2B_uc002uap.2_Missense_Mutation_p.G1681V	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1717					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						TCTCCACCAACCAAACTGCAT	0.308													48	574	---	---	---	---	PASS
PTH2R	5746	broad.mit.edu	37	2	209353839	209353839	+	Silent	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209353839C>A	uc002vdb.2	+	11	1392	c.1179C>A	c.(1177-1179)ATC>ATA	p.I393I	PTH2R_uc010zjb.1_Silent_p.I404I|PTH2R_uc010fuo.1_RNA	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	393	Extracellular (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		GGTGGGAGATCCGCATGCACT	0.483													8	342	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210887820	210887820	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210887820C>G	uc002vds.2	-	15	3025	c.2817G>C	c.(2815-2817)CAG>CAC	p.Q939H	C2orf67_uc002vdt.2_Missense_Mutation_p.Q897H	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	939										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		ACCTTTCAACCTGATCCTTTT	0.443													137	257	---	---	---	---	PASS
GLT8D1	55830	broad.mit.edu	37	3	52729443	52729443	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52729443T>C	uc003dfi.3	-	8	945	c.806A>G	c.(805-807)AAT>AGT	p.N269S	GLT8D1_uc003dfj.2_Missense_Mutation_p.N269S|GLT8D1_uc003dfk.2_Missense_Mutation_p.N269S|GLT8D1_uc003dfl.2_Missense_Mutation_p.N269S|GLT8D1_uc003dfm.2_Missense_Mutation_p.N269S|GLT8D1_uc003dfn.2_Missense_Mutation_p.N269S|GLT8D1_uc003dfo.1_Missense_Mutation_p.N269S	NM_152932	NP_690909	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	269	Lumenal (Potential).					integral to membrane|mitochondrion	transferase activity, transferring glycosyl groups				0				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TTACTCTACATTGAGTTTCAT	0.378													127	213	---	---	---	---	PASS
ARHGEF3	50650	broad.mit.edu	37	3	56789107	56789107	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56789107G>C	uc003dig.2	-	3	446	c.277C>G	c.(277-279)CCC>GCC	p.P93A	ARHGEF3_uc011bew.1_Missense_Mutation_p.P93A|ARHGEF3_uc003dih.2_Missense_Mutation_p.P125A|ARHGEF3_uc011bev.1_Missense_Mutation_p.P64A|ARHGEF3_uc003dif.2_Missense_Mutation_p.P99A|ARHGEF3_uc010hmy.1_5'UTR|ARHGEF3_uc003dii.2_Missense_Mutation_p.P93A	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform	93					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		GTGCTCGAGGGGGCGGCATTT	0.537													33	46	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173322838	173322838	+	Silent	SNP	C	T	T	rs140286287		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173322838C>T	uc003fio.1	+	3	873	c.450C>T	c.(448-450)AGC>AGT	p.S150S	NLGN1_uc010hww.1_Silent_p.S150S|NLGN1_uc003fip.1_Silent_p.S150S	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	150	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AAGACCAGAGCGAAGACTGCC	0.373													47	111	---	---	---	---	PASS
LAMP3	27074	broad.mit.edu	37	3	182870208	182870208	+	Silent	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182870208A>G	uc003flh.3	-	3	1067	c.843T>C	c.(841-843)CTT>CTC	p.L281L		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	281	Lumenal (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			AATTCAACAGAAGGTTGGATT	0.473													13	175	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55131181	55131181	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55131181G>T	uc003han.3	+	5	1055	c.724G>T	c.(724-726)GTG>TTG	p.V242L	PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_3'UTR|PDGFRA_uc010igq.1_Missense_Mutation_p.V136L|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	242	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TAACAATGAGGTGGTTGACCT	0.348			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			127	232	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73985963	73985963	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73985963G>T	uc003hgp.2	-	21	4058	c.3941C>A	c.(3940-3942)CCT>CAT	p.P1314H	ANKRD17_uc003hgo.2_Missense_Mutation_p.P1201H|ANKRD17_uc003hgq.2_Missense_Mutation_p.P1063H|ANKRD17_uc003hgr.2_Missense_Mutation_p.P1313H|ANKRD17_uc011cbd.1_Missense_Mutation_p.P879H	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	1314					interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GGGAACTGGAGGGGCATTAAC	0.453													99	218	---	---	---	---	PASS
TLL1	7092	broad.mit.edu	37	4	166910623	166910623	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166910623G>A	uc003irh.1	+	2	907	c.260G>A	c.(259-261)GGA>GAA	p.G87E	TLL1_uc011cjn.1_Missense_Mutation_p.G87E|TLL1_uc011cjo.1_5'UTR	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor	87					cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		AACCCCTTTGGAAACCTTGGA	0.333													31	421	---	---	---	---	PASS
ANKRD55	79722	broad.mit.edu	37	5	55412459	55412459	+	Silent	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55412459G>T	uc003jqu.2	-	9	1100	c.948C>A	c.(946-948)CTC>CTA	p.L316L	ANKRD55_uc003jqt.2_Silent_p.L28L	NM_024669	NP_078945	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55 isoform 1	315	ANK 9.									skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				CTTGGGAGAGGAGTTTGACAC	0.473													10	33	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82835015	82835015	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82835015G>T	uc003kii.3	+	8	6549	c.6193G>T	c.(6193-6195)GAA>TAA	p.E2065*	VCAN_uc003kij.3_Nonsense_Mutation_p.E1078*|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Nonsense_Mutation_p.E729*	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	2065	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ACCAACAGCAGAAGTGGAAGG	0.428													52	117	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56469946	56469946	+	Intron	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56469946C>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Nonsense_Mutation_p.W2623*	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TATTCCCTTCCCACGATGTAA	0.338													60	139	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74407276	74407276	+	Silent	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74407276A>G	uc003php.2	+	2	653	c.228A>G	c.(226-228)GCA>GCG	p.A76A	CD109_uc010kaz.2_Silent_p.A76A|CD109_uc003phq.2_Silent_p.A76A|CD109_uc010kba.2_Silent_p.A76A|uc003pho.1_5'Flank	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	76						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						TCCTGGAAGCAGAAGGAGTCT	0.438													5	127	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129588336	129588336	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129588336C>A	uc003qbn.2	+	16	2399	c.2294C>A	c.(2293-2295)TCC>TAC	p.S765Y	LAMA2_uc003qbo.2_Missense_Mutation_p.S765Y	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	765	Laminin EGF-like 6.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CATGCGGAGTCCTGTGATGAC	0.488													127	304	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21745087	21745087	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21745087C>A	uc003svc.2	+	40	6530	c.6499C>A	c.(6499-6501)CTT>ATT	p.L2167I		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2167	AAA 2 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGTTGTCCAGCTTGAGGAACT	0.433									Kartagener_syndrome				5	191	---	---	---	---	PASS
GGCT	79017	broad.mit.edu	37	7	30538534	30538534	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30538534C>T	uc003tba.2	-	3	435	c.308G>A	c.(307-309)GGA>GAA	p.G103E	GGCT_uc003tbb.2_Intron|GGCT_uc003tbc.2_RNA|GGCT_uc003taz.2_Missense_Mutation_p.G42E	NM_024051	NP_076956	O75223	GGCT_HUMAN	gamma-glutamyl cyclotransferase	103					release of cytochrome c from mitochondria	cytosol	acyltransferase activity|gamma-glutamylcyclotransferase activity|protein homodimerization activity				0						AACATACATTCCACTTTTAAC	0.378													162	347	---	---	---	---	PASS
GRB10	2887	broad.mit.edu	37	7	50737542	50737542	+	Silent	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50737542G>A	uc003tpi.2	-	4	412	c.381C>T	c.(379-381)GAC>GAT	p.D127D	GRB10_uc003tph.3_Silent_p.D69D|GRB10_uc003tpj.2_Silent_p.D127D|GRB10_uc003tpk.2_Silent_p.D127D|GRB10_uc010kzb.2_Silent_p.D69D|GRB10_uc003tpl.2_Silent_p.D121D|GRB10_uc003tpm.2_Silent_p.D69D|GRB10_uc003tpn.2_Silent_p.D69D	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	127					insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					TAAACTGCTGGTCTTCCTCCT	0.458									Russell-Silver_syndrome				16	25	---	---	---	---	PASS
C7orf66	154907	broad.mit.edu	37	7	108524166	108524166	+	Silent	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108524166A>G	uc003vfo.2	-	2	294	c.246T>C	c.(244-246)ATT>ATC	p.I82I		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	82						integral to membrane				ovary(2)	2						ATCCCTCATGAATTCTAGTTC	0.393													155	326	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148511134	148511134	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148511134A>T	uc003wfd.1	-	15	1919	c.1753T>A	c.(1753-1755)TGT>AGT	p.C585S	EZH2_uc011kug.1_Missense_Mutation_p.C534S|EZH2_uc003wfb.1_Missense_Mutation_p.C590S|EZH2_uc003wfc.1_Missense_Mutation_p.C546S|EZH2_uc011kuh.1_Missense_Mutation_p.C576S	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	585	Cys-rich.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CAAGTAAGACAGAGGTCAGGG	0.537			Mis		DLBCL								8	143	---	---	---	---	PASS
SMARCD3	6604	broad.mit.edu	37	7	150938474	150938474	+	Intron	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150938474C>T	uc003wjs.2	-						SMARCD3_uc003wjt.2_Intron|SMARCD3_uc003wju.2_Intron|SMARCD3_uc011kvh.1_Silent_p.*348*|SMARCD3_uc010lqa.1_3'UTR	NM_001003801	NP_001003801	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin						cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ttctgctactcAGGAATCTAG	0.284													5	18	---	---	---	---	PASS
ADAM28	10863	broad.mit.edu	37	8	24167416	24167416	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24167416G>T	uc003xdy.2	+	3	243	c.160G>T	c.(160-162)GAA>TAA	p.E54*	ADAM28_uc003xdx.2_Nonsense_Mutation_p.E54*|ADAM28_uc011kzz.1_5'UTR|ADAM28_uc011laa.1_RNA	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	54					proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		GGAACAATTTGAAACTGAATT	0.259													10	272	---	---	---	---	PASS
DEPDC6	64798	broad.mit.edu	37	8	121019105	121019105	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121019105G>C	uc003yow.3	+	7	1174	c.987G>C	c.(985-987)AAG>AAC	p.K329N	DEPDC6_uc011lid.1_Missense_Mutation_p.K228N	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6	329					intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATGCAAGGAAGACATTCACGG	0.498													26	163	---	---	---	---	PASS
C9orf68	55064	broad.mit.edu	37	9	4625315	4625315	+	Intron	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4625315T>C	uc011llz.1	-						C9orf68_uc003zik.2_RNA|C9orf68_uc003zil.2_Intron|C9orf68_uc010mhj.2_Intron|C9orf68_uc011lly.1_Intron	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN	hypothetical protein LOC55064												0		Breast(48;0.0456)		GBM - Glioblastoma multiforme(50;0.0222)		TAAAAAATAATTTTAGGCTCA	0.363													22	589	---	---	---	---	PASS
GOLM1	51280	broad.mit.edu	37	9	88692459	88692459	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88692459C>T	uc004aol.2	-	3	375	c.177G>A	c.(175-177)GAG>GAA	p.E59E	GOLM1_uc010mqd.1_RNA|GOLM1_uc004aom.2_Silent_p.E59E	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1	59	Potential.|Lumenal (Potential).					Golgi apparatus|integral to plasma membrane					0						CGGCGCCTCTCTCTGCAGCCG	0.597													21	40	---	---	---	---	PASS
FKBP15	23307	broad.mit.edu	37	9	115973862	115973862	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115973862C>T	uc004bgs.2	-	2	182	c.64G>A	c.(64-66)GCC>ACC	p.A22T	FKBP15_uc010muu.1_Missense_Mutation_p.A86T|FKBP15_uc011lxd.1_Intron|FKBP15_uc010mut.1_5'UTR|FKBP15_uc004bgt.2_Missense_Mutation_p.A22T	NM_015258	NP_056073	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	22					endocytosis|protein folding	axon|early endosome	actin binding			ovary(3)	3						AAAAGTGAGGCCAATCTGGCA	0.428													5	160	---	---	---	---	PASS
BMI1	648	broad.mit.edu	37	10	22605369	22605369	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22605369A>G	uc009xkg.2	+	1	71	c.23A>G	c.(22-24)CAG>CGG	p.Q8R	COMMD3_uc001ire.2_Missense_Mutation_p.Q8R|COMMD3_uc001irf.2_Missense_Mutation_p.Q8R|COMMD3_uc001irg.2_RNA	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene	Error:Variant_position_missing_in_P35226_after_alignment					hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						GAGTCTGTGCAGAAAGGCTTC	0.597													3	9	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24809158	24809158	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24809158G>T	uc001iru.3	+	11	2687	c.2284G>T	c.(2284-2286)GGA>TGA	p.G762*	KIAA1217_uc001irs.2_Nonsense_Mutation_p.G682*|KIAA1217_uc001irt.3_Nonsense_Mutation_p.G727*|KIAA1217_uc010qcy.1_Nonsense_Mutation_p.G727*|KIAA1217_uc010qcz.1_Nonsense_Mutation_p.G727*|KIAA1217_uc001irv.1_Nonsense_Mutation_p.G577*|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Nonsense_Mutation_p.G445*|KIAA1217_uc001irz.2_Nonsense_Mutation_p.G445*|KIAA1217_uc001irx.2_Nonsense_Mutation_p.G445*|KIAA1217_uc001iry.2_Nonsense_Mutation_p.G445*	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	762					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GCGTCAAGTGGGAGAGGCTGT	0.522													4	60	---	---	---	---	PASS
ARMC4	55130	broad.mit.edu	37	10	28274097	28274097	+	Silent	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28274097A>G	uc009xky.2	-	4	524	c.426T>C	c.(424-426)AAT>AAC	p.N142N	ARMC4_uc010qdt.1_5'Flank|ARMC4_uc001itz.2_Silent_p.N142N	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	142							binding			ovary(4)|skin(2)	6						CTTTCATTGTATTATAATCAG	0.318													28	313	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69902842	69902842	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69902842G>C	uc001jnm.3	+	4	1233	c.1048G>C	c.(1048-1050)GAT>CAT	p.D350H	MYPN_uc001jnl.1_Missense_Mutation_p.D350H|MYPN_uc001jnn.3_Missense_Mutation_p.D75H|MYPN_uc001jno.3_Missense_Mutation_p.D350H|MYPN_uc001jnp.1_Missense_Mutation_p.D350H|MYPN_uc009xps.2_Missense_Mutation_p.D350H|MYPN_uc009xpt.2_Missense_Mutation_p.D350H|MYPN_uc010qit.1_Missense_Mutation_p.D56H|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	350	Interaction with CARP.|Ig-like 1.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						CTATGGGACAGATTCGACTTC	0.373													5	130	---	---	---	---	PASS
ALDH18A1	5832	broad.mit.edu	37	10	97373858	97373858	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97373858T>C	uc001kkz.2	-	14	1908	c.1666A>G	c.(1666-1668)ATT>GTT	p.I556V	ALDH18A1_uc001kky.2_Missense_Mutation_p.I554V|ALDH18A1_uc010qog.1_Missense_Mutation_p.I445V|ALDH18A1_uc010qoh.1_Missense_Mutation_p.I344V	NM_002860	NP_002851	P54886	P5CS_HUMAN	pyrroline-5-carboxylate synthetase isoform 1	556	Gamma-glutamyl phosphate reductase.				proline biosynthetic process	mitochondrial inner membrane	ATP binding|glutamate 5-kinase activity|glutamate-5-semialdehyde dehydrogenase activity			pancreas(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)	L-Glutamic Acid(DB00142)	CCACGTGGAATGATCAGATCT	0.448													44	111	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100904018	100904018	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100904018G>A	uc001kpn.1	-	3	647	c.587C>T	c.(586-588)ACT>ATT	p.T196I	HPSE2_uc009xwc.1_Missense_Mutation_p.T186I|HPSE2_uc001kpo.1_Missense_Mutation_p.T186I|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	196					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ATTACTGTAAGTATTGGAGAA	0.433													57	124	---	---	---	---	PASS
PPAPDC1A	196051	broad.mit.edu	37	10	122278346	122278346	+	Silent	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122278346G>A	uc001lev.1	+	4	610	c.258G>A	c.(256-258)GCG>GCA	p.A86A	PPAPDC1A_uc010qtd.1_Silent_p.A86A|PPAPDC1A_uc009xzl.1_Intron|PPAPDC1A_uc001lew.1_Intron|PPAPDC1A_uc001lex.1_Intron|PPAPDC1A_uc001ley.1_5'UTR	NM_001030059	NP_001025230	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain	86	Helical; (Potential).				phospholipid dephosphorylation	integral to membrane	phosphatidate phosphatase activity			breast(1)	1		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		GTTTTGTAGCGGTGTCCTTGG	0.308													19	721	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61897352	61897352	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61897352G>A	uc001nsw.1	+	4	555	c.353G>A	c.(352-354)GGC>GAC	p.G118D	INCENP_uc009ynv.2_Missense_Mutation_p.G118D|INCENP_uc009ynw.1_Missense_Mutation_p.G118D|INCENP_uc001nsx.1_Missense_Mutation_p.G118D	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	118					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						GGGGAGAACGGCTCCGTCCTG	0.642													3	4	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62296451	62296451	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62296451G>A	uc001ntl.2	-	5	5738	c.5438C>T	c.(5437-5439)CCG>CTG	p.P1813L	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1813					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				ATCAACTTGCGGCCCTCTGAG	0.498													5	121	---	---	---	---	PASS
ARHGAP20	57569	broad.mit.edu	37	11	110451792	110451792	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110451792G>T	uc001pkz.1	-	16	2163	c.1878C>A	c.(1876-1878)GAC>GAA	p.D626E	ARHGAP20_uc001pky.1_Missense_Mutation_p.D603E|ARHGAP20_uc009yyb.1_Missense_Mutation_p.D590E|ARHGAP20_uc001pla.1_Missense_Mutation_p.D590E|ARHGAP20_uc001plb.2_Missense_Mutation_p.D169E	NM_020809	NP_065860	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	626					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		CCTCGGGCTGGTCAAGATCAT	0.483													59	98	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26810788	26810788	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26810788A>G	uc001rhg.2	-	18	2461	c.2044T>C	c.(2044-2046)TCC>CCC	p.S682P		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	682	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GAAAGGATGGAGCTCTCCATG	0.398													7	342	---	---	---	---	PASS
ACVR1B	91	broad.mit.edu	37	12	52374764	52374764	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52374764T>G	uc001rzn.2	+	4	634	c.592T>G	c.(592-594)TTT>GTT	p.F198V	ACVR1B_uc001rzl.2_Missense_Mutation_p.F198V|ACVR1B_uc001rzm.2_Missense_Mutation_p.F198V|ACVR1B_uc010snn.1_Missense_Mutation_p.F198V	NM_004302	NP_004293	P36896	ACV1B_HUMAN	activin A receptor, type IB isoform a precursor	198	Cytoplasmic (Potential).|GS.				G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|peptidyl-threonine phosphorylation|positive regulation of activin receptor signaling pathway|positive regulation of erythrocyte differentiation|protein autophosphorylation|transmembrane receptor protein serine/threonine kinase signaling pathway	cell surface	activin receptor activity, type I|ATP binding|metal ion binding|SMAD binding|transforming growth factor beta receptor activity|ubiquitin protein ligase binding			pancreas(4)|breast(2)|ovary(1)|lung(1)|kidney(1)	9				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	GTTACCCCTCTTTGTCCAGCG	0.498											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	40	83	---	---	---	---	PASS
ITGB7	3695	broad.mit.edu	37	12	53594099	53594099	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53594099C>T	uc009zmv.2	-	2	200	c.129G>A	c.(127-129)GGG>GGA	p.G43G	ITGB7_uc001scc.2_Silent_p.G43G|ITGB7_uc010snz.1_RNA|ITGB7_uc010soa.1_Silent_p.G43G	NM_000889	NP_000880	P26010	ITB7_HUMAN	integrin, beta 7 precursor	43	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						GCTGGCAGGACCCCAGCATGG	0.582													20	34	---	---	---	---	PASS
RARG	5916	broad.mit.edu	37	12	53605604	53605604	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53605604C>T	uc001sce.2	-	10	1706	c.1221G>A	c.(1219-1221)CCG>CCA	p.P407P	RARG_uc001scd.2_Silent_p.P396P|RARG_uc010sob.1_Silent_p.P385P|RARG_uc001scf.2_Silent_p.P407P|RARG_uc001scg.2_Silent_p.P335P|RARG_uc010soc.1_Silent_p.P286P	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	407	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)|lung(1)	4					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	AGGGAGGCATCGGGCCTGGAA	0.547													4	94	---	---	---	---	PASS
MIR616	693201	broad.mit.edu	37	12	57912980	57912980	+	RNA	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57912980C>A	hsa-mir-616|MI0003629	-			c.63C>A			DDIT3_uc001soi.2_Intron|DDIT3_uc009zps.2_Intron|DDIT3_uc009zpt.2_Intron																	0						tcaaaccctccaatgacttcc	0.000													4	182	---	---	---	---	PASS
KCNC2	3747	broad.mit.edu	37	12	75444937	75444937	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75444937G>A	uc001sxg.1	-	3	1392	c.848C>T	c.(847-849)ACG>ATG	p.T283M	KCNC2_uc009zry.2_Missense_Mutation_p.T283M|KCNC2_uc001sxe.2_Missense_Mutation_p.T283M|KCNC2_uc001sxf.2_Missense_Mutation_p.T283M|KCNC2_uc010stw.1_Missense_Mutation_p.T283M	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	283					energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						TTCTACATACGTCAAGGCAGG	0.348													9	368	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80615945	80615945	+	IGR	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80615945A>G								PPP1R12A (286710 upstream) : PTPRQ (222181 downstream)																							ATTCGATGGCATCTACTATTA	0.418													22	360	---	---	---	---	PASS
NT5DC3	51559	broad.mit.edu	37	12	104179176	104179176	+	Silent	SNP	C	A	A	rs61752308		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104179176C>A	uc010swe.1	-	12	1307	c.1266G>T	c.(1264-1266)ACG>ACT	p.T422T		NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	422							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						TGTATTGCTCCGTGTTCATGA	0.423													187	342	---	---	---	---	PASS
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50235160G>C	uc001vdg.2	-	4	628	c.565C>G	c.(565-567)CTA>GTA	p.L189V	EBPL_uc001vdh.2_RNA|EBPL_uc001vdi.2_3'UTR	NM_032565	NP_115954	Q9BY08	EBPL_HUMAN	emopamil binding related protein, delta8-delta7	189					sterol metabolic process	endoplasmic reticulum membrane|integral to membrane	cholestenol delta-isomerase activity				0		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418													6	212	---	---	---	---	PASS
SUGT1	10910	broad.mit.edu	37	13	53254114	53254114	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53254114A>G	uc001vhc.2	+	13	1045	c.820A>G	c.(820-822)AAG>GAG	p.K274E	SUGT1_uc001vha.2_RNA|SUGT1_uc001vhb.2_Missense_Mutation_p.K242E|SUGT1_uc010thb.1_Missense_Mutation_p.K186E|SUGT1_uc001vhd.2_Missense_Mutation_p.K131E	NM_001130912	NP_001124384	Q9Y2Z0	SUGT1_HUMAN	suppressor of G2 allele of SKP1 isoform a	274					mitosis	kinetochore|ubiquitin ligase complex	binding				0		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		CATAGATGTAAAGAACCTATA	0.323													6	376	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92345927	92345927	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92345927T>A	uc010tif.1	+	3	1178	c.812T>A	c.(811-813)ATG>AAG	p.M271K		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	271						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				AAGCCTTGTATGGGATACTGC	0.547													15	34	---	---	---	---	PASS
GPC6	10082	broad.mit.edu	37	13	94482723	94482723	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94482723C>T	uc001vlt.2	+	3	1268	c.636C>T	c.(634-636)ACC>ACT	p.T212T	GPC6_uc010tig.1_Silent_p.T212T|GPC6_uc001vlu.1_Silent_p.T142T	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	212						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TTCAGGTTACCCGCGCCTTCA	0.493													28	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	23016469	23016469	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23016469C>T	uc001wbw.2	+	4	438	c.429C>T	c.(427-429)GCC>GCT	p.A143A	uc010aja.1_RNA|uc010tmk.1_3'UTR|uc001wco.2_RNA|uc010aje.1_3'UTR|uc001wcp.2_Silent_p.A141A|uc001wcr.1_3'UTR|uc001wcs.1_3'UTR|uc010ajf.1_Silent_p.A100A|uc001wcx.3_RNA|uc001wde.1_3'UTR|uc010ajk.1_Silent_p.A138A|uc001wdg.1_Silent_p.A56A|uc010ajo.1_Silent_p.A112A|uc010ajp.1_Silent_p.A138A|uc001wdv.3_Silent_p.A69A|uc001wec.2_Silent_p.A28A|uc001wee.3_5'UTR|uc010tmt.1_RNA|uc010ajv.1_RNA|uc001weg.2_5'UTR|uc001wei.2_5'UTR|uc001wej.2_5'UTR|uc001wek.2_Silent_p.A14A|uc001wel.2_5'UTR|uc001wem.3_5'UTR|uc001wen.1_RNA|uc001weo.2_5'UTR|uc001wep.2_5'UTR|uc001weq.2_Silent_p.A21A|uc001wer.2_RNA|uc001wet.2_5'UTR|uc001weu.2_5'UTR|uc001wev.2_Silent_p.A22A|uc001wew.2_5'UTR|uc010tmv.1_RNA|uc001wez.2_RNA|uc010ajx.1_5'UTR|uc001wfb.1_RNA|uc001wfd.1_5'UTR|uc001wfe.2_Silent_p.A29A|uc001wfg.2_RNA|uc001wfh.1_Silent_p.A20A|uc001wfi.2_RNA|uc001wfk.2_5'UTR|uc010ajy.1_5'UTR|uc001wfn.2_5'UTR|uc001wfp.2_5'UTR|uc001wfq.1_RNA|uc001wfr.1_RNA|uc010ajz.1_RNA|uc001wfs.1_RNA|uc001wft.1_RNA|uc001wfv.1_RNA|uc001wfw.1_5'UTR|uc001wfx.2_5'UTR|uc001wfy.1_Silent_p.A14A|uc001wfz.1_RNA|uc001wgc.2_Silent_p.A27A|uc001wgd.2_Silent_p.A14A|uc001wge.3_5'UTR|uc001wgf.2_RNA|uc010tmw.1_5'UTR|uc010tmx.1_5'UTR|uc001wgh.2_5'UTR|uc001wgi.1_RNA|uc001wgj.1_5'UTR|uc001wgk.2_5'UTR					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CTGACCCTGCCGTGTACCAGC	0.483													4	99	---	---	---	---	PASS
ACIN1	22985	broad.mit.edu	37	14	23530305	23530305	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23530305C>T	uc001wit.3	-	18	4015	c.3687G>A	c.(3685-3687)CTG>CTA	p.L1229L	ACIN1_uc001wio.3_RNA|ACIN1_uc001wip.3_Silent_p.L471L|ACIN1_uc001wiq.3_Silent_p.L471L|ACIN1_uc001wir.3_Silent_p.L502L|ACIN1_uc001wis.3_Silent_p.L910L|ACIN1_uc010akg.2_Silent_p.L1216L	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1229	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GGCTGTCAGTCAGTGGGAGCC	0.567													7	105	---	---	---	---	PASS
SAMD4A	23034	broad.mit.edu	37	14	55218223	55218223	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55218223G>T	uc001xbb.2	+	5	1142	c.1141G>T	c.(1141-1143)GAA>TAA	p.E381*	SAMD4A_uc001xbc.2_Nonsense_Mutation_p.E293*	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform	382	SAM.				positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						GAAGCTCAAAGAAAGACAAAA	0.328													118	128	---	---	---	---	PASS
C14orf48	256369	broad.mit.edu	37	14	94465939	94465939	+	5'UTR	SNP	C	T	T	rs149338502		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94465939C>T	uc001ycg.1	+	3					C14orf48_uc001ycf.2_RNA|C14orf48_uc010twp.1_RNA	NR_024184				Homo sapiens cDNA FLJ40422 fis, clone TESTI2038858.												0				Epithelial(152;0.114)|all cancers(159;0.191)|COAD - Colon adenocarcinoma(157;0.208)		GCAGAAGAAGCTCAAGAGAGA	0.527													9	113	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33916176	33916176	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33916176G>T	uc001zhi.2	+	20	2596	c.2526G>T	c.(2524-2526)CAG>CAT	p.Q842H	RYR3_uc010bar.2_Missense_Mutation_p.Q842H	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	842	4 X approximate repeats.|1.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTACCACCCAGTTCCTCTCCC	0.463													55	88	---	---	---	---	PASS
RPUSD2	27079	broad.mit.edu	37	15	40866002	40866002	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40866002T>G	uc001zmd.1	+	3	1180	c.1180T>G	c.(1180-1182)TGG>GGG	p.W394G		NM_152260	NP_689473	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing	394					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			skin(1)	1		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		CTCAGTTGCCTGGGGTCCTTC	0.592													7	14	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55964783	55964783	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55964783A>G	uc002adg.2	-	11	1949	c.1901T>C	c.(1900-1902)ATT>ACT	p.I634T	PRTG_uc002adh.2_Missense_Mutation_p.I136T	NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	634	Fibronectin type-III 3.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		CCTCACAGAAATGGTGGTACA	0.453													55	90	---	---	---	---	PASS
SCAPER	49855	broad.mit.edu	37	15	77057685	77057685	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77057685G>A	uc002bby.2	-	12	1665	c.1606C>T	c.(1606-1608)CGT>TGT	p.R536C	SCAPER_uc002bbx.2_Missense_Mutation_p.R290C|SCAPER_uc002bbz.1_Missense_Mutation_p.R407C|SCAPER_uc002bca.1_Missense_Mutation_p.R401C|SCAPER_uc002bcb.1_Missense_Mutation_p.R542C|SCAPER_uc002bcc.1_Missense_Mutation_p.R536C	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	535	Glu-rich.					endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						GACCTTTTACGAGAGGGTGAA	0.413													12	287	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	82635163	82635163	+	RNA	SNP	C	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82635163C>G	uc002bgx.2	-	5		c.417G>C						A6NI86	GG6LA_HUMAN	Homo sapiens cDNA FLJ40113 fis, clone TESTI2008621.												0						CCCTGTTCTCCGCAGCCCGAA	0.478													11	15	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21147816	21147816	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21147816T>C	uc010vbe.1	-	6	715	c.715A>G	c.(715-717)ACC>GCC	p.T239A	DNAH3_uc002die.2_Missense_Mutation_p.T210A	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	239	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		ATTCCATTGGTCAGATAGTAA	0.468													8	446	---	---	---	---	PASS
MT1X	4501	broad.mit.edu	37	16	56717110	56717110	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56717110G>A	uc002ejy.2	+	2	133	c.62G>A	c.(61-63)TGC>TAC	p.C21Y	MT1X_uc002ejz.2_RNA	NM_005952	NP_005943	P80297	MT1X_HUMAN	metallothionein 1X	21	Beta.	Divalent metal cation; cluster B.			response to metal ion		metal ion binding				0						TCCTGCAAATGCAAAGAGTGC	0.552													49	183	---	---	---	---	PASS
MT1X	4501	broad.mit.edu	37	16	56717111	56717111	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56717111C>T	uc002ejy.2	+	2	134	c.63C>T	c.(61-63)TGC>TGT	p.C21C	MT1X_uc002ejz.2_RNA	NM_005952	NP_005943	P80297	MT1X_HUMAN	metallothionein 1X	21	Beta.	Divalent metal cation; cluster B.			response to metal ion		metal ion binding				0						CCTGCAAATGCAAAGAGTGCA	0.557													47	183	---	---	---	---	PASS
RRAD	6236	broad.mit.edu	37	16	66956073	66956073	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66956073G>T	uc002eqn.2	-	5	985	c.833C>A	c.(832-834)GCG>GAG	p.A278E	RRAD_uc002eqo.2_Missense_Mutation_p.A278E	NM_001128850	NP_001122322	P55042	RAD_HUMAN	Ras-related associated with diabetes	278	Calmodulin-binding.				small GTPase mediated signal transduction	plasma membrane	calmodulin binding|GTP binding|GTPase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GAAGCGCTTCGCCTTTTTGCC	0.612													4	47	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70030074	70030074	+	Intron	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70030074G>A	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						GGGTCAGGACGATAGAGAGCT	0.488													4	132	---	---	---	---	PASS
ZCCHC14	23174	broad.mit.edu	37	16	87493727	87493727	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87493727C>G	uc002fjz.1	-	2	197	c.170G>C	c.(169-171)AGA>ACA	p.R57T	ZCCHC14_uc002fka.1_RNA	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	57					cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		GGCCTCAGTTCTTGGAGTGAT	0.448													59	175	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10433248	10433248	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10433248C>T	uc010coi.2	-	23	2969	c.2841G>A	c.(2839-2841)AGG>AGA	p.R947R	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.R947R|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	947	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CCTCCAGTTTCCTCTTCTTGG	0.443													8	329	---	---	---	---	PASS
CCDC144C	348254	broad.mit.edu	37	17	20294948	20294948	+	RNA	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20294948T>C	uc010cqy.1	+	13		c.3671T>C				NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0						AAACAAGAAGTAGTAAACCTC	0.338													5	183	---	---	---	---	PASS
SARM1	23098	broad.mit.edu	37	17	26686415	26686415	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26686415C>T	uc010wah.1	+	3	370	c.363C>T	c.(361-363)AAC>AAT	p.N121N	POLDIP2_uc002haz.2_5'Flank|POLDIP2_uc010wag.1_5'Flank|TMEM199_uc002hba.2_Silent_p.N121N	NM_152464	NP_689677	Q6SZW1	SARM1_HUMAN	transmembrane protein 199	Error:Variant_position_missing_in_Q6SZW1_after_alignment					innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TCACCCGCAACGTCACTTGTC	0.468													60	116	---	---	---	---	PASS
SMARCE1	6605	broad.mit.edu	37	17	38788560	38788560	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38788560G>T	uc002hux.2	-	8	725	c.601C>A	c.(601-603)CGC>AGC	p.R201S	SMARCE1_uc010wff.1_Missense_Mutation_p.R166S|SMARCE1_uc010wfg.1_Missense_Mutation_p.R131S|SMARCE1_uc002huy.2_Missense_Mutation_p.R166S|SMARCE1_uc010wfh.1_Missense_Mutation_p.R131S|SMARCE1_uc010wfi.1_Missense_Mutation_p.R183S	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	201					chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)				CTGATGAGGCGGTGGTTTCTC	0.478													4	170	---	---	---	---	PASS
HOXB6	3216	broad.mit.edu	37	17	46673821	46673821	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46673821G>A	uc002ins.1	-	4	954	c.629C>T	c.(628-630)GCG>GTG	p.A210V	HOXB5_uc002inr.2_5'Flank|HOXB6_uc010dbh.1_Missense_Mutation_p.A210V|HOXB6_uc002int.1_3'UTR	NM_018952	NP_061825	P17509	HXB6_HUMAN	homeobox B6	210					anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GAGCTGAGACGCGCTGAGCAG	0.592													25	61	---	---	---	---	PASS
RPS6KB1	6198	broad.mit.edu	37	17	58022845	58022845	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58022845C>T	uc002ixy.2	+	14	1409	c.1306C>T	c.(1306-1308)CGA>TGA	p.R436*	RPS6KB1_uc010ddj.1_Nonsense_Mutation_p.R436*|RPS6KB1_uc010wom.1_Nonsense_Mutation_p.R383*|RPS6KB1_uc010won.1_Nonsense_Mutation_p.R413*|RPS6KB1_uc010woo.1_Nonsense_Mutation_p.R371*|RPS6KB1_uc002ixz.2_RNA	NM_003161	NP_003152	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide	436	Autoinhibitory domain.				apoptosis|G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|negative regulation of apoptosis|phosphatidylinositol-mediated signaling|positive regulation of mitotic cell cycle|positive regulation of translational initiation|TOR signaling cascade	cell junction|cytoplasm|cytosol|mitochondrial outer membrane|nucleus|nucleus|synapse|synaptosome	ATP binding|protein binding|protein kinase activity			large_intestine(1)	1	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			CCGATCACCTCGAAGATTTAT	0.373													69	168	---	---	---	---	PASS
CHST9	83539	broad.mit.edu	37	18	24496333	24496333	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24496333G>C	uc002kwd.2	-	5	1420	c.1222C>G	c.(1222-1224)CAA>GAA	p.Q408E	C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Missense_Mutation_p.Q323E|CHST9_uc002kwe.2_Missense_Mutation_p.Q408E	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2	408	Lumenal (Potential).				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)					CTCACGACTTGAGCATTGGTT	0.358													104	301	---	---	---	---	PASS
ZBTB7C	201501	broad.mit.edu	37	18	45567044	45567044	+	Silent	SNP	G	A	A	rs144374638		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45567044G>A	uc002lda.2	-	1	451	c.435C>T	c.(433-435)GAC>GAT	p.D145D	ZBTB7C_uc002ldb.2_Silent_p.D145D|ZBTB7C_uc010dnu.2_Silent_p.D154D|ZBTB7C_uc010dnv.2_Silent_p.D167D|ZBTB7C_uc010dnw.2_Silent_p.D145D|ZBTB7C_uc010dnx.1_Silent_p.D145D|ZBTB7C_uc010dny.1_Silent_p.D145D|ZBTB7C_uc010dnz.1_Silent_p.D167D|ZBTB7C_uc010dob.1_Silent_p.D145D|ZBTB7C_uc010doc.1_Silent_p.D154D|ZBTB7C_uc010dod.1_Silent_p.D167D|ZBTB7C_uc010doe.1_Silent_p.D145D|ZBTB7C_uc010dof.1_Silent_p.D145D|ZBTB7C_uc010dog.1_Silent_p.D145D|ZBTB7C_uc010doh.1_Silent_p.D154D|ZBTB7C_uc010doi.1_Silent_p.D145D|ZBTB7C_uc010doj.1_Silent_p.D154D|ZBTB7C_uc010dok.1_Silent_p.D194D|ZBTB7C_uc010dol.1_Silent_p.D154D|ZBTB7C_uc010doa.1_Silent_p.D167D|ZBTB7C_uc010don.1_Silent_p.D153D|ZBTB7C_uc010doo.1_Silent_p.D145D|ZBTB7C_uc010dop.1_Silent_p.D145D|ZBTB7C_uc010doq.1_Silent_p.D154D|ZBTB7C_uc010dor.1_Silent_p.D167D|ZBTB7C_uc010dos.1_Silent_p.D145D|ZBTB7C_uc010dot.1_Silent_p.D145D|ZBTB7C_uc010dou.1_Silent_p.D154D|ZBTB7C_uc010dom.1_Silent_p.D154D	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	145	Glu-rich.|Asp-rich.					intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1						catcatcttcgtcgtcgtcat	0.274													41	126	---	---	---	---	PASS
AKAP8L	26993	broad.mit.edu	37	19	15521398	15521398	+	Silent	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15521398G>A	uc002naw.1	-	2	120	c.21C>T	c.(19-21)GTC>GTT	p.V7V	AKAP8L_uc002nax.1_RNA|AKAP8L_uc010xoh.1_Silent_p.V7V|AKAP8L_uc002nay.1_Silent_p.V7V	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	7						cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						CAGATCCCTGGACAAAGCCTA	0.478													6	205	---	---	---	---	PASS
ZNF461	92283	broad.mit.edu	37	19	37149322	37149322	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37149322C>A	uc002oem.2	-	3	243	c.15G>T	c.(13-15)TTG>TTT	p.L5F	ZNF461_uc002oen.2_5'UTR|ZNF461_uc010xtj.1_Missense_Mutation_p.L5F	NM_153257	NP_694989	Q8TAF7	ZN461_HUMAN	gonadotropin inducible transcription repressor	5					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TGAACATCACCAACTCCTAAA	0.373													5	298	---	---	---	---	PASS
DBP	1628	broad.mit.edu	37	19	49134131	49134131	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49134131A>T	uc002pjx.3	-	4	1329	c.941T>A	c.(940-942)GTG>GAG	p.V314E	DBP_uc002pjy.2_3'UTR	NM_001352	NP_001343	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box)	314					regulation of transcription from RNA polymerase II promoter|rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		TCGGGACAGCACGGCGCGGTA	0.672													4	5	---	---	---	---	PASS
NKG7	4818	broad.mit.edu	37	19	51874879	51874879	+	3'UTR	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51874879G>A	uc002pwj.2	-	4					CLDND2_uc002pwi.1_5'Flank|NKG7_uc002pwk.2_3'UTR	NM_005601	NP_005592	Q16617	NKG7_HUMAN	natural killer cell group 7 sequence							integral to plasma membrane				central_nervous_system(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCAGATTCCAGCCAAATTTTG	0.527													13	26	---	---	---	---	PASS
OSCAR	126014	broad.mit.edu	37	19	54598464	54598464	+	3'UTR	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54598464C>T	uc002qdd.2	-	5					OSCAR_uc002qcy.2_3'UTR|OSCAR_uc002qcz.2_3'UTR|OSCAR_uc002qda.2_3'UTR|OSCAR_uc002qdb.2_3'UTR|OSCAR_uc010erc.2_3'UTR|OSCAR_uc002qdc.2_3'UTR	NM_206818	NP_996554	Q8IYS5	OSCAR_HUMAN	osteoclast-associated receptor isoform 1							extracellular region|integral to membrane|plasma membrane	receptor activity				0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)					TTGGAAGTCTCGGGCTGCAGT	0.657													6	10	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55489137	55489137	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55489137C>T	uc002qij.2	+	4	429	c.343C>T	c.(343-345)CGA>TGA	p.R115*	NLRP2_uc010yfp.1_Nonsense_Mutation_p.R92*|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Nonsense_Mutation_p.R115*|NLRP2_uc010esp.2_Nonsense_Mutation_p.R115*	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	115					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		ACGGAAAGAACGACCACCTCT	0.552													19	51	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243988	56243988	+	Silent	SNP	A	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243988A>T	uc002qly.2	-	2	1237	c.1209T>A	c.(1207-1209)ATT>ATA	p.I403I		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	403	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TATATGTCCAAATTCCCTCTG	0.468													59	111	---	---	---	---	PASS
TRPC4AP	26133	broad.mit.edu	37	20	33595391	33595391	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33595391C>T	uc002xbk.2	-	14	1682	c.1648G>A	c.(1648-1650)GCA>ACA	p.A550T	TRPC4AP_uc002xbj.2_5'Flank|TRPC4AP_uc010zuq.1_Missense_Mutation_p.A141T|TRPC4AP_uc002xbl.2_Missense_Mutation_p.A542T|TRPC4AP_uc010zur.1_Missense_Mutation_p.A511T|TRPC4AP_uc002xbm.1_3'UTR	NM_015638	NP_056453	Q8TEL6	TP4AP_HUMAN	TRPC4-associated protein isoform a	550					protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)			ATCTGGTCTGCATAGGAGGTG	0.602													21	39	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33074137	33074137	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33074137A>T	uc002ypd.2	-	6	978	c.552T>A	c.(550-552)GAT>GAA	p.D184E	SFRS15_uc002ype.2_Missense_Mutation_p.D184E|SFRS15_uc010glu.2_Missense_Mutation_p.D169E|SFRS15_uc002ypf.1_5'UTR|SFRS15_uc002ypg.2_Missense_Mutation_p.D184E	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	184						nucleus	nucleotide binding|RNA binding				0						CAGCAAAAGCATCAGAGCTGG	0.483													42	81	---	---	---	---	PASS
POTEH	23784	broad.mit.edu	37	22	16278057	16278057	+	Intron	SNP	G	A	A	rs146119771		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16278057G>A	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron|POTEH_uc002zlj.1_Intron|uc002zlk.2_RNA	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						CACCAAGGTTGAAAGGAAGGG	0.368													5	18	---	---	---	---	PASS
MICAL3	57553	broad.mit.edu	37	22	18376628	18376628	+	Silent	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18376628G>A	uc002zng.3	-	11	1845	c.1492C>T	c.(1492-1494)CTG>TTG	p.L498L	MICAL3_uc011agl.1_Silent_p.L498L|MICAL3_uc002znh.2_Silent_p.L498L|MICAL3_uc002znj.1_Silent_p.L198L|MICAL3_uc002znk.1_Silent_p.L498L|MICAL3_uc002znl.1_Silent_p.L131L|MICAL3_uc002znm.2_5'UTR|MICAL3_uc010grf.2_Silent_p.L498L	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin	498						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		TCCATTTCCAGGTGAATATCT	0.423													17	68	---	---	---	---	PASS
GGT1	2678	broad.mit.edu	37	22	25024856	25024856	+	3'UTR	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25024856C>T	uc003aan.1	+	16					GGT1_uc003aat.1_3'UTR|GGT1_uc003aau.1_3'UTR|GGT1_uc003aav.1_3'UTR|GGT1_uc003aaw.1_3'UTR|GGT1_uc003aax.1_3'UTR|GGT1_uc003aay.1_3'UTR	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	AAGATACTCACCAGGACCAGG	0.627													9	8	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25147411	25147411	+	Silent	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25147411T>C	uc003abd.1	-	9	1449	c.1032A>G	c.(1030-1032)GAA>GAG	p.E344E	PIWIL3_uc011ajx.1_Silent_p.E235E|PIWIL3_uc011ajy.1_Silent_p.E235E|PIWIL3_uc010gut.1_Silent_p.E344E	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	344	PAZ.				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						TAAATGTGTCTTCAGGATTCT	0.303													9	769	---	---	---	---	PASS
RFPL2	10739	broad.mit.edu	37	22	32589043	32589043	+	Silent	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32589043C>T	uc003amg.3	-	4	1338	c.402G>A	c.(400-402)GGG>GGA	p.G134G	RFPL2_uc003ame.3_Silent_p.G73G|RFPL2_uc003amf.3_Silent_p.G44G|RFPL2_uc003amh.3_Silent_p.G44G	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	134	RING-type; degenerate.						zinc ion binding			skin(1)	1						GTAGATCCTCCCCATGGGGCT	0.532													70	148	---	---	---	---	PASS
IL3RA	3563	broad.mit.edu	37	X	1467340	1467340	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467340A>G	uc004cps.2	+	4	549	c.200A>G	c.(199-201)TAT>TGT	p.Y67C	IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor	67	Extracellular (Potential).					integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	AACAATAGCTATTGCCAGTTT	0.433													26	343	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34150174	34150174	+	Silent	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34150174G>A	uc004ddg.2	-	1	255	c.222C>T	c.(220-222)GAC>GAT	p.D74D		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	74										ovary(4)|central_nervous_system(1)	5						GTAAAAACTCGTCACGGCGAC	0.532													6	85	---	---	---	---	PASS
CFP	5199	broad.mit.edu	37	X	47487501	47487501	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47487501C>T	uc004dig.3	-	3	529	c.403G>A	c.(403-405)GAG>AAG	p.E135K	CFP_uc004dih.2_Missense_Mutation_p.E135K|CFP_uc004dii.1_Missense_Mutation_p.E71K|CFP_uc010nhu.2_Missense_Mutation_p.E135K	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor	135					complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						TCCTCCTCACCAGGACAGCAC	0.642													4	7	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53246339	53246339	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53246339T>A	uc004drz.2	-	5	1176	c.643A>T	c.(643-645)AGA>TGA	p.R215*	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Nonsense_Mutation_p.R148*|KDM5C_uc004dsa.2_Nonsense_Mutation_p.R214*	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	215					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						GGCTGCAGTCTCTTGGCCCGC	0.537			N|F|S		clear cell renal carcinoma								67	64	---	---	---	---	PASS
ZXDB	158586	broad.mit.edu	37	X	57620976	57620976	+	3'UTR	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57620976C>T	uc004dvd.2	+	1						NM_007157	NP_009088	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						TATTTAAGTGCAGTCATTTCT	0.189													67	74	---	---	---	---	PASS
WDR44	54521	broad.mit.edu	37	X	117575413	117575413	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117575413A>G	uc004eqn.2	+	15	2482	c.2057A>G	c.(2056-2058)AAT>AGT	p.N686S	WDR44_uc004eqo.2_Missense_Mutation_p.N686S|WDR44_uc011mtr.1_Intron|WDR44_uc010nqi.2_Missense_Mutation_p.N396S	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein	686						cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						GCTTTGTGGAATGAAGTAGAT	0.408													12	306	---	---	---	---	PASS
SMARCA1	6594	broad.mit.edu	37	X	128650464	128650464	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128650464C>T	uc004eun.3	-	3	385	c.272G>A	c.(271-273)CGA>CAA	p.R91Q	SMARCA1_uc004eup.3_Missense_Mutation_p.R91Q|SMARCA1_uc011muk.1_Missense_Mutation_p.R91Q|SMARCA1_uc011mul.1_Missense_Mutation_p.R91Q	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	91					ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						TCTCTTTGCTCGGTCGGCTTT	0.299													7	242	---	---	---	---	PASS
ZNF449	203523	broad.mit.edu	37	X	134483227	134483227	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134483227T>A	uc004eys.2	+	3	712	c.547T>A	c.(547-549)TTT>ATT	p.F183I	ZNF449_uc004eyq.1_3'UTR|ZNF449_uc004eyt.2_Missense_Mutation_p.F63I	NM_152695	NP_689908	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	183					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					ATGTCAGAACTTTCTGGACCC	0.522													95	80	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9095	9095	+	RNA	SNP	T	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9095T>C	uc011mfi.1	+	1		c.433T>C			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TCCCTCTACACTTATCATCTT	0.458													4	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	12756	12756	+	RNA	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:12756G>A	uc004cox.3	+	1		c.420G>A			uc004coy.2_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CTATTCCAACTGTTCATCGGC	0.403													13	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13069	13069	+	RNA	SNP	G	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13069G>A	uc004cox.3	+	1		c.733G>A			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		CCCCAGTCTCAGCCCTACTCC	0.537													53	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	13077	13077	+	RNA	SNP	C	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:13077C>T	uc004cox.3	+	1		c.741C>T			uc004coy.2_5'Flank|uc004coz.1_5'Flank					Homo sapiens NADH dehydrogenase subunit 5 (MTND5) mRNA, RNA 5, complete cds; mitochondrial gene for mitochondrial product.																		TCAGCCCTACTCCACTCAAGC	0.522													6	58	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15489	15489	+	3'UTR	SNP	A	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15489A>G	uc004coy.2	+	1					uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		ATTCTCACCAGACCTCCTAGG	0.458											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	35	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	1055405	1055405	+	IGR	DEL	A	-	-	rs77768502		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1055405delA								C1orf159 (3669 upstream) : MIR200B (47079 downstream)																							ctccatctccaaaaaaaaaaa	0.184													4	2	---	---	---	---	
TNFRSF4	7293	broad.mit.edu	37	1	1147976	1147977	+	Intron	INS	-	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1147976_1147977insC	uc001ade.2	-						TNFRSF4_uc001adf.2_Intron	NM_003327	NP_003318	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily,						immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		aaccaccccaacccccccccag	0.307													4	2	---	---	---	---	
CDK11B	984	broad.mit.edu	37	1	1651062	1651063	+	Intron	INS	-	C	C	rs72634835		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1651062_1651063insC	uc001agv.1	-						CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron|CDK11A_uc010nyt.1_Intron|CDK11A_uc010nyu.1_Intron|CDK11A_uc009vkt.1_Intron|CDK11A_uc009vku.1_Intron|CDK11A_uc009vkv.1_Intron|CDK11A_uc001aht.1_Intron|CDK11B_uc001ahu.1_Intron|CDK11B_uc001ahv.1_Intron|CDK11B_uc001ahw.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						Atcttttttttttttttttttt	0.149													11	6	---	---	---	---	
IFFO2	126917	broad.mit.edu	37	1	19252597	19252597	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19252597delT	uc001bbd.2	-							NM_001136265	NP_001129737	Q5TF58	IFFO2_HUMAN	intermediate filament family orphan 2												0						gatggatggattggttggatg	0.154													3	3	---	---	---	---	
INPP5B	3633	broad.mit.edu	37	1	38383722	38383722	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38383722delC	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001ccf.1_Intron	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CATCATTCTTCCTATCAGCCA	0.522													4	2	---	---	---	---	
NASP	4678	broad.mit.edu	37	1	46081689	46081690	+	Intron	DEL	AG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46081689_46081690delAG	uc001coi.1	+						NASP_uc001coh.1_Intron|NASP_uc001coj.1_Intron|NASP_uc010olr.1_Intron|NASP_uc001col.1_Intron	NM_002482	NP_002473	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein isoform 2						blastocyst development|cell cycle|cell proliferation|DNA replication|histone exchange|protein transport	cytoplasm|nucleus	Hsp90 protein binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TCCATCTCCAAGAACTCATTTG	0.376													3	3	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	50418255	50418255	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50418255delC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		TAGCCAATATCCAAATTCAGC	0.229													4	2	---	---	---	---	
TMEM59	9528	broad.mit.edu	37	1	54507729	54507729	+	Intron	DEL	G	-	-	rs58401714		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54507729delG	uc001cwp.2	-						TMEM59_uc001cwn.2_Intron|TMEM59_uc001cwo.2_Intron|TMEM59_uc001cwq.2_Intron|TMEM59_uc001cwr.2_Intron|TMEM59_uc001cws.1_Intron	NM_004872	NP_004863	Q9BXS4	TMM59_HUMAN	thymic dendritic cell-derived factor 1							Golgi membrane|integral to membrane					0						GTTTTGTTTTGTTTTTTTTTT	0.323													4	2	---	---	---	---	
DOCK7	85440	broad.mit.edu	37	1	62954372	62954373	+	Intron	INS	-	A	A	rs145774892	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62954372_62954373insA	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron|DOCK7_uc010oov.1_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						ATTCAAAAATGAAAAAAAAAAG	0.262													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	84033908	84033908	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84033908delC								None (None upstream) : TTLL7 (301151 downstream)																							CATGTGGACTCTTAGCTCCTG	0.532													4	2	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113666351	113666351	+	Intron	DEL	G	-	-	rs66524955		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113666351delG	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		GGTGGTTTTtgtgtgtgtgtg	0.289													4	4	---	---	---	---	
LRIG2	9860	broad.mit.edu	37	1	113666353	113666353	+	Intron	DEL	G	-	-	rs1728223		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113666353delG	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGGTTTTtgtgtgtgtgtgtg	0.284													4	4	---	---	---	---	
C1orf161	126868	broad.mit.edu	37	1	116655005	116655005	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116655005delT	uc001egc.1	+							NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868												0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTTTAAATTCTTTTTTTTTTA	0.343													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	144009132	144009132	+	Intron	DEL	G	-	-	rs11364742		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144009132delG	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		tttttaatctgtttttttcag	0.204													2	4	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145017413	145017414	+	Intron	DEL	AG	-	-	rs59118882		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145017413_145017414delAG	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAGAAAGCAAAGCCTCTGTCAA	0.416			T	PDGFRB	MPD								4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145017417	145017417	+	Intron	DEL	T	-	-	rs60375515		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145017417delT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGCAAAGCCTCTGTCAAACA	0.418			T	PDGFRB	MPD								4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145017421	145017441	+	Intron	DEL	TCAAACAAAGTACACAGAGGA	-	-	rs56742449		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145017421_145017441delTCAAACAAAGTACACAGAGGA	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron|uc001emj.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAAGCCTCTGTCAAACAAAGTACACAGAGGACCTCATGTTG	0.398			T	PDGFRB	MPD								4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145069498	145069498	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145069498delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						GTCATAGCACAAAAAAATGCA	0.338													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145199593	145199594	+	Intron	DEL	AC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145199593_145199594delAC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						cttaaaaaaaacaaaacaaaac	0.119													5	3	---	---	---	---	
SNAPIN	23557	broad.mit.edu	37	1	153632223	153632224	+	Intron	DEL	TG	-	-	rs67464033		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153632223_153632224delTG	uc001fcq.2	+							NM_012437	NP_036569	O95295	SNAPN_HUMAN	SNAP-associated protein						intracellular protein transport|synaptic vesicle exocytosis	BLOC-1 complex|cell junction|perinuclear region of cytoplasm|synaptic vesicle membrane|synaptosome	SNARE binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTTACATTCTTGTGTGTGTGTG	0.228													3	3	---	---	---	---	
UAP1	6675	broad.mit.edu	37	1	162558826	162558826	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162558826delT	uc001gce.3	+							NM_003115	NP_003106	Q16222	UAP1_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1						dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol|nucleus|plasma membrane	UDP-N-acetylglucosamine diphosphorylase activity			ovary(2)|skin(2)|kidney(1)	5	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			TGAGTACAACTTTTTTTTTTT	0.239													4	2	---	---	---	---	
DARS2	55157	broad.mit.edu	37	1	173802912	173802912	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173802912delT	uc001gjh.1	+							NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	Atttcttttcttttttttttt	0.154													3	3	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183187793	183187794	+	Intron	DEL	AC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183187793_183187794delAC	uc001gqa.2	+						LAMC2_uc001gpz.3_Intron|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						AACAGCAAAAACACACACACAC	0.455													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	190526058	190526058	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190526058delT								FAM5C (79299 upstream) : None (None downstream)																							TCTTTGCTTCTTTTTTTTGGT	0.358													4	2	---	---	---	---	
UCHL5	51377	broad.mit.edu	37	1	193028132	193028133	+	Intron	INS	-	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193028132_193028133insG	uc001gsm.2	-						UCHL5_uc001gsn.2_Intron|UCHL5_uc001gso.2_Intron|UCHL5_uc010pov.1_Intron|UCHL5_uc001gsp.2_Intron|UCHL5_uc001gsq.2_Intron|UCHL5_uc010pow.1_Intron|UCHL5_uc010pox.1_Intron|UCHL5_uc001gsr.1_3'UTR|TROVE2_uc001gst.1_5'Flank|TROVE2_uc001gss.2_5'Flank|TROVE2_uc001gsu.1_5'Flank|TROVE2_uc001gsv.1_5'Flank|TROVE2_uc001gsw.2_5'Flank|TROVE2_uc009wyp.2_5'Flank|TROVE2_uc009wyq.2_5'Flank	NM_015984	NP_057068	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5						DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|ovary(1)	3						CAAATTACTGTGGAAACGCGAC	0.396													4	2	---	---	---	---	
PPP1R12B	4660	broad.mit.edu	37	1	202406723	202406723	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202406723delG	uc001gya.1	+						PPP1R12B_uc001gxy.2_Intron|PPP1R12B_uc009xad.1_Intron|PPP1R12B_uc009xae.1_Intron|PPP1R12B_uc001gxz.1_Intron	NM_002481	NP_002472	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)			AGCACTGTGTGAAGAATCCGA	0.368													4	2	---	---	---	---	
SYT14	255928	broad.mit.edu	37	1	210194203	210194204	+	Intron	DEL	TG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210194203_210194204delTG	uc009xcv.2	+						SYT14_uc001hhs.3_Intron|SYT14_uc001hht.3_Intron|SYT14_uc001hhu.3_Intron|SYT14_uc010psn.1_Intron|SYT14_uc010pso.1_Intron	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4							integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		ATAAtatatatgtgtgtgtgtg	0.163													4	2	---	---	---	---	
SYT14	255928	broad.mit.edu	37	1	210198207	210198209	+	Intron	DEL	AGA	-	-	rs138320559		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210198207_210198209delAGA	uc009xcv.2	+						SYT14_uc001hhs.3_Intron|SYT14_uc001hht.3_Intron|SYT14_uc001hhu.3_Intron|SYT14_uc010psn.1_Intron|SYT14_uc010pso.1_Intron	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4							integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GAAAAGTTTTAGAAGAAGAAGGA	0.360													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213523790	213523791	+	IGR	DEL	GT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213523790_213523791delGT								RPS6KC1 (76983 upstream) : PROX1 (637495 downstream)																							AGATGTGGGAGTGTGTGTGTAT	0.465													4	2	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217037913	217037913	+	Intron	DEL	A	-	-	rs11358051		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217037913delA	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AATAATACAGAAAAAAAAAAC	0.338													4	2	---	---	---	---	
AKT3	10000	broad.mit.edu	37	1	243800803	243800803	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243800803delT	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456	Q9Y243	AKT3_HUMAN	AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			TACAACCATATTTTGGTTGTT	0.259													67	36	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12840823	12840823	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12840823delC								LPIN1 (873292 upstream) : TRIB2 (16175 downstream)																							AAATCAGTGACCCCACAAGAA	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16559502	16559503	+	IGR	INS	-	GC	GC			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16559502_16559503insGC								MYCN (472374 upstream) : FAM49A (174398 downstream)																							GGGGTCCTGCTAAGGTGGATGT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34326756	34326756	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34326756delC								MYADML (373472 upstream) : None (None downstream)																							TAATTACCTACCAAGGTGAGT	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38782811	38782811	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38782811delC								ATL2 (178379 upstream) : HNRPLL (7517 downstream)																							CTATATCCTGCCCCCATCCAC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85913031	85913032	+	IGR	INS	-	C	C	rs146084620	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85913031_85913032insC								SFTPB (17657 upstream) : GNLY (8382 downstream)																							ATTCACTTTTAATGGCAACATA	0.282													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91791778	91791778	+	IGR	DEL	T	-	-	rs112645372		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91791778delT								None (None upstream) : LOC654342 (13414 downstream)																							GTCAGTCTCATTTTTTTTTTG	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95542752	95542752	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95542752delG	uc002stv.1	-											Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																		GGTGGGGACTGGGGCTCCACA	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	124450104	124450104	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124450104delA								None (None upstream) : CNTNAP5 (332760 downstream)																							ctgagatgtcaaaaaaaaaag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133102450	133102451	+	IGR	INS	-	TT	TT	rs141217632	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133102450_133102451insTT								NCRNA00164 (86908 upstream) : GPR39 (71696 downstream)																							gtcaggagttcaagaccagcct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133118545	133118545	+	IGR	DEL	T	-	-	rs113968246		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133118545delT								NCRNA00164 (103003 upstream) : GPR39 (55602 downstream)																							TCATGGGTACTTCATATAATA	0.348													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	150453704	150453704	+	IGR	DEL	T	-	-	rs67994160		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150453704delT								MMADHC (9374 upstream) : RND3 (871008 downstream)																							TTATTTTTGATTTTTTTTTGT	0.363													2	5	---	---	---	---	
LY75	4065	broad.mit.edu	37	2	160668796	160668797	+	Intron	INS	-	T	T	rs75852824		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160668796_160668797insT	uc002ubc.3	-						LY75_uc002ubb.3_Intron|LY75_uc010fos.2_Intron	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)		GCTTCCAACTCTTTTTTTTTTT	0.307													1	5	---	---	---	---	
SLC4A10	57282	broad.mit.edu	37	2	162807001	162807001	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162807001delA	uc002ubx.3	+						SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						tgttgtgaagaaaaaaaaaat	0.080													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	177708740	177708741	+	IGR	INS	-	C	C	rs147322190	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177708740_177708741insC								MIR1246 (242960 upstream) : HNRNPA3 (368681 downstream)																							ATCTCGCTCAACTCCCTTAGCa	0.084													4	4	---	---	---	---	
ITGA4	3676	broad.mit.edu	37	2	182363702	182363702	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182363702delT	uc002unu.2	+						ITGA4_uc010frj.1_Intron	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	TGTATCATCCTTTTTCACATT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	195561950	195561950	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195561950delA								None (None upstream) : SLC39A10 (959582 downstream)																							ACATAAAGTGAAAAAAAACAA	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206540532	206540533	+	IGR	INS	-	A	A	rs146669108	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206540532_206540533insA								PARD3B (59995 upstream) : NRP2 (6691 downstream)																							AGGTTTGCTTTaaaaaaaaaca	0.347											OREG0015151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
ADAM23	8745	broad.mit.edu	37	2	207350157	207350157	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207350157delG	uc002vbq.2	+						ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein						cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		GTAAGTATGTGGGCTCAGGGT	0.458													4	2	---	---	---	---	
ADAM23	8745	broad.mit.edu	37	2	207452304	207452305	+	Intron	INS	-	A	A	rs117434816		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207452304_207452305insA	uc002vbq.2	+						ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein						cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CAGATTAAGAGAAAAAAAAAAA	0.322													3	5	---	---	---	---	
ERBB4	2066	broad.mit.edu	37	2	213152446	213152446	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213152446delA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		AAGACTGCCTAAGAATTAGgc	0.179										TSP Lung(8;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	1782471	1782471	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1782471delA								CNTN6 (337194 upstream) : CNTN4 (358079 downstream)																							tctctaaaagaaaaaaaaaaT	0.174													8	4	---	---	---	---	
LARS2	23395	broad.mit.edu	37	3	45441485	45441485	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45441485delA	uc003cop.1	+						LARS2_uc010hit.1_Intron	NM_015340	NP_056155	Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial						leucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|leucine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	TTTAAAAGAGAAAAAAAAAAG	0.174													4	2	---	---	---	---	
SMARCC1	6599	broad.mit.edu	37	3	47734484	47734484	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47734484delA	uc003crq.2	-						SMARCC1_uc011bbd.1_Intron	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		attccgtcttaaaaaaaaaag	0.000													4	2	---	---	---	---	
USP4	7375	broad.mit.edu	37	3	49364972	49364972	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49364972delA	uc003cwq.2	-						USP4_uc003cwr.2_Intron	NM_003363	NP_003354	Q13107	UBP4_HUMAN	ubiquitin specific protease 4 isoform a						negative regulation of protein ubiquitination|protein deubiquitination|protein localization at cell surface|regulation of protein stability|ubiquitin-dependent protein catabolic process	lysosome|nucleus	adenosine receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|urinary_tract(1)|lung(1)	4		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		actccatctcaaaaaaaaaaG	0.199													6	3	---	---	---	---	
ABHD6	57406	broad.mit.edu	37	3	58242073	58242073	+	Intron	DEL	T	-	-	rs10574237		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58242073delT	uc003djs.3	+						ABHD6_uc003djr.2_Intron|ABHD6_uc003djt.3_Intron	NM_020676	NP_065727	Q9BV23	ABHD6_HUMAN	abhydrolase domain containing 6							integral to membrane	acylglycerol lipase activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(55;0.000225)|KIRC - Kidney renal clear cell carcinoma(284;0.0471)|Kidney(284;0.0589)|OV - Ovarian serous cystadenocarcinoma(275;0.209)		ctttataatgttttttttttt	0.050													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	58429550	58429550	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58429550delT								PDHB (9985 upstream) : KCTD6 (48273 downstream)																							TAACCCCTCATAAAGATACTT	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	73332468	73332469	+	IGR	DEL	GG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73332468_73332469delGG								PPP4R2 (217457 upstream) : PDZRN3 (99183 downstream)																							caaactttttggtaaagggcca	0.178													4	2	---	---	---	---	
CADM2	253559	broad.mit.edu	37	3	85348909	85348909	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85348909delC	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TGTGATTTTTCTTCTTTTCTG	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	117469636	117469637	+	IGR	INS	-	AC	AC	rs147371729	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117469636_117469637insAC								None (None upstream) : None (None downstream)																							AATATAATGGAACACACACACA	0.391													4	2	---	---	---	---	
NEK11	79858	broad.mit.edu	37	3	130871047	130871047	+	Intron	DEL	T	-	-	rs150507740	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130871047delT	uc003eny.2	+						NEK11_uc003enx.2_Intron|NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron|NEK11_uc011blm.1_Intron|NEK11_uc010hto.1_Intron	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						ACTTTTTTGGTTTTTTTTTTG	0.323													5	3	---	---	---	---	
PIK3CB	5291	broad.mit.edu	37	3	138413450	138413450	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138413450delT	uc011bmq.1	-						PIK3CB_uc011bmn.1_Intron|PIK3CB_uc011bmo.1_Intron|PIK3CB_uc011bmp.1_Intron	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						ATGCTTTTGGTTTTTTTTTTC	0.224													4	2	---	---	---	---	
CP	1356	broad.mit.edu	37	3	148918731	148918731	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148918731delA	uc003ewy.3	-						CP_uc011bnr.1_Intron|CP_uc003ewx.3_Intron|CP_uc003ewz.2_Intron|CP_uc010hvf.1_Intron	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor						cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CACCGCTAGGAAAAAAAAAAG	0.418													10	5	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160948877	160948878	+	Intron	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160948877_160948878insA	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			taaccaaatttataatttagcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172123727	172123727	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172123727delT								FNDC3B (5237 upstream) : GHSR (39224 downstream)																							TGCACATACATTTTTTTTTTC	0.383													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190415970	190415970	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190415970delT								IL1RAP (40127 upstream) : LOC647309 (154556 downstream)																							GAGATTGTTATTTTTTTTTTG	0.403													4	2	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195690462	195690463	+	Intron	INS	-	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195690462_195690463insG	uc003fvy.2	-						SDHAP1_uc003fvx.3_Intron					Homo sapiens full length insert cDNA clone ZC24D06.												0						catgcgcaacaggggactgtaa	0.045													5	3	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21714405	21714405	+	Intron	DEL	A	-	-	rs28691092	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21714405delA	uc003gqi.1	-							NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				AGAGATTTTTAAAAAAAAAAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28907816	28907816	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28907816delT								None (None upstream) : None (None downstream)																							aacaacttcattttttttttt	0.035													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	45307373	45307373	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45307373delA								GNPDA2 (578761 upstream) : GABRG1 (730416 downstream)																							aaaaatggccaaaaatagtca	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49266212	49266213	+	IGR	DEL	TC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49266212_49266213delTC								CWH43 (202119 upstream) : None (None downstream)																							gcacagagcttctcaagctctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49534615	49534616	+	IGR	INS	-	C	C	rs68121402		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49534615_49534616insC								CWH43 (470522 upstream) : None (None downstream)																							TAAAAAAAAAACACTACTGCTT	0.129													6	3	---	---	---	---	
ANKRD17	26057	broad.mit.edu	37	4	73963572	73963572	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73963572delA	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTTAACAACCAAAAAAAAAAG	0.269													6	4	---	---	---	---	
HELQ	113510	broad.mit.edu	37	4	84339020	84339020	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84339020delT	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TCCTGTTATGTTTTTTTTTTC	0.398								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					9	5	---	---	---	---	
IBSP	3381	broad.mit.edu	37	4	88733233	88733233	+	3'UTR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88733233delT	uc003hqx.3	+	7						NM_004967	NP_004958	P21815	SIAL_HUMAN	integrin-binding sialoprotein precursor						biomineral tissue development|cell adhesion|ossification						0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		TTCTTGTCCCTTTTTTTTCTG	0.348													4	2	---	---	---	---	
ABCG2	9429	broad.mit.edu	37	4	89058962	89058962	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89058962delA	uc003hrg.2	-						ABCG2_uc003hrh.2_Intron|ABCG2_uc003hri.1_Intron|ABCG2_uc003hrj.1_Intron|ABCG2_uc003hrk.1_Intron	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2						cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)	aaatgcagtgaaatgttggct	0.040													4	2	---	---	---	---	
EMCN	51705	broad.mit.edu	37	4	101416162	101416163	+	Intron	DEL	TT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101416162_101416163delTT	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326	Q9ULC0	MUCEN_HUMAN	endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		CTAATGTGAATTTAAAAAAAAG	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	112528650	112528650	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112528650delA								MIR297 (746847 upstream) : C4orf32 (537903 downstream)																							taacatatgcaagggaaattc	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	138091885	138091886	+	IGR	DEL	TG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138091885_138091886delTG								None (None upstream) : PCDH18 (348190 downstream)																							gtgaaaatgttgtgactaaaag	0.005													4	2	---	---	---	---	
ZNF827	152485	broad.mit.edu	37	4	146859775	146859775	+	5'Flank	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146859775delT	uc003ikn.2	-						ZNF827_uc003ikm.2_5'Flank|ZNF827_uc010iox.2_5'Flank	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					tcttttttccttttttttttt	0.398													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	153121364	153121365	+	IGR	DEL	TC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153121364_153121365delTC								PET112L (439218 upstream) : FBXW7 (121046 downstream)																							TATCCATAGATCTCTCTCTATC	0.495													4	2	---	---	---	---	
ARFIP1	27236	broad.mit.edu	37	4	153736334	153736334	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153736334delT	uc003imz.2	+						ARFIP1_uc003inb.2_Intron|ARFIP1_uc003ina.2_Intron|ARFIP1_uc003inc.2_Intron|ARFIP1_uc011cij.1_Intron	NM_001025595	NP_001020766	P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1						intracellular protein transport|regulation of protein secretion	cytosol|Golgi membrane				ovary(1)	1	all_hematologic(180;0.093)					cttctgcttctttTTTTTTAA	0.090													4	2	---	---	---	---	
GLRB	2743	broad.mit.edu	37	4	157999548	157999549	+	Intron	DEL	TG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157999548_157999549delTG	uc003ipj.2	+							NM_000824	NP_000815	P48167	GLRB_HUMAN	glycine receptor, beta isoform A precursor						nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)	TTTTATACACTGTTTACAAAAG	0.287													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	165927631	165927631	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165927631delC								TRIM61 (28813 upstream) : TRIM60 (25520 downstream)																							TTGATTCTTTCCAAGAGCTGT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	174893879	174893879	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174893879delG	uc003itn.2	-											full-length cDNA clone CS0DB006YO06 of Neuroblastoma Cot 10-normalized of Homo sapiens (human).																		ctagaatccagggcatagaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190618926	190618926	+	IGR	DEL	A	-	-	rs111791484		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190618926delA								None (None upstream) : FRG1 (243048 downstream)																							CTTGAAAAAGAAAAAAAAAGG	0.403													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190801791	190801792	+	Intron	INS	-	T	T	rs149682890		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190801791_190801792insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		AAGGATAGTCATTTTTTAAAAC	0.337													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190818022	190818022	+	Intron	DEL	A	-	-	rs113369235		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190818022delA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		ttgtgatggtaggggggtggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190821799	190821800	+	Intron	INS	-	T	T	rs140638219	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190821799_190821800insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		TTTTTTGTTTGTTTTTTACTTA	0.317													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1795468	1795469	+	IGR	INS	-	G	G	rs77372099		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1795468_1795469insG								LOC728613 (161348 upstream) : MRPL36 (3031 downstream)																							GGAAATGCATAGACAGCTCCTA	0.495													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18118349	18118350	+	IGR	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18118349_18118350insT								BASP1 (841414 upstream) : None (None downstream)																							TAACCTTTGAATTTTTTTTTGT	0.332													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34534191	34534192	+	IGR	INS	-	TAAG	TAAG	rs140368639	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34534191_34534192insTAAG								C1QTNF3 (490874 upstream) : RAI14 (122241 downstream)																							GTTGTCCACCTTAAGTATTGAG	0.386													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39433164	39433165	+	IGR	DEL	GT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39433164_39433165delGT								DAB2 (7829 upstream) : None (None downstream)																							tgtgttaagcgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
NLN	57486	broad.mit.edu	37	5	65029554	65029555	+	Intron	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65029554_65029555insT	uc003juf.2	+						NLN_uc003jue.2_Intron	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor						proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		GACACAGGTGCttttttttttt	0.248													3	3	---	---	---	---	
MAST4	375449	broad.mit.edu	37	5	65910468	65910469	+	Intron	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65910468_65910469insA	uc003jur.3	+						MAST4_uc010iwz.2_Intron	NM_198828	NP_942123	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ACTTTCAATTTTCTCCTTCCCT	0.411													4	2	---	---	---	---	
GTF2H2C	728340	broad.mit.edu	37	5	68878272	68878273	+	Intron	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68878272_68878273insA	uc003jwx.3	+						GTF2H2C_uc003jwz.3_Intron|GTF2H2C_uc011cre.1_Intron|GTF2H2C_uc003jwy.3_Intron|GTF2H2C_uc003jxa.1_RNA	NM_001098728	NP_001092198	Q6P1K8	T2H2L_HUMAN	general transcription factor IIH, polypeptide						DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0						TAAAGACCTTGAAAATATCAGT	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	79258635	79258636	+	IGR	INS	-	AA	AA	rs149664126	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79258635_79258636insAA								CMYA5 (162587 upstream) : MTX3 (13905 downstream)																							ggattcgatggaaaacaaaaac	0.000													4	4	---	---	---	---	
TMEM161B	153396	broad.mit.edu	37	5	87491918	87491918	+	3'UTR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87491918delT	uc003kjc.2	-	12					TMEM161B_uc011cty.1_3'UTR|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctx.1_3'UTR	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B							integral to membrane				skin(2)	2		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		TTCTGATATGTTTTTTTTTTC	0.284													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97949359	97949359	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97949359delT								None (None upstream) : RGMB (155640 downstream)																							TCTCGAAATCTTTTTTTTCCT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103433448	103433448	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103433448delC								NUDT12 (534958 upstream) : None (None downstream)																							GTAGGTGGAACAGCATCAGCT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	113565450	113565452	+	IGR	DEL	GTG	-	-	rs10577450		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113565450_113565452delGTG								YTHDC2 (634471 upstream) : KCNN2 (132564 downstream)																							AATTACTGTTGTGGTACTAATAA	0.296													3	3	---	---	---	---	
FEM1C	56929	broad.mit.edu	37	5	114861454	114861454	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114861454delA	uc003krb.1	-							NM_020177	NP_064562	Q96JP0	FEM1C_HUMAN	feminization 1 homolog a							cytoplasm				breast(2)|ovary(1)	3		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		TACAAACGAGAAAAAAAAATT	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	123635755	123635756	+	IGR	DEL	CA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123635755_123635756delCA								CSNK1G3 (683293 upstream) : ZNF608 (336854 downstream)																							gaaacacatgcacacacacaca	0.277													4	2	---	---	---	---	
ADAMTS19	171019	broad.mit.edu	37	5	128886604	128886604	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128886604delA	uc003kvb.1	+							NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TAGCAGCAATAAAAAAAATCC	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	135754936	135754937	+	IGR	INS	-	A	A	rs150290072		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135754936_135754937insA								TRPC7 (61863 upstream) : SPOCK1 (556051 downstream)																							ggtctgtctccaaaaaaaaaaa	0.198													2	4	---	---	---	---	
ARHGAP26	23092	broad.mit.edu	37	5	142273580	142273580	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142273580delT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886	Q9UNA1	RHG26_HUMAN	GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATTAGAAAGCTTTTTTTTTGT	0.144													4	2	---	---	---	---	
HTR4	3360	broad.mit.edu	37	5	147928557	147928557	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147928557delA	uc003lpn.2	-						HTR4_uc010jgu.1_Intron|HTR4_uc003lpi.1_Intron|HTR4_uc003lpj.1_Intron|HTR4_uc003lpk.2_Intron|HTR4_uc011dby.1_Intron|HTR4_uc003lpl.2_Intron|HTR4_uc003lpm.2_Intron|HTR4_uc010jgv.2_Intron|HTR4_uc003lpo.1_Intron	NM_000870	NP_000861	Q13639	5HT4R_HUMAN	serotonin 5-HT4 receptor isoform b						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)	agggagggggaaagaggaaag	0.209													21	13	---	---	---	---	
GLRA1	2741	broad.mit.edu	37	5	151228742	151228744	+	Intron	DEL	TTC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151228742_151228744delTTC	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ctttctttctttctttcttttct	0.000													6	3	---	---	---	---	
GRIA1	2890	broad.mit.edu	37	5	153065415	153065415	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153065415delC	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_Intron|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Intron|GRIA1_uc010jia.1_Intron	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCTTTGCAGGCCCCCCATACT	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	153968123	153968124	+	IGR	DEL	CA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153968123_153968124delCA								HAND1 (110299 upstream) : MIR1303 (97212 downstream)																							AGCATGTGTGCACACACACACA	0.515													2	4	---	---	---	---	
SGCD	6444	broad.mit.edu	37	5	155779232	155779234	+	Intron	DEL	TCA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155779232_155779234delTCA	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGCTTAGGAGTCATCAGTGGATG	0.271													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157922956	157922957	+	IGR	DEL	GC	-	-	rs77870480		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157922956_157922957delGC								CLINT1 (636788 upstream) : EBF1 (199967 downstream)																							GAGGTATTTGGCGCCATTTGCT	0.252													3	4	---	---	---	---	
WWC1	23286	broad.mit.edu	37	5	167722168	167722168	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167722168delG	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ctgtctgtgtggccttgggca	0.154													4	2	---	---	---	---	
WWC1	23286	broad.mit.edu	37	5	167861375	167861376	+	Intron	INS	-	G	G	rs144243144	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167861375_167861376insG	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron|WWC1_uc003lzw.2_Intron|WWC1_uc010jjf.1_Intron	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		GGGAGGAAAAAGGCCTGTCCTC	0.540													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174162066	174162067	+	IGR	INS	-	T	T	rs138636248	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174162066_174162067insT								MSX2 (4165 upstream) : DRD1 (705609 downstream)																							ctttctcttccttttttctttt	0.069													3	3	---	---	---	---	
UNC5A	90249	broad.mit.edu	37	5	176252037	176252038	+	Intron	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176252037_176252038insT	uc003mey.2	+						UNC5A_uc003mex.1_Intron	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGAGTCTGCATTTGGGGCCTT	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14051469	14051470	+	IGR	DEL	AC	-	-	rs35933754		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14051469_14051470delAC								RNF182 (71236 upstream) : CD83 (66395 downstream)																							ACAGGACTGTacacacacacac	0.381													4	2	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24873398	24873398	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24873398delA	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron|FAM65B_uc003nep.2_Intron|FAM65B_uc011djt.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						AGAAAAGGAGAAAAAAGCTGA	0.468													4	2	---	---	---	---	
FAM65B	9750	broad.mit.edu	37	6	24892767	24892768	+	Intron	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24892767_24892768insT	uc003neo.1	-						FAM65B_uc011djs.1_Intron|FAM65B_uc011dju.1_Intron	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						TGCCTTTTCCATTTTTTTTCTA	0.416													4	2	---	---	---	---	
ZNF192	7745	broad.mit.edu	37	6	28117603	28117603	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28117603delT	uc003nkn.1	+						ZNF192_uc010jqx.1_Intron|ZNF192_uc010jqy.1_Intron|ZNF192_uc011dkz.1_Intron	NM_006298	NP_006289	Q15776	ZN192_HUMAN	zinc finger protein 192						viral reproduction	cytoplasm|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ataatttgacttttttttttt	0.139													3	3	---	---	---	---	
C6orf27	80737	broad.mit.edu	37	6	31744362	31744362	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31744362delT	uc011dog.1	-	2	433	c.195delA	c.(193-195)CCAfs	p.P65fs	C6orf27_uc003nxd.2_5'UTR|C6orf27_uc011doh.1_RNA	NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor	65						extracellular region				ovary(3)	3						GGCCTGGGGGTGGCTGCTCCA	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32209772	32209773	+	IGR	DEL	TT	-	-	rs146656438		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32209772_32209773delTT								NOTCH4 (17928 upstream) : C6orf10 (46530 downstream)																							GCTTTCAAACTTTTTCTTTTCA	0.431													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57169499	57169499	+	IGR	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57169499delG								RAB23 (82398 upstream) : PRIM2 (12923 downstream)																							GCTGTTCCCTGGGGCATTGTG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57514722	57514723	+	IGR	INS	-	AAG	AAG	rs149088959		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57514722_57514723insAAG								PRIM2 (1347 upstream) : GUSBL2 (731436 downstream)																							CGTTGTGTTAAAAGGGAGATAT	0.361													5	3	---	---	---	---	
KHDRBS2	202559	broad.mit.edu	37	6	62604849	62604850	+	Intron	DEL	TC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62604849_62604850delTC	uc003peg.2	-							NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		AATACAAATTTCTCTCTCTCTC	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	97212819	97212819	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97212819delA								FHL5 (148307 upstream) : GPR63 (33070 downstream)																							ACCCTAGAGGAAAAAAAAAAT	0.274													4	2	---	---	---	---	
C6orf174	387104	broad.mit.edu	37	6	127806435	127806435	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127806435delA	uc003qbd.2	-							NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		aggaaaagggaaaaaaaaagg	0.015													4	2	---	---	---	---	
STX7	8417	broad.mit.edu	37	6	132789853	132789854	+	Intron	INS	-	C	C	rs144448943	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132789853_132789854insC	uc003qdg.2	-						STX7_uc011ecg.1_Intron|STX7_uc011ech.1_Intron	NM_003569	NP_003560	O15400	STX7_HUMAN	syntaxin 7						intracellular protein transport|post-Golgi vesicle-mediated transport	early endosome membrane|integral to membrane	SNAP receptor activity				0	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		TACCAAGTGAGCGAGGCAGGAT	0.332													4	2	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	137105032	137105033	+	Intron	INS	-	TG	TG	rs139322941	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137105032_137105033insTG	uc003qhc.2	-						MAP3K5_uc011edk.1_Intron|MAP3K5_uc010kgw.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTCCCGGACTTTGTGCTTGTCC	0.495													4	3	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150123751	150123751	+	Intron	DEL	G	-	-	rs59103152		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150123751delG	uc003qne.2	+						PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		GGCTTTTTTTGTTTGTTTGTT	0.323													3	5	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152638369	152638370	+	Intron	INS	-	T	T	rs67090957		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152638369_152638370insT	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kiz.2_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		tttcttttttcttttttttttt	0.134										HNSCC(10;0.0054)			6	4	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168885624	168885625	+	Intron	INS	-	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168885624_168885625insG	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		gggctggggaaggggaaatggg	0.000													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945272	945273	+	Intron	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945272_945273insA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aaggagaaagggaaaggagaaa	0.000													4	4	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	945326	945326	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945326delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						aggagaaaggagaaaggagaa	0.000													5	4	---	---	---	---	
AMZ1	155185	broad.mit.edu	37	7	2749072	2749073	+	Intron	INS	-	GGCCTCCCCAG	GGCCTCCCCAG	rs142816481	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2749072_2749073insGGCCTCCCCAG	uc003smr.1	+						AMZ1_uc003sms.1_Intron|AMZ1_uc011jwa.1_Intron	NM_133463	NP_597720	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity|zinc ion binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CTATCCTGTGTGGCCTCCCACC	0.629											OREG0017838	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
RSPH10B2	728194	broad.mit.edu	37	7	5984436	5984436	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5984436delA	uc003sph.1	-						RSPH10B2_uc003spg.1_Intron|RSPH10B2_uc010ktd.1_Intron|RSPH10B2_uc011jwk.1_Intron	NM_173565	NP_775836	B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B											ovary(1)|pancreas(1)|skin(1)	3						ctaaaaatacaaaaaaaaatt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	20845110	20845111	+	IGR	DEL	CA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20845110_20845111delCA								SP8 (18602 upstream) : RPL23P8 (21806 downstream)																							acacacacaccacacacacaca	0.163													4	2	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28824112	28824112	+	Intron	DEL	T	-	-	rs66535657		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28824112delT	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron|CREB5_uc003szs.2_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						AGCTATAGGATTTTTTTTTCC	0.488													4	2	---	---	---	---	
BBS9	27241	broad.mit.edu	37	7	33277909	33277910	+	Intron	DEL	TT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33277909_33277910delTT	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc011kan.1_Intron|BBS9_uc011kao.1_Intron	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			CTCAAAGGTCtttttttttttg	0.243									Bardet-Biedl_syndrome				3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	36891586	36891586	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36891586delT								AOAH (127433 upstream) : ELMO1 (2375 downstream)																							CACTTCAAGCTTGCCCCCACA	0.403													4	2	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	36950517	36950517	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36950517delC	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CTGTATTTTTCCCCCAAAATG	0.438													4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38574787	38574787	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38574787delA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						ggagttgaacaaaaaaaaaaa	0.209													13	6	---	---	---	---	
C7orf10	79783	broad.mit.edu	37	7	40617014	40617014	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40617014delT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13								transferase activity			ovary(2)	2						ttttcctggattttttttttt	0.030													3	3	---	---	---	---	
UBE2D4	51619	broad.mit.edu	37	7	43985939	43985940	+	Intron	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43985939_43985940insA	uc003tja.1	+						POLR2J4_uc003tjc.2_Intron|UBE2D4_uc003tjb.1_Intron	NM_015983	NP_057067	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)						protein K11-linked ubiquitination|protein K27-linked ubiquitination|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0						GTTTAAAAAAGAAAAAAAAAGT	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54848495	54848495	+	IGR	DEL	A	-	-	rs71561914		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54848495delA								SEC61G (21556 upstream) : EGFR (238230 downstream)																							TACACAAAGCAAAAAAAAAAA	0.269													5	5	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71431024	71431025	+	Intron	INS	-	A	A	rs150654549	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71431024_71431025insA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				atactcaatagaaaaatcagct	0.015													2	4	---	---	---	---	
GTF2IRD1	9569	broad.mit.edu	37	7	73887759	73887760	+	Intron	DEL	TT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73887759_73887760delTT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						AGCTCAGGGCtttttttttttt	0.282													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	108673649	108673649	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108673649delA								C7orf66 (149012 upstream) : EIF3IP1 (925635 downstream)																							TCTCCAAAATAAAAAAAAAGG	0.358													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	109054001	109054001	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109054001delA								C7orf66 (529364 upstream) : EIF3IP1 (545283 downstream)																							gtgaaatgataaaaaacagat	0.114													4	2	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114229407	114229408	+	Intron	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114229407_114229408insA	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						TAGATTTCTTTAAAAAAAAAGC	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142046492	142046493	+	Intron	INS	-	G	G			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142046492_142046493insG	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		GAGGAGTTCCTGGAGGTTTTAT	0.386													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148729222	148729222	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148729222delA								PDIA4 (3440 upstream) : ZNF786 (37511 downstream)																							GCCAGGCGATAAAAGGTTTAG	0.308													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151944708	151944708	+	Intron	DEL	T	-	-	rs113407913		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151944708delT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ACTAAAAGAATTTTTAAAGTT	0.264			N		medulloblastoma								4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151976776	151976776	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151976776delC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GAAACATCTGCTAAAAAAAAT	0.368			N		medulloblastoma								6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158778697	158778698	+	IGR	INS	-	A	A	rs143866567	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158778697_158778698insA								WDR60 (39815 upstream) : LOC154822 (22347 downstream)																							ATGATATTGGCAAAAAAAAAGG	0.441													4	3	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6334558	6334558	+	Intron	DEL	A	-	-	rs35023439		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6334558delA	uc003wqi.2	+							NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		TTAGATAAGCaaaaaaaaaat	0.274													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	15743824	15743827	+	IGR	DEL	CTAA	-	-	rs34170419		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15743824_15743827delCTAA								TUSC3 (121831 upstream) : MSR1 (221561 downstream)																							ACAAGTGGCGCTAACTGACAAAGC	0.348													3	3	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32326885	32326885	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32326885delC	uc003xip.2	+							NM_013962	NP_039256	Q02297	NRG1_HUMAN	neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTGGGACTGTCGGACCTCAGG	0.463													4	2	---	---	---	---	
WHSC1L1	54904	broad.mit.edu	37	8	38189346	38189355	+	Intron	DEL	CAAAACAAAA	-	-	rs71842910		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38189346_38189355delCAAAACAAAA	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_Intron	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			actcttgtctcaaaacaaaacaaaacaaaa	0.076			T	NUP98	AML								9	4	---	---	---	---	
MCM4	4173	broad.mit.edu	37	8	48887743	48887743	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48887743delT	uc003xqk.1	+						MCM4_uc003xql.1_Intron|MCM4_uc011ldi.1_Intron	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				tttTTTtttgttttttttttt	0.000													5	3	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	50977038	50977038	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50977038delT	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ccgtttgcactttttaccttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	73145923	73145923	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73145923delC	uc010lzg.2	-											Homo sapiens cDNA, FLJ99767.																		CTCTAACATGCCATGGGAACA	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	97002782	97002782	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97002782delA								C8orf37 (721345 upstream) : GDF6 (151778 downstream)																							AGCAAGTATTACAAAAGCACA	0.294													4	2	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101074574	101074574	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101074574delA	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc011lgz.1_Intron|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AATTCTGCTGAAAAAAAAAAA	0.179													8	5	---	---	---	---	
ZFPM2	23414	broad.mit.edu	37	8	106646805	106646806	+	Intron	INS	-	TGCC	TGCC	rs145935684	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106646805_106646806insTGCC	uc003ymd.2	+							NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AATTTACTTAGTGCCTTATACA	0.332													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66455714	66455714	+	Intron	DEL	G	-	-	rs111864374		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66455714delG	uc010mng.1	-						uc004aec.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		TCCTCTTGGTGCTGTGGGCCC	0.572													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68405348	68405349	+	IGR	INS	-	T	T	rs140647636		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68405348_68405349insT								FAM27B (611159 upstream) : MIR1299 (596890 downstream)																							aaaattctcaataaatgaggta	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68420736	68420736	+	IGR	DEL	G	-	-	rs145155427		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68420736delG								FAM27B (626547 upstream) : MIR1299 (581503 downstream)																							AGGTGTTGCAGAAACTGGGCA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68688108	68688109	+	IGR	DEL	AG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68688108_68688109delAG								FAM27B (893919 upstream) : MIR1299 (314130 downstream)																							CAACAAAAAAAGAAAACTGAAC	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69877812	69877812	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69877812delT								LOC100133920 (212863 upstream) : FOXD4L5 (297897 downstream)																							TTCACAGGGAtttttttttct	0.154													4	2	---	---	---	---	
TRPM3	80036	broad.mit.edu	37	9	73517902	73517903	+	Intron	DEL	GT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73517902_73517903delGT	uc004aid.2	-						TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						ACAAGGCATCGTGTGTTTTGCT	0.495													4	2	---	---	---	---	
PRUNE2	158471	broad.mit.edu	37	9	79310826	79310826	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79310826delA	uc010mpk.2	-						PRUNE2_uc004akj.3_Intron|PRUNE2_uc010mpl.1_Intron	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2						apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						tttcagatggaaaaaaaaaag	0.020													4	2	---	---	---	---	
NCBP1	4686	broad.mit.edu	37	9	100425515	100425524	+	Intron	DEL	TTATTATGAT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100425515_100425524delTTATTATGAT	uc004axq.2	+							NM_002486	NP_002477	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa						gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA cleavage|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of mRNA 3'-end processing|positive regulation of viral transcription|regulation of translational initiation|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm|ribonucleoprotein complex	protein binding|RNA cap binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.158)				AGAGTAAGCATTATTATGATTTGGTTTTGA	0.305													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	113978418	113978419	+	IGR	DEL	AT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113978418_113978419delAT								LPAR1 (176892 upstream) : OR2K2 (111345 downstream)																							taggttgtcaatttgtgctctt	0.000													7	17	---	---	---	---	
DEC1	50514	broad.mit.edu	37	9	118098586	118098587	+	Intron	INS	-	A	A	rs138702670	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118098586_118098587insA	uc004bjk.1	+						DEC1_uc004bjl.1_Intron	NM_017418	NP_059114	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1						negative regulation of cell proliferation					ovary(1)	1						gaaataatgtgaaaaaaaagga	0.168													1	5	---	---	---	---	
USP20	10868	broad.mit.edu	37	9	132633135	132633135	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132633135delT	uc004bys.2	+						USP20_uc004byr.2_Intron|USP20_uc004byt.1_Intron	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20						endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)				agtttctacattttttgttaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138340841	138340841	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138340841delT								OLFM1 (327810 upstream) : KIAA0649 (30807 downstream)																							TCGAAGGCCCTTTTTTGCTCA	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6766150	6766150	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6766150delA								PRKCQ (143912 upstream) : SFMBT2 (438099 downstream)																							taatgataataaAGAATTTAG	0.184													4	2	---	---	---	---	
NUDT5	11164	broad.mit.edu	37	10	12216930	12216931	+	Intron	INS	-	A	A	rs144188409	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12216930_12216931insA	uc001ilj.2	-						NUDT5_uc001ilk.2_Intron	NM_014142	NP_054861	Q9UKK9	NUDT5_HUMAN	nudix-type motif 5						D-ribose catabolic process|ribonucleoside diphosphate catabolic process	intracellular	ADP-ribose diphosphatase activity|magnesium ion binding			ovary(1)|pancreas(1)	2		Renal(717;0.228)				TGGTGGCCATTAGGGGACTCCC	0.500													3	6	---	---	---	---	
OPTN	10133	broad.mit.edu	37	10	13154860	13154861	+	Intron	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13154860_13154861insT	uc001ilu.1	+						OPTN_uc001ilv.1_Intron|OPTN_uc001ilw.1_Intron|OPTN_uc001ilx.1_Intron|OPTN_uc001ily.1_Intron|OPTN_uc010qbr.1_Intron|OPTN_uc001ilz.1_Intron	NM_001008213	NP_001008214	Q96CV9	OPTN_HUMAN	optineurin						cell death|Golgi ribbon formation|Golgi to plasma membrane protein transport|protein targeting to Golgi|signal transduction	perinuclear region of cytoplasm|trans-Golgi network	protein C-terminus binding			ovary(2)	2						AAGCTGTAGTCTTTTTTTTTTT	0.302													4	2	---	---	---	---	
NSUN6	221078	broad.mit.edu	37	10	18834658	18834658	+	3'UTR	DEL	T	-	-	rs34407644		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18834658delT	uc010qcp.1	-	11					NSUN6_uc001iqb.2_5'Flank	NM_182543	NP_872349	Q8TEA1	NSUN6_HUMAN	NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2						AAAAAAAAAATCTTTTAAAAA	0.323													7	4	---	---	---	---	
CREM	1390	broad.mit.edu	37	10	35464374	35464374	+	Intron	DEL	A	-	-	rs78388179		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35464374delA	uc001iyb.2	+						CREM_uc001ixx.2_Intron|CREM_uc001ixy.2_Intron|CREM_uc001ixz.2_Intron|CREM_uc001iya.2_Intron|CREM_uc001iyc.2_Intron|CREM_uc001iyd.2_Intron|CREM_uc001iye.2_Intron|CREM_uc001iyf.2_Intron|CREM_uc001iyg.2_Intron|CREM_uc001iyh.2_5'Flank|CREM_uc001iyi.2_5'Flank|CREM_uc001iyj.2_5'Flank|CREM_uc001iyk.2_5'Flank	NM_181571	NP_853549	Q03060	CREM_HUMAN	cAMP responsive element modulator isoform a						cell differentiation|multicellular organismal development|signal transduction|spermatogenesis	nucleus	cAMP response element binding protein binding|protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						actccgtctcaaaaaaaaaag	0.174													4	4	---	---	---	---	
ANKRD30A	91074	broad.mit.edu	37	10	37504947	37504947	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37504947delT	uc001iza.1	+							NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						agaggagaggttttttttttt	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38705589	38705589	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38705589delT								SEPT7L (13809 upstream) : LOC399744 (11485 downstream)																							TTGATATCCCTTTTTCTTTTT	0.318													4	2	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51466157	51466157	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51466157delA	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|AGAP7_uc001jio.2_Intron	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		ctgtctttacaaaaaaaaaag	0.000													3	3	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55798071	55798071	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55798071delA	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TATACTGTATAAAGGTGTttg	0.164										HNSCC(58;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	60649682	60649682	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60649682delA								BICC1 (60837 upstream) : PHYHIPL (286666 downstream)																							tctcatgcgtaaaatgaggat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86761904	86761904	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86761904delT								FAM190B (483628 upstream) : GRID1 (597408 downstream)																							CCACATCTGATTTTTTTTTTG	0.398													4	2	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88819233	88819234	+	Intron	INS	-	A	A	rs35013042		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88819233_88819234insA	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TTCTATTTAGGAAAAAAAAAAA	0.327													4	2	---	---	---	---	
IFIT1B	439996	broad.mit.edu	37	10	91142772	91142772	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91142772delT	uc001kgh.2	+						LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron	NM_001010987	NP_001010987	Q5T764	IFT1B_HUMAN	interferon-induced protein with								binding				0						AGAAGACAGGTTTTGCAGTGT	0.418													4	2	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105185436	105185436	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105185436delT	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TGCAAGAttcttttttttttc	0.184													4	3	---	---	---	---	
C10orf79	80217	broad.mit.edu	37	10	105956911	105956911	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105956911delT	uc001kxw.2	-						C10orf79_uc001kxx.3_Intron|C10orf79_uc001kxy.1_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217												0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		CTAATTAGTATTAGAAAAGTA	0.214													4	2	---	---	---	---	
VTI1A	143187	broad.mit.edu	37	10	114258296	114258296	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114258296delA	uc001kzy.2	+						VTI1A_uc001kzz.2_Intron	NM_145206	NP_660207	Q96AJ9	VTI1A_HUMAN	SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		CTTCTTTCttaaaaaaaaaat	0.303													6	3	---	---	---	---	
GFRA1	2674	broad.mit.edu	37	10	118028752	118028752	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118028752delA	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)		TTTAATGTGGAAAAAAAAAAA	0.398													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	119992794	119992794	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119992794delA								CASC2 (23135 upstream) : C10orf84 (75778 downstream)																							atttccctagaaaaaaatgac	0.119													4	2	---	---	---	---	
KNDC1	85442	broad.mit.edu	37	10	135022930	135022931	+	Intron	DEL	GT	-	-	rs142395560		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135022930_135022931delGT	uc001llz.1	+							NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		ggcgggtatagtgtgtgtgtgc	0.104													4	3	---	---	---	---	
SYCE1	93426	broad.mit.edu	37	10	135368147	135368147	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135368147delT	uc009ybn.2	-						CYP2E1_uc001lnl.1_Intron|SYCE1_uc001lnm.2_Intron|SYCE1_uc001lnn.2_Intron	NM_001143763	NP_001137235	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1						cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TCatttttaatttttttttta	0.398													4	2	---	---	---	---	
PDE3B	5140	broad.mit.edu	37	11	14876895	14876895	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14876895delA	uc001mln.2	+						PDE3B_uc010rcr.1_Intron	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						gattttgtttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
LUZP2	338645	broad.mit.edu	37	11	24639969	24639969	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24639969delC	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2						gcctactgggcctttgttggc	0.000													4	2	---	---	---	---	
TRAF6	7189	broad.mit.edu	37	11	36514141	36514141	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36514141delG	uc001mwr.1	-	7	1056	c.716delC	c.(715-717)CCAfs	p.P239fs	TRAF6_uc001mws.1_Frame_Shift_Del_p.P239fs	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	239	Interaction with TAX1BP1.|TRAF-type 2.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)				GCATGGAATTGGGGCTGTAGG	0.323													422	207	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	38213044	38213044	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38213044delT								None (None upstream) : None (None downstream)																							TTGTTTCTTGTTTTTTTTTTT	0.378													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49009777	49009777	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49009777delA								OR4A47 (498505 upstream) : FOLH1 (158411 downstream)																							ACATTTTTTTAATTTCACtat	0.274													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	59211770	59211770	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59211770delA								OR5A1 (181 upstream) : OR4D6 (12664 downstream)																							ATAGATAGCCAAAAAGGGAAG	0.353													6	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	67583919	67583924	+	IGR	DEL	TGTATA	-	-	rs112406289		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67583919_67583924delTGTATA								LOC645332 (11112 upstream) : UNC93B1 (174651 downstream)																							tgtgtgtgtgtgtatatatatatata	0.000													4	2	---	---	---	---	
NUMA1	4926	broad.mit.edu	37	11	71728543	71728544	+	Intron	INS	-	A	A	rs143789109	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71728543_71728544insA	uc001orl.1	-						NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Intron|NUMA1_uc001orm.1_Intron|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Intron|NUMA1_uc001oro.1_Intron|NUMA1_uc009ysy.1_3'UTR|NUMA1_uc001orp.2_3'UTR|NUMA1_uc001orq.2_3'UTR	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1						G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						ATTGACTGGGGAAAAAAAAAAT	0.228			T	RARA	APL								1	6	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76893731	76893732	+	Intron	INS	-	A	A	rs141456150	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76893731_76893732insA	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CTCCTCTGCAGAAAAAGGATCC	0.559													6	3	---	---	---	---	
CCDC83	220047	broad.mit.edu	37	11	85595184	85595184	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85595184delG	uc001pbh.1	+						CCDC83_uc001pbg.1_Intron|CCDC83_uc001pbi.1_Intron|CCDC83_uc001pbj.1_Intron	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83											skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				GGCTGAGCATGGGGATGTGTC	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112652883	112652883	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112652883delA								PTS (512206 upstream) : NCAM1 (179112 downstream)																							tgaaacagacaaaaaaaaata	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113510968	113510968	+	IGR	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113510968delG								DRD2 (164555 upstream) : TMPRSS5 (47301 downstream)																							AAGGTGAGATGGGGGAGAGGG	0.433													4	2	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118391366	118391366	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118391366delA	uc001pta.2	+						MLL_uc001ptb.2_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		actccatctcaaaaaaaaaaG	0.194			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								5	5	---	---	---	---	
FOXRED1	55572	broad.mit.edu	37	11	126141134	126141135	+	Intron	INS	-	AAGG	AAGG	rs141438450	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126141134_126141135insAAGG	uc001qdi.2	+						SRPR_uc001qdh.2_5'Flank|SRPR_uc010sbm.1_5'Flank|FOXRED1_uc010sbn.1_Intron|FOXRED1_uc010sbo.1_Intron|FOXRED1_uc010sbp.1_Intron|FOXRED1_uc010sbq.1_Intron|FOXRED1_uc001qdj.2_Intron|FOXRED1_uc010sbr.1_Intron|FOXRED1_uc001qdk.2_5'UTR	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CAATGCATGAAGAGACTGATGG	0.342													3	3	---	---	---	---	
TIRAP	114609	broad.mit.edu	37	11	126161276	126161276	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126161276delC	uc001qdm.1	+						TIRAP_uc001qdl.1_Intron|TIRAP_uc009zcb.1_Intron|TIRAP_uc001qdn.1_Intron|TIRAP_uc001qdo.1_Intron	NM_001039661	NP_001034750	P58753	TIRAP_HUMAN	Toll-interleukin 1 receptor domain-containing						3'-UTR-mediated mRNA stabilization|cellular response to bacterial lipopeptide|cellular response to lipoteichoic acid|defense response to Gram-positive bacterium|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|myeloid cell differentiation|negative regulation of growth of symbiont in host|positive regulation of B cell proliferation|positive regulation of chemokine (C-X-C motif) ligand 1 production|positive regulation of chemokine (C-X-C motif) ligand 2 production|positive regulation of ERK1 and ERK2 cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-12 production|positive regulation of interleukin-15 production|positive regulation of interleukin-6 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of JNK cascade|positive regulation of neutrophil chemotaxis|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein homodimerization activity|positive regulation of toll-like receptor 2 signaling pathway|positive regulation of toll-like receptor 3 signaling pathway|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|regulation of interferon-beta production|response to lipopolysaccharide|TIRAP-dependent toll-like receptor 4 signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway	endocytic vesicle|intrinsic to membrane|ruffle membrane	phosphatidylinositol-4,5-bisphosphate binding|protein binding, bridging|protein heterodimerization activity|protein homodimerization activity|protein kinase C delta binding|Toll-like receptor 2 binding|Toll-like receptor 4 binding|transmembrane receptor activity			ovary(1)	1	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		CTTATGGAGTCCCATACTCCA	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	128077877	128077877	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128077877delT								None (None upstream) : ETS1 (250779 downstream)																							TCTAGACCTATTTTTTTTCTT	0.413													4	2	---	---	---	---	
CCDC77	84318	broad.mit.edu	37	12	522112	522112	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:522112delT	uc001qig.2	+						CCDC77_uc009zdk.2_Intron|CCDC77_uc010sdp.1_Intron|CCDC77_uc010sdq.1_Intron	NM_032358	NP_115734	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77 isoform a							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			GTTGCttttcttttttttttt	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	2874315	2874316	+	IGR	DEL	AC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2874315_2874316delAC								CACNA1C (67200 upstream) : FKBP4 (29792 downstream)																							cacatcacagacacacacacac	0.000													4	2	---	---	---	---	
CLEC4D	338339	broad.mit.edu	37	12	8666083	8666083	+	5'Flank	DEL	T	-	-	rs112268689		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8666083delT	uc001qun.2	+							NM_080387	NP_525126	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D						innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)					CTCAATTTCCTTTTTTTTTTT	0.343													4	4	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31595513	31595513	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31595513delT	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron|DENND5B_uc001rkj.2_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						TGTTTTTTTCTTTTTTTTTTT	0.279													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	58989443	58989444	+	Intron	INS	-	CA	CA	rs138081526	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58989443_58989444insCA	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																		ATGGTGGGGACGAGTCCTCTCT	0.401													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68064043	68064043	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68064043delT								DYRK2 (7600 upstream) : IFNG (484507 downstream)																							accctgtttatttttttttta	0.000													5	3	---	---	---	---	
ZDHHC17	23390	broad.mit.edu	37	12	77239826	77239826	+	Intron	DEL	T	-	-	rs57863212		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77239826delT	uc001syk.1	+							NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						GGAGGCAAAATTTTTTTTTTC	0.363													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80661815	80661815	+	IGR	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80661815delC								PPP1R12A (332580 upstream) : PTPRQ (176311 downstream)																							TGTGCCTCCTCCCCAGGCCCA	0.353													4	2	---	---	---	---	
ANKS1B	56899	broad.mit.edu	37	12	100289448	100289448	+	Intron	DEL	A	-	-	rs5800388		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100289448delA	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		taccaaccacaaaaaaaacag	0.179													2	4	---	---	---	---	
CHST11	50515	broad.mit.edu	37	12	105064247	105064248	+	Intron	INS	-	CC	CC	rs139927200	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105064247_105064248insCC	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883	Q9NPF2	CHSTB_HUMAN	carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0						ATATGTTCAGACCcacacacac	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	112597545	112597545	+	IGR	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112597545delG								TRAFD1 (6138 upstream) : C12orf51 (567 downstream)																							TGGAACAGTAGGAGGGGACAA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124599937	124599938	+	IGR	INS	-	A	A	rs149355690	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124599937_124599938insA								ZNF664 (99970 upstream) : FAM101A (173772 downstream)																							GGAGGCTGAAGAAAAAAAAAAG	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128402267	128402267	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128402267delC	uc001uhq.2	+						uc001uhr.2_Intron					Homo sapiens cDNA clone IMAGE:5274197.																		TTGGGTTGGGCCCCTGGGATA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	128696881	128696881	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128696881delA								None (None upstream) : TMEM132C (202410 downstream)																							AATGATTAAGAAAAAAAATGG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130470239	130470239	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130470239delT								TMEM132D (82027 upstream) : LOC100190940 (47760 downstream)																							ACACTAACTCTTTAGAAAAGT	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19158992	19158993	+	IGR	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19158992_19158993insT								None (None upstream) : LOC284232 (249550 downstream)																							ttggactacccttgtgaaaata	0.000													4	3	---	---	---	---	
FAM48A	55578	broad.mit.edu	37	13	37618503	37618503	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37618503delA	uc001uwg.2	-						FAM48A_uc010abt.2_Intron|FAM48A_uc001uwh.2_Intron|FAM48A_uc001uwi.2_Intron|FAM48A_uc001uwj.2_Intron|FAM48A_uc001uwk.2_Intron|FAM48A_uc010tes.1_Intron|FAM48A_uc001uwl.1_Intron	NM_001014286	NP_001014308	Q8NEM7	FA48A_HUMAN	family with sequence similarity 48, member A						autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)		CTTAAGGGGGAAAAAAAAAAC	0.313													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	61421464	61421464	+	IGR	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61421464delG								TDRD3 (273452 upstream) : PCDH20 (562357 downstream)																							tgaggctctaggggaaaatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79603454	79603454	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79603454delT								RNF219 (368754 upstream) : RBM26 (290646 downstream)																							AAAAACATTATTTTTAAAAGT	0.308													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	94508783	94508783	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94508783delT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGCAAAAATATTTGCACAGTT	0.343													4	2	---	---	---	---	
ERCC5	2073	broad.mit.edu	37	13	103513652	103513652	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103513652delT	uc001vpw.2	+						ERCC5_uc001vpu.1_Intron|ERCC5_uc010tjb.1_Intron|ERCC5_uc010tjc.1_Intron|ERCC5_uc010tjd.1_Intron	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein						negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GTATTCATGATTTTTTTTTGC	0.144			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	104029063	104029063	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104029063delA								SLC10A2 (309867 upstream) : None (None downstream)																							ATGGTCCAGGAAAAAAAAATC	0.338													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	109186973	109186973	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109186973delA								TNFSF13B (227609 upstream) : MYO16 (61527 downstream)																							CTTCTACATTAAAAAAAAACC	0.373													5	3	---	---	---	---	
ADPRHL1	113622	broad.mit.edu	37	13	114088341	114088342	+	Intron	INS	-	G	G	rs143712724	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114088341_114088342insG	uc001vtq.1	-						ADPRHL1_uc001vtp.1_Intron	NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1						protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)			GCCACTCAAGTCCTGCAGCAGA	0.416													3	3	---	---	---	---	
SCFD1	23256	broad.mit.edu	37	14	31152719	31152719	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31152719delC	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		GCCCATGGGACCCCCAGCGGC	0.587													4	2	---	---	---	---	
BAZ1A	11177	broad.mit.edu	37	14	35311418	35311418	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35311418delA	uc001wsk.2	-						BAZ1A_uc001wsl.2_Intron|BAZ1A_uc001wsm.1_Intron	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A						chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		ACCTTCAAAGAAAAAAAAAGG	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	46432183	46432183	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:46432183delT								C14orf106 (709578 upstream) : RPL10L (688039 downstream)																							actgatctTGTTTTTTTCCCT	0.199													4	2	---	---	---	---	
VIPAR	63894	broad.mit.edu	37	14	77907716	77907716	+	Intron	DEL	T	-	-	rs34716621		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77907716delT	uc001xtt.1	-						VIPAR_uc001xtu.1_Intron|VIPAR_uc010tvj.1_Intron|VIPAR_uc001xtv.1_Intron	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894						endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1						TTGGTTGTTGTTTTTTTTTTT	0.358													1	5	---	---	---	---	
TSHR	7253	broad.mit.edu	37	14	81563267	81563268	+	Intron	INS	-	GTGT	GTGT	rs147149121	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81563267_81563268insGTGT	uc001xvd.1	+						TSHR_uc001xvb.1_Intron|TSHR_uc001xvc.2_Intron|TSHR_uc010tvs.1_Intron	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TTTTCTCCCTGgtgtgtgtgtg	0.351			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						4	2	---	---	---	---	
ITPK1	3705	broad.mit.edu	37	14	93581341	93581361	+	Intron	DEL	CACCGGGCTCGGGCCGGGGGT	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93581341_93581361delCACCGGGCTCGGGCCGGGGGT	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		AATGAGGCTGCACCGGGCTCGGGCCGGGGGTCACCGGGCTc	0.552													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106770438	106770439	+	Splice_Site	INS	-	CT	CT			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106770438_106770439insCT	uc010tyt.1	-	442		c.15776_splice	c.e442-1							Parts of antibodies, mostly variable regions.												0						CCTGGCCCAGCCTCTCTTGGCT	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31691724	31691725	+	Intron	INS	-	C	C			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31691724_31691725insC	uc001zfp.1	+											Homo sapiens cDNA FLJ36439 fis, clone THYMU2012401.																		GCCCTTGGTTTCCCAGAGCCAT	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	46001944	46001944	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46001944delT								SQRDL (18466 upstream) : None (None downstream)																							TTCTCTCCACtttttatttgg	0.239													4	2	---	---	---	---	
NEO1	4756	broad.mit.edu	37	15	73343576	73343578	+	5'Flank	DEL	ACC	-	-	rs148096264		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73343576_73343578delACC	uc002avm.3	+						NEO1_uc010ukx.1_5'Flank|NEO1_uc010uky.1_5'Flank|NEO1_uc010ukz.1_5'Flank	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						ACGCCTATCAACCACCAAACGTG	0.365													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95899807	95899808	+	IGR	INS	-	A	A	rs138965148	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95899807_95899808insA								MCTP2 (872627 upstream) : LOC145820 (76514 downstream)																							ACCATCACATTAAAAAAAAACC	0.248													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97388906	97388906	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97388906delT								SPATA8 (60062 upstream) : LOC91948 (896940 downstream)																							GTCCTTATCCTTCTTTGCCTG	0.383													4	2	---	---	---	---	
LOC146336	146336	broad.mit.edu	37	16	1120386	1120386	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1120386delG	uc002cko.2	-							NR_027242				SubName: Full=cDNA FLJ32252 fis, clone PROST1000167, weakly similar to SYNAPSIN I;												0						GCAGGCTGTTGGGGGCAGCGG	0.652													4	2	---	---	---	---	
EMP2	2013	broad.mit.edu	37	16	10626598	10626598	+	3'UTR	DEL	T	-	-	rs67718108		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10626598delT	uc002czx.2	-	5						NM_001424	NP_001415	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation	integral to membrane					0						CTCTTTTGGAttttttttttc	0.279													4	7	---	---	---	---	
C16orf62	57020	broad.mit.edu	37	16	19602875	19602875	+	Intron	DEL	A	-	-	rs35875567		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19602875delA	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron|C16orf62_uc010vas.1_Intron|C16orf62_uc002dgm.1_Intron	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020							integral to membrane				ovary(1)	1						ccatctctacaaaaaaaaaaa	0.114													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26407156	26407156	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26407156delA								HS3ST4 (258148 upstream) : C16orf82 (671063 downstream)																							tccagcatccagcatccagca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32851409	32851409	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32851409delA								TP53TG3B (162531 upstream) : SLC6A10P (37388 downstream)																							tgctgaggagagctttacttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33537914	33537914	+	IGR	DEL	A	-	-	rs111565786		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33537914delA								SLC6A10P (641451 upstream) : MIR1826 (427594 downstream)																							AGCTGAGTGTAAAAAAAGTCA	0.338													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33976750	33976750	+	IGR	DEL	A	-	-	rs151149529		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33976750delA								MIR1826 (11158 upstream) : UBE2MP1 (427052 downstream)																							gcctatggtgaaaaaaggaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34180389	34180389	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34180389delT								MIR1826 (214797 upstream) : UBE2MP1 (223413 downstream)																							ccctttgtcattttgaaatgt	0.070													6	3	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53100329	53100329	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53100329delA	uc002egy.2	+							NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TACCAGCCTTAAAAAATGTAC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55282796	55282797	+	IGR	DEL	TG	-	-	rs35088518		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55282796_55282797delTG								IRX5 (314403 upstream) : IRX6 (75674 downstream)																							tgtgtgtgtttgtgtgtgtgtg	0.218													4	2	---	---	---	---	
OGFOD1	55239	broad.mit.edu	37	16	56501343	56501343	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56501343delT	uc002ejb.2	+						OGFOD1_uc002ejc.2_Intron	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase								iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)	tttttcttccttttttttttt	0.149													12	7	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70211512	70211512	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70211512delT	uc002exy.2	+						CLEC18C_uc010vlt.1_Intron|CLEC18C_uc002eyk.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						TTAGttttacttttttttttt	0.219													6	4	---	---	---	---	
ANKRD11	29123	broad.mit.edu	37	16	89444851	89444851	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89444851delA	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AATTCTTGATAATAATTTCAA	0.259													4	2	---	---	---	---	
FANCA	2175	broad.mit.edu	37	16	89833967	89833967	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89833967delT	uc002fou.1	-						FANCA_uc010vpn.1_Intron|FANCA_uc010vpo.1_5'Flank	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform						DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		ttgttagtgctttttttttga	0.000			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6972699	6972699	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6972699delA								SLC16A11 (25457 upstream) : CLEC10A (5158 downstream)																							TTTTTCTTGCAAAAAAAAGAC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21518703	21518704	+	IGR	INS	-	A	A	rs150372573	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21518703_21518704insA								C17orf51 (40972 upstream) : FAM27L (306666 downstream)																							TTCAAGGAATCAAAAAATGAAA	0.218													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25283826	25283827	+	IGR	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25283826_25283827insT								None (None upstream) : WSB1 (337279 downstream)																							gagctaaattgtttcctctata	0.005													6	3	---	---	---	---	
NLK	51701	broad.mit.edu	37	17	26449400	26449400	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26449400delT	uc010crj.2	+						NLK_uc010cri.1_Intron	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase						intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TAGACAGGGATTTTTTTTTTT	0.338													4	3	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	31845515	31845515	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31845515delG	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	catcagatctgggtgggttcc	0.124													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36357576	36357577	+	Intron	INS	-	AAGA	AAGA			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36357576_36357577insAAGA	uc010cvk.2	-						TBC1D3_uc010wdn.1_Intron	NM_001123391	NP_001116863	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GATGGAGAGAGAAGAAAGTCCT	0.411													4	2	---	---	---	---	
CCR7	1236	broad.mit.edu	37	17	38718037	38718038	+	Intron	INS	-	TC	TC			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38718037_38718038insTC	uc002huw.2	-							NM_001838	NP_001829	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7 precursor						cell maturation|immunological synapse formation|inflammatory response|interleukin-12 secretion|lymphocyte migration into lymph node|positive regulation of dendritic cell antigen processing and presentation|positive regulation of glycoprotein biosynthetic process|positive regulation of humoral immune response|positive regulation of hypersensitivity|positive regulation of interleukin-12 production|positive regulation of neutrophil chemotaxis|regulation of interferon-gamma production|regulation of interleukin-1 beta secretion|T cell costimulation	integral to membrane|intracellular	C-C chemokine receptor activity|chemokine (C-C motif) ligand 19 binding|chemokine (C-C motif) ligand 21 binding			breast(1)	1		Breast(137;0.000496)				AACACAACTTTTCTCTCTCTCT	0.510													4	2	---	---	---	---	
ACLY	47	broad.mit.edu	37	17	40048933	40048933	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40048933delT	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				AAGCCTTGCCttttttttttc	0.264													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44908362	44908362	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44908362delA								WNT3 (12280 upstream) : WNT9B (20606 downstream)																							ctcattgttGAAAATGAGTAA	0.015													4	2	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49134089	49134090	+	Intron	INS	-	T	T			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49134089_49134090insT	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CCCCTAAACAGTTTTTTTTTTA	0.317													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	50357214	50357214	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50357214delT								CA10 (119837 upstream) : None (None downstream)																							atttatagtcttttttttttt	0.000													6	3	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57746520	57746520	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57746520delA	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTAAAAGAAGAAAAAAAAAAT	0.284			T	ALK|TFE3	ALCL|renal 								8	4	---	---	---	---	
MAP2K6	5608	broad.mit.edu	37	17	67494428	67494431	+	Intron	DEL	ACAA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67494428_67494431delACAA	uc002jij.2	+						MAP2K6_uc002jii.2_Intron	NM_002758	NP_002749	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)					GTAaaacaagacaaacaaacaaac	0.167													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70379069	70379069	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70379069delA								SOX9 (256517 upstream) : SLC39A11 (263017 downstream)																							GTAGCAAAGGAAAAAAAAAAA	0.423													3	4	---	---	---	---	
METRNL	284207	broad.mit.edu	37	17	81052554	81052554	+	3'UTR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81052554delT	uc002kgh.2	+	4					METRNL_uc002kgi.2_3'UTR	NM_001004431	NP_001004431	Q641Q3	METRL_HUMAN	meteorin, glial cell differentiation							extracellular region					0	Breast(20;0.000443)|all_neural(118;0.0779)		BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			AGTTATTATATTTTTTTTTGG	0.428													4	2	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8261143	8261143	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8261143delC	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				TTTCGAGGGACCAGCTGAGTC	0.468													4	2	---	---	---	---	
GNAL	2774	broad.mit.edu	37	18	11857133	11857133	+	Intron	DEL	A	-	-	rs66532953		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11857133delA	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_5'Flank	NM_001142339	NP_001135811	P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						CCCAGATGTTAAAAAAAAAAA	0.318													3	3	---	---	---	---	
ANKRD29	147463	broad.mit.edu	37	18	21213851	21213852	+	Intron	INS	-	A	A	rs148190832	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21213851_21213852insA	uc002kun.2	-						ANKRD29_uc002kuo.2_Intron	NM_173505	NP_775776	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29											ovary(3)|breast(1)	4	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGTTTCTATATAAAAAAAGCCC	0.218													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	31357067	31357068	+	IGR	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31357067_31357068insA								ASXL3 (29668 upstream) : NOL4 (74002 downstream)																							CATTAATAATGGATGAATATCT	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	31357071	31357072	+	IGR	DEL	GA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31357071_31357072delGA								ASXL3 (29672 upstream) : NOL4 (73998 downstream)																							AATAATGGATGAATATCTATGG	0.292													4	2	---	---	---	---	
C18orf21	83608	broad.mit.edu	37	18	33558575	33558575	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33558575delA	uc002kzc.2	+						C18orf21_uc002kzd.2_Intron	NM_031446	NP_113634	Q32NC0	CR021_HUMAN	chromosome 18 open reading frame 21												0						ctccgtctccaaaaaaaaaaa	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65223890	65223891	+	IGR	INS	-	T	T	rs151192971	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65223890_65223891insT								DSEL (39923 upstream) : None (None downstream)																							ctgtttgtctatttttttttgc	0.000													2	6	---	---	---	---	
CCDC102B	79839	broad.mit.edu	37	18	66513890	66513892	+	Intron	DEL	ATT	-	-	rs144161618		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66513890_66513892delATT	uc002lkk.2	+						CCDC102B_uc002lki.2_Intron|CCDC102B_uc002lkj.1_Intron	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B											ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				TATATTGGTCATTATTTATTTTC	0.261													6	7	---	---	---	---	
HSD11B1L	374875	broad.mit.edu	37	19	5681632	5681635	+	Intron	DEL	TCCA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5681632_5681635delTCCA	uc002mck.2	+						C19orf70_uc002mch.1_5'Flank|C19orf70_uc002mci.1_5'Flank|HSD11B1L_uc002mcj.2_Intron|HSD11B1L_uc002mcu.2_Intron|HSD11B1L_uc002mcl.2_Intron|HSD11B1L_uc002mcm.2_Intron|HSD11B1L_uc002mcq.2_Intron|HSD11B1L_uc002mcr.2_Intron|HSD11B1L_uc002mcs.2_Intron|HSD11B1L_uc010dug.2_Intron|HSD11B1L_uc002mct.2_Intron|HSD11B1L_uc002mco.2_Intron|HSD11B1L_uc002mcn.2_Intron|HSD11B1L_uc002mcp.2_Intron	NM_198533	NP_940935	Q7Z5J1	DHI1L_HUMAN	short-chain dehydrogenase/reductase 10 isoform							extracellular region	binding|oxidoreductase activity				0						catctatccgtccatccatccatc	0.000													3	3	---	---	---	---	
ZNF44	51710	broad.mit.edu	37	19	12363548	12363548	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12363548delA	uc002mtl.2	-						ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_Intron|ZNF44_uc002mtn.3_Intron			P15621	ZNF44_HUMAN	Homo sapiens GIOT-2 mRNA for gonadotropin inducible transcription repressor-2, complete cds.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		aaaatagtgtaaaaaaaaaaa	0.070													4	2	---	---	---	---	
CD97	976	broad.mit.edu	37	19	14499040	14499040	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14499040delA	uc002myl.2	+						CD97_uc002mym.2_Intron|CD97_uc002myn.2_Intron	NM_078481	NP_510966	P48960	CD97_HUMAN	CD97 antigen isoform 1 precursor						cell adhesion|cell-cell signaling|cellular component movement|immune response|inflammatory response|neuropeptide signaling pathway	extracellular space|integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(3)|breast(1)	4						agcctgtgtcaaaaaaaaaac	0.209													4	2	---	---	---	---	
SLC25A42	284439	broad.mit.edu	37	19	19211867	19211867	+	Intron	DEL	C	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19211867delC	uc002nlf.1	+						SLC25A42_uc010xqn.1_Intron	NM_178526	NP_848621	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			AATGGAAACTCCAACCTGATG	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	41332936	41332937	+	IGR	INS	-	A	A			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41332936_41332937insA								EGLN2 (18600 upstream) : CYP2A6 (16507 downstream)																							GTTGGCAACACACACACAGCAC	0.530													4	2	---	---	---	---	
GRIK5	2901	broad.mit.edu	37	19	42558300	42558301	+	Intron	DEL	AG	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42558300_42558301delAG	uc002osj.1	-						GRIK5_uc010eib.1_Intron	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor							cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	AGACTCAGAAAGAGAGAGAGAG	0.535													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4650900	4650900	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4650900delT								ADRA1D (421241 upstream) : PRNP (15897 downstream)																							CCGTATGTCCTTCCTGCTCAA	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26078136	26078136	+	IGR	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26078136delG								FAM182A (10584 upstream) : C20orf191 (5917 downstream)																							CAGCAGCTCTGGGACCCTGGA	0.358													5	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29617220	29617220	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29617220delG	uc010ztk.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron					RecName: Full=Protein FRG1B;												0						ttttagtacaggggtattcaa	0.000													4	2	---	---	---	---	
COMMD7	149951	broad.mit.edu	37	20	31316255	31316260	+	Intron	DEL	ACACAC	-	-	rs112717200		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31316255_31316260delACACAC	uc002wya.3	-						COMMD7_uc010ged.2_Intron|COMMD7_uc002wyb.2_Intron	NM_053041	NP_444269	Q86VX2	COMD7_HUMAN	COMM domain containing 7 isoform 1						negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1						agacagacatacacacacacacacac	0.262													4	2	---	---	---	---	
DNMT3B	1789	broad.mit.edu	37	20	31387738	31387741	+	Intron	DEL	TAGT	-	-	rs145092112		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31387738_31387741delTAGT	uc002wyc.2	+						DNMT3B_uc010zty.1_Intron|DNMT3B_uc002wyd.2_Intron|DNMT3B_uc002wye.2_Intron|DNMT3B_uc010gee.2_Intron|DNMT3B_uc010gef.2_Intron|DNMT3B_uc010ztz.1_Intron|DNMT3B_uc010zua.1_Intron|DNMT3B_uc002wyf.2_Intron|DNMT3B_uc002wyg.2_Intron|DNMT3B_uc010geg.2_5'Flank|DNMT3B_uc010geh.2_5'Flank	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						GGAGATAAACTAGTTAACAACTAC	0.363													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37401401	37401401	+	IGR	DEL	A	-	-	rs11476502		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37401401delA								ACTR5 (312 upstream) : PPP1R16B (32947 downstream)																							GAAGAAAGATAAGACTGGAGG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44056080	44056081	+	IGR	INS	-	GTG	GTG	rs143824542	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44056080_44056081insGTG								PIGT (1196 upstream) : WFDC2 (42313 downstream)																							GGACTTAACACGTGTTCCTTAT	0.505													5	3	---	---	---	---	
TCFL5	10732	broad.mit.edu	37	20	61491080	61491080	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61491080delT	uc002ydp.2	-						TCFL5_uc002ydo.2_Intron|TCFL5_uc002ydq.2_Intron	NM_006602	NP_006593	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 protein						cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)					tgtttttttgttttttttttt	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10705770	10705770	+	IGR	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10705770delA								None (None upstream) : TPTE (200973 downstream)																							gagcagttcgaaaacagtctt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10763129	10763130	+	IGR	INS	-	AA	AA	rs142173047		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10763129_10763130insAA								None (None upstream) : TPTE (143613 downstream)																							tctgctccatcaagaaaagatc	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11062343	11062344	+	Intron	INS	-	AG	AG	rs148978863		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11062343_11062344insAG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGTAAAAGACAGCAACTTTCA	0.208													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11087766	11087766	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11087766delT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAGACTGTATTTTTTATGGA	0.134													7	5	---	---	---	---	
TMPRSS15	5651	broad.mit.edu	37	21	19662112	19662112	+	Intron	DEL	C	-	-	rs35335139		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19662112delC	uc002ykw.2	-							NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor						proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TGCCCACCCACGTGACTGCAT	0.234													4	2	---	---	---	---	
HUNK	30811	broad.mit.edu	37	21	33346634	33346634	+	Intron	DEL	C	-	-	rs113469359		TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33346634delC	uc002yph.2	+							NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase						multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						aatacttcagcaaaaaaaaaa	0.000													4	2	---	---	---	---	
IFNGR2	3460	broad.mit.edu	37	21	34805378	34805379	+	Intron	DEL	AA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34805378_34805379delAA	uc002yrp.3	+						IFNGR2_uc002yrq.3_Intron|IFNGR2_uc010gma.2_Intron|IFNGR2_uc002yrr.3_Intron|TMEM50B_uc002yrs.1_Intron	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	tttttggtagaaacagggtttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40310917	40310918	+	IGR	DEL	TC	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40310917_40310918delTC								ETS2 (114041 upstream) : PSMG1 (236472 downstream)																							tttctgcagttctagaggctgg	0.030													4	2	---	---	---	---	
HSF2BP	11077	broad.mit.edu	37	21	45025034	45025035	+	Intron	DEL	CA	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45025034_45025035delCA	uc002zdi.2	-						HSF2BP_uc011aey.1_Intron	NM_007031	NP_008962	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding						spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)		tcagacacaccacacacacacc	0.114													4	2	---	---	---	---	
MICAL3	57553	broad.mit.edu	37	22	18355180	18355180	+	Intron	DEL	G	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18355180delG	uc002zng.3	-						MICAL3_uc011agl.1_Intron|MICAL3_uc002znh.2_Intron|MICAL3_uc002znj.1_Intron|MICAL3_uc002znk.1_Intron|MICAL3_uc002znl.1_Intron|MICAL3_uc002znm.2_Intron|MICAL3_uc010grf.2_Intron	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		AGGGATGGGAGGGGCATGATG	0.527													4	2	---	---	---	---	
TOP3B	8940	broad.mit.edu	37	22	22326532	22326532	+	Intron	DEL	A	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22326532delA	uc002zvs.2	-						TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTTTTGGACCAAAAAAAAAAG	0.289													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35119653	35119654	+	IGR	INS	-	AG	AG	rs77514368	by1000genomes	TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35119653_35119654insAG								LARGE (801069 upstream) : ISX (342475 downstream)																							tattcagacactgtgaggaaca	0.079													4	4	---	---	---	---	
NCF4	4689	broad.mit.edu	37	22	37260746	37260746	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37260746delT	uc003apy.3	+						NCF4_uc003apz.3_Intron	NM_000631	NP_000622	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4 isoform 1						cell communication|immune response|oxidation-reduction process	cytosol|NADPH oxidase complex	phosphatidylinositol binding|protein dimerization activity			ovary(1)	1						CTTTTTCCAGTtttttttttc	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	101801664	101801664	+	IGR	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101801664delT								TMSB15A (29965 upstream) : NXF4 (3229 downstream)																							TTGTTTTTAATTTTTTTGTGA	0.398													6	3	---	---	---	---	
XIAP	331	broad.mit.edu	37	X	123022776	123022776	+	Intron	DEL	T	-	-			TCGA-CZ-5467-01A-01D-1501-10	TCGA-CZ-5467-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123022776delT	uc010nqu.2	+						XIAP_uc004etx.2_Intron|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4						anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						AGATTATCCCttttttttttt	0.169									X-linked_Lymphoproliferative_syndrome				6	3	---	---	---	---	
