Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
AGRN	375790	broad.mit.edu	37	1	985444	985444	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:985444delG	uc001ack.1	+							NM_198576	NP_940978			agrin precursor						axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)														---	---	---	---
GNB1	2782	broad.mit.edu	37	1	1750962	1750962	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1750962delT	uc001aif.2	-						GNB1_uc009vky.2_Intron	NM_002074	NP_002065			guanine nucleotide-binding protein, beta-1						cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	2629838	2629838	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2629838delC								MMEL1 (65357 upstream) : ACTRT2 (308208 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	2765680	2765680	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2765680delC								MMEL1 (201199 upstream) : ACTRT2 (172366 downstream)																																			---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3098294	3098295	+	Intron	INS	-	CA	CA	rs149978104	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3098294_3098295insCA	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3253552	3253553	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3253552_3253553delTG	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
AJAP1	55966	broad.mit.edu	37	1	4728383	4728384	+	Intron	DEL	TG	-	-	rs71580280		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4728383_4728384delTG	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943			adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)														---	---	---	---
AJAP1	55966	broad.mit.edu	37	1	4754239	4754240	+	Intron	INS	-	CAGTCTG	CAGTCTG	rs145693833	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4754239_4754240insCAGTCTG	uc001alm.1	+						AJAP1_uc001aln.2_Intron	NM_001042478	NP_001035943			adherens junction associated protein 1						cell adhesion	adherens junction|apical plasma membrane|basolateral plasma membrane|integral to membrane				lung(1)	1	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	5172511	5172512	+	IGR	INS	-	ATGGGG	ATGGGG	rs146133507	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5172511_5172512insATGGGG								AJAP1 (328661 upstream) : NPHP4 (750358 downstream)																																			---	---	---	---
CHD5	26038	broad.mit.edu	37	1	6221406	6221406	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6221406delG	uc001amb.1	-							NM_015557	NP_056372			chromodomain helicase DNA binding protein 5						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)														---	---	---	---
ESPN	83715	broad.mit.edu	37	1	6501920	6501920	+	Intron	DEL	C	-	-	rs113472511		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6501920delC	uc001amy.2	+							NM_031475	NP_113663			espin						sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	6907065	6907066	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6907065_6907066insT	uc001aoi.2	+						CAMTA1_uc001aoh.2_Intron	NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7469597	7469598	+	Intron	INS	-	A	A	rs139164551	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7469597_7469598insA	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7613864	7613864	+	Intron	DEL	C	-	-	rs35083227		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7613864delC	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	9265679	9265679	+	IGR	DEL	T	-	-	rs111332932		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9265679delT								MIR34A (53843 upstream) : H6PD (29184 downstream)																																			---	---	---	---
SPSB1	80176	broad.mit.edu	37	1	9361600	9361601	+	Intron	INS	-	CCT	CCT	rs144801831	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9361600_9361601insCCT	uc010oae.1	+							NM_025106	NP_079382			splA/ryanodine receptor domain and SOCS box						intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	10863030	10863030	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10863030delT								CASZ1 (6323 upstream) : C1orf127 (143503 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	11004026	11004027	+	IGR	INS	-	A	A	rs145696204	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11004026_11004027insA								CASZ1 (147319 upstream) : C1orf127 (2506 downstream)																																			---	---	---	---
MTOR	2475	broad.mit.edu	37	1	11178676	11178678	+	Intron	DEL	TTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11178676_11178678delTTT	uc001asd.2	-						MTOR_uc001asc.2_Intron	NM_004958	NP_004949			FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---
NPPA	4878	broad.mit.edu	37	1	11906969	11906969	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11906969delC	uc001ati.2	-						CLCN6_uc010oav.1_Intron|CLCN6_uc010oaw.1_Intron|CLCN6_uc010oax.1_Intron|CLCN6_uc010oay.1_Intron|CLCN6_uc010oaz.1_Intron|CLCN6_uc010oba.1_Intron	NM_006172	NP_006163			natriuretic peptide precursor A preproprotein						cGMP biosynthetic process|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size	extracellular region	hormone activity			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.04e-06)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|Kidney(185;0.000733)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PRAMEF11	440560	broad.mit.edu	37	1	12889170	12889171	+	Intron	INS	-	TTCT	TTCT	rs141644713	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12889170_12889171insTTCT	uc001auk.2	-							NM_001146344	NP_001139816			PRAME family member 11												0																		---	---	---	---
PRAMEF5	343068	broad.mit.edu	37	1	13051905	13051906	+	Intron	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13051905_13051906insC	uc001aur.2	-							NM_001013407	NP_001013425			PRAME family member 5												0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PRDM2	7799	broad.mit.edu	37	1	14117239	14117240	+	Intron	INS	-	TGG	TGG	rs144854811	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14117239_14117240insTGG	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363			retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)														---	---	---	---
PRDM2	7799	broad.mit.edu	37	1	14145040	14145041	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14145040_14145041insT	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron|PRDM2_uc001avl.1_5'Flank	NM_012231	NP_036363			retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)														---	---	---	---
TMEM51	55092	broad.mit.edu	37	1	15479260	15479260	+	5'UTR	DEL	G	-	-	rs35890014		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15479260delG	uc001avw.3	+	1					C1orf126_uc001avv.3_5'Flank|C1orf126_uc009voh.2_5'Flank|TMEM51_uc010obk.1_5'UTR|TMEM51_uc001avz.2_5'Flank|TMEM51_uc001avy.2_5'Flank|TMEM51_uc001avx.2_5'Flank	NM_001136216	NP_001129688			transmembrane protein 51							integral to membrane					0		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)												OREG0013124	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	16440416	16440416	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16440416delA								FAM131C (40289 upstream) : EPHA2 (10416 downstream)																																			---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16951775	16951776	+	Intron	INS	-	ATT	ATT	rs139363602	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16951775_16951776insATT	uc010ocf.1	-						CROCCL1_uc009vov.1_Intron|CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	17015710	17015710	+	IGR	DEL	T	-	-	rs112604834		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17015710delT								MST1P2 (38796 upstream) : ESPNP (2003 downstream)																																			---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17193441	17193442	+	Intron	INS	-	T	T	rs145637472	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17193441_17193442insT	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17195763	17195763	+	Intron	DEL	A	-	-	rs68102505		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17195763delA	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18581353	18581356	+	Intron	DEL	CATC	-	-	rs72010934		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18581353_18581356delCATC	uc001bau.1	+							NM_032880	NP_116269			immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	18774151	18774152	+	IGR	INS	-	ACAC	ACAC	rs147080604	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18774151_18774152insACAC								IGSF21 (69175 upstream) : KLHDC7A (33272 downstream)																																			---	---	---	---
PAX7	5081	broad.mit.edu	37	1	19020268	19020269	+	Intron	INS	-	GC	GC	rs142412200	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19020268_19020269insGC	uc001bay.2	+						PAX7_uc001baz.2_Intron|PAX7_uc010oct.1_Intron	NM_002584	NP_002575			paired box 7 isoform 1						anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)				T	FOXO1A	alveolar rhabdomyosarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	20200635	20200636	+	IGR	INS	-	CAT	CAT	rs55934105		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20200635_20200636insCAT								RNF186 (58864 upstream) : OTUD3 (8252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	20505705	20505706	+	IGR	INS	-	TG	TG	rs139820513	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20505705_20505706insTG								PLA2G2C (4018 upstream) : UBXN10 (6872 downstream)																																			---	---	---	---
VWA5B1	127731	broad.mit.edu	37	1	20617670	20617671	+	Intron	DEL	TA	-	-	rs71843717		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20617670_20617671delTA	uc009vps.2	+						VWA5B1_uc001bdd.2_Intron|VWA5B1_uc010odc.1_Intron	NM_001039500	NP_001034589			von Willebrand factor A domain containing 5B1							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	20870418	20870419	+	IGR	INS	-	A	A	rs75995255		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20870418_20870419insA								MUL1 (35744 upstream) : FAM43B (8513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	22478575	22478576	+	IGR	INS	-	T	T	rs71589748		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22478575_22478576insT								WNT4 (8190 upstream) : ZBTB40 (299768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	23013465	23013465	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23013465delA								C1QB (25437 upstream) : EPHB2 (23866 downstream)																																			---	---	---	---
EPHB2	2048	broad.mit.edu	37	1	23212251	23212251	+	Intron	DEL	T	-	-	rs11338643		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23212251delT	uc009vqj.1	+						EPHB2_uc001bge.2_Intron|EPHB2_uc001bgf.2_Intron|EPHB2_uc010odu.1_Intron	NM_017449	NP_059145			ephrin receptor EphB2 isoform 1 precursor						axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)										Hereditary_Prostate_Cancer				---	---	---	---
HMGCL	3155	broad.mit.edu	37	1	24131367	24131367	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24131367delC	uc001bib.2	-						HMGCL_uc010oec.1_Intron|HMGCL_uc009vqr.2_Intron|HMGCL_uc001bic.2_Intron|HMGCL_uc009vqs.1_Intron	NM_000191	NP_000182			3-hydroxy-3-methylglutaryl CoA lyase isoform 1						acetoacetic acid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA lyase activity|metal ion binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)														---	---	---	---
CNR2	1269	broad.mit.edu	37	1	24230669	24230669	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24230669delT	uc001bif.2	-							NM_001841	NP_001832			cannabinoid receptor 2 (macrophage)						behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)													---	---	---	---
SRRM1	10250	broad.mit.edu	37	1	24967068	24967069	+	5'Flank	INS	-	A	A	rs34007436		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24967068_24967069insA	uc001bjm.2	+						SRRM1_uc010oel.1_5'Flank|SRRM1_uc009vrh.1_5'Flank	NM_005839	NP_005830			serine/arginine repetitive matrix 1						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytosol|nuclear matrix|nuclear speck	DNA binding|protein binding|RNA binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	25562010	25562011	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25562010_25562011insA								SYF2 (2997 upstream) : C1orf63 (6730 downstream)																																			---	---	---	---
TMEM50A	23585	broad.mit.edu	37	1	25675174	25675175	+	Intron	INS	-	A	A	rs57543271		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25675174_25675175insA	uc001bke.2	+						TMEM50A_uc010oeq.1_Intron|TMEM50A_uc009vrr.2_Intron|TMEM50A_uc009vrs.2_Intron	NM_014313	NP_055128			small membrane protein 1							endoplasmic reticulum|integral to membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;3.47e-27)|Colorectal(126;1.1e-08)|COAD - Colon adenocarcinoma(152;7.48e-07)|STAD - Stomach adenocarcinoma(196;0.00035)|BRCA - Breast invasive adenocarcinoma(304;0.00047)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|GBM - Glioblastoma multiforme(114;0.00106)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.204)														---	---	---	---
TMEM57	55219	broad.mit.edu	37	1	25814984	25814984	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25814984delT	uc001bkk.2	+						TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron	NM_018202	NP_060672			transmembrane protein 57							axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
MAN1C1	57134	broad.mit.edu	37	1	26005481	26005482	+	Intron	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26005481_26005482delAG	uc001bkm.2	+						MAN1C1_uc009vry.1_Intron	NM_020379	NP_065112			mannosidase, alpha, class 1C, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)														---	---	---	---
C1orf135	79000	broad.mit.edu	37	1	26186959	26186960	+	5'Flank	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186959_26186960insT	uc001bkw.1	-							NM_024037	NP_076942			aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	27382383	27382385	+	IGR	DEL	TTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27382383_27382385delTTC								FAM46B (43050 upstream) : SLC9A1 (42916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	30798780	30798780	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30798780delC								None (None upstream) : MATN1 (385346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31128790	31128791	+	IGR	INS	-	T	T	rs144223262	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128790_31128791insT								None (None upstream) : MATN1 (55335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31561168	31561169	+	IGR	INS	-	A	A	rs74885952		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31561168_31561169insA								PUM1 (22405 upstream) : NKAIN1 (91424 downstream)																																			---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34004076	34004077	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34004076_34004077delGT	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
EIF2C3	192669	broad.mit.edu	37	1	36453368	36453368	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36453368delA	uc001bzp.2	+						EIF2C3_uc001bzq.2_Intron	NM_024852	NP_079128			eukaryotic translation initiation factor 2C, 3						mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	38760816	38760821	+	IGR	DEL	ATGTGT	-	-	rs74411996		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38760816_38760821delATGTGT								POU3F1 (248366 upstream) : RRAGC (544194 downstream)																																			---	---	---	---
RRAGC	64121	broad.mit.edu	37	1	39323638	39323639	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39323638_39323639insA	uc001ccq.2	-						RRAGC_uc010oim.1_Intron|RRAGC_uc001ccr.2_Intron	NM_022157	NP_071440			Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
RHBDL2	54933	broad.mit.edu	37	1	39371738	39371739	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39371738_39371739insA	uc001ccu.1	-						RHBDL2_uc010oin.1_Intron|RHBDL2_uc010oio.1_Intron	NM_017821	NP_060291			rhomboid protease 2						proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)															---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39948488	39948488	+	Intron	DEL	C	-	-	rs61698509		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39948488delC	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cde.1_Intron|MACF1_uc001cdf.1_Intron|MACF1_uc001cdg.2_Intron|MACF1_uc001cdh.2_Intron	NM_033044	NP_149033			microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40286963	40286963	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40286963delA								BMP8B (32430 upstream) : TRIT1 (19745 downstream)																																			---	---	---	---
TRIT1	54802	broad.mit.edu	37	1	40351811	40351811	+	5'Flank	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40351811delG	uc010oiz.1	-						TRIT1_uc001ceq.2_5'Flank|TRIT1_uc001cek.2_5'Flank|TRIT1_uc009vvx.2_5'Flank|TRIT1_uc001cel.2_5'Flank|TRIT1_uc001cem.2_5'Flank|TRIT1_uc001cen.2_5'Flank|TRIT1_uc001ceo.2_5'Flank|TRIT1_uc001cep.2_5'Flank	NM_017646	NP_060116			tRNA isopentenyltransferase 1 precursor						tRNA processing	mitochondrion	ATP binding|metal ion binding|tRNA dimethylallyltransferase activity			ovary(1)	1	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40760704	40760705	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40760704_40760705insT								ZMPSTE24 (849 upstream) : COL9A2 (5458 downstream)																																			---	---	---	---
ZNF642	339559	broad.mit.edu	37	1	40952093	40952096	+	Intron	DEL	CCTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40952093_40952096delCCTT	uc001cfo.2	+						ZNF642_uc009vwb.2_Intron|ZNF642_uc010ojk.1_Intron	NM_198494	NP_940896			zinc finger protein 642						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	41419058	41419059	+	IGR	INS	-	T	T	rs78328076		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41419058_41419059insT								CITED4 (91040 upstream) : CTPS (25948 downstream)																																			---	---	---	---
SCMH1	22955	broad.mit.edu	37	1	41603116	41603117	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41603116_41603117delCA	uc001cgo.2	-						SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Intron|SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgs.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron|SCMH1_uc010ojs.1_Intron	NM_001031694	NP_001026864			sex comb on midleg 1 isoform 1						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	41840685	41840685	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41840685delT								SCMH1 (132897 upstream) : EDN2 (103764 downstream)																																			---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42028265	42028266	+	Intron	INS	-	CTTC	CTTC	rs140344828		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42028265_42028266insCTTC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
HIVEP3	59269	broad.mit.edu	37	1	42372506	42372506	+	Intron	DEL	T	-	-	rs71784460		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42372506delT	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001chb.1_Intron	NM_024503	NP_078779			human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)																---	---	---	---
CCDC30	728621	broad.mit.edu	37	1	43099921	43099922	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43099921_43099922delAA	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron	NM_001080850	NP_001074319			coiled-coil domain containing 30												0																		---	---	---	---
RNF220	55182	broad.mit.edu	37	1	44967828	44967831	+	Intron	DEL	CTCA	-	-	rs28684546	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44967828_44967831delCTCA	uc001clv.1	+						RNF220_uc001clw.1_Intron|RNF220_uc010okx.1_Intron|RNF220_uc010oky.1_Intron	NM_018150	NP_060620			ring finger protein 220						protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
TMEM69	51249	broad.mit.edu	37	1	46157214	46157214	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46157214delA	uc001cor.1	+							NM_016486	NP_057570			transmembrane protein 69							integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
CYP4Z2P	163720	broad.mit.edu	37	1	47332641	47332641	+	Intron	DEL	A	-	-	rs34700016		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47332641delA	uc001cqo.1	-							NR_002788				Homo sapiens cDNA FLJ40054 fis, clone TBAES2000315, weakly similar to CYTOCHROME P450 4A1 (EC 1.14.15.3).												0																		---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49432744	49432745	+	Intron	DEL	AC	-	-	rs71715136		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49432744_49432745delAC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
FAF1	11124	broad.mit.edu	37	1	51042750	51042750	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51042750delT	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron|FAF1_uc010onc.1_Intron	NM_007051	NP_008982			FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)														---	---	---	---
TTC39A	22996	broad.mit.edu	37	1	51790926	51790927	+	5'Flank	INS	-	A	A	rs113824158		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51790926_51790927insA	uc001csl.2	-						TTC39A_uc001csk.2_5'Flank|TTC39A_uc010ond.1_Intron|TTC39A_uc010one.1_Intron|TTC39A_uc010onf.1_Intron|TTC39A_uc001csn.2_Intron|TTC39A_uc001cso.1_Intron|TTC39A_uc009vyy.1_Intron	NM_001080494	NP_001073963			tetratricopeptide repeat domain 39A isoform 2								binding			skin(1)	1																		---	---	---	---
ZFYVE9	9372	broad.mit.edu	37	1	52810258	52810259	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52810258_52810259insT	uc001cto.2	+						ZFYVE9_uc001ctp.2_Intron	NM_004799	NP_004790			zinc finger, FYVE domain containing 9 isoform 3						endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8																		---	---	---	---
DHCR24	1718	broad.mit.edu	37	1	55353498	55353498	+	5'Flank	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55353498delG	uc001cyc.1	-						DHCR24_uc010ook.1_5'Flank	NM_014762	NP_055577			24-dehydrocholesterol reductase precursor						anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1																		---	---	---	---
TMEM61	199964	broad.mit.edu	37	1	55443992	55443992	+	5'Flank	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55443992delG	uc001cyd.2	+							NM_182532	NP_872338			transmembrane protein 61							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	55708754	55708755	+	IGR	DEL	AC	-	-	rs137977471		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55708754_55708755delAC								USP24 (27992 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	56609259	56609259	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56609259delT								USP24 (928497 upstream) : PPAP2B (351174 downstream)																																			---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58062165	58062166	+	Intron	INS	-	T	T	rs112582451		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58062165_58062166insT	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58413348	58413349	+	Intron	INS	-	G	G	rs144925897	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58413348_58413349insG	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	59108246	59108246	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59108246delA								TACSTD2 (65080 upstream) : MYSM1 (17344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	59676814	59676816	+	IGR	DEL	TGA	-	-	rs331632	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59676814_59676816delTGA								LOC729467 (64335 upstream) : FGGY (85809 downstream)																																			---	---	---	---
C1orf87	127795	broad.mit.edu	37	1	60519253	60519257	+	Intron	DEL	TGATA	-	-	rs146070128		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60519253_60519257delTGATA	uc001czs.1	-							NM_152377	NP_689590			hypothetical protein LOC127795								calcium ion binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	61498281	61498281	+	IGR	DEL	T	-	-	rs111819290		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61498281delT								C1orf87 (958855 upstream) : NFIA (44665 downstream)																																			---	---	---	---
TM2D1	83941	broad.mit.edu	37	1	62167229	62167230	+	Intron	DEL	GT	-	-	rs66799538		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62167229_62167230delGT	uc001czz.1	-							NM_032027	NP_114416			beta-amyloid binding protein precursor						apoptosis					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	63800144	63800147	+	IGR	DEL	TTTC	-	-	rs58291773	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63800144_63800147delTTTC								FOXD3 (9347 upstream) : ALG6 (33114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	64908284	64908284	+	IGR	DEL	T	-	-	rs76464698		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64908284delT								UBE2U (198257 upstream) : CACHD1 (28192 downstream)																																			---	---	---	---
CACHD1	57685	broad.mit.edu	37	1	64941788	64941796	+	Intron	DEL	AGCAGCAGC	-	-	rs71808796		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64941788_64941796delAGCAGCAGC	uc001dbo.1	+							NM_020925	NP_065976			cache domain containing 1						calcium ion transport	integral to membrane				ovary(2)	2																		---	---	---	---
RAVER2	55225	broad.mit.edu	37	1	65211843	65211843	+	Intron	DEL	C	-	-	rs2375475	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65211843delC	uc001dbs.1	+							NM_018211	NP_060681			ribonucleoprotein, PTB-binding 2							cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)	1																		---	---	---	---
DNAJC6	9829	broad.mit.edu	37	1	65751931	65751932	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65751931_65751932insT	uc001dcd.1	+						DNAJC6_uc001dcc.1_Intron|DNAJC6_uc010opc.1_Intron	NM_014787	NP_055602			DnaJ (Hsp40) homolog, subfamily C, member 6						cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	69402508	69402509	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69402508_69402509insT								DEPDC1 (439709 upstream) : LRRC7 (630359 downstream)																																			---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70441577	70441578	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70441577_70441578insT	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	70910326	70910326	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70910326delT								CTH (5074 upstream) : PTGER3 (407710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	71521309	71521319	+	Intron	DEL	TGGCTTTTTTG	-	-	rs71986613		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71521309_71521319delTGGCTTTTTTG	uc001dfr.2	+											Homo sapiens cDNA clone IMAGE:5271818.																														---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75791948	75791948	+	Intron	DEL	T	-	-	rs67153330		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75791948delT	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	76029872	76029872	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76029872delA	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	76419781	76419782	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76419781_76419782insT								ASB17 (21665 upstream) : ST6GALNAC3 (120607 downstream)																																			---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76662154	76662154	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76662154delT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82267559	82267560	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82267559_82267560insT	uc001dit.3	+						LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Intron|LPHN2_uc001div.2_Intron|LPHN2_uc009wcd.2_Intron	NM_012302	NP_036434			latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	85108557	85108560	+	IGR	DEL	AGAA	-	-	rs149485105		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85108557_85108560delAGAA								C1orf180 (7854 upstream) : SSX2IP (1038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	85254984	85254985	+	IGR	INS	-	A	A	rs72508953		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85254984_85254985insA								SSX2IP (98544 upstream) : LPAR3 (24101 downstream)																																			---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85842399	85842400	+	Intron	INS	-	TA	TA	rs142725332	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85842399_85842400insTA	uc001dlb.2	-						DDAH1_uc001dlc.2_Intron|uc001dla.1_Intron|DDAH1_uc010osb.1_Intron|DDAH1_uc009wco.2_Intron	NM_012137	NP_036269			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	86062895	86062895	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86062895delC								CYR61 (13249 upstream) : ZNHIT6 (55597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	86642094	86642095	+	IGR	DEL	GC	-	-	rs72718017	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86642094_86642095delGC								COL24A1 (19648 upstream) : ODF2L (172317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	86988499	86988499	+	IGR	DEL	T	-	-	rs148738627	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86988499delT								CLCA1 (22527 upstream) : CLCA4 (24260 downstream)																																			---	---	---	---
HS2ST1	9653	broad.mit.edu	37	1	87468180	87468180	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87468180delA	uc010osk.1	+						HS2ST1_uc001dmc.3_Intron|LOC339524_uc001dme.1_Intron	NM_012262	NP_036394			heparan sulfate 2-O-sulfotransferase 1 isoform							Golgi membrane|integral to membrane				central_nervous_system(1)	1		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	87900378	87900378	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87900378delA								LMO4 (85775 upstream) : None (None downstream)																																			---	---	---	---
PKN2	5586	broad.mit.edu	37	1	89192446	89192447	+	Intron	INS	-	T	T	rs138978085	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89192446_89192447insT	uc001dmn.2	+						PKN2_uc001dmm.1_Intron|PKN2_uc010osp.1_Intron|PKN2_uc010osq.1_Intron|PKN2_uc009wcv.2_Intron	NM_006256	NP_006247			protein kinase N2						signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	89308559	89308559	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89308559delG								PKN2 (6622 upstream) : GTF2B (9763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	90762124	90762125	+	IGR	INS	-	T	T	rs138035635	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90762124_90762125insT								ZNF326 (268030 upstream) : BARHL2 (415455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91290888	91290888	+	IGR	DEL	A	-	-	rs72395314		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91290888delA								BARHL2 (108094 upstream) : ZNF644 (89972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91540557	91540558	+	IGR	INS	-	A	A	rs75141688		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91540557_91540558insA								ZNF644 (52886 upstream) : HFM1 (185766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	94862147	94862148	+	IGR	DEL	GT	-	-	rs72382202		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94862147_94862148delGT								ARHGAP29 (121523 upstream) : ABCD3 (21785 downstream)																																			---	---	---	---
ABCD3	5825	broad.mit.edu	37	1	94907023	94907023	+	Intron	DEL	T	-	-	rs34173893		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94907023delT	uc001dqn.3	+						ABCD3_uc001dqm.3_Intron|ABCD3_uc010oto.1_Intron|ABCD3_uc010otp.1_Intron|ABCD3_uc009wdr.2_Intron	NM_002858	NP_002849			ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	97043065	97043065	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97043065delC								None (None upstream) : PTBP2 (144110 downstream)																																			---	---	---	---
PTBP2	58155	broad.mit.edu	37	1	97224213	97224213	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97224213delA	uc001drq.2	+						PTBP2_uc001drn.2_Intron|PTBP2_uc001dro.2_Intron|PTBP2_uc010otz.1_Intron|PTBP2_uc001drp.2_Intron|PTBP2_uc009wdw.2_Intron|PTBP2_uc001drr.2_Intron|PTBP2_uc010oua.1_Intron|PTBP2_uc001dru.2_Intron|PTBP2_uc001drm.2_Intron	NM_021190	NP_067013			polypyrimidine tract binding protein 2								nucleotide binding				0		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)														---	---	---	---
DPYD	1806	broad.mit.edu	37	1	98012780	98012780	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98012780delT	uc001drv.2	-							NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	99972474	99972475	+	IGR	INS	-	A	A	rs150103214	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99972474_99972475insA								LPPR4 (197338 upstream) : PALMD (138956 downstream)																																			---	---	---	---
CDC14A	8556	broad.mit.edu	37	1	100849451	100849451	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100849451delT	uc001dtg.3	+						CDC14A_uc009web.2_Intron|CDC14A_uc010oui.1_Intron|CDC14A_uc001dte.3_Intron|CDC14A_uc001dtf.2_Intron|CDC14A_uc009wed.1_Intron|CDC14A_uc009wee.2_Intron|CDC14A_uc009wec.1_Intron	NM_003672	NP_003663			CDC14 homolog A isoform 1						cell cycle|cell division|cell proliferation	centrosome|nucleus|spindle	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			large_intestine(1)	1		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	103737051	103737051	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103737051delG								COL11A1 (162999 upstream) : RNPC3 (331527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105584722	105584722	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105584722delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	106288897	106288898	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:106288897_106288898delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107822657	107822658	+	Intron	DEL	GT	-	-	rs72191658		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107822657_107822658delGT	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
SORT1	6272	broad.mit.edu	37	1	109856385	109856386	+	3'UTR	DEL	AA	-	-	rs5776974		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109856385_109856386delAA	uc001dxm.1	-	20					SORT1_uc010ovi.1_3'UTR	NM_002959	NP_002950			sortilin 1 preproprotein						endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	111394739	111394740	+	IGR	INS	-	CA	CA	rs142065304	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111394739_111394740insCA								KCNA3 (177084 upstream) : CD53 (19081 downstream)																																			---	---	---	---
KCND3	3752	broad.mit.edu	37	1	112483809	112483810	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112483809_112483810insA	uc001ebu.1	-						KCND3_uc001ebv.1_Intron	NM_004980	NP_004971			potassium voltage-gated channel, Shal-related							sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	112869299	112869300	+	IGR	INS	-	TTT	TTT	rs150306955	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112869299_112869300insTTT								KCND3 (337522 upstream) : CTTNBP2NL (69500 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	113591873	113591873	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113591873delA	uc001ede.1	-											Homo sapiens cDNA clone IMAGE:4798439.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	114765697	114765700	+	IGR	DEL	TGAA	-	-	rs111351666		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114765697_114765700delTGAA								SYT6 (69225 upstream) : TRIM33 (169701 downstream)																																			---	---	---	---
NGF	4803	broad.mit.edu	37	1	115864663	115864663	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115864663delT	uc001efu.1	-							NM_002506	NP_002497			nerve growth factor, beta polypeptide precursor						activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	115976902	115976910	+	IGR	DEL	ATCAATATA	-	-	rs71794076		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115976902_115976910delATCAATATA								NGF (96045 upstream) : VANGL1 (207664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	116482630	116482630	+	IGR	DEL	T	-	-	rs36056810		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116482630delT								NHLH2 (98883 upstream) : SLC22A15 (36489 downstream)																																			---	---	---	---
SLC22A15	55356	broad.mit.edu	37	1	116539857	116539859	+	Intron	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116539857_116539859delTTG	uc001egb.3	+						SLC22A15_uc001ega.2_Intron	NM_018420	NP_060890			solute carrier family 22, member 15						ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	117595933	117595934	+	IGR	INS	-	A	A	rs140415396		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117595933_117595934insA								CD101 (16760 upstream) : TTF2 (7015 downstream)																																			---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118554383	118554384	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118554383_118554384delAC	uc001ehk.2	-							NM_206996	NP_996879			sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119691496	119691497	+	Intron	INS	-	T	T	rs113934772		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119691496_119691497insT	uc001ehp.1	+						uc001eho.1_Intron|uc009whk.1_Intron					Homo sapiens cDNA FLJ43771 fis, clone TESTI2049553.																														---	---	---	---
ZNF697	90874	broad.mit.edu	37	1	120165030	120165031	+	3'UTR	INS	-	TCCTCAAGG	TCCTCAAGG	rs145858922	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120165030_120165031insTCCTCAAGG	uc001ehy.1	-	3						NM_001080470	NP_001073939			zinc finger protein 697						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)														---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120560007	120560008	+	Intron	INS	-	A	A	rs138352700	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120560007_120560008insA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120571063	120571064	+	Intron	INS	-	AT	AT	rs143345197	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120571063_120571064insAT	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120612003	120612004	+	Frame_Shift_Del	DEL	GG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612003_120612004delGG	uc001eik.2	-	1	273_274	c.17_18delCC	c.(16-18)CCCfs	p.P6fs	NOTCH2_uc001eil.2_Frame_Shift_Del_p.P6fs|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	6					anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	120750815	120750816	+	IGR	INS	-	G	G	rs141062385	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120750815_120750816insG								NOTCH2 (138539 upstream) : FAM72B (88189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	121117729	121117729	+	Intron	DEL	T	-	-	rs67740413		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121117729delT	uc001eis.2	+							NM_001042758	NP_001036223			SLIT-ROBO Rho GTPase activating protein 2																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	121381832	121381833	+	IGR	INS	-	T	T	rs146968468	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121381832_121381833insT								LOC647121 (68146 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142561242	142561243	+	IGR	INS	-	A	A	rs148304868		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142561242_142561243insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142663276	142663277	+	Intron	DEL	AA	-	-	rs61807144		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663276_142663277delAA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142663441	142663442	+	Intron	INS	-	A	A	rs147458002		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142663441_142663442insA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143144597	143144597	+	Intron	DEL	T	-	-	rs71270044		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143144597delT	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143174696	143174696	+	Intron	DEL	C	-	-	rs112579256		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143174696delC	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143413594	143413594	+	IGR	DEL	G	-	-	rs112862668		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143413594delG								None (None upstream) : LOC100286793 (234045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143504763	143504764	+	IGR	INS	-	A	A	rs150986294	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143504763_143504764insA								None (None upstream) : LOC100286793 (142875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143983223	143983224	+	Intron	INS	-	A	A	rs148621543		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143983223_143983224insA	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	144024726	144024730	+	Intron	DEL	TTTTT	-	-	rs67898337		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144024726_144024730delTTTTT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144853333	144853334	+	Intron	INS	-	AA	AA	rs149112816		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144853333_144853334insAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145042712	145042712	+	Intron	DEL	T	-	-	rs66720105		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145042712delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'Flank|PDE4DIP_uc001eln.3_5'Flank|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_5'Flank|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145104805	145104805	+	Intron	DEL	A	-	-	rs112695430		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145104805delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145219643	145219643	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145219643delT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	147392377	147392381	+	IGR	DEL	AGAAC	-	-	rs5777663		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147392377_147392381delAGAAC								GJA8 (10984 upstream) : GPR89B (8125 downstream)																																			---	---	---	---
GPR89B	51463	broad.mit.edu	37	1	147413544	147413545	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147413544_147413545insA	uc001epv.3	+						GPR89B_uc010ozs.1_Intron|GPR89B_uc010ozt.1_Intron|GPR89B_uc010ozu.1_Intron|GPR89B_uc001epw.3_Intron|GPR89B_uc010ozv.1_Intron|GPR89B_uc001epx.3_5'Flank	NM_016334	NP_057418			G protein-coupled receptor 89B						intracellular pH reduction|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein transport	Golgi cisterna membrane|Golgi-associated vesicle membrane|integral to membrane	signal transducer activity|voltage-gated anion channel activity				0	all_hematologic(923;0.0276)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	148844203	148844204	+	IGR	DEL	AT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148844203_148844204delAT								NBPF16 (85892 upstream) : LOC645166 (84082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148847577	148847578	+	IGR	DEL	AT	-	-	rs142173842		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148847577_148847578delAT								NBPF16 (89266 upstream) : LOC645166 (80708 downstream)																																			---	---	---	---
LOC645166	645166	broad.mit.edu	37	1	148944038	148944038	+	Intron	DEL	A	-	-	rs76811044		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148944038delA	uc010pbc.1	+						LOC645166_uc010pbd.1_Intron|LOC645166_uc009wkw.1_Intron	NR_027355				Homo sapiens cDNA, FLJ18771.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	149024639	149024639	+	IGR	DEL	A	-	-	rs111240894		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149024639delA								LOC645166 (71585 upstream) : LOC388692 (254837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149362298	149362299	+	IGR	DEL	GG	-	-	rs112653148	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149362298_149362299delGG								LOC388692 (70556 upstream) : FCGR1C (6995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150895340	150895340	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150895340delT								ARNT (46154 upstream) : SETDB1 (3475 downstream)																																			---	---	---	---
CELF3	11189	broad.mit.edu	37	1	151677297	151677298	+	Intron	DEL	GA	-	-	rs35738969	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151677297_151677298delGA	uc001eys.1	-						CELF3_uc010pdh.1_Intron|CELF3_uc001eyr.2_Intron|CELF3_uc009wmy.2_Intron|CELF3_uc009wmx.1_Intron	NM_007185	NP_009116			trinucleotide repeat containing 4						nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	mRNA binding|nucleotide binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	151999540	151999540	+	Intron	DEL	T	-	-	rs111736581		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151999540delT	uc001ezm.1	+											Homo sapiens cDNA FLJ43896 fis, clone TESTI4009752.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	152169856	152169859	+	IGR	DEL	TCTT	-	-	rs138883689		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152169856_152169859delTCTT								RPTN (38152 upstream) : HRNR (14699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152490040	152490040	+	IGR	DEL	T	-	-	rs5777813		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152490040delT								CRCT1 (1560 upstream) : LCE3E (48091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	152654065	152654066	+	IGR	DEL	AC	-	-	rs112460096		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152654065_152654066delAC								LCE2C (5018 upstream) : LCE2B (4533 downstream)																																			---	---	---	---
IL6R	3570	broad.mit.edu	37	1	154382553	154382553	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154382553delG	uc001fez.1	+						IL6R_uc001ffa.1_Intron	NM_000565	NP_000556			interleukin 6 receptor isoform 1 precursor						acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155519819	155519819	+	Intron	DEL	T	-	-	rs112994246		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155519819delT	uc009wqq.2	-						ASH1L_uc001fkt.2_Intron|ASH1L_uc009wqr.1_Intron	NM_018489	NP_060959			absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
GON4L	54856	broad.mit.edu	37	1	155806041	155806042	+	Intron	DEL	TT	-	-	rs140291845		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155806041_155806042delTT	uc001flz.2	-						GON4L_uc001fly.1_Intron|GON4L_uc009wrh.1_Intron|GON4L_uc001fma.1_Intron|GON4L_uc001fmc.2_Intron|GON4L_uc001fmd.3_Intron|GON4L_uc009wri.2_Intron	NM_001037533	NP_001032622			gon-4-like isoform a						regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)																	---	---	---	---
MEF2D	4209	broad.mit.edu	37	1	156435518	156435518	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156435518delA	uc001fpc.2	-	12					MEF2D_uc001fpb.2_3'UTR|MEF2D_uc001fpd.2_3'UTR|MEF2D_uc001fpe.1_3'UTR|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911			myocyte enhancer factor 2D						apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	157218631	157218634	+	IGR	DEL	AAAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157218631_157218634delAAAC								ETV3 (110248 upstream) : FCRL5 (264534 downstream)																																			---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158653885	158653885	+	Intron	DEL	G	-	-	rs138226465		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158653885delG	uc001fst.1	-							NM_003126	NP_003117			spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	160079193	160079193	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160079193delG								IGSF8 (10575 upstream) : ATP1A2 (6327 downstream)																																	OREG0013926	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	160420398	160420399	+	IGR	INS	-	TGTGTG	TGTGTG	rs61802582	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160420398_160420399insTGTGTG								VANGL2 (21934 upstream) : SLAMF6 (34421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	160425343	160425343	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160425343delT								VANGL2 (26879 upstream) : SLAMF6 (29477 downstream)																																			---	---	---	---
F11R	50848	broad.mit.edu	37	1	160975208	160975209	+	Intron	INS	-	CCTT	CCTT	rs148184814	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160975208_160975209insCCTT	uc009wtt.2	-						F11R_uc010pjv.1_Intron|F11R_uc001fxe.3_Intron|F11R_uc009wtu.2_Intron|F11R_uc010pjw.1_Intron|F11R_uc001fxf.3_Intron	NM_016946	NP_058642			F11 receptor precursor						blood coagulation|inflammatory response|interspecies interaction between organisms|leukocyte migration|tight junction assembly	integral to membrane|tight junction				ovary(2)	2	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	161698012	161698015	+	IGR	DEL	GGGG	-	-	rs71661065		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161698012_161698015delGGGG								FCRLB (80 upstream) : DUSP12 (21566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	161716275	161716278	+	IGR	DEL	TTTC	-	-	rs71519230		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161716275_161716278delTTTC								FCRLB (18343 upstream) : DUSP12 (3303 downstream)																																			---	---	---	---
ATF6	22926	broad.mit.edu	37	1	161783678	161783679	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161783678_161783679insT	uc001gbr.2	+						ATF6_uc001gbq.1_Intron	NM_007348	NP_031374			activating transcription factor 6						positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	163530773	163530774	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163530773_163530774delTG								NUF2 (205220 upstream) : PBX1 (998028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163847103	163847104	+	IGR	INS	-	A	A	rs76530881		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163847103_163847104insA								NUF2 (521550 upstream) : PBX1 (681698 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164692040	164692041	+	Intron	INS	-	G	G	rs143887925	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164692040_164692041insG	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	165353611	165353611	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165353611delT								LMX1A (28136 upstream) : RXRG (16740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	165900546	165900546	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165900546delT								UCK2 (23209 upstream) : FAM78B (128870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	166175986	166175986	+	IGR	DEL	T	-	-	rs67134395		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166175986delT								FAM78B (39780 upstream) : FMO9P (397167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	166466119	166466119	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166466119delA								FAM78B (329913 upstream) : FMO9P (107034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	167157129	167157138	+	IGR	DEL	TGTTTTGTTT	-	-	rs72044826	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167157129_167157138delTGTTTTGTTT								DUSP27 (58727 upstream) : POU2F1 (33005 downstream)																																			---	---	---	---
POU2F1	5451	broad.mit.edu	37	1	167306400	167306401	+	Intron	INS	-	A	A	rs36068958		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167306400_167306401insA	uc001gec.2	+						POU2F1_uc010plg.1_Intron|POU2F1_uc001ged.2_Intron|POU2F1_uc001gee.2_Intron|POU2F1_uc010plh.1_Intron|POU2F1_uc001gef.2_Intron	NM_002697	NP_002688			POU class 2 homeobox 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5																		---	---	---	---
ADCY10	55811	broad.mit.edu	37	1	167802982	167802983	+	Intron	INS	-	A	A	rs75547198		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167802982_167802983insA	uc001ger.2	-						ADCY10_uc009wvj.2_Intron|ADCY10_uc009wvk.2_Intron|ADCY10_uc010plj.1_Intron	NM_018417	NP_060887			adenylate cyclase 10						intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	168554788	168554789	+	IGR	INS	-	T	T	rs141755691	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168554788_168554789insT								XCL1 (3473 upstream) : DPT (109918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	168820951	168820952	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168820951_168820952delAC								MGC4473 (58831 upstream) : ATP1B1 (254995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170332859	170332860	+	IGR	INS	-	TGTGTG	TGTGTG	rs150660222	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170332859_170332860insTGTGTG								LOC284688 (79510 upstream) : GORAB (168403 downstream)																																			---	---	---	---
PRRX1	5396	broad.mit.edu	37	1	170700468	170700469	+	Intron	INS	-	G	G	rs143239595	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170700468_170700469insG	uc001ghf.2	+						PRRX1_uc001ghe.2_Intron	NM_022716	NP_073207			paired mesoderm homeobox 1 isoform pmx-1b							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	171583250	171583250	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171583250delA								BAT2L2 (20601 upstream) : MYOC (21309 downstream)																																			---	---	---	---
DNM3	26052	broad.mit.edu	37	1	171923191	171923191	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171923191delC	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172317891	172317891	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172317891delC	uc001gie.2	+						DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	173007249	173007249	+	IGR	DEL	A	-	-	rs35083957		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173007249delA								FASLG (371239 upstream) : TNFSF18 (3111 downstream)																																			---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174242687	174242687	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174242687delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_5'Flank	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174356685	174356685	+	Intron	DEL	T	-	-	rs5778801		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174356685delT	uc001gjx.2	+						RABGAP1L_uc009wwq.1_Intron|RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
PAPPA2	60676	broad.mit.edu	37	1	176604084	176604087	+	Intron	DEL	TAGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176604084_176604087delTAGA	uc001gkz.2	+						PAPPA2_uc001gky.1_Intron|PAPPA2_uc009www.2_Intron	NM_020318	NP_064714			pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---
ABL2	27	broad.mit.edu	37	1	179134935	179134935	+	Intron	DEL	T	-	-	rs34798552		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179134935delT	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
ABL2	27	broad.mit.edu	37	1	179158962	179158963	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179158962_179158963insT	uc001gmj.3	-						ABL2_uc010pnf.1_Intron|ABL2_uc010png.1_Intron|ABL2_uc010pnh.1_Intron|ABL2_uc009wxe.2_Intron	NM_007314	NP_009298			arg tyrosine kinase isoform b						axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---
C1orf125	126859	broad.mit.edu	37	1	179429070	179429071	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179429070_179429071delTC	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297			hypothetical protein LOC126859 isoform 1												0																		---	---	---	---
TOR1AIP1	26092	broad.mit.edu	37	1	179862401	179862401	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179862401delA	uc001gnq.2	+						TOR1AIP1_uc001gnp.1_Intron	NM_015602	NP_056417			lamina-associated polypeptide 1B							integral to membrane|nuclear inner membrane				breast(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	180483721	180483721	+	IGR	DEL	A	-	-	rs12755495		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180483721delA								ACBD6 (11699 upstream) : XPR1 (117425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	181053531	181053532	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181053531_181053532delCA								MR1 (28898 upstream) : IER5 (4106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	182080258	182080258	+	IGR	DEL	T	-	-	rs5779119		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182080258delT								ZNF648 (49411 upstream) : GLUL (271411 downstream)																																			---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183074770	183074771	+	Intron	INS	-	A	A	rs5779154		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183074770_183074771insA	uc001gpy.3	+							NM_002293	NP_002284			laminin, gamma 1 precursor						axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	185306544	185306544	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185306544delT	uc001grn.3	-											Homo sapiens clone IMAGp998D064417Q2 mRNA sequence.																														---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	185780743	185780743	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185780743delA	uc001grq.1	+							NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	186441362	186441362	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186441362delG								PDC (11123 upstream) : PTGS2 (199583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191294652	191294653	+	IGR	INS	-	A	A	rs141418185	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191294652_191294653insA								FAM5C (847893 upstream) : RGS18 (832939 downstream)																																			---	---	---	---
UCHL5	51377	broad.mit.edu	37	1	193007585	193007585	+	Intron	DEL	A	-	-	rs150374316		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193007585delA	uc001gsm.2	-						UCHL5_uc001gsn.2_Intron|UCHL5_uc001gso.2_Intron|UCHL5_uc010pov.1_Intron|UCHL5_uc001gsp.2_Intron|UCHL5_uc001gsq.2_Intron|UCHL5_uc010pow.1_Intron|UCHL5_uc010pox.1_Intron	NM_015984	NP_057068			ubiquitin carboxyl-terminal hydrolase L5						DNA recombination|DNA repair|protein deubiquitination|regulation of proteasomal protein catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytosol|Ino80 complex|proteasome complex	endopeptidase inhibitor activity|omega peptidase activity|proteasome binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	193274596	193274596	+	IGR	DEL	T	-	-	rs67665927		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193274596delT								CDC73 (50656 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	193626790	193626790	+	IGR	DEL	T	-	-	rs5779685		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193626790delT								CDC73 (402850 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195723924	195723927	+	IGR	DEL	ACAC	-	-	rs34256060		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195723924_195723927delACAC								None (None upstream) : KCNT2 (470986 downstream)																																			---	---	---	---
ZBTB41	360023	broad.mit.edu	37	1	197141236	197141237	+	Intron	DEL	TA	-	-	rs10572836		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197141236_197141237delTA	uc001gtx.1	-						ZBTB41_uc009wyz.1_Intron	NM_194314	NP_919290			zinc finger and BTB domain containing 41						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	197467215	197467216	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197467215_197467216delAC								CRB1 (19631 upstream) : DENND1B (12293 downstream)																																			---	---	---	---
DENND1B	163486	broad.mit.edu	37	1	197726483	197726483	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197726483delC	uc001guf.3	-						DENND1B_uc010ppe.1_Intron|DENND1B_uc010ppf.1_Intron|DENND1B_uc001gue.3_Intron	NM_144977	NP_659414			DENN/MADD domain containing 1B isoform 2							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198980161	198980162	+	Intron	INS	-	AC	AC	rs150656124	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198980161_198980162insAC	uc001gva.3	-											Homo sapiens, clone IMAGE:5583320, mRNA.																														---	---	---	---
CACNA1S	779	broad.mit.edu	37	1	201072372	201072373	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201072372_201072373insA	uc001gvv.2	-							NM_000069	NP_000060			calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
CACNA1S	779	broad.mit.edu	37	1	201077234	201077235	+	Intron	DEL	TT	-	-	rs111404229		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201077234_201077235delTT	uc001gvv.2	-							NM_000069	NP_000060			calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
IGFN1	91156	broad.mit.edu	37	1	201189188	201189189	+	Intron	INS	-	T	T	rs143782441	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201189188_201189189insT	uc001gwc.2	+						IGFN1_uc001gwb.2_Intron	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3																		---	---	---	---
LAD1	3898	broad.mit.edu	37	1	201362874	201362874	+	Intron	DEL	A	-	-	rs67653666		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201362874delA	uc001gwm.2	-						LAD1_uc009wzu.1_Intron	NM_005558	NP_005549			ladinin 1							basement membrane	structural molecule activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	201611819	201611821	+	IGR	DEL	TTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201611819_201611821delTTC								RPS10P7 (112217 upstream) : NAV1 (5629 downstream)																																			---	---	---	---
NAV1	89796	broad.mit.edu	37	1	201653603	201653604	+	Intron	INS	-	T	T	rs34268541		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201653603_201653604insT	uc001gwu.2	+							NM_020443	NP_065176			neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
PPP1R12B	4660	broad.mit.edu	37	1	202457853	202457854	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202457853_202457854delAC	uc001gya.1	+						PPP1R12B_uc001gxz.1_Intron|PPP1R12B_uc001gyb.1_Intron|PPP1R12B_uc001gyc.1_Intron	NM_002481	NP_002472			protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	202788399	202788400	+	5'Flank	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202788399_202788400insT	uc001gyh.2	+											Homo sapiens hypothetical protein LOC641515, mRNA (cDNA clone MGC:33633 IMAGE:4827085), complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	203405925	203405926	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203405925_203405926insA								FMOD (85636 upstream) : PRELP (38957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	203581987	203581987	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203581987delA								OPTC (103910 upstream) : ATP2B4 (13941 downstream)																																			---	---	---	---
LAX1	54900	broad.mit.edu	37	1	203744527	203744528	+	3'UTR	INS	-	C	C	rs142836373		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203744527_203744528insC	uc001haa.2	+	5					LAX1_uc010pql.1_3'UTR|LAX1_uc001hab.2_3'UTR	NM_017773	NP_060243			lymphocyte transmembrane adaptor 1 isoform a						B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)															---	---	---	---
ZC3H11A	9877	broad.mit.edu	37	1	203773281	203773281	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203773281delT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron	NM_014827	NP_055642			zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	204737738	204737741	+	IGR	DEL	CTTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204737738_204737741delCTTC								MDM4 (60077 upstream) : NFASC (60041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	205254840	205254840	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205254840delA								TMCC2 (12370 upstream) : NUAK2 (16353 downstream)																																			---	---	---	---
SLC45A3	85414	broad.mit.edu	37	1	205648814	205648815	+	Intron	DEL	AC	-	-	rs71923182		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205648814_205648815delAC	uc001hda.1	-						SLC45A3_uc010prp.1_Intron|ELK4_uc010prq.1_Intron	NM_033102	NP_149093			prostein						transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)					T	ETV1|ETV5|ELK4|ERG	prostate 								---	---	---	---
NUCKS1	64710	broad.mit.edu	37	1	205717608	205717608	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205717608delA	uc001hdb.2	-							NM_022731	NP_073568			nuclear casein kinase and cyclin-dependent							nucleus					0	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	205726393	205726394	+	IGR	DEL	TT	-	-	rs11290400		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205726393_205726394delTT								NUCKS1 (7032 upstream) : RAB7L1 (10721 downstream)																																			---	---	---	---
FAIM3	9214	broad.mit.edu	37	1	207097551	207097552	+	5'Flank	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207097551_207097552delGT	uc001hey.2	-						FAIM3_uc010prz.1_5'Flank|FAIM3_uc010psa.1_5'Flank|FAIM3_uc010psb.1_5'Flank	NM_005449	NP_005440			Fas apoptotic inhibitory molecule 3 isoform a						anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)																	---	---	---	---
FAIM3	9214	broad.mit.edu	37	1	207097707	207097708	+	5'Flank	INS	-	GT	GT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207097707_207097708insGT	uc001hey.2	-						FAIM3_uc010prz.1_5'Flank|FAIM3_uc010psa.1_5'Flank|FAIM3_uc010psb.1_5'Flank	NM_005449	NP_005440			Fas apoptotic inhibitory molecule 3 isoform a						anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	207273399	207273414	+	IGR	DEL	ATGTGTGTGTGTGTGT	-	-	rs57088528		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273399_207273414delATGTGTGTGTGTGTGT								C4BPB (64 upstream) : C4BPA (4097 downstream)																																			---	---	---	---
CR1	1378	broad.mit.edu	37	1	207749205	207749206	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207749205_207749206insT	uc001hfy.2	+						CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Intron	NM_000573	NP_000564			complement receptor 1 isoform F precursor						complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	208963964	208963964	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208963964delT								PLXNA2 (546299 upstream) : LOC642587 (638204 downstream)																																			---	---	---	---
TRAF3IP3	80342	broad.mit.edu	37	1	209943814	209943815	+	Intron	DEL	GT	-	-	rs34097069		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209943814_209943815delGT	uc001hho.2	+						TRAF3IP3_uc001hhl.2_Intron|TRAF3IP3_uc001hhm.1_Intron|TRAF3IP3_uc001hhn.2_Intron|TRAF3IP3_uc009xcr.2_Intron	NM_025228	NP_079504			TRAF3-interacting JNK-activating modulator							integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)														---	---	---	---
IRF6	3664	broad.mit.edu	37	1	209981050	209981055	+	5'Flank	DEL	ATTTGT	-	-	rs150968205		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209981050_209981055delATTTGT	uc001hhq.1	-						IRF6_uc010psm.1_5'Flank|IRF6_uc009xct.1_5'Flank	NM_006147	NP_006138			interferon regulatory factor 6						cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)											HNSCC(57;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210056854	210056854	+	IGR	DEL	A	-	-	rs5780545		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210056854delA								C1orf107 (25946 upstream) : SYT14 (54684 downstream)																																			---	---	---	---
HHAT	55733	broad.mit.edu	37	1	210594589	210594590	+	Intron	INS	-	T	T	rs143006020	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210594589_210594590insT	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron	NM_001122834	NP_001116306			hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212320361	212320362	+	IGR	DEL	TC	-	-	rs34444328		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212320361_212320362delTC								DTL (42175 upstream) : PPP2R5A (138517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	212392712	212392713	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212392712_212392713insT								DTL (114526 upstream) : PPP2R5A (66166 downstream)																																			---	---	---	---
TMEM206	55248	broad.mit.edu	37	1	212573508	212573509	+	Intron	DEL	CT	-	-	rs10563965		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212573508_212573509delCT	uc001hjc.3	-						TMEM206_uc010pte.1_Intron	NM_018252	NP_060722			transmembrane protein 206							integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212670576	212670581	+	IGR	DEL	CAACAA	-	-	rs112477542		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212670576_212670581delCAACAA								NENF (50857 upstream) : ATF3 (68116 downstream)																																			---	---	---	---
FLVCR1	28982	broad.mit.edu	37	1	213035526	213035527	+	Intron	INS	-	C	C	rs148022972	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213035526_213035527insC	uc001hjt.2	+							NM_014053	NP_054772			feline leukemia virus subgroup C cellular						cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)														---	---	---	---
RPS6KC1	26750	broad.mit.edu	37	1	213298970	213298971	+	Intron	DEL	TG	-	-	rs141623623		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213298970_213298971delTG	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556			ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)														---	---	---	---
RPS6KC1	26750	broad.mit.edu	37	1	213310364	213310364	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213310364delT	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556			ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)														---	---	---	---
RPS6KC1	26750	broad.mit.edu	37	1	213319767	213319767	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213319767delT	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556			ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)														---	---	---	---
PTPN14	5784	broad.mit.edu	37	1	214660563	214660581	+	Intron	DEL	GAAAGACAGGAATTAAAGT	-	-	rs66521861		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214660563_214660581delGAAAGACAGGAATTAAAGT	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392			protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	215112928	215112929	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215112928_215112929insT								CENPF (275016 upstream) : KCNK2 (65956 downstream)																																			---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216801161	216801161	+	Intron	DEL	T	-	-	rs67766294		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216801161delT	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429			estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216913759	216913760	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216913759_216913760delCA	uc001hky.1	-						ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217823276	217823277	+	Intron	INS	-	TT	TT	rs72464427		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217823276_217823277insTT	uc001hlh.1	+						SPATA17_uc009xdr.1_Intron|SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
TGFB2	7042	broad.mit.edu	37	1	218518423	218518426	+	5'Flank	DEL	TCCT	-	-	rs148529383		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218518423_218518426delTCCT	uc001hlm.2	+						TGFB2_uc001hll.2_5'Flank|TGFB2_uc001hln.2_5'Flank|TGFB2_uc010pue.1_5'Flank|TGFB2_uc001hlo.2_5'Flank	NM_003238	NP_003229			transforming growth factor, beta 2 isoform 2						activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219335481	219335482	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219335481_219335482insA	uc001hlp.2	-											Homo sapiens cDNA clone IMAGE:6189076.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	219649035	219649036	+	IGR	INS	-	AGAA	AGAA	rs5029261	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219649035_219649036insAGAA								LYPLAL1 (262829 upstream) : SLC30A10 (209733 downstream)																																			---	---	---	---
RAB3GAP2	25782	broad.mit.edu	37	1	220426050	220426052	+	Intron	DEL	AGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220426050_220426052delAGG	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron|RAB3GAP2_uc010pum.1_Intron	NM_012414	NP_036546			rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	221658925	221658926	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221658925_221658926delTC								LOC400804 (149287 upstream) : DUSP10 (215840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221737403	221737403	+	IGR	DEL	C	-	-	rs112958805		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221737403delC								LOC400804 (227765 upstream) : DUSP10 (137363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222027693	222027694	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222027693_222027694delCA								DUSP10 (112232 upstream) : HHIPL2 (667908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222111957	222111957	+	IGR	DEL	T	-	-	rs75536474		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222111957delT								DUSP10 (196496 upstream) : HHIPL2 (583645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222205540	222205546	+	IGR	DEL	ATTGACC	-	-	rs150829423		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222205540_222205546delATTGACC								DUSP10 (290079 upstream) : HHIPL2 (490056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	223600382	223600382	+	IGR	DEL	T	-	-	rs75944142		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223600382delT								C1orf65 (31570 upstream) : CAPN8 (114590 downstream)																																			---	---	---	---
TP53BP2	7159	broad.mit.edu	37	1	224006887	224006887	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224006887delA	uc010pvb.1	-						TP53BP2_uc001hod.2_Intron	NM_001031685	NP_001026855			tumor protein p53 binding protein, 2 isoform 1						apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)														---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225523106	225523107	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225523106_225523107delTG	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225547149	225547150	+	Intron	INS	-	T	T	rs145198324	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225547149_225547150insT	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225564672	225564673	+	Intron	INS	-	T	T	rs138724305	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225564672_225564673insT	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	225872305	225872305	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225872305delT								ENAH (31460 upstream) : SRP9 (93210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	226728328	226728329	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226728328_226728329insT	uc001hqe.1	-											Homo sapiens cDNA FLJ31294 fis, clone KIDNE2007810, weakly similar to DEOXYURIDINE 5'-TRIPHOSPHATE NUCLEOTIDOHYDROLASE (EC 3.6.1.23).																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	226951146	226951147	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226951146_226951147insT								ITPKB (24270 upstream) : PSEN2 (107126 downstream)																																			---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227189607	227189608	+	Intron	INS	-	A	A	rs147593730	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227189607_227189608insA	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Intron|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227459212	227459212	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227459212delA	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	227562776	227562777	+	IGR	INS	-	TT	TT	rs4653832	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227562776_227562777insTT								CDC42BPA (56950 upstream) : ZNF678 (188467 downstream)																																			---	---	---	---
RNF187	149603	broad.mit.edu	37	1	228679147	228679148	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228679147_228679148insT	uc001htb.2	+						RNF187_uc001htc.2_Intron	NM_001010858	NP_001010858			ring finger protein 187						positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K48-linked ubiquitination	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
ABCB10	23456	broad.mit.edu	37	1	229656261	229656261	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229656261delA	uc001htp.3	-							NM_012089	NP_036221			ATP-binding cassette, sub-family B, member 10							integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)																---	---	---	---
URB2	9816	broad.mit.edu	37	1	229776756	229776757	+	Intron	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229776756_229776757insTT	uc001hts.1	+						URB2_uc009xfd.1_Intron	NM_014777	NP_055592			URB2 ribosome biogenesis 2 homolog							nucleolus				central_nervous_system(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	230001593	230001594	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230001593_230001594insG								URB2 (205647 upstream) : GALNT2 (191942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	230667460	230667461	+	IGR	INS	-	A	A	rs142774069	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230667460_230667461insA								PGBD5 (154093 upstream) : COG2 (110741 downstream)																																			---	---	---	---
DISC1	27185	broad.mit.edu	37	1	232042843	232042844	+	Intron	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232042843_232042844insC	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	232400224	232400225	+	IGR	INS	-	TCAGG	TCAGG	rs146033041	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232400224_232400225insTCAGG								DISC1 (223208 upstream) : SIPA1L2 (133489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232790677	232790678	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232790677_232790678insA								SIPA1L2 (139434 upstream) : KIAA1383 (149960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232824742	232824745	+	IGR	DEL	GTGT	-	-	rs113675329		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232824742_232824745delGTGT								SIPA1L2 (173499 upstream) : KIAA1383 (115893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233856677	233856677	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233856677delA								KCNK1 (48419 upstream) : SLC35F3 (184002 downstream)																																			---	---	---	---
SLC35F3	148641	broad.mit.edu	37	1	234255045	234255046	+	Intron	INS	-	T	T	rs34256875		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234255045_234255046insT	uc001hvy.1	+							NM_173508	NP_775779			solute carrier family 35, member F3						transport	integral to membrane				ovary(2)	2	Ovarian(103;0.0454)	all_cancers(173;0.145)|Prostate(94;0.0885)	OV - Ovarian serous cystadenocarcinoma(106;0.00531)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	234914923	234914923	+	IGR	DEL	A	-	-	rs11314394		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234914923delA								IRF2BP2 (169652 upstream) : TOMM20 (357737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234919752	234919753	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234919752_234919753insA								IRF2BP2 (174481 upstream) : TOMM20 (352907 downstream)																																			---	---	---	---
GNG4	2786	broad.mit.edu	37	1	235759509	235759510	+	Intron	INS	-	AC	AC	rs58186840		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235759509_235759510insAC	uc001hxe.3	-						GNG4_uc009xfz.2_Intron|GNG4_uc001hxh.3_Intron	NM_001098722	NP_001092192			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)															---	---	---	---
GPR137B	7107	broad.mit.edu	37	1	236336716	236336717	+	Intron	INS	-	AGGA	AGGA	rs147488004	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236336716_236336717insAGGA	uc001hxq.2	+						GPR137B_uc001hxr.1_Intron	NM_003272	NP_003263			G protein-coupled receptor 137B							integral to plasma membrane|membrane fraction					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)															---	---	---	---
MTR	4548	broad.mit.edu	37	1	237061705	237061705	+	3'UTR	DEL	T	-	-	rs112597294		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237061705delT	uc001hyi.3	+	33					MTR_uc010pxw.1_3'UTR|MTR_uc010pxx.1_3'UTR|MTR_uc010pxy.1_3'UTR	NM_000254	NP_000245			5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	238390439	238390439	+	IGR	DEL	C	-	-	rs34274924		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238390439delC								LOC100130331 (298822 upstream) : LOC339535 (253247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238404426	238404427	+	IGR	INS	-	AA	AA	rs11429716		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238404426_238404427insAA								LOC100130331 (312809 upstream) : LOC339535 (239259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239525866	239525867	+	IGR	DEL	CA	-	-	rs140894770		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239525866_239525867delCA								LOC339535 (876549 upstream) : CHRM3 (23998 downstream)																																			---	---	---	---
CHRM3	1131	broad.mit.edu	37	1	239874993	239874993	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239874993delT	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731			cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	240244272	240244273	+	IGR	INS	-	T	T	rs34575993		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240244272_240244273insT								CHRM3 (171557 upstream) : FMN2 (10912 downstream)																																			---	---	---	---
RGS7	6000	broad.mit.edu	37	1	241265548	241265548	+	Intron	DEL	C	-	-	rs5782175		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241265548delC	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
OPN3	23596	broad.mit.edu	37	1	241764659	241764660	+	Intron	INS	-	T	T	rs34332468		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241764659_241764660insT	uc001hza.2	-						OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron	NM_014322	NP_055137			opsin 3						phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242377164	242377164	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242377164delT	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242627072	242627073	+	Intron	INS	-	A	A	rs141821774	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242627072_242627073insA	uc001hzn.1	-						PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242677915	242677916	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242677915_242677916insA	uc001hzn.1	-						PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242832278	242832278	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242832278delA								PLD5 (144280 upstream) : CEP170 (455453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	242987908	242987909	+	IGR	INS	-	T	T	rs72503247		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242987908_242987909insT								PLD5 (299910 upstream) : CEP170 (299822 downstream)																																			---	---	---	---
CEP170	9859	broad.mit.edu	37	1	243340772	243340772	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243340772delA	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron	NM_014812	NP_055627			centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)															---	---	---	---
SDCCAG8	10806	broad.mit.edu	37	1	243467375	243467375	+	Intron	DEL	A	-	-	rs147707292		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243467375delA	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron|SDCCAG8_uc001hzy.1_Intron	NM_006642	NP_006633			serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)														---	---	---	---
AKT3	10000	broad.mit.edu	37	1	243680449	243680450	+	Intron	INS	-	T	T	rs140201095	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243680449_243680450insT	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456			AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)															---	---	---	---
EFCAB2	84288	broad.mit.edu	37	1	245160828	245160828	+	Intron	DEL	T	-	-	rs67484371		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245160828delT	uc001ibd.2	+						EFCAB2_uc001ibc.2_Intron|EFCAB2_uc010pyo.1_Intron|EFCAB2_uc010pyp.1_Intron|EFCAB2_uc001ibe.2_Intron	NR_026586				RecName: Full=EF-hand calcium-binding domain-containing protein 2;								calcium ion binding				0	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245539724	245539725	+	Intron	INS	-	A	A	rs113389945		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245539724_245539725insA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245566932	245566933	+	Intron	INS	-	AT	AT	rs140721885	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245566932_245566933insAT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246625292	246625293	+	Intron	INS	-	G	G	rs141341051	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246625292_246625293insG	uc001ibl.2	-							NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	247844648	247844648	+	IGR	DEL	A	-	-	rs77810390		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247844648delA								OR13G1 (8305 upstream) : OR6F1 (30483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	248608092	248608093	+	IGR	DEL	AA	-	-	rs71761334		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248608092_248608093delAA								OR2T1 (37688 upstream) : OR2T2 (8006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	207277	207278	+	IGR	INS	-	AGGG	AGGG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207277_207278insAGGG								FAM110C (160892 upstream) : SH3YL1 (10860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	434916	434919	+	IGR	DEL	TTCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:434916_434919delTTCT								FAM150B (146608 upstream) : TMEM18 (233056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	544093	544093	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:544093delT								FAM150B (255785 upstream) : TMEM18 (123882 downstream)																																			---	---	---	---
TPO	7173	broad.mit.edu	37	2	1527332	1527332	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1527332delA	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron|TPO_uc002qwy.1_Intron|TPO_uc002qwz.2_Intron	NM_000547	NP_000538			thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)													---	---	---	---
TPO	7173	broad.mit.edu	37	2	1529324	1529325	+	Intron	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1529324_1529325insC	uc002qww.2	+						TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Intron|TPO_uc002qwr.2_Intron|TPO_uc002qwx.2_Intron|TPO_uc010yio.1_Intron|TPO_uc010yip.1_Intron|TPO_uc002qwy.1_Intron|TPO_uc002qwz.2_Intron	NM_000547	NP_000538			thyroid peroxidase isoform a						cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	1632127	1632127	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1632127delT								TPO (85629 upstream) : PXDN (3533 downstream)																																			---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1953226	1953227	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1953226_1953227delCA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2092403	2092403	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2092403delA	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc002qxf.1_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	2480354	2480354	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2480354delT								MYT1L (145309 upstream) : TSSC1 (712387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2591430	2591431	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2591430_2591431delTG								MYT1L (256385 upstream) : TSSC1 (601310 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4149090	4149091	+	IGR	INS	-	T	T	rs143579845	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4149090_4149091insT								ALLC (398832 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6400177	6400180	+	IGR	DEL	TTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6400177_6400180delTTGT								LOC400940 (271813 upstream) : CMPK2 (580323 downstream)																																			---	---	---	---
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198			UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
CMPK2	129607	broad.mit.edu	37	2	7001250	7001259	+	Intron	DEL	CACACACACC	-	-	rs57039812		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001250_7001259delCACACACACC	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198			UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	7400337	7400337	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7400337delA								RNF144A (216030 upstream) : LOC339788 (662221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8021949	8021949	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8021949delT								RNF144A (837642 upstream) : LOC339788 (40609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8227171	8227172	+	Intron	INS	-	CA	CA	rs112519316		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8227171_8227172insCA	uc010eww.1	-											Homo sapiens cDNA FLJ45673 fis, clone D9OST2003989.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	8403044	8403045	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8403044_8403045insG	uc010eww.1	-						uc002qyy.1_Intron					Homo sapiens cDNA FLJ45673 fis, clone D9OST2003989.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	8758184	8758184	+	IGR	DEL	C	-	-	rs149650643		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8758184delC								LOC339788 (641207 upstream) : ID2 (61156 downstream)																																			---	---	---	---
KIDINS220	57498	broad.mit.edu	37	2	8954413	8954413	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8954413delT	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron	NM_020738	NP_065789			kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
ASAP2	8853	broad.mit.edu	37	2	9464186	9464186	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9464186delA	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	10603690	10603690	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10603690delT								ODC1 (15237 upstream) : NOL10 (107204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	10676504	10676504	+	IGR	DEL	G	-	-	rs145653242		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10676504delG								ODC1 (88051 upstream) : NOL10 (34390 downstream)																																			---	---	---	---
NOL10	79954	broad.mit.edu	37	2	10795329	10795330	+	Intron	INS	-	T	T	rs1017146	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10795329_10795330insT	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170			nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)														---	---	---	---
GREB1	9687	broad.mit.edu	37	2	11679021	11679022	+	Intron	INS	-	TTCC	TTCC	rs139061496	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11679021_11679022insTTCC	uc002rbk.1	+						GREB1_uc002rbl.2_5'Flank	NM_014668	NP_055483			growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12146453	12146454	+	5'Flank	INS	-	G	G	rs139966505	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12146453_12146454insG	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12583593	12583593	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12583593delA	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	13227751	13227752	+	IGR	INS	-	T	T	rs112886316		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13227751_13227752insT								TRIB2 (344895 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13557242	13557243	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13557242_13557243delCT								TRIB2 (674386 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13790267	13790267	+	IGR	DEL	A	-	-	rs112542456		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13790267delA								TRIB2 (907411 upstream) : FAM84A (982589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15849163	15849164	+	Intron	DEL	CC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15849163_15849164delCC	uc002rcf.1	+											Homo sapiens cDNA FLJ36206 fis, clone TESTI2028662.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	16407935	16407935	+	IGR	DEL	T	-	-	rs78167150		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16407935delT								MYCN (320807 upstream) : FAM49A (325966 downstream)																																			---	---	---	---
FAM49A	81553	broad.mit.edu	37	2	16816758	16816758	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16816758delA	uc002rck.1	-							NM_030797	NP_110424			family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	19420588	19420589	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19420588_19420589delCT								NT5C1B (649750 upstream) : OSR1 (130658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19617452	19617453	+	IGR	INS	-	A	A	rs116580413		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19617452_19617453insA								OSR1 (59080 upstream) : TTC32 (479065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19928405	19928405	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19928405delT								OSR1 (370033 upstream) : TTC32 (168113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20681094	20681094	+	IGR	DEL	G	-	-	rs342057	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20681094delG								RHOB (31894 upstream) : HS1BP3 (136470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21604928	21604928	+	IGR	DEL	A	-	-	rs72308205		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21604928delA								APOB (337983 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22062949	22062949	+	IGR	DEL	T	-	-	rs67609039		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22062949delT								APOB (796004 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23038259	23038259	+	IGR	DEL	C	-	-	rs67867957		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23038259delC								None (None upstream) : KLHL29 (717196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23301290	23301291	+	IGR	DEL	TA	-	-	rs2018618	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23301290_23301291delTA								None (None upstream) : KLHL29 (454164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	25148553	25148556	+	IGR	DEL	TGTG	-	-	rs143582620		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25148553_25148556delTGTG								ADCY3 (6498 upstream) : DNAJC27 (17949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	25217968	25217968	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25217968delA	uc002rfv.2	+											Homo sapiens cDNA FLJ45127 fis, clone BRAWH3036951.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	25441663	25441664	+	IGR	INS	-	A	A	rs4665289		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25441663_25441664insA								POMC (50104 upstream) : DNMT3A (14182 downstream)																																			---	---	---	---
HADHA	3030	broad.mit.edu	37	2	26439186	26439187	+	Intron	INS	-	T	T	rs71399369		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26439186_26439187insT	uc002rgy.2	-						HADHA_uc010yks.1_Intron|HADHA_uc010ykt.1_Intron	NM_000182	NP_000173			mitochondrial trifunctional protein, alpha						fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)													---	---	---	---
GCKR	2646	broad.mit.edu	37	2	27738808	27738809	+	Intron	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27738808_27738809delTT	uc002rky.2	+						GCKR_uc010ezd.2_Intron|GCKR_uc010ylu.1_Intron	NM_001486	NP_001477			glucokinase regulatory protein						carbohydrate metabolic process|glucose transport|negative regulation of glucokinase activity|positive regulation of gene expression|protein import into nucleus, translocation|regulation of glucose transport|response to fructose stimulus|transmembrane transport|triglyceride homeostasis|urate metabolic process	cytosol|nucleoplasm	fructose-6-phosphate binding|protein binding			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28443979	28443980	+	Intron	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28443979_28443980delCT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
PLB1	151056	broad.mit.edu	37	2	28770069	28770070	+	Intron	INS	-	A	A	rs74619650		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28770069_28770070insA	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_5'Flank	NM_153021	NP_694566			phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	30504629	30504629	+	IGR	DEL	A	-	-	rs60827632	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30504629delA								LBH (21730 upstream) : LCLAT1 (165494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	30514351	30514354	+	IGR	DEL	AACA	-	-	rs112369011		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30514351_30514354delAACA								LBH (31452 upstream) : LCLAT1 (155769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	30542454	30542461	+	IGR	DEL	GGATGGAC	-	-	rs12997033		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30542454_30542461delGGATGGAC								LBH (59555 upstream) : LCLAT1 (127662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	31837368	31837368	+	IGR	DEL	G	-	-	rs508562		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31837368delG								SRD5A2 (31328 upstream) : MEMO1 (255528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	31852502	31852503	+	IGR	INS	-	GTGT	GTGT	rs578939	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31852502_31852503insGTGT								SRD5A2 (46462 upstream) : MEMO1 (240393 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	32070571	32070574	+	IGR	DEL	TCTT	-	-	rs71405593		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32070571_32070574delTCTT								SRD5A2 (264531 upstream) : MEMO1 (22322 downstream)																																			---	---	---	---
LOC285045	285045	broad.mit.edu	37	2	33088074	33088075	+	Intron	INS	-	TT	TT	rs141584414	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33088074_33088075insTT	uc002roo.2	+						LOC285045_uc002rop.1_Intron	NR_027098				Homo sapiens cDNA FLJ37863 fis, clone BRSSN2015907.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	34601024	34601024	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34601024delT								MYADML (647740 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34623745	34623746	+	IGR	INS	-	GT	GT	rs144074156	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34623745_34623746insGT								MYADML (670461 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34880183	34880183	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34880183delA								MYADML (926899 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	34930633	34930654	+	Intron	DEL	TTTCTCCTCCTTCTCTTCCTCC	-	-	rs143436758	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34930633_34930654delTTTCTCCTCCTTCTCTTCCTCC	uc002rpc.1	+											full-length cDNA clone CS0DI009YL06 of Placenta Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	35425082	35425082	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35425082delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36257513	36257513	+	IGR	DEL	A	-	-	rs75591224		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36257513delA								None (None upstream) : CRIM1 (325884 downstream)																																			---	---	---	---
FAM82A1	151393	broad.mit.edu	37	2	38282977	38282977	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38282977delG	uc002rqn.1	+							NM_144713	NP_653314			family with sequence similarity 82, member A1							cytoplasm|integral to membrane|microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	39676646	39676647	+	Intron	INS	-	A	A	rs77849792		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39676646_39676647insA	uc002rrq.2	+						uc002rrr.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																														---	---	---	---
TMEM178	130733	broad.mit.edu	37	2	39933764	39933765	+	Intron	INS	-	T	T	rs142212141	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39933764_39933765insT	uc002rrt.2	+						TMEM178_uc010fam.1_Intron	NM_152390	NP_689603			transmembrane protein 178 precursor							integral to membrane					0		all_hematologic(82;0.248)																---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40349339	40349340	+	Intron	INS	-	GCGT	GCGT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40349339_40349340insGCGT	uc002rrx.2	-						uc002rrw.2_Intron|SLC8A1_uc002rry.2_Intron|SLC8A1_uc002rrz.2_Intron|SLC8A1_uc002rsa.2_Intron|SLC8A1_uc002rsd.3_Intron	NM_021097	NP_066920			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	41913635	41913636	+	IGR	INS	-	GT	GT	rs115214008		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41913635_41913636insGT								None (None upstream) : PKDCC (361525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42134183	42134190	+	IGR	DEL	ACAACACA	-	-	rs145003865		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42134183_42134190delACAACACA								None (None upstream) : PKDCC (140971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42308061	42308061	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42308061delA								PKDCC (22395 upstream) : EML4 (88429 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42373019	42373020	+	IGR	DEL	GT	-	-	rs146084956		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42373019_42373020delGT								PKDCC (87353 upstream) : EML4 (23470 downstream)																																			---	---	---	---
EML4	27436	broad.mit.edu	37	2	42406181	42406182	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42406181_42406182insA	uc002rsi.2	+						EML4_uc002rsh.3_Intron|EML4_uc010fap.2_Intron	NM_019063	NP_061936			echinoderm microtubule associated protein like 4						microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250								T	ALK	NSCLC								---	---	---	---
PLEKHH2	130271	broad.mit.edu	37	2	43863479	43863480	+	5'Flank	INS	-	GAT	GAT	rs149126413	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43863479_43863480insGAT	uc010yny.1	+						PLEKHH2_uc002rte.3_5'Flank|PLEKHH2_uc002rtf.3_5'Flank	NM_172069	NP_742066			pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	44293377	44293377	+	IGR	DEL	G	-	-	rs61062797		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44293377delG								LRPPRC (70233 upstream) : PPM1B (102623 downstream)																																			---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44669304	44669304	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44669304delA	uc002rum.2	+						C2orf34_uc002rul.2_Intron	NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	48163661	48163661	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48163661delA								FBXO11 (30847 upstream) : FOXN2 (378134 downstream)																																			---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50701822	50701823	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50701822_50701823delAA	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	52454732	52454733	+	IGR	INS	-	CA	CA	rs146774101	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52454732_52454733insCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52714243	52714245	+	IGR	DEL	GTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52714243_52714245delGTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53181577	53181577	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53181577delA								None (None upstream) : ASB3 (715541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	57048453	57048456	+	IGR	DEL	AAAC	-	-	rs58180591		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57048453_57048456delAAAC								CCDC85A (435145 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	57987642	57987642	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57987642delT								None (None upstream) : VRK2 (147144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	59185581	59185582	+	Intron	DEL	AC	-	-	rs113407515		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59185581_59185582delAC	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	60257168	60257168	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60257168delG								None (None upstream) : BCL11A (421135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60457434	60457435	+	IGR	INS	-	TGTG	TGTG	rs142861521	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60457434_60457435insTGTG								None (None upstream) : BCL11A (220868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60550706	60550711	+	IGR	DEL	GTGTGT	-	-	rs67709427		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60550706_60550711delGTGTGT								None (None upstream) : BCL11A (127592 downstream)																																			---	---	---	---
BCL11A	53335	broad.mit.edu	37	2	60694268	60694268	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60694268delT	uc002sae.1	-						BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Intron|BCL11A_uc002saf.1_Intron	NM_022893	NP_075044			B-cell CLL/lymphoma 11A isoform 1						negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)					T	IGH@	B-CLL								---	---	---	---
Unknown	0	broad.mit.edu	37	2	60869842	60869847	+	IGR	DEL	CACACA	-	-	rs112545596		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60869842_60869847delCACACA								BCL11A (89209 upstream) : PAPOLG (113536 downstream)																																	OREG0014630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
USP34	9736	broad.mit.edu	37	2	61483709	61483709	+	Intron	DEL	A	-	-	rs34025877		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61483709delA	uc002sbe.2	-						USP34_uc002sbf.2_Intron	NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
USP34	9736	broad.mit.edu	37	2	61583315	61583323	+	Intron	DEL	AAAAAAAAA	-	-	rs144627793		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61583315_61583323delAAAAAAAAA	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
COMMD1	150684	broad.mit.edu	37	2	62203593	62203594	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62203593_62203594insA	uc002sbp.2	+							NM_152516	NP_689729			MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)															---	---	---	---
EHBP1	23301	broad.mit.edu	37	2	63132958	63132959	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63132958_63132959insA	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067			EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)											Hereditary_Prostate_Cancer				---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63769376	63769377	+	Intron	INS	-	T	T	rs74650253		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63769376_63769377insT	uc002sch.2	-						C2orf86_uc002sci.1_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
SLC1A4	6509	broad.mit.edu	37	2	65242578	65242578	+	Intron	DEL	C	-	-	rs11343057		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65242578delC	uc010yqa.1	+						SLC1A4_uc010ypy.1_Intron|SLC1A4_uc010ypz.1_Intron|SLC1A4_uc010fcv.2_Intron|SLC1A4_uc002sdh.2_Intron	NM_003038	NP_003029			solute carrier family 1, member 4 isoform 1						cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	66952856	66952859	+	IGR	DEL	TGTG	-	-	rs72286654		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66952856_66952859delTGTG								MEIS1 (152966 upstream) : ETAA1 (671583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67103398	67103401	+	IGR	DEL	CCTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67103398_67103401delCCTT								MEIS1 (303508 upstream) : ETAA1 (521041 downstream)																																			---	---	---	---
WDR92	116143	broad.mit.edu	37	2	68382286	68382286	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68382286delA	uc002see.1	-						WDR92_uc002sed.1_Intron|WDR92_uc002sef.1_Intron|WDR92_uc002seg.1_Intron|PNO1_uc002seh.2_5'Flank	NM_138458	NP_612467			monad						apoptosis|histone lysine methylation		methylated histone residue binding				0																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71845009	71845010	+	Intron	INS	-	GT	GT	rs67846692		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845009_71845010insGT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	72228604	72228604	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72228604delT								DYSF (314712 upstream) : CYP26B1 (127763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	73405337	73405337	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73405337delC								RAB11FIP5 (65191 upstream) : NOTO (24049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	79281606	79281606	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79281606delA								REG3G (25976 upstream) : REG1B (30543 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79427158	79427159	+	Intron	DEL	AG	-	-	rs71748871		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79427158_79427159delAG	uc010yse.1	+							NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79763701	79763702	+	Intron	INS	-	TA	TA	rs147615298	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79763701_79763702insTA	uc010yse.1	+						CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	81619001	81619001	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81619001delC								CTNNA2 (743097 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	81992437	81992437	+	IGR	DEL	C	-	-	rs35979192		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81992437delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82794551	82794552	+	IGR	INS	-	TCCT	TCCT	rs149914330	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82794551_82794552insTCCT								None (None upstream) : None (None downstream)																																			---	---	---	---
C2orf89	129293	broad.mit.edu	37	2	85103123	85103123	+	Intron	DEL	A	-	-	rs76321812		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85103123delA	uc010ysl.1	-						C2orf89_uc002sou.3_Intron|C2orf89_uc010fgc.1_Intron	NM_001080824	NP_001074293			hypothetical protein LOC129293 precursor							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	85113203	85113203	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85113203delA								C2orf89 (4951 upstream) : TMSB10 (19560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	85191999	85191999	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85191999delA								TMSB10 (58200 upstream) : KCMF1 (6232 downstream)																																			---	---	---	---
MRPL35	51318	broad.mit.edu	37	2	86430204	86430204	+	Intron	DEL	T	-	-	rs139180280		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86430204delT	uc002srg.3	+						MRPL35_uc002srf.3_Intron	NM_016622	NP_057706			mitochondrial ribosomal protein L35 isoform a						translation	mitochondrial ribosome	structural constituent of ribosome				0																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87095981	87095982	+	Intron	INS	-	A	A	rs67413624		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87095981_87095982insA	uc002srs.3	+						uc010fgu.1_Intron					SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87528467	87528468	+	Intron	INS	-	CA	CA	rs149933183	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87528467_87528468insCA	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
KRCC1	51315	broad.mit.edu	37	2	88350442	88350443	+	Intron	DEL	GC	-	-	rs72845084		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88350442_88350443delGC	uc002sso.1	-						KRCC1_uc002ssp.1_Intron	NM_016618	NP_057702			lysine-rich coiled-coil 1											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88741330	88741330	+	IGR	DEL	G	-	-	rs111758137		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88741330delG								THNSL2 (255185 upstream) : FOXI3 (6396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	89226113	89226113	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89226113delA	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90417220	90417224	+	Intron	DEL	ATGAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417220_90417224delATGAA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	91658502	91658502	+	IGR	DEL	C	-	-	rs71269521		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91658502delC								None (None upstream) : LOC654342 (146690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91659824	91659825	+	IGR	INS	-	TT	TT	rs147266308		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91659824_91659825insTT								None (None upstream) : LOC654342 (145367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91705140	91705140	+	IGR	DEL	T	-	-	rs142679773		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91705140delT								None (None upstream) : LOC654342 (100052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91739761	91739765	+	IGR	DEL	ATTTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91739761_91739765delATTTC								None (None upstream) : LOC654342 (65427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92241544	92241546	+	IGR	DEL	TTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92241544_92241546delTTC								FKSG73 (111050 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92241572	92241572	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92241572delC								FKSG73 (111078 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317890	92317890	+	IGR	DEL	T	-	-	rs7597972		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317890delT								FKSG73 (187396 upstream) : None (None downstream)																																			---	---	---	---
CNNM3	26505	broad.mit.edu	37	2	97485341	97485341	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97485341delT	uc002swy.2	+						CNNM3_uc002swz.2_Intron	NM_017623	NP_060093			cyclin M3 isoform 1						ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98775174	98775174	+	Intron	DEL	G	-	-	rs11297362		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98775174delG	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98828148	98828149	+	Intron	INS	-	GTC	GTC	rs151319823	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98828148_98828149insGTC	uc002syo.2	+						VWA3B_uc010yvh.1_Intron|VWA3B_uc002syj.2_Intron|VWA3B_uc002syk.1_Intron|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron|VWA3B_uc002syp.1_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
TSGA10	80705	broad.mit.edu	37	2	99616974	99616975	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99616974_99616975delAA	uc002szg.3	-						TSGA10_uc002szh.3_Intron|TSGA10_uc002szi.3_Intron|TSGA10_uc010fin.1_Intron	NM_182911	NP_878915			testis specific, 10						spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100920615	100920616	+	Intron	INS	-	T	T	rs142520879	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100920615_100920616insT	uc002tal.3	-						LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863			LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	100958238	100958239	+	IGR	INS	-	TG	TG	rs142215796	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100958238_100958239insTG								LONRF2 (19043 upstream) : CHST10 (50084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	101820197	101820198	+	IGR	INS	-	T	T	rs138939551		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101820197_101820198insT								TBC1D8 (52351 upstream) : C2orf29 (49147 downstream)																																			---	---	---	---
RFX8	731220	broad.mit.edu	37	2	102026879	102026880	+	Intron	INS	-	CACT	CACT	rs3045577		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102026879_102026880insCACT	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136			regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102123823	102123823	+	IGR	DEL	C	-	-	rs66671167		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102123823delC								RFX8 (32658 upstream) : MAP4K4 (190665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	102177192	102177193	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102177192_102177193delAC								RFX8 (86027 upstream) : MAP4K4 (137295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103483368	103483368	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103483368delT								TMEM182 (49232 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	104386733	104386733	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104386733delA								TMEM182 (952597 upstream) : LOC150568 (664072 downstream)																																			---	---	---	---
LOC150568	150568	broad.mit.edu	37	2	105061893	105061894	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105061893_105061894insA	uc002tch.2	+							NR_015399				Homo sapiens cDNA FLJ30528 fis, clone BRAWH2001037.												0																		---	---	---	---
NCK2	8440	broad.mit.edu	37	2	106508953	106508954	+	Intron	INS	-	CT	CT	rs148893211	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106508953_106508954insCT	uc002tdg.2	+						NCK2_uc002tdh.2_Intron|NCK2_uc002tdi.2_Intron	NM_003581	NP_003572			NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	106851832	106851832	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106851832delG								UXS1 (41037 upstream) : PLGLA (150937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107865106	107865106	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107865106delT								ST6GAL2 (361543 upstream) : LOC729121 (574414 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108350533	108350533	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108350533delA								ST6GAL2 (846970 upstream) : LOC729121 (88987 downstream)																																			---	---	---	---
SLC5A7	60482	broad.mit.edu	37	2	108616052	108616052	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108616052delA	uc002tdv.2	+						SLC5A7_uc010ywm.1_Intron|SLC5A7_uc010fjj.2_Intron|SLC5A7_uc010ywn.1_Intron	NM_021815	NP_068587			solute carrier family 5 (choline transporter),						acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)													---	---	---	---
LIMS1	3987	broad.mit.edu	37	2	109178202	109178202	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109178202delG	uc002tef.2	+							NM_004987	NP_004978			LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0																		---	---	---	---
SH3RF3	344558	broad.mit.edu	37	2	110058783	110058783	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110058783delG	uc010ywt.1	+							NM_001099289	NP_001092759			SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1																		---	---	---	---
ACOXL	55289	broad.mit.edu	37	2	111774507	111774508	+	Intron	INS	-	A	A	rs140464792	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111774507_111774508insA	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986			acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113368734	113368735	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113368734_113368735insT								CHCHD5 (21884 upstream) : SLC20A1 (34792 downstream)																																			---	---	---	---
CKAP2L	150468	broad.mit.edu	37	2	113513315	113513316	+	Intron	INS	-	A	A	rs150191453		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113513315_113513316insA	uc002tie.2	-						CKAP2L_uc002tif.2_Intron|CKAP2L_uc010yxp.1_Intron|CKAP2L_uc010yxq.1_Intron	NM_152515	NP_689728			cytoskeleton associated protein 2-like							centrosome					0																		---	---	---	---
INSIG2	51141	broad.mit.edu	37	2	118851625	118851626	+	Intron	INS	-	GAA	GAA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118851625_118851626insGAA	uc002tlk.2	+						INSIG2_uc010yye.1_Intron	NM_016133	NP_057217			insulin induced protein 2						ER-nuclear sterol response pathway	SREBP-SCAP-Insig complex				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
C2orf76	130355	broad.mit.edu	37	2	120109164	120109164	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120109164delA	uc002tls.2	-						C2orf76_uc010flf.1_Intron|C2orf76_uc010yyg.1_Intron|C2orf76_uc002tlt.2_Intron|C2orf76_uc002tlu.2_Intron	NM_001017927	NP_001017927			hypothetical protein LOC130355												0																		---	---	---	---
EPB41L5	57669	broad.mit.edu	37	2	120872662	120872662	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120872662delT	uc002tmg.2	+						EPB41L5_uc010fll.2_Intron|EPB41L5_uc010flm.2_Intron	NM_020909	NP_065960			erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	121408531	121408534	+	IGR	DEL	CACC	-	-	rs70954503	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121408531_121408534delCACC								LOC84931 (184606 upstream) : GLI2 (84665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121408533	121408534	+	IGR	DEL	CC	-	-	rs7576987		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121408533_121408534delCC								LOC84931 (184608 upstream) : GLI2 (84665 downstream)																																			---	---	---	---
GLI2	2736	broad.mit.edu	37	2	121531480	121531483	+	Intron	DEL	TCCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121531480_121531483delTCCT	uc010yyu.1	+						GLI2_uc002tmp.1_Intron					SubName: Full=cDNA FLJ60878, highly similar to Homo sapiens GLI-Kruppel family member GLI2, mRNA;						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	121795066	121795066	+	IGR	DEL	C	-	-	rs57551014		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121795066delC								GLI2 (44838 upstream) : TFCP2L1 (179100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124108103	124108103	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124108103delT								None (None upstream) : CNTNAP5 (674761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126017225	126017227	+	IGR	DEL	TCA	-	-	rs71387271		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126017225_126017227delTCA								CNTNAP5 (344364 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126821244	126821245	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126821244_126821245delTG								None (None upstream) : GYPC (592439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127324443	127324443	+	IGR	DEL	G	-	-	rs112787850		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127324443delG								None (None upstream) : GYPC (89241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129380730	129380731	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129380730_129380731delCT								HS6ST1 (304559 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	129605626	129605626	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129605626delT								HS6ST1 (529455 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130301352	130301355	+	IGR	DEL	CTCT	-	-	rs112069834		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130301352_130301355delCTCT								None (None upstream) : LOC389033 (379080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130317910	130317911	+	IGR	INS	-	GG	GG	rs140422223		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130317910_130317911insGG								None (None upstream) : LOC389033 (362524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132783472	132783473	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132783472_132783473insT								C2orf27B (224238 upstream) : NCRNA00164 (121691 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132969410	132969411	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132969410_132969411delAC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133036892	133036892	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133036892delG								NCRNA00164 (21350 upstream) : GPR39 (137255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133071744	133071745	+	Intron	INS	-	A	A	rs150436393	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133071744_133071745insA	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	133074008	133074009	+	Intron	INS	-	T	T	rs144826258	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133074008_133074009insT	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	133107763	133107764	+	IGR	INS	-	C	C	rs143923523	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133107763_133107764insC								NCRNA00164 (92221 upstream) : GPR39 (66383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133110394	133110394	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133110394delG								NCRNA00164 (94852 upstream) : GPR39 (63753 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133440839	133440840	+	Intron	INS	-	A	A	rs140985151	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133440839_133440840insA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133507953	133507953	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133507953delC	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134174228	134174228	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134174228delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134222578	134222578	+	Intron	DEL	T	-	-	rs11314518		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134222578delT	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	134707203	134707203	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134707203delG								NCKAP5 (381172 upstream) : MGAT5 (304627 downstream)																																			---	---	---	---
ACMSD	130013	broad.mit.edu	37	2	135607534	135607537	+	Intron	DEL	ACAC	-	-	rs71973242		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135607534_135607537delACAC	uc002ttz.2	+						ACMSD_uc002tua.2_Intron	NM_138326	NP_612199			aminocarboxymuconate semialdehyde decarboxylase						quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)														---	---	---	---
RAB3GAP1	22930	broad.mit.edu	37	2	135875252	135875254	+	Intron	DEL	CTG	-	-	rs62170235		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135875252_135875254delCTG	uc002tuj.2	+						RAB3GAP1_uc010fnf.2_Intron|RAB3GAP1_uc010fng.2_Intron|RAB3GAP1_uc010fnh.1_Intron	NM_012233	NP_036365			RAB3 GTPase-activating protein							centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)														---	---	---	---
ZRANB3	84083	broad.mit.edu	37	2	135958871	135958871	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135958871delT	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron	NM_032143	NP_115519			zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)														---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136314837	136314837	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136314837delT	uc002tuo.2	+							NM_015361	NP_056176			R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)														---	---	---	---
R3HDM1	23518	broad.mit.edu	37	2	136433223	136433224	+	Intron	INS	-	TT	TT	rs72538400		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136433223_136433224insTT	uc002tuo.2	+						R3HDM1_uc010fni.2_Intron|R3HDM1_uc002tup.2_Intron|R3HDM1_uc010zbh.1_Intron	NM_015361	NP_056176			R3H domain containing 1								nucleic acid binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	136965668	136965668	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136965668delA								CXCR4 (89943 upstream) : THSD7B (557447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	137157135	137157135	+	IGR	DEL	C	-	-	rs59749218		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137157135delC								CXCR4 (281410 upstream) : THSD7B (365980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	137189395	137189396	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137189395_137189396delGA								CXCR4 (313670 upstream) : THSD7B (333719 downstream)																																			---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138114518	138114519	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138114518_138114519delAC	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138254783	138254786	+	Intron	DEL	ACAC	-	-	rs138624375		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138254783_138254786delACAC	uc002tva.1	+						THSD7B_uc010zbj.1_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141281697	141281698	+	Intron	INS	-	A	A	rs145999651	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141281697_141281698insA	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141340737	141340740	+	Intron	DEL	TTTC	-	-	rs1905926		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141340737_141340740delTTTC	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141963701	141963702	+	Intron	DEL	CA	-	-	rs148919787		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141963701_141963702delCA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142253846	142253846	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142253846delA	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144161108	144161109	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144161108_144161109insA	uc002tvm.3	+						ARHGAP15_uc010zbl.1_Intron	NM_018460	NP_060930			ARHGAP15						regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	144548361	144548361	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144548361delG								ARHGAP15 (22441 upstream) : GTDC1 (155222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	147759480	147759480	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147759480delT								PABPC1P2 (410923 upstream) : ACVR2A (842606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148452775	148452775	+	IGR	DEL	T	-	-	rs11315706		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148452775delT								None (None upstream) : ACVR2A (149311 downstream)																																			---	---	---	---
MBD5	55777	broad.mit.edu	37	2	149204838	149204841	+	Intron	DEL	GAAA	-	-	rs3955149		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149204838_149204841delGAAA	uc002twm.3	+							NM_018328	NP_060798			methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)														---	---	---	---
EPC2	26122	broad.mit.edu	37	2	149411274	149411274	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149411274delT	uc010zbt.1	+							NM_015630	NP_056445			enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)														---	---	---	---
EPC2	26122	broad.mit.edu	37	2	149504391	149504392	+	Intron	INS	-	AC	AC	rs146474372	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149504391_149504392insAC	uc010zbt.1	+							NM_015630	NP_056445			enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	149571401	149571401	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149571401delA								EPC2 (26266 upstream) : KIF5C (61418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	150644585	150644592	+	IGR	DEL	GTGTGTGT	-	-	rs111565712		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150644585_150644592delGTGTGTGT								MMADHC (200255 upstream) : RND3 (680120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	150833950	150833951	+	IGR	INS	-	ATAG	ATAG	rs138668717	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150833950_150833951insATAG								MMADHC (389620 upstream) : RND3 (490761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151397782	151397782	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151397782delA								RND3 (53602 upstream) : RBM43 (706947 downstream)																																			---	---	---	---
NMI	9111	broad.mit.edu	37	2	152148495	152148496	+	5'Flank	DEL	AC	-	-	rs67140206		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152148495_152148496delAC	uc002txi.2	-						NMI_uc010zbx.1_5'Flank|NMI_uc002txj.2_5'Flank	NM_004688	NP_004679			N-myc and STAT interactor						inflammatory response|JAK-STAT cascade|transcription from RNA polymerase II promoter	cytoplasm|nucleus	nucleotide binding|protein binding|transcription cofactor activity				0				BRCA - Breast invasive adenocarcinoma(221;0.0571)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	153656568	153656568	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153656568delT								ARL6IP6 (38801 upstream) : RPRM (677284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154206899	154206900	+	IGR	DEL	TT	-	-	rs72524030		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154206899_154206900delTT								ARL6IP6 (589132 upstream) : RPRM (126952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154328966	154328966	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154328966delG								ARL6IP6 (711199 upstream) : RPRM (4886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	155742173	155742174	+	IGR	INS	-	T	T	rs112235198		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155742173_155742174insT								KCNJ3 (29159 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	156877536	156877537	+	RNA	DEL	AG	-	-	rs139259977		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156877536_156877537delAG	uc002tyw.2	-	4		c.1256_1257delCT								Homo sapiens cDNA clone IMAGE:5209417.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	157845422	157845422	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157845422delC								GPD2 (375175 upstream) : GALNT5 (268918 downstream)																																			---	---	---	---
WDSUB1	151525	broad.mit.edu	37	2	160141926	160141926	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160141926delA	uc002uaj.3	-						WDSUB1_uc002uak.3_Intron|WDSUB1_uc002ual.3_Intron|WDSUB1_uc002uam.3_Intron|WDSUB1_uc010foo.2_Intron	NM_152528	NP_689741			WD repeat, sterile alpha motif and U-box domain							ubiquitin ligase complex	ubiquitin-protein ligase activity				0																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160413652	160413653	+	Intron	INS	-	T	T	rs35808640		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160413652_160413653insT	uc002uao.2	-						BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uas.1_Intron|BAZ2B_uc002uau.1_Intron|BAZ2B_uc002uat.3_5'Flank	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160430873	160430873	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160430873delA	uc002uao.2	-						BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uas.1_Intron|BAZ2B_uc002uau.1_Intron	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
MARCH7	64844	broad.mit.edu	37	2	160605489	160605489	+	Intron	DEL	C	-	-	rs72017785		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160605489delC	uc002uax.2	+						MARCH7_uc010foq.2_Intron|MARCH7_uc010zcn.1_Intron|MARCH7_uc010for.2_Intron|MARCH7_uc002uay.2_Intron	NM_022826	NP_073737			axotrophin								ligase activity|zinc ion binding				0																		---	---	---	---
LY75	4065	broad.mit.edu	37	2	160639235	160639236	+	Intron	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160639235_160639236insAA	uc002ubb.3	-						LY75_uc010fos.2_Intron|CD302_uc002uba.2_Intron|CD302_uc010zco.1_Intron	NM_002349	NP_002340			lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)														---	---	---	---
LY75	4065	broad.mit.edu	37	2	160645682	160645682	+	Intron	DEL	T	-	-	rs67451693		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160645682delT	uc002ubb.3	-						LY75_uc010fos.2_Intron|CD302_uc002uba.2_Intron|CD302_uc010zco.1_Intron	NM_002349	NP_002340			lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	161590072	161590097	+	IGR	DEL	CACACACACACACACACACACACACA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161590072_161590097delCACACACACACACACACACACACACA								RBMS1 (239754 upstream) : TANK (403369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	161898020	161898021	+	IGR	INS	-	AC	AC	rs145663083	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161898020_161898021insAC								RBMS1 (547702 upstream) : TANK (95445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	161985020	161985020	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161985020delA								RBMS1 (634702 upstream) : TANK (8446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164040048	164040048	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164040048delT								KCNH7 (344808 upstream) : FIGN (424070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	164609268	164609268	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164609268delT								FIGN (16755 upstream) : GRB14 (740065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	165087140	165087140	+	IGR	DEL	A	-	-	rs10715894		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165087140delA								FIGN (494627 upstream) : GRB14 (262193 downstream)																																			---	---	---	---
SCN3A	6328	broad.mit.edu	37	2	166047571	166047571	+	Intron	DEL	T	-	-	rs72518637		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166047571delT	uc002ucx.2	-						SCN3A_uc002ucy.2_Intron|SCN3A_uc002ucz.2_Intron	NM_006922	NP_008853			sodium channel, voltage-gated, type III, alpha							voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	166706924	166706924	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166706924delC								GALNT3 (55755 upstream) : TTC21B (7064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	166827967	166827968	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166827967_166827968insA								TTC21B (17619 upstream) : SCN1A (17703 downstream)																																			---	---	---	---
LASS6	253782	broad.mit.edu	37	2	169317492	169317493	+	Intron	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169317492_169317493delGA	uc002ueb.1	+						LASS6_uc002uec.1_Intron	NM_203463	NP_982288			longevity assurance homolog 6							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170152353	170152353	+	Intron	DEL	G	-	-	rs11348179		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170152353delG	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
UBR3	130507	broad.mit.edu	37	2	170703633	170703636	+	Intron	DEL	GTGC	-	-	rs141194440		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170703633_170703636delGTGC	uc010zdi.1	+							NM_172070	NP_742067			E3 ubiquitin-protein ligase UBR3						sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171372813	171372814	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171372813_171372814insT	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482			myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171465113	171465114	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171465113_171465114delAA	uc002ufy.2	+						MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482			myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	171580516	171580516	+	Intron	DEL	T	-	-	rs71399548		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171580516delT	uc002ugf.1	-											Homo sapiens cDNA FLJ13453 fis, clone PLACE1003205.																														---	---	---	---
TLK1	9874	broad.mit.edu	37	2	171889392	171889392	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171889392delT	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron|TLK1_uc010zdn.1_Intron	NM_012290	NP_036422			tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1																		---	---	---	---
TLK1	9874	broad.mit.edu	37	2	171920515	171920515	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171920515delT	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron|TLK1_uc010zdn.1_Intron	NM_012290	NP_036422			tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	176088143	176088146	+	IGR	DEL	TCTT	-	-	rs149509407		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176088143_176088146delTCTT								ATP5G3 (41653 upstream) : KIAA1715 (702264 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	177764560	177764561	+	IGR	INS	-	T	T	rs149556498	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177764560_177764561insT								MIR1246 (298780 upstream) : HNRNPA3 (312861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	178091286	178091286	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178091286delT								HNRNPA3 (2601 upstream) : NFE2L2 (3748 downstream)																																			---	---	---	---
NFE2L2	4780	broad.mit.edu	37	2	178152583	178152583	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178152583delA	uc002uli.3	-						LOC100130691_uc002ulj.1_Intron	NM_001145412	NP_001138884			nuclear factor erythroid 2-like 2 isoform 2						transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)					Mis		NSCLC|HNSCC					HNSCC(56;0.16)			---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180553217	180553218	+	Intron	INS	-	AAC	AAC	rs147799361		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180553217_180553218insAAC	uc002unn.3	-						ZNF385B_uc002unm.2_Intron	NM_152520	NP_689733			zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	181029146	181029147	+	IGR	INS	-	TGTGTG	TGTGTG	rs147222702	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181029146_181029147insTGTGTG								CWC22 (157306 upstream) : UBE2E3 (815965 downstream)																																			---	---	---	---
UBE2E3	10477	broad.mit.edu	37	2	181856986	181856987	+	Intron	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181856986_181856987delTT	uc002unq.1	+						UBE2E3_uc002unr.1_Intron|UBE2E3_uc010fri.1_Intron	NM_182678	NP_872619			ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
PPP1R1C	151242	broad.mit.edu	37	2	182874862	182874862	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182874862delT	uc002uoo.2	+						PPP1R1C_uc002uon.2_Intron|PPP1R1C_uc002uop.1_Intron|PPP1R1C_uc010frm.1_Intron|PPP1R1C_uc010frn.1_Intron	NM_001080545	NP_001074014			protein phosphatase 1, regulatory (inhibitor)						signal transduction	cytoplasm	protein phosphatase inhibitor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0628)															---	---	---	---
PPP1R1C	151242	broad.mit.edu	37	2	182950617	182950618	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182950617_182950618insA	uc002uoo.2	+						PPP1R1C_uc002uon.2_Intron|PPP1R1C_uc002uop.1_Intron|PPP1R1C_uc010frm.1_Intron|PPP1R1C_uc010frn.1_Intron	NM_001080545	NP_001074014			protein phosphatase 1, regulatory (inhibitor)						signal transduction	cytoplasm	protein phosphatase inhibitor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0628)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	183692206	183692206	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183692206delA								DNAJC10 (48951 upstream) : FRZB (6531 downstream)																																			---	---	---	---
NUP35	129401	broad.mit.edu	37	2	184002518	184002518	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184002518delA	uc002upf.2	+						NUP35_uc010zfs.1_Intron|NUP35_uc010zft.1_Intron|NUP35_uc002upg.2_Intron	NM_138285	NP_612142			nucleoporin 35kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	intermediate filament cytoskeleton|nuclear membrane|nuclear pore|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	184425819	184425820	+	IGR	INS	-	TC	TC	rs139181696	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184425819_184425820insTC								NUP35 (399412 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184458462	184458462	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184458462delC								NUP35 (432055 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	185041818	185041818	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185041818delG								None (None upstream) : ZNF804A (421275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	185080124	185080124	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185080124delT								None (None upstream) : ZNF804A (382969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	186128369	186128369	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186128369delA								ZNF804A (324157 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	186793205	186793208	+	IGR	DEL	AGGG	-	-	rs34233648		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186793205_186793208delAGGG								ZNF804A (988993 upstream) : ZC3H15 (557677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	187281665	187281666	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187281665_187281666delAC								None (None upstream) : ZC3H15 (69219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	187966452	187966453	+	IGR	INS	-	AC	AC	rs148251577	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187966452_187966453insAC								ZSWIM2 (252555 upstream) : CALCRL (241398 downstream)																																			---	---	---	---
SLC40A1	30061	broad.mit.edu	37	2	190449678	190449679	+	5'Flank	INS	-	T	T	rs147965138	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190449678_190449679insT	uc002uqr.1	-						SLC40A1_uc002uqs.1_5'Flank					Synthetic construct DNA, clone: pF1KB8672, Homo sapiens SLC40A1 gene for solute carrier family 40 (iron-regulated transporter), member 1, without stop codon, in Flexi system.						anatomical structure morphogenesis|cellular iron ion homeostasis	cytoplasm|integral to plasma membrane	iron ion transmembrane transporter activity|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	190974081	190974081	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190974081delT								MSTN (46626 upstream) : C2orf88 (28405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	191699442	191699445	+	IGR	DEL	TTTA	-	-	rs10535318		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191699442_191699445delTTTA								NAB1 (141951 upstream) : GLS (46102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194621100	194621101	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194621100_194621101delAC								PCGEM1 (979479 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194649611	194649612	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194649611_194649612insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195130490	195130490	+	IGR	DEL	A	-	-	rs79277748		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195130490delA								None (None upstream) : None (None downstream)																																			---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197113261	197113261	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197113261delA	uc002utm.1	-						HECW2_uc002utl.1_Intron	NM_020760	NP_065811			HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	199207593	199207593	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199207593delT	uc002uux.1	-											Homo sapiens cDNA FLJ39180 fis, clone OCBBF2004168.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	200125339	200125339	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200125339delA								None (None upstream) : SATB2 (8885 downstream)																																			---	---	---	---
CLK1	1195	broad.mit.edu	37	2	201732118	201732119	+	5'Flank	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201732118_201732119insA	uc002uwe.2	-						CLK1_uc010zhi.1_5'Flank|CLK1_uc002uwf.2_5'Flank|CLK1_uc002uwg.2_5'Flank|CLK1_uc010fsv.2_5'Flank	NM_004071	NP_004062			CDC-like kinase 1 isoform 1						cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2																		---	---	---	---
TRAK2	66008	broad.mit.edu	37	2	202281983	202281983	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202281983delG	uc002uyb.3	-						TRAK2_uc002uyc.2_Intron	NM_015049	NP_055864			trafficking protein, kinesin binding 2							early endosome|plasma membrane	GABA receptor binding				0																		---	---	---	---
CDK15	65061	broad.mit.edu	37	2	202698439	202698439	+	Intron	DEL	C	-	-	rs10597284		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202698439delC	uc002uyt.2	+						CDK15_uc010ftm.2_Intron|CDK15_uc002uys.2_Intron|CDK15_uc010ftn.1_Intron|CDK15_uc010fto.1_Intron	NM_139158	NP_631897			PFTAIRE protein kinase 2								ATP binding|cyclin-dependent protein kinase activity|metal ion binding|protein binding			breast(2)|ovary(1)|lung(1)|kidney(1)	5					Adenosine triphosphate(DB00171)													---	---	---	---
NBEAL1	65065	broad.mit.edu	37	2	203983317	203983318	+	Intron	INS	-	T	T	rs59948628		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203983317_203983318insT	uc002uzt.3	+							NM_001114132	NP_001107604			neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2																		---	---	---	---
CYP20A1	57404	broad.mit.edu	37	2	204101568	204101568	+	5'Flank	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204101568delG	uc002uzv.3	+						CYP20A1_uc002uzx.3_5'Flank|CYP20A1_uc010zif.1_5'Flank|CYP20A1_uc002uzy.3_5'Flank|CYP20A1_uc002uzw.3_5'Flank	NM_177538	NP_803882			cytochrome P450, family 20, subfamily A,							integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	204869172	204869174	+	IGR	DEL	AAG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204869172_204869174delAAG								ICOS (42876 upstream) : PARD3B (541342 downstream)																																			---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206439580	206439580	+	Intron	DEL	A	-	-	rs72157213		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206439580delA	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	207587192	207587193	+	IGR	INS	-	T	T	rs147473234	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207587192_207587193insT								DYTN (4072 upstream) : MDH1B (11750 downstream)																																			---	---	---	---
CPO	130749	broad.mit.edu	37	2	207821136	207821137	+	Intron	INS	-	CAG	CAG	rs141567906	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207821136_207821137insCAG	uc002vby.2	+							NM_173077	NP_775100			carboxypeptidase O precursor						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	207910916	207910918	+	IGR	DEL	GAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207910916_207910918delGAA								CPO (76718 upstream) : KLF7 (34611 downstream)																																			---	---	---	---
KLF7	8609	broad.mit.edu	37	2	207955022	207955022	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207955022delA	uc002vbz.1	-						KLF7_uc002vca.1_Intron|KLF7_uc010zix.1_Intron	NM_003709	NP_003700			Kruppel-like factor 7 (ubiquitous)						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	209078340	209078341	+	IGR	DEL	AC	-	-	rs72359181		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209078340_209078341delAC								C2orf80 (23567 upstream) : IDH1 (22613 downstream)																																			---	---	---	---
RPE	6120	broad.mit.edu	37	2	210882456	210882457	+	Intron	DEL	GC	-	-	rs2243769		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210882456_210882457delGC	uc002vdn.2	+						RPE_uc002vdm.2_Intron|RPE_uc002vdo.2_Intron|RPE_uc010zjf.1_Intron|RPE_uc002vdp.2_Intron|RPE_uc010fup.2_Intron|RPE_uc002vdq.2_Intron|RPE_uc002vdr.2_Intron	NM_199229	NP_954699			ribulose-5-phosphate-3-epimerase isoform 1						pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)														---	---	---	---
C2orf67	151050	broad.mit.edu	37	2	210894384	210894386	+	Intron	DEL	TTG	-	-	rs3835772		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210894384_210894386delTTG	uc002vds.2	-						C2orf67_uc002vdt.2_Intron	NM_152519	NP_689732			hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	211218905	211218905	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211218905delG								MYL1 (39010 upstream) : LANCL1 (77069 downstream)																																			---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214357873	214357873	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214357873delA	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
VWC2L	402117	broad.mit.edu	37	2	215341497	215341498	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215341497_215341498delTC	uc002vet.2	+						VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969			von Willebrand factor C domain-containing							extracellular region					0																		---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215800523	215800523	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215800523delA	uc002vew.2	-						ABCA12_uc002vev.2_Intron|ABCA12_uc010zjn.1_Intron	NM_173076	NP_775099			ATP-binding cassette, sub-family A, member 12						cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	216168212	216168213	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216168212_216168213insA								ABCA12 (165061 upstream) : ATIC (8479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217484725	217484726	+	IGR	DEL	GT	-	-	rs72547232		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217484725_217484726delGT								RPL37A (118539 upstream) : IGFBP2 (13401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217648818	217648819	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217648818_217648819insT								IGFBP5 (88546 upstream) : TNP1 (75365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217677427	217677428	+	IGR	INS	-	A	A	rs145231606		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217677427_217677428insA								IGFBP5 (117155 upstream) : TNP1 (46756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	217824616	217824616	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217824616delT								TNP1 (99834 upstream) : DIRC3 (324132 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218162276	218162276	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218162276delA	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	218955386	218955387	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218955386_218955387insC								RUFY4 (83 upstream) : CXCR2 (34611 downstream)																																			---	---	---	---
USP37	57695	broad.mit.edu	37	2	219328252	219328253	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219328252_219328253delAC	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986			ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	222236409	222236410	+	IGR	INS	-	C	C	rs78549493		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222236409_222236410insC								None (None upstream) : EPHA4 (46339 downstream)																																			---	---	---	---
SGPP2	130367	broad.mit.edu	37	2	223382284	223382284	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223382284delG	uc010zlo.1	+						SGPP2_uc010zlp.1_Intron	NM_152386	NP_689599			sphingosine-1-phosphate phosphotase 2						sphingosine metabolic process	endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)|skin(1)	2		Renal(207;0.0376)		Epithelial(121;2.08e-09)|all cancers(144;9.25e-07)|LUSC - Lung squamous cell carcinoma(224;0.011)|Lung(261;0.0143)														---	---	---	---
KIAA1486	57624	broad.mit.edu	37	2	226377569	226377576	+	Intron	DEL	CTTCCTTC	-	-	rs34679202	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226377569_226377576delCTTCCTTC	uc002voe.2	+						KIAA1486_uc010fxa.1_Intron	NM_020864	NP_065915			hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	226604334	226604334	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226604334delG								KIAA1486 (8863 upstream) : IRS1 (991700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228292849	228292852	+	IGR	DEL	TTCT	-	-	rs67570984		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228292849_228292852delTTCT								TM4SF20 (48827 upstream) : AGFG1 (44036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228804218	228804233	+	IGR	DEL	TTCTTTCCTTCCTTCG	-	-	rs71043010	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228804218_228804233delTTCTTTCCTTCCTTCG								WDR69 (15192 upstream) : SPHKAP (40437 downstream)																																			---	---	---	---
ARMC9	80210	broad.mit.edu	37	2	232196169	232196169	+	Intron	DEL	T	-	-	rs35508844		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232196169delT	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron|ARMC9_uc002vrr.1_Intron	NM_025139	NP_079415			armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	233211234	233211236	+	IGR	DEL	CCC	-	-	rs56379460		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233211234_233211236delCCC								DIS3L2 (9327 upstream) : ALPP (32112 downstream)																																			---	---	---	---
NGEF	25791	broad.mit.edu	37	2	233753001	233753002	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233753001_233753002delCA	uc002vts.2	-						NGEF_uc010zmm.1_Intron|NGEF_uc010fyg.1_Intron	NM_019850	NP_062824			neuronal guanine nucleotide exchange factor						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)														---	---	---	---
INPP5D	3635	broad.mit.edu	37	2	233994620	233994629	+	Intron	DEL	GTGTGTGTGA	-	-	rs72057746	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233994620_233994629delGTGTGTGTGA	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915			SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)														---	---	---	---
INPP5D	3635	broad.mit.edu	37	2	234095791	234095792	+	Intron	INS	-	TGCA	TGCA	rs142806499	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234095791_234095792insTGCA	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915			SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235440948	235440949	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235440948_235440949delAC								ARL4C (35255 upstream) : SH3BP4 (419679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235738581	235738582	+	IGR	DEL	TC	-	-	rs72475164		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235738581_235738582delTC								ARL4C (332888 upstream) : SH3BP4 (122046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237709127	237709128	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237709127_237709128delTG								CXCR7 (218135 upstream) : COPS8 (284956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	238095423	238095423	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238095423delT								COPS8 (87936 upstream) : COL6A3 (137232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	238147011	238147011	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238147011delT								COPS8 (139524 upstream) : COL6A3 (85644 downstream)																																			---	---	---	---
MLPH	79083	broad.mit.edu	37	2	238425583	238425594	+	Intron	DEL	GATAGGTGGATA	-	-	rs117629582		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238425583_238425594delGATAGGTGGATA	uc002vwt.2	+						MLPH_uc002vws.2_Intron|MLPH_uc010fyt.1_Intron|MLPH_uc002vwu.2_Intron|MLPH_uc002vwv.2_Intron|MLPH_uc002vww.2_Intron|MLPH_uc002vwx.2_5'Flank|MLPH_uc010fyu.2_5'Flank	NM_024101	NP_077006			melanophilin isoform 1								metal ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)														---	---	---	---
SCLY	51540	broad.mit.edu	37	2	238939717	238939717	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238939717delC	uc002vxm.3	+						UBE2F_uc010znn.1_Intron|UBE2F_uc002vxk.2_Intron|UBE2F_uc002vxl.2_Intron|UBE2F_uc010zno.1_Intron|UBE2F_uc010znp.1_Intron	NM_016510	NP_057594			selenocysteine lyase						cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239402576	239402576	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239402576delT								ASB1 (41686 upstream) : TWIST2 (354097 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240287284	240287285	+	Intron	INS	-	AG	AG	rs138547361	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240287284_240287285insAG	uc002vyk.3	-						HDAC4_uc010fza.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	240389226	240389229	+	IGR	DEL	TGTG	-	-	rs34178093		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240389226_240389229delTGTG								HDAC4 (65880 upstream) : NDUFA10 (510929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	240676573	240676574	+	IGR	INS	-	TGGA	TGGA	rs143853869	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240676573_240676574insTGGA								HDAC4 (353227 upstream) : NDUFA10 (223584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	240835379	240835380	+	IGR	INS	-	A	A	rs144749671	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240835379_240835380insA								HDAC4 (512033 upstream) : NDUFA10 (64778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241248595	241248596	+	IGR	INS	-	TATC	TATC	rs141356115		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241248595_241248596insTATC								OTOS (168522 upstream) : GPC1 (126519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241273806	241273807	+	IGR	DEL	GT	-	-	rs112243583		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241273806_241273807delGT								OTOS (193733 upstream) : GPC1 (101308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241580362	241580365	+	IGR	DEL	CCTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241580362_241580365delCCTT								GPR35 (9687 upstream) : AQP12B (35471 downstream)																																			---	---	---	---
PASK	23178	broad.mit.edu	37	2	242059912	242059913	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242059912_242059913insA	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_Intron|PASK_uc002waq.2_Intron	NM_015148	NP_055963			PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	243010021	243010022	+	IGR	INS	-	T	T	rs58667887		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:243010021_243010022insT								C2orf85 (194539 upstream) : LOC728323 (20822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	916048	916049	+	IGR	INS	-	ACAC	ACAC	rs139508947	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:916048_916049insACAC								CHL1 (464953 upstream) : CNTN6 (218571 downstream)																																			---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1342259	1342265	+	Intron	DEL	AAGAAAG	-	-	rs72571146		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1342259_1342265delAAGAAAG	uc003boz.2	+						CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276			contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	1487882	1487897	+	IGR	DEL	GTGTGTGTGTGTGTGT	-	-	rs72314367		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1487882_1487897delGTGTGTGTGTGTGTGT								CNTN6 (42605 upstream) : CNTN4 (652653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	3105125	3105126	+	IGR	INS	-	G	G	rs142655295	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3105125_3105126insG								CNTN4 (5481 upstream) : IL5RA (6275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	3232366	3232366	+	IGR	DEL	T	-	-	rs11288178		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3232366delT								CRBN (10976 upstream) : SUMF1 (590670 downstream)																																			---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4806748	4806749	+	Intron	INS	-	AAAAG	AAAAG	rs142335213	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4806748_4806749insAAAAG	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Intron	NM_001099952	NP_001093422			inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	5595706	5595706	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5595706delT								EDEM1 (334057 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6329999	6330000	+	IGR	INS	-	C	C	rs145360118	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6329999_6330000insC								None (None upstream) : GRM7 (572802 downstream)																																			---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7342850	7342851	+	Intron	INS	-	T	T	rs140844063	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7342850_7342851insT	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron|GRM7_uc003bqn.1_Intron	NM_000844	NP_000835			glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
C3orf32	51066	broad.mit.edu	37	3	8700558	8700558	+	Intron	DEL	A	-	-	rs34979782		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8700558delA	uc003bqz.2	-						C3orf32_uc003bqw.2_Intron|C3orf32_uc003bqx.2_Intron|C3orf32_uc003bqy.2_Intron	NM_015931	NP_057015			hypothetical protein LOC51066											skin(1)	1																		---	---	---	---
SETD5	55209	broad.mit.edu	37	3	9468086	9468087	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9468086_9468087insT	uc003brt.2	+						SETD5_uc003brs.1_Intron	NM_001080517	NP_001073986			SET domain containing 5											ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)														---	---	---	---
LHFPL4	375323	broad.mit.edu	37	3	9562916	9562917	+	Intron	INS	-	T	T	rs34985785		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9562916_9562917insT	uc003bry.2	-							NM_198560	NP_940962			lipoma HMGIC fusion partner-like 4							integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)																	---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10715085	10715086	+	Intron	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10715085_10715086delAG	uc003bvw.2	-							NM_001683	NP_001674			plasma membrane calcium ATPase 2 isoform 2						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
C3orf31	132001	broad.mit.edu	37	3	11880176	11880177	+	Intron	INS	-	T	T	rs142939273	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11880176_11880177insT	uc003bwh.2	-						C3orf31_uc003bwj.2_Intron|C3orf31_uc003bwi.2_Intron|C3orf31_uc011auo.1_Intron|C3orf31_uc011aup.1_Intron|C3orf31_uc010hdy.1_Intron	NM_138807	NP_620162			MMP37-like protein, mitochondrial precursor						protein import into mitochondrial matrix	extrinsic to mitochondrial inner membrane					0																		---	---	---	---
SYN2	6854	broad.mit.edu	37	3	12064428	12064429	+	Intron	INS	-	CAA	CAA	rs140511819	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12064428_12064429insCAA	uc003bwm.2	+						SYN2_uc003bwl.1_Intron	NM_133625	NP_598328			synapsin II isoform IIa						neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CAND2	23066	broad.mit.edu	37	3	12839606	12839606	+	Intron	DEL	G	-	-	rs5846788		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12839606delG	uc003bxk.2	+						CAND2_uc003bxj.2_Intron	NM_001162499	NP_001155971			TBP-interacting protein isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			skin(3)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	13142919	13142920	+	IGR	INS	-	A	A	rs34264129		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13142919_13142920insA								IQSEC1 (28302 upstream) : NUP210 (214817 downstream)																																			---	---	---	---
LOC285375	285375	broad.mit.edu	37	3	13726016	13726016	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13726016delT	uc003byd.1	+							NR_027103				Homo sapiens, clone IMAGE:5742174, mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	14326844	14326844	+	IGR	DEL	A	-	-	rs34312182		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14326844delA								LSM3 (87008 upstream) : SLC6A6 (117262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	14422858	14422859	+	IGR	DEL	AC	-	-	rs35846400		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14422858_14422859delAC								LSM3 (183022 upstream) : SLC6A6 (21247 downstream)																																			---	---	---	---
FGD5	152273	broad.mit.edu	37	3	14953937	14953937	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14953937delA	uc003bzc.2	+						FGD5_uc011avk.1_Intron|FGD5_uc003bzd.2_Intron	NM_152536	NP_689749			FYVE, RhoGEF and PH domain containing 5						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
METTL6	131965	broad.mit.edu	37	3	15451694	15451695	+	3'UTR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15451694_15451695insC	uc003bzs.1	-	6					METTL6_uc011avp.1_3'UTR|METTL6_uc010hen.1_Intron	NM_152396	NP_689609			methyltransferase like 6								methyltransferase activity				0																		---	---	---	---
HACL1	26061	broad.mit.edu	37	3	15613336	15613336	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15613336delC	uc003caf.2	-						HACL1_uc011avr.1_Intron|HACL1_uc011avs.1_Intron|HACL1_uc011avt.1_Intron|HACL1_uc003cag.2_Intron|HACL1_uc011avu.1_Intron|HACL1_uc010hep.2_Intron	NM_012260	NP_036392			2-hydroxyphytanoyl-CoA lyase						fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	17821371	17821372	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17821371_17821372delAG								TBC1D5 (37131 upstream) : SATB1 (567894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	18264267	18264267	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18264267delC	uc003cbg.2	+											Homo sapiens cDNA clone IMAGE:5584035.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	18809404	18809405	+	IGR	DEL	AG	-	-	rs147393414		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18809404_18809405delAG								SATB1 (329152 upstream) : KCNH8 (380612 downstream)																																			---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22301326	22301327	+	Intron	INS	-	A	A	rs34864158		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22301326_22301327insA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	22521563	22521564	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22521563_22521564delGT								ZNF385D (107440 upstream) : UBE2E2 (723089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	24051421	24051421	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24051421delT								NR1D2 (29312 upstream) : LOC152024 (86359 downstream)																																			---	---	---	---
TOP2B	7155	broad.mit.edu	37	3	25658716	25658716	+	Intron	DEL	A	-	-	rs4681030	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25658716delA	uc011awn.1	-						TOP2B_uc003cdj.2_Intron|TOP2B_uc011awm.1_Intron|TOP2B_uc010hff.1_Intron	NM_001068	NP_001059			DNA topoisomerase II, beta isozyme						DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	27628305	27628305	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27628305delT								SLC4A7 (102467 upstream) : EOMES (129583 downstream)																																			---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28414091	28414092	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28414091_28414092insT	uc003ceh.2	+							NM_001040432	NP_001035522			zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	29048230	29048231	+	IGR	INS	-	AA	AA	rs140099037	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29048230_29048231insAA								ZCWPW2 (481600 upstream) : RBMS3 (274712 downstream)																																			---	---	---	---
GPD1L	23171	broad.mit.edu	37	3	32200958	32200958	+	Intron	DEL	A	-	-	rs35234737		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32200958delA	uc003cew.2	+							NM_015141	NP_055956			glycerol-3-phosphate dehydrogenase 1-like						glycerol-3-phosphate catabolic process	glycerol-3-phosphate dehydrogenase complex	glycerol-3-phosphate dehydrogenase|NAD binding|protein homodimerization activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	34587586	34587586	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34587586delA								PDCD6IP (676392 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	34588038	34588039	+	IGR	DEL	TG	-	-	rs10575588		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34588038_34588039delTG								PDCD6IP (676844 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	36598551	36598552	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36598551_36598552delAG								STAC (9055 upstream) : DCLK3 (155361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	36635674	36635674	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36635674delA								STAC (46178 upstream) : DCLK3 (118239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	39214004	39214005	+	IGR	INS	-	T	T	rs140059530		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39214004_39214005insT								CSRNP1 (17951 upstream) : XIRP1 (10702 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41373698	41373699	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41373698_41373699insA	uc003ckv.3	-							NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41900162	41900163	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41900162_41900163insT	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41933865	41933865	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41933865delA	uc003ckv.3	-						ULK4_uc003ckw.2_Intron|ULK4_uc003ckx.1_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
NKTR	4820	broad.mit.edu	37	3	42678146	42678146	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42678146delA	uc003clo.2	+						NKTR_uc003clm.1_Intron|NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Intron|NKTR_uc003clr.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376			natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	43120115	43120116	+	IGR	DEL	CT	-	-	rs148122538		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43120115_43120116delCT								FAM198A (18412 upstream) : C3orf39 (613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	43709401	43709401	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43709401delA								ANO10 (45841 upstream) : ABHD5 (22974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	44123546	44123547	+	IGR	INS	-	CTCC	CTCC	rs146570357	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44123546_44123547insCTCC								ABHD5 (359330 upstream) : MIR138-1 (32157 downstream)																																			---	---	---	---
CLEC3B	7123	broad.mit.edu	37	3	45069517	45069518	+	Intron	INS	-	C	C	rs142519896	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45069517_45069518insC	uc003cok.3	+						CLEC3B_uc003col.2_5'Flank	NM_003278	NP_003269			C-type lectin domain family 3, member B						skeletal system development	extracellular space	protein binding|sugar binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	45209801	45209802	+	IGR	INS	-	AAA	AAA	rs10662728		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45209801_45209802insAAA								CDCP1 (21887 upstream) : TMEM158 (56155 downstream)																																			---	---	---	---
LIMD1	8994	broad.mit.edu	37	3	45644049	45644050	+	Intron	INS	-	C	C	rs147314465	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45644049_45644050insC	uc003coq.2	+							NM_014240	NP_055055			LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)														---	---	---	---
LIMD1	8994	broad.mit.edu	37	3	45654008	45654010	+	Intron	DEL	AGG	-	-	rs139445986		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45654008_45654010delAGG	uc003coq.2	+							NM_014240	NP_055055			LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)														---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46240696	46240697	+	Intron	DEL	TG	-	-	rs35161976		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46240696_46240697delTG	uc003cpg.1	+							NM_178329	NP_847899			CC chemokine receptor 3 isoform 1						cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	46312084	46312085	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46312084_46312085insT								CCR3 (3922 upstream) : CCR2 (83150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	46949123	46949126	+	IGR	DEL	TGTG	-	-	rs112845652		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46949123_46949126delTGTG								PTH1R (3837 upstream) : CCDC12 (14094 downstream)																																			---	---	---	---
KLHL18	23276	broad.mit.edu	37	3	47352504	47352504	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47352504delT	uc003crd.2	+						KLHL18_uc003crc.2_Intron|KLHL18_uc011bav.1_Intron	NM_025010	NP_079286			kelch-like 18												0		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)														---	---	---	---
MAP4	4134	broad.mit.edu	37	3	48048442	48048442	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48048442delA	uc003csb.2	-						MAP4_uc003csc.3_Intron|MAP4_uc011bbf.1_Intron|MAP4_uc003csf.3_Intron|MAP4_uc003csg.2_Intron	NM_002375	NP_002366			microtubule-associated protein 4 isoform 1						negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)														---	---	---	---
CELSR3	1951	broad.mit.edu	37	3	48710980	48710980	+	5'Flank	DEL	A	-	-	rs112012742		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48710980delA	uc003cuf.1	-							NM_001407	NP_001398			cadherin EGF LAG seven-pass G-type receptor 3						homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)														---	---	---	---
IP6K2	51447	broad.mit.edu	37	3	48727594	48727594	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48727594delA	uc003cup.2	-						IP6K2_uc003cuq.2_Intron	NM_001005909	NP_001005909			inositol hexaphosphate kinase 2 isoform a						negative regulation of cell growth|phosphatidylinositol phosphorylation|positive regulation of apoptosis|type I interferon-mediated signaling pathway	intermediate filament cytoskeleton|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0																		---	---	---	---
PRKAR2A	5576	broad.mit.edu	37	3	48860216	48860216	+	Intron	DEL	G	-	-	rs11326627		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48860216delG	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148			cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)														---	---	---	---
SLC25A20	788	broad.mit.edu	37	3	48921792	48921792	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48921792delT	uc003cva.3	-						SLC25A20_uc011bbw.1_Intron|SLC25A20_uc010hkj.2_Intron	NM_000387	NP_000378			carnitine/acylcarnitine translocase						carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)													---	---	---	---
QRICH1	54870	broad.mit.edu	37	3	49078773	49078774	+	Intron	DEL	TG	-	-	rs34898562		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49078773_49078774delTG	uc010hkq.2	-						QRICH1_uc003cvu.2_Intron|QRICH1_uc003cvv.2_Intron	NM_198880	NP_942581			glutamine-rich 1											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)														---	---	---	---
RBM6	10180	broad.mit.edu	37	3	50109842	50109843	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50109842_50109843insA	uc003cyc.2	+						RBM6_uc003cyd.2_Intron|RBM6_uc003cye.2_Intron|RBM6_uc011bdi.1_Intron|RBM6_uc010hld.1_Intron|RBM6_uc010hle.1_Intron|RBM6_uc010hlf.1_Intron	NM_005777	NP_005768			RNA binding motif protein 6						RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)														---	---	---	---
CACNA2D2	9254	broad.mit.edu	37	3	50537682	50537683	+	Intron	INS	-	C	C	rs143578015	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50537682_50537683insC	uc003daq.2	-						CACNA2D2_uc003dap.2_Intron	NM_006030	NP_006021			calcium channel, voltage-dependent, alpha						energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)													---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	50783540	50783541	+	Intron	INS	-	T	T	rs150867289		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50783540_50783541insT	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
GRM2	2912	broad.mit.edu	37	3	51738902	51738903	+	5'Flank	INS	-	GT	GT	rs138178730	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51738902_51738903insGT	uc010hlv.2	+						GRM2_uc003dbo.3_5'Flank|GRM2_uc010hlu.2_5'Flank	NM_000839	NP_000830			glutamate receptor, metabotropic 2 isoform a						synaptic transmission	integral to plasma membrane				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acamprosate(DB00659)|Nicotine(DB00184)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	51965748	51965749	+	IGR	INS	-	A	A	rs11446645		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51965748_51965749insA								IQCF1 (28362 upstream) : RRP9 (1697 downstream)																																			---	---	---	---
MUSTN1	389125	broad.mit.edu	37	3	52866685	52866685	+	Intron	DEL	T	-	-	rs11313924		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52866685delT	uc010hmq.1	-						ITIH4_uc011bem.1_5'Flank|ITIH4_uc011ben.1_5'Flank|ITIH4_uc003dfz.2_5'Flank|ITIH4_uc010hmp.1_5'Flank					Homo sapiens mRNA for hypothetical protein (ORF1), clone 03708.												0				BRCA - Breast invasive adenocarcinoma(193;6.56e-05)|Kidney(197;0.000586)|KIRC - Kidney renal clear cell carcinoma(197;0.000755)|OV - Ovarian serous cystadenocarcinoma(275;0.0471)														---	---	---	---
RFT1	91869	broad.mit.edu	37	3	53136551	53136551	+	Intron	DEL	G	-	-	rs891369	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53136551delG	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091			RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	53412282	53412282	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53412282delT								DCP1A (30645 upstream) : CACNA1D (116749 downstream)																																			---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54623583	54623584	+	Intron	INS	-	A	A	rs140008325	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54623583_54623584insA	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56377269	56377270	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56377269_56377270delAC	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
DNASE1L3	1776	broad.mit.edu	37	3	58185394	58185394	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58185394delA	uc003djo.1	-						DNASE1L3_uc011bfd.1_Intron|DNASE1L3_uc003djp.1_Intron|DNASE1L3_uc003djq.1_Intron	NM_004944	NP_004935			deoxyribonuclease I-like 3 precursor						apoptosis|DNA catabolic process	nucleus	calcium ion binding|DNA binding|endodeoxyribonuclease activity, producing 5'-phosphomonoesters			breast(2)|large_intestine(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	59137402	59137402	+	IGR	DEL	T	-	-	rs112469828		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59137402delT								C3orf67 (101644 upstream) : FHIT (597636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	59316171	59316171	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59316171delA								C3orf67 (280413 upstream) : FHIT (418867 downstream)																																			---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60659770	60659771	+	Intron	INS	-	A	A	rs144153177	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60659770_60659771insA	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
Unknown	0	broad.mit.edu	37	3	67085366	67085367	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67085366_67085367delCA								KBTBD8 (23736 upstream) : SUCLG2 (339778 downstream)																																			---	---	---	---
FRMD4B	23150	broad.mit.edu	37	3	69407652	69407653	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69407652_69407653insA	uc003dnv.2	-						FRMD4B_uc003dnw.2_Intron|FRMD4B_uc003dny.2_Intron	NM_015123	NP_055938			FERM domain containing 4B							cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	72521665	72521666	+	IGR	INS	-	G	G	rs142019269	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72521665_72521666insG								RYBP (25891 upstream) : SHQ1 (276764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72697354	72697354	+	IGR	DEL	T	-	-	rs34747404		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72697354delT								RYBP (201580 upstream) : SHQ1 (101076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72725154	72725154	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72725154delT								RYBP (229380 upstream) : SHQ1 (73276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72732097	72732098	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72732097_72732098insC								RYBP (236323 upstream) : SHQ1 (66332 downstream)																																			---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	79055413	79055413	+	Intron	DEL	C	-	-	rs67909236		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79055413delC	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron	NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	80003942	80003942	+	IGR	DEL	G	-	-	rs77429452		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80003942delG								ROBO1 (186883 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	80014190	80014193	+	IGR	DEL	ACAC	-	-	rs71631685		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80014190_80014193delACAC								ROBO1 (197131 upstream) : None (None downstream)																																			---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81541828	81541829	+	Intron	INS	-	TTCTCCCT	TTCTCCCT	rs149554537	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541828_81541829insTTCTCCCT	uc003dqg.2	-							NM_000158	NP_000149			glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
Unknown	0	broad.mit.edu	37	3	84950702	84950703	+	IGR	INS	-	T	T	rs143223897	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84950702_84950703insT								None (None upstream) : CADM2 (57430 downstream)																																			---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85171291	85171291	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85171291delT	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	86297757	86297757	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86297757delA								CADM2 (179809 upstream) : VGLL3 (689368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87365210	87365221	+	IGR	DEL	TATGATTACATG	-	-	rs76619980	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87365210_87365221delTATGATTACATG								POU1F1 (39473 upstream) : HTR1F (666505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87543762	87543763	+	IGR	INS	-	AAGG	AAGG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87543762_87543763insAAGG								POU1F1 (218025 upstream) : HTR1F (487963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88345876	88345876	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88345876delA								C3orf38 (138763 upstream) : EPHA3 (810798 downstream)																																			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89260890	89260892	+	Intron	DEL	CTC	-	-	rs9310114	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89260890_89260892delCTC	uc003dqy.2	+						EPHA3_uc003dqx.1_Intron|EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	89617725	89617725	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89617725delA								EPHA3 (86443 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	97572251	97572252	+	Intron	DEL	AC	-	-	rs141359748		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97572251_97572252delAC	uc011bgq.1	+											SubName: Full=cDNA FLJ60082, weakly similar to Uro-adherence factor A; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	99168579	99168580	+	IGR	INS	-	TCATC	TCATC	rs79423836		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99168579_99168580insTCATC								DCBLD2 (548046 upstream) : COL8A1 (188874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	100836257	100836258	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100836257_100836258insT								ABI3BP (123923 upstream) : IMPG2 (109030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	100904116	100904117	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100904116_100904117insA								ABI3BP (191782 upstream) : IMPG2 (41171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103878429	103878430	+	IGR	INS	-	T	T	rs33933933		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103878429_103878430insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104543171	104543172	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104543171_104543172insT								None (None upstream) : ALCAM (542541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104878720	104878722	+	IGR	DEL	CTC	-	-	rs76316530		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104878720_104878722delCTC								None (None upstream) : ALCAM (206991 downstream)																																			---	---	---	---
ALCAM	214	broad.mit.edu	37	3	105212430	105212431	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105212430_105212431insG	uc003dvx.2	+						ALCAM_uc003dvv.2_Intron|ALCAM_uc003dvw.1_Intron|ALCAM_uc003dvy.2_Intron|ALCAM_uc011bhh.1_Intron	NM_001627	NP_001618			activated leukocyte cell adhesion molecule						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	105594056	105594056	+	IGR	DEL	A	-	-	rs72297556		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105594056delA								CBLB (5790 upstream) : LOC100302640 (961604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	106339608	106339609	+	IGR	INS	-	GAAGGAAGGAAG	GAAGGAAGGAAG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106339608_106339609insGAAGGAAGGAAG								CBLB (751342 upstream) : LOC100302640 (216051 downstream)																																			---	---	---	---
LOC100302640	100302640	broad.mit.edu	37	3	106743613	106743613	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106743613delT	uc003dwf.3	-											Homo sapiens cDNA clone IMAGE:5284861.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	108464116	108464116	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108464116delA								DZIP3 (50424 upstream) : RETNLB (10370 downstream)																																			---	---	---	---
PHLDB2	90102	broad.mit.edu	37	3	111685396	111685397	+	Intron	DEL	TA	-	-	rs58758341	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111685396_111685397delTA	uc010hqa.2	+						PHLDB2_uc003dyc.2_Intron|PHLDB2_uc003dyd.2_Intron|PHLDB2_uc003dyg.2_Intron|PHLDB2_uc003dyh.2_Intron|PHLDB2_uc003dyi.2_Intron|PHLDB2_uc003dyj.2_Intron	NM_001134438	NP_001127910			pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6																		---	---	---	---
LSAMP	4045	broad.mit.edu	37	3	116129073	116129073	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116129073delA	uc003ebt.2	-						LSAMP_uc011bis.1_Intron	NM_002338	NP_002329			limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	118607980	118607981	+	IGR	INS	-	AAG	AAG	rs67513551		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118607980_118607981insAAG								None (None upstream) : IGSF11 (11500 downstream)																																			---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118802381	118802384	+	Intron	DEL	ACAA	-	-	rs13073678		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118802381_118802384delACAA	uc003eby.2	-						IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_152538	NP_689751			immunoglobulin superfamily, member 11 isoform a						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118845678	118845680	+	Intron	DEL	CAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118845678_118845680delCAA	uc003eby.2	-						IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_152538	NP_689751			immunoglobulin superfamily, member 11 isoform a						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
POPDC2	64091	broad.mit.edu	37	3	119386572	119386579	+	5'Flank	DEL	ACACAGAG	-	-	rs72012394	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119386572_119386579delACACAGAG	uc003ecy.1	-											Homo sapiens popeye protein 2 (POP2) mRNA, complete cds.							integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	120278179	120278180	+	IGR	INS	-	T	T	rs11454750		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120278179_120278180insT								FSTL1 (108261 upstream) : NDUFB4 (36948 downstream)																																			---	---	---	---
GTF2E1	2960	broad.mit.edu	37	3	120471969	120471969	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120471969delT	uc003edz.3	+							NM_005513	NP_005504			general transcription factor IIE, polypeptide 1,						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.159)														---	---	---	---
POLQ	10721	broad.mit.edu	37	3	121215028	121215029	+	Intron	INS	-	TT	TT	rs72498227		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121215028_121215029insTT	uc003eee.3	-							NM_199420	NP_955452			DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
CCDC58	131076	broad.mit.edu	37	3	122084233	122084233	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122084233delT	uc003eey.2	-							NM_001017928	NP_001017928			coiled-coil domain containing 58												0				GBM - Glioblastoma multiforme(114;0.148)														---	---	---	---
PARP9	83666	broad.mit.edu	37	3	122268288	122268288	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122268288delG	uc010hri.2	-						PARP9_uc003eff.3_Intron|PARP9_uc011bjs.1_Intron|PARP9_uc003efg.2_Intron|PARP9_uc003efi.2_Intron|PARP9_uc003efh.2_Intron|PARP9_uc003efj.2_Intron	NM_001146102	NP_001139574			poly (ADP-ribose) polymerase family, member 9						cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)														---	---	---	---
PARP14	54625	broad.mit.edu	37	3	122438902	122438903	+	Intron	INS	-	T	T	rs151330692		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122438902_122438903insT	uc003efq.3	+						PARP14_uc010hrk.2_Intron|PARP14_uc003efr.2_Intron|PARP14_uc003efs.1_Intron	NM_017554	NP_060024			poly (ADP-ribose) polymerase family, member 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	NAD+ ADP-ribosyltransferase activity			ovary(2)|breast(2)|lung(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(114;0.0531)														---	---	---	---
PDIA5	10954	broad.mit.edu	37	3	122847913	122847914	+	Intron	INS	-	AAAT	AAAT	rs143955762	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122847913_122847914insAAAT	uc003egc.1	+						PDIA5_uc003egd.1_Intron	NM_006810	NP_006801			protein disulfide isomerase A5 precursor						cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)														---	---	---	---
ADCY5	111	broad.mit.edu	37	3	123087599	123087600	+	Intron	INS	-	A	A	rs138058637		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123087599_123087600insA	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200			adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	124481609	124481610	+	IGR	INS	-	TATC	TATC	rs138438169	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124481609_124481610insTATC								UMPS (17571 upstream) : ITGB5 (186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	125118759	125118759	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125118759delT								ZNF148 (24561 upstream) : SNX4 (46736 downstream)																																			---	---	---	---
TXNRD3IT1	645840	broad.mit.edu	37	3	126319414	126319415	+	Intron	DEL	TT	-	-	rs72369665		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126319414_126319415delTT	uc003ejc.2	-							NM_001039783	NP_001034872			thioredoxin reductase 3 intronic transcript 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	126811019	126811020	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126811019_126811020delGA								PLXNA1 (54791 upstream) : TPRA1 (480888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	127272605	127272606	+	IGR	INS	-	A	A	rs112258965		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127272605_127272606insA								PLXNA1 (516377 upstream) : TPRA1 (19302 downstream)																																			---	---	---	---
MGLL	11343	broad.mit.edu	37	3	127447150	127447153	+	Intron	DEL	ATCC	-	-	rs144512182		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127447150_127447153delATCC	uc003ejx.2	-						MGLL_uc003ejw.2_Intron|MGLL_uc011bko.1_Intron|MGLL_uc010hsp.1_Intron|MGLL_uc003ejv.2_Intron	NM_001003794	NP_001003794			monoglyceride lipase isoform 2						arachidonic acid metabolic process|fatty acid biosynthetic process|inflammatory response|platelet activation|regulation of endocannabinoid signaling pathway|regulation of inflammatory response|regulation of sensory perception of pain|triglyceride catabolic process	plasma membrane	acylglycerol lipase activity|carboxylesterase activity|lysophospholipase activity|protein homodimerization activity				0																		---	---	---	---
RAB43	339122	broad.mit.edu	37	3	128810609	128810610	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128810609_128810610delAA	uc003eln.1	-						RAB43_uc003elo.1_Intron|RAB43_uc010hsy.1_Intron	NM_198490	NP_940892			RAB43 protein						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1																		---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129418685	129418685	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129418685delA	uc003emz.3	-						TMCC1_uc011blc.1_Intron|TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395			transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1																		---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129425844	129425844	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129425844delA	uc003emz.3	-						TMCC1_uc011blc.1_Intron|TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395			transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1																		---	---	---	---
COL6A4P2	646300	broad.mit.edu	37	3	129958721	129958722	+	Intron	INS	-	A	A	rs140957795		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129958721_129958722insA	uc011blf.1	+							NR_027898				Homo sapiens collagen VI alpha 4 pseudogene 2 (COL6A4P2), non-coding RNA.												0																		---	---	---	---
NCRNA00119	348808	broad.mit.edu	37	3	132459988	132459988	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132459988delT	uc010htu.1	+						NCRNA00119_uc003epg.1_Intron					Homo sapiens cDNA clone IMAGE:4826885.												0																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	132779083	132779083	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132779083delG	uc003eph.2	+						TMEM108_uc003epi.2_Intron	NM_023943	NP_076432			transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	132923976	132923977	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132923976_132923977insT	uc003eph.2	+						TMEM108_uc003epi.2_Intron|TMEM108_uc003epj.1_Intron|TMEM108_uc003epk.2_Intron	NM_023943	NP_076432			transmembrane protein 108 precursor							integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
SRPRB	58477	broad.mit.edu	37	3	133538763	133538764	+	3'UTR	DEL	TT	-	-	rs78963965		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133538763_133538764delTT	uc003epx.1	+	7						NM_021203	NP_067026			signal recognition particle receptor, beta							endoplasmic reticulum membrane|integral to membrane	GTP binding|protein binding|receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	133996746	133996746	+	IGR	DEL	G	-	-	rs74791253		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133996746delG								RYK (27160 upstream) : AMOTL2 (73948 downstream)																																			---	---	---	---
AMOTL2	51421	broad.mit.edu	37	3	134088856	134088856	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134088856delC	uc003eqf.2	-						AMOTL2_uc003eqg.1_Intron|AMOTL2_uc003eqh.1_Intron	NM_016201	NP_057285			angiomotin like 2											large_intestine(1)	1																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134512680	134512681	+	5'Flank	INS	-	GGGGC	GGGGC	rs146987905	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134512680_134512681insGGGGC	uc003eqt.2	+						EPHB1_uc010htz.1_5'Flank|EPHB1_uc011bly.1_5'Flank	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134546206	134546207	+	Intron	DEL	CA	-	-	rs34291875		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134546206_134546207delCA	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134652305	134652305	+	Intron	DEL	T	-	-	rs5852802		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134652305delT	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	135112355	135112358	+	IGR	DEL	GATT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135112355_135112358delGATT								EPHB1 (133050 upstream) : PPP2R3A (572209 downstream)																																			---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136384180	136384181	+	Intron	INS	-	A	A	rs139811193	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136384180_136384181insA	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron|STAG1_uc003ere.2_Intron	NM_005862	NP_005853			stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
IL20RB	53833	broad.mit.edu	37	3	136689513	136689513	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136689513delG	uc003eri.1	+						IL20RB_uc003erj.1_Intron	NM_144717	NP_653318			interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1																		---	---	---	---
CEP70	80321	broad.mit.edu	37	3	138240967	138240967	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138240967delC	uc003esl.2	-						CEP70_uc011bmk.1_Intron|CEP70_uc011bml.1_Intron|CEP70_uc011bmm.1_Intron|CEP70_uc003esm.2_Intron	NM_024491	NP_077817			centrosomal protein 70 kDa						G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	138695854	138695857	+	IGR	DEL	TGTG	-	-	rs143256064	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138695854_138695857delTGTG								C3orf72 (23024 upstream) : PRR23A (26948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	140762795	140762797	+	IGR	DEL	AAA	-	-	rs77731162		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140762795_140762797delAAA								SLC25A36 (64010 upstream) : SPSB4 (7946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	141582830	141582831	+	IGR	INS	-	T	T	rs28452526		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141582830_141582831insT								GRK7 (46940 upstream) : ATP1B3 (12639 downstream)																																			---	---	---	---
GK5	256356	broad.mit.edu	37	3	141899743	141899743	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141899743delA	uc003euq.1	-						GK5_uc003eup.1_Intron|GK5_uc010hus.1_Intron	NM_001039547	NP_001034636			glycerol kinase 5 (putative)						glycerol metabolic process		ATP binding|glycerol kinase activity				0																		---	---	---	---
XRN1	54464	broad.mit.edu	37	3	142037150	142037151	+	Intron	INS	-	T	T	rs141496562	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142037150_142037151insT	uc003eus.2	-						XRN1_uc010huu.2_Intron|XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron	NM_019001	NP_061874			5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143136390	143136390	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143136390delG	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143483934	143483937	+	Intron	DEL	TCTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143483934_143483937delTCTT	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144377761	144377762	+	IGR	INS	-	T	T	rs146117342	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144377761_144377762insT								C3orf58 (666552 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145236981	145236982	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145236981_145236982delCA								None (None upstream) : PLOD2 (550246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145402178	145402179	+	IGR	INS	-	T	T	rs76416196		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145402178_145402179insT								None (None upstream) : PLOD2 (385049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145460965	145460965	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145460965delT								None (None upstream) : PLOD2 (326263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	146767558	146767559	+	IGR	INS	-	A	A	rs143765100	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146767558_146767559insA								PLSCR5 (443555 upstream) : ZIC4 (336278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147103029	147103029	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147103029delA								PLSCR5 (779026 upstream) : ZIC4 (808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147452624	147452625	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147452624_147452625insT								ZIC1 (318120 upstream) : AGTR1 (963033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148077139	148077140	+	IGR	INS	-	CACA	CACA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148077139_148077140insCACA								ZIC1 (942635 upstream) : AGTR1 (338518 downstream)																																			---	---	---	---
HLTF	6596	broad.mit.edu	37	3	148780854	148780855	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148780854_148780855insT	uc003ewq.1	-						HLTF_uc003ewr.1_Intron|HLTF_uc003ews.1_Intron|HLTF_uc010hve.1_Intron	NM_139048	NP_620636			helicase-like transcription factor						chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	148953949	148953951	+	IGR	DEL	AAC	-	-	rs112455496		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148953949_148953951delAAC								CP (14117 upstream) : TM4SF18 (84905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	151297663	151297664	+	IGR	INS	-	AAGGAAGAAAGG	AAGGAAGAAAGG	rs145031240	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151297663_151297664insAAGGAAGAAAGG								IGSF10 (121166 upstream) : AADACL2 (154040 downstream)																																			---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	155978702	155978702	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155978702delA	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	156135508	156135509	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156135508_156135509insA	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Intron|KCNAB1_uc010hvt.1_Intron	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	156163348	156163348	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156163348delA	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron|KCNAB1_uc003fat.2_Intron|KCNAB1_uc010hvt.1_Intron	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	156495869	156495870	+	Intron	DEL	CA	-	-	rs55691224		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156495869_156495870delCA	uc003fax.1	-											Homo sapiens cDNA FLJ31839 fis, clone NT2RP7000086.																														---	---	---	---
LEKR1	389170	broad.mit.edu	37	3	156570521	156570522	+	Intron	INS	-	A	A	rs140310304	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156570521_156570522insA	uc003fbb.2	+						LEKR1_uc003fba.1_Intron					Homo sapiens cDNA FLJ16641 fis, clone TESTI4028958.												0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159273371	159273372	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159273371_159273372delTG	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
ARL14	80117	broad.mit.edu	37	3	160393683	160393686	+	5'Flank	DEL	GTGT	-	-	rs112491968		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160393683_160393686delGTGT	uc003fdq.2	+							NM_025047	NP_079323			ADP-ribosylation factor-like 14						small GTPase mediated signal transduction	intracellular	GTP binding				0			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)															---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160545487	160545493	+	Intron	DEL	TGACTAA	-	-	rs112256257		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160545487_160545493delTGACTAA	uc003fdr.2	+							NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	162120514	162120515	+	IGR	INS	-	TG	TG	rs139104961	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162120514_162120515insTG								OTOL1 (898786 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162652460	162652461	+	Intron	INS	-	AG	AG	rs145854897	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162652460_162652461insAG	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
SI	6476	broad.mit.edu	37	3	164711911	164711912	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164711911_164711912insA	uc003fei.2	-							NM_001041	NP_001032			sucrase-isomaltase						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)										HNSCC(35;0.089)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165133200	165133200	+	IGR	DEL	C	-	-	rs57235786		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165133200delC								SLITRK3 (218731 upstream) : BCHE (357494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166537771	166537771	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166537771delA								BCHE (982518 upstream) : ZBBX (420310 downstream)																																			---	---	---	---
ZBBX	79740	broad.mit.edu	37	3	167046265	167046266	+	Intron	INS	-	A	A	rs140932795	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167046265_167046266insA	uc003fep.2	-						ZBBX_uc011bpc.1_Intron|ZBBX_uc003feq.2_Intron	NM_024687	NP_078963			zinc finger, B-box domain containing							intracellular	zinc ion binding			ovary(2)	2																		---	---	---	---
WDR49	151790	broad.mit.edu	37	3	167321681	167321682	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167321681_167321682delTG	uc003fev.1	-						WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146			WD repeat domain 49											large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	168666941	168666942	+	IGR	INS	-	AC	AC	rs145227665	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168666941_168666942insAC								C3orf50 (118569 upstream) : MECOM (134345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168726406	168726409	+	IGR	DEL	GAGT	-	-	rs143882881		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168726406_168726409delGAGT								C3orf50 (178034 upstream) : MECOM (74878 downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169067362	169067362	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169067362delC	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
GPR160	26996	broad.mit.edu	37	3	169788883	169788884	+	Intron	INS	-	G	G	rs139511938	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169788883_169788884insG	uc003fgi.2	+						GPR160_uc010hwq.2_Intron	NM_014373	NP_055188			G protein-coupled receptor 160							integral to membrane|plasma membrane	G-protein coupled receptor activity				0	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)															---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170565841	170565842	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170565841_170565842delAC	uc011bpt.1	+							NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	170877058	170877058	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170877058delA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	171275606	171275606	+	IGR	DEL	G	-	-	rs11361800		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171275606delG								TNIK (97409 upstream) : PLD1 (43014 downstream)																																			---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171808216	171808219	+	Intron	DEL	AAAC	-	-	rs10576458		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171808216_171808219delAAAC	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171813583	171813586	+	Intron	DEL	AAAC	-	-	rs6148193		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171813583_171813586delAAAC	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	171899185	171899186	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171899185_171899186insA	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron|FNDC3B_uc003fhx.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
NCEH1	57552	broad.mit.edu	37	3	172412186	172412187	+	Intron	INS	-	TC	TC	rs72370651		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172412186_172412187insTC	uc011bpx.1	-						NCEH1_uc003fig.2_Intron|NCEH1_uc011bpw.1_Intron|NCEH1_uc011bpy.1_Intron	NM_001146276	NP_001139748			arylacetamide deacetylase-like 1 isoform a						lipid catabolic process	endoplasmic reticulum|integral to membrane|microsome	carboxylesterase activity				0																		---	---	---	---
ECT2	1894	broad.mit.edu	37	3	172536642	172536642	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172536642delA	uc003fii.2	+						ECT2_uc003fih.2_Intron|ECT2_uc003fij.1_Intron|ECT2_uc003fik.1_Intron|ECT2_uc003fil.1_Intron|ECT2_uc003fim.1_Intron	NM_018098	NP_060568			epithelial cell transforming sequence 2 oncogene						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)															---	---	---	---
SPATA16	83893	broad.mit.edu	37	3	172647347	172647348	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172647347_172647348delTC	uc003fin.3	-							NM_031955	NP_114161			spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	174273765	174273766	+	Intron	DEL	GT	-	-	rs149480566		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174273765_174273766delGT	uc003fir.2	+						uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	174444665	174444665	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174444665delA	uc003fir.2	+						uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	174493392	174493393	+	IGR	INS	-	TAAACA	TAAACA	rs148917498	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174493392_174493393insTAAACA								NLGN1 (492276 upstream) : NAALADL2 (83718 downstream)																																			---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174583659	174583659	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174583659delT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174835909	174835910	+	Intron	INS	-	T	T	rs148981824	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174835909_174835910insT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175000700	175000701	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175000700_175000701insT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175114904	175114906	+	Intron	DEL	AAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175114904_175114906delAAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	176961305	176961310	+	IGR	DEL	GAAACC	-	-	rs66954762		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176961305_176961310delGAAACC								TBL1XR1 (46257 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177210432	177210432	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177210432delA								TBL1XR1 (295384 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177400662	177400663	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177400662_177400663insA								TBL1XR1 (485614 upstream) : KCNMB2 (853561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177728453	177728454	+	IGR	DEL	TG	-	-	rs145446461		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177728453_177728454delTG								TBL1XR1 (813405 upstream) : KCNMB2 (525770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177731622	177731623	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177731622_177731623insT								TBL1XR1 (816574 upstream) : KCNMB2 (522601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	178242926	178242927	+	IGR	INS	-	T	T	rs142638127		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178242926_178242927insT								None (None upstream) : KCNMB2 (11297 downstream)																																			---	---	---	---
KCNMB2	10242	broad.mit.edu	37	3	178531736	178531737	+	Intron	INS	-	GTT	GTT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178531736_178531737insGTT	uc003fjd.2	+						uc003fjb.1_Intron|uc003fjc.1_Intron|KCNMB2_uc003fje.2_Intron|KCNMB2_uc003fjf.2_Intron|KCNMB2_uc011bqa.1_Intron|KCNMB2_uc011bqb.1_Intron	NM_181361	NP_852006			calcium-activated potassium channel beta 2						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)															---	---	---	---
USP13	8975	broad.mit.edu	37	3	179446770	179446771	+	Intron	INS	-	AGAGGG	AGAGGG	rs150181314	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179446770_179446771insAGAGGG	uc003fkh.2	+						USP13_uc003fkf.2_Intron	NM_003940	NP_003931			ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	180076715	180076715	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180076715delA								PEX5L (322198 upstream) : TTC14 (243203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	180563081	180563082	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180563081_180563082insA	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																														---	---	---	---
FXR1	8087	broad.mit.edu	37	3	180682809	180682810	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180682809_180682810insT	uc003fkq.2	+						FXR1_uc003fkp.2_Intron|FXR1_uc003fkr.2_Intron|FXR1_uc011bqj.1_Intron|FXR1_uc003fks.2_Intron|FXR1_uc011bqk.1_Intron|FXR1_uc011bql.1_Intron	NM_005087	NP_005078			fragile X mental retardation-related protein 1						apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	181221074	181221074	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181221074delA								DNAJC19 (513544 upstream) : SOX2OT (60435 downstream)																																			---	---	---	---
PSMD2	5708	broad.mit.edu	37	3	184019125	184019125	+	Intron	DEL	A	-	-	rs112455702		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184019125delA	uc003fnn.1	+						PSMD2_uc011brj.1_Intron|PSMD2_uc011brk.1_Intron	NM_002808	NP_002799			proteasome 26S non-ATPase subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)													---	---	---	---
C3orf70	285382	broad.mit.edu	37	3	184835207	184835210	+	Intron	DEL	ACAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184835207_184835210delACAC	uc003fpd.2	-							NM_001025266	NP_001020437			hypothetical protein LOC285382												0																		---	---	---	---
C3orf70	285382	broad.mit.edu	37	3	184835242	184835243	+	Intron	INS	-	AG	AG	rs3072374		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184835242_184835243insAG	uc003fpd.2	-							NM_001025266	NP_001020437			hypothetical protein LOC285382												0																		---	---	---	---
IGF2BP2	10644	broad.mit.edu	37	3	185383283	185383291	+	Intron	DEL	AGGAGGAGA	-	-	rs71999161		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185383283_185383291delAGGAGGAGA	uc003fpo.2	-						IGF2BP2_uc010hyi.2_Intron|IGF2BP2_uc010hyj.2_Intron|IGF2BP2_uc010hyk.2_Intron|IGF2BP2_uc010hyl.2_Intron|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron	NM_006548	NP_006539			insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	185731018	185731023	+	IGR	DEL	TGTGTG	-	-	rs138587607		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185731018_185731023delTGTGTG								TRA2B (75094 upstream) : ETV5 (33085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	186209419	186209419	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186209419delC	uc003fqd.1	-											Homo sapiens cDNA FLJ32735 fis, clone TESTI2001229.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	187479923	187479924	+	IGR	INS	-	GGTT	GGTT	rs139213631	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187479923_187479924insGGTT								BCL6 (16448 upstream) : LPP (391795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	187558476	187558477	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187558476_187558477insA								BCL6 (95001 upstream) : LPP (313242 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	187898336	187898336	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187898336delT	uc011bsg.1	+						FLJ42393_uc011bsh.1_RNA	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
LPP	4026	broad.mit.edu	37	3	188500153	188500153	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188500153delC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	189155573	189155575	+	IGR	DEL	TTG	-	-	rs62810561		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189155573_189155575delTTG								TPRG1 (114303 upstream) : TP63 (193641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	189875760	189875761	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189875760_189875761delAC								LEPREL1 (35534 upstream) : CLDN1 (147742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	189890997	189890998	+	IGR	INS	-	ATGT	ATGT	rs142151645	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189890997_189890998insATGT								LEPREL1 (50771 upstream) : CLDN1 (132505 downstream)																																			---	---	---	---
CLDN1	9076	broad.mit.edu	37	3	190040814	190040815	+	5'Flank	INS	-	AA	AA	rs73192411		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190040814_190040815insAA	uc003fsh.2	-							NM_021101	NP_066924			claudin 1						calcium-independent cell-cell adhesion|interspecies interaction between organisms	integral to plasma membrane|tight junction	identical protein binding|structural molecule activity			lung(1)	1	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	190206990	190207013	+	IGR	DEL	CTTCCTTCCTTCCTTCCTCTCTTC	-	-	rs66873658		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190206990_190207013delCTTCCTTCCTTCCTTCCTCTCTTC								TMEM207 (39325 upstream) : IL1RAP (24878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190514840	190514841	+	IGR	INS	-	AT	AT	rs138418741	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190514840_190514841insAT								IL1RAP (138997 upstream) : LOC647309 (55685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190516198	190516199	+	IGR	INS	-	TG	TG	rs140534313		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190516198_190516199insTG								IL1RAP (140355 upstream) : LOC647309 (54327 downstream)																																			---	---	---	---
CCDC50	152137	broad.mit.edu	37	3	191107825	191107825	+	Intron	DEL	T	-	-	rs67236627		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191107825delT	uc003fsw.2	+						CCDC50_uc003fsv.2_Intron	NM_174908	NP_777568			Ymer protein short isoform							cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	191156222	191156223	+	IGR	INS	-	TCCT	TCCT	rs148729910	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191156222_191156223insTCCT								CCDC50 (39764 upstream) : PYDC2 (22729 downstream)																																			---	---	---	---
FAM43A	131583	broad.mit.edu	37	3	194409746	194409746	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194409746delA	uc003fuj.2	+	1						NM_153690	NP_710157			hypothetical protein LOC131583											central_nervous_system(1)	1	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)														---	---	---	---
C3orf21	152002	broad.mit.edu	37	3	194880831	194880832	+	Intron	INS	-	A	A	rs140353332	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194880831_194880832insA	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744			hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)														---	---	---	---
ACAP2	23527	broad.mit.edu	37	3	195098785	195098788	+	Intron	DEL	GAGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195098785_195098788delGAGG	uc003fun.3	-						ACAP2_uc003fuo.2_Intron	NM_012287	NP_036419			centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	195436325	195436326	+	Intron	INS	-	G	G	rs144844794		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195436325_195436326insG	uc003fux.1	+											Homo sapiens cDNA FLJ46488 fis, clone THYMU3026869.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195889900	195889900	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195889900delT								TFRC (80868 upstream) : ZDHHC19 (34424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195893659	195893660	+	IGR	INS	-	A	A	rs56088900		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195893659_195893660insA								TFRC (84627 upstream) : ZDHHC19 (30664 downstream)																																			---	---	---	---
FBXO45	200933	broad.mit.edu	37	3	196297137	196297137	+	Intron	DEL	T	-	-	rs68172877		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196297137delT	uc010iai.2	+						WDR53_uc003fwt.2_5'Flank	NM_001105573	NP_001099043			F-box protein 45						nervous system development|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	cell junction|postsynaptic membrane|presynaptic membrane	protein binding			skin(1)	1	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197133510	197133510	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197133510delT								DLG1 (107367 upstream) : BDH1 (103145 downstream)																																			---	---	---	---
FAM157A	728262	broad.mit.edu	37	3	197900128	197900131	+	Intron	DEL	GGTA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197900128_197900131delGGTA	uc011bup.1	+						FAM157A_uc011buq.1_Intron	NM_001145248	NP_001138720			family with sequence similarity 157, member A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	1516496	1516498	+	IGR	DEL	TGA	-	-	rs148365881	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1516496_1516498delTGA								CRIPAK (126714 upstream) : FAM53A (125111 downstream)																																			---	---	---	---
POLN	353497	broad.mit.edu	37	4	2148231	2148233	+	Intron	DEL	CAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2148231_2148233delCAA	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524			DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)										DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
GRK4	2868	broad.mit.edu	37	4	3038771	3038772	+	Intron	INS	-	GT	GT	rs34590630		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3038771_3038772insGT	uc003ggn.1	+						GRK4_uc003ggo.1_Intron|GRK4_uc003ggp.1_Intron|GRK4_uc003ggq.1_Intron	NM_182982	NP_892027			G protein-coupled receptor kinase 4 isoform							cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3537336	3537336	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3537336delA								LRPAP1 (3112 upstream) : ADRA2C (230739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3600585	3600586	+	IGR	INS	-	GTGA	GTGA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3600585_3600586insGTGA								LRPAP1 (66361 upstream) : ADRA2C (167489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3614431	3614431	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3614431delG								LRPAP1 (80207 upstream) : ADRA2C (153644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3860341	3860341	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3860341delC								ADRA2C (90090 upstream) : LOC348926 (83329 downstream)																																			---	---	---	---
STX18	53407	broad.mit.edu	37	4	4482163	4482163	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4482163delG	uc003gic.2	-							NM_016930	NP_058626			syntaxin 18						ER to Golgi vesicle-mediated transport|intracellular protein transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	SNAP receptor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)												OREG0016055	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	4	4660977	4660978	+	Intron	INS	-	AA	AA	rs34590808		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4660977_4660978insAA	uc003gid.2	+											Homo sapiens, clone IMAGE:5204729, mRNA.																														---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7526312	7526313	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7526312_7526313insT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	7964478	7964478	+	IGR	DEL	C	-	-	rs35527816		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7964478delC								AFAP1 (22825 upstream) : ABLIM2 (2560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	10480679	10480679	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10480679delT								ZNF518B (21647 upstream) : CLNK (11160 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	11699240	11699241	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11699240_11699241insT								HS3ST1 (268703 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14219508	14219509	+	IGR	INS	-	AAGAGACACTATAGTGTCTCTTACAAC	AAGAGACACTATAGTGTCTCTTACAAC	rs147584656	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14219508_14219509insAAGAGACACTATAGTGTCTCTTACAAC								BOD1L (590180 upstream) : CPEB2 (786013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14246587	14246588	+	IGR	INS	-	TG	TG	rs140598575	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14246587_14246588insTG								BOD1L (617259 upstream) : CPEB2 (758934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14650781	14650782	+	Intron	DEL	TG	-	-	rs143383825		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14650781_14650782delTG	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	19883460	19883461	+	IGR	INS	-	C	C	rs71179257	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19883460_19883461insC								None (None upstream) : SLIT2 (371774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	19883718	19883719	+	IGR	DEL	TG	-	-	rs149716022		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19883718_19883719delTG								None (None upstream) : SLIT2 (371516 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20855228	20855229	+	Intron	INS	-	CAAAAG	CAAAAG	rs143110247	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20855228_20855229insCAAAAG	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron|KCNIP4_uc010iel.2_Intron|KCNIP4_uc003gqd.3_Intron	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21323428	21323428	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21323428delA	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	23390919	23390920	+	IGR	INS	-	TCA	TCA	rs149342052	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23390919_23390920insTCA								GBA3 (569728 upstream) : PPARGC1A (402725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	23590846	23590847	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23590846_23590847insG								GBA3 (769655 upstream) : PPARGC1A (202798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	23776873	23776874	+	IGR	INS	-	TT	TT	rs35219026		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23776873_23776874insTT								GBA3 (955682 upstream) : PPARGC1A (16771 downstream)																																			---	---	---	---
CCDC149	91050	broad.mit.edu	37	4	24821785	24821786	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24821785_24821786delCA	uc011bxr.1	-						CCDC149_uc003grc.2_Intron|CCDC149_uc003grb.2_Intron|CCDC149_uc003grd.2_Intron|CCDC149_uc011bxq.1_Intron	NM_173463	NP_775734			coiled-coil domain containing 149 isoform 1												0		Breast(46;0.173)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	25497611	25497612	+	IGR	INS	-	CTTT	CTTT	rs144415784	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25497611_25497612insCTTT								ANAPC4 (77492 upstream) : SLC34A2 (159823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27773184	27773184	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27773184delA								STIM2 (747376 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28736642	28736642	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28736642delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29827024	29827025	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29827024_29827025insG								None (None upstream) : PCDH7 (895012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	30567496	30567497	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30567496_30567497insT								None (None upstream) : PCDH7 (154540 downstream)																																			---	---	---	---
PCDH7	5099	broad.mit.edu	37	4	30940104	30940105	+	Intron	DEL	AC	-	-	rs67269463		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30940104_30940105delAC	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580			protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	31633972	31633973	+	IGR	INS	-	AAAG	AAAG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31633972_31633973insAAAG								PCDH7 (485551 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31699331	31699331	+	IGR	DEL	A	-	-	rs140751790		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31699331delA								PCDH7 (550910 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32869848	32869849	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32869848_32869849delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	34749863	34749864	+	IGR	DEL	TG	-	-	rs34186023		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34749863_34749864delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	34950497	34950498	+	IGR	INS	-	A	A	rs138186983		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34950497_34950498insA								None (None upstream) : ARAP2 (999346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	36467027	36467028	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36467027_36467028delTC								MIR1255B-1 (38977 upstream) : KIAA1239 (779662 downstream)																																			---	---	---	---
FAM114A1	92689	broad.mit.edu	37	4	38871340	38871341	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38871340_38871341insT	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron|FAM114A1_uc011byg.1_Intron	NM_138389	NP_612398			hypothetical protein LOC92689							cytoplasm				ovary(1)	1																		---	---	---	---
APBB2	323	broad.mit.edu	37	4	40984470	40984473	+	Intron	DEL	GAAT	-	-	rs28410225	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40984470_40984473delGAAT	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
KCTD8	386617	broad.mit.edu	37	4	44191667	44191668	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44191667_44191668delCA	uc003gwu.2	-							NM_198353	NP_938167			potassium channel tetramerisation domain							cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3															HNSCC(17;0.042)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45924477	45924477	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45924477delT								None (None upstream) : GABRG1 (113312 downstream)																																			---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47034104	47034104	+	Intron	DEL	G	-	-	rs67779259		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47034104delG	uc003gxh.2	+						GABRB1_uc011bze.1_Intron|GABRB1_uc011bzd.1_Intron|GABRB1_uc010igg.2_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47209710	47209711	+	Intron	INS	-	AT	AT	rs79924109		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47209710_47209711insAT	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
TXK	7294	broad.mit.edu	37	4	48130505	48130506	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48130505_48130506insT	uc003gxx.3	-						TXK_uc003gxy.1_Intron	NM_003328	NP_003319			TXK tyrosine kinase							cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49241350	49241350	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49241350delG								CWH43 (177257 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49535586	49535586	+	IGR	DEL	C	-	-	rs57914280		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49535586delC								CWH43 (471493 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53012362	53012363	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53012362_53012363insT								SPATA18 (48905 upstream) : USP46 (444766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53365811	53365811	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53365811delT								SPATA18 (402354 upstream) : USP46 (91318 downstream)																																			---	---	---	---
USP46	64854	broad.mit.edu	37	4	53512146	53512147	+	Intron	DEL	TT	-	-	rs35181985		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53512146_53512147delTT	uc003gzn.2	-						USP46_uc003gzm.3_Intron|USP46_uc011bzr.1_Intron|USP46_uc011bzs.1_Intron	NM_022832	NP_073743			ubiquitin specific peptidase 46 isoform 1						behavior|protein deubiquitination|regulation of synaptic transmission, GABAergic|ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(32;0.0295)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	56985495	56985496	+	IGR	INS	-	T	T	rs113862163		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56985495_56985496insT								CEP135 (85969 upstream) : KIAA1211 (50865 downstream)																																			---	---	---	---
SRP72	6731	broad.mit.edu	37	4	57345807	57345807	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57345807delG	uc003hbv.2	+						SRP72_uc010ihe.2_Intron|SRP72_uc003hbw.1_Intron	NM_006947	NP_008878			signal recognition particle 72kDa						response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	58031190	58031191	+	Intron	DEL	CC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58031190_58031191delCC	uc003hco.2	+											Homo sapiens, clone IMAGE:5722917, mRNA.																												OREG0016209	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	4	58977601	58977602	+	IGR	INS	-	AGTG	AGTG	rs142592404	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58977601_58977602insAGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	60989669	60989669	+	IGR	DEL	A	-	-	rs35997295		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:60989669delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	62006145	62006147	+	IGR	DEL	TCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62006145_62006147delTCT								None (None upstream) : LPHN3 (60827 downstream)																																			---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62431255	62431255	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62431255delT	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc010ihg.1_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	63085787	63085787	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63085787delA								LPHN3 (147620 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65439926	65439926	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65439926delT								TECRL (164748 upstream) : EPHA5 (745356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67946078	67946079	+	IGR	INS	-	GA	GA	rs151187539	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67946078_67946079insGA								MIR1269 (803432 upstream) : CENPC1 (391910 downstream)																																			---	---	---	---
TMPRSS11D	9407	broad.mit.edu	37	4	68745189	68745190	+	Intron	INS	-	A	A	rs146157783		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68745189_68745190insA	uc003hdq.2	-						LOC550112_uc003hdl.3_Intron|TMPRSS11D_uc011caj.1_Intron	NM_004262	NP_004253			transmembrane protease, serine 11D						proteolysis|respiratory gaseous exchange	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	70066031	70066031	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70066031delT	uc003hei.1	+											Homo sapiens cDNA FLJ42278 fis, clone TLIVE2002562.																														---	---	---	---
SLC4A4	8671	broad.mit.edu	37	4	72397544	72397545	+	Intron	DEL	AA	-	-	rs5859267		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72397544_72397545delAA	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc010iid.2_Intron	NM_001098484	NP_001091954			solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	72467386	72467386	+	IGR	DEL	A	-	-	rs33996837		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72467386delA								SLC4A4 (29583 upstream) : GC (140027 downstream)																																			---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73421894	73421894	+	Intron	DEL	G	-	-	rs35472144		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73421894delG	uc003hgk.1	-							NM_014243	NP_055058			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77415312	77415313	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77415312_77415313insT	uc011cbx.1	+							NM_020859	NP_065910			shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77702934	77702934	+	3'UTR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77702934delT	uc011cbx.1	+	11					SHROOM3_uc003hkg.2_3'UTR	NM_020859	NP_065910			shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78596638	78596639	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78596638_78596639insA								CXCL13 (63652 upstream) : CNOT6L (37903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	78964940	78964947	+	IGR	DEL	CTTTCTTT	-	-	rs58709113		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78964940_78964947delCTTTCTTT								MRPL1 (90996 upstream) : FRAS1 (13777 downstream)																																			---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79199614	79199614	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79199614delA	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc003hky.1_Intron|FRAS1_uc003hkz.2_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79201734	79201735	+	Intron	INS	-	TT	TT	rs34405763		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79201734_79201735insTT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron|FRAS1_uc003hky.1_Intron|FRAS1_uc003hkz.2_Intron	NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	80125779	80125780	+	Intron	INS	-	TTGT	TTGT	rs144225645	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80125779_80125780insTTGT	uc003hlr.1	+						uc003hls.2_Intron					Homo sapiens full length insert cDNA clone YY75G10.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	80126082	80126083	+	Intron	INS	-	ATACAC	ATACAC	rs142300602	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80126082_80126083insATACAC	uc003hlr.1	+						uc003hls.2_Intron					Homo sapiens full length insert cDNA clone YY75G10.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	80277077	80277077	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80277077delA								NAA11 (29906 upstream) : GK2 (50431 downstream)																																			---	---	---	---
C4orf22	255119	broad.mit.edu	37	4	81769365	81769365	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81769365delA	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983			hypothetical protein LOC255119											skin(2)	2																		---	---	---	---
SCD5	79966	broad.mit.edu	37	4	83650787	83650788	+	Intron	INS	-	T	T	rs72609301	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83650787_83650788insT	uc003hna.2	-						SCD5_uc003hnb.3_Intron|SCD5_uc003hnc.2_Intron	NM_001037582	NP_001032671			stearoyl-CoA desaturase 5 isoform a						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	iron ion binding|stearoyl-CoA 9-desaturase activity			ovary(1)	1		Colorectal(4;0.0323)|Hepatocellular(203;0.115)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	84577147	84577148	+	IGR	INS	-	T	T	rs74444687		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84577147_84577148insT								AGPAT9 (50122 upstream) : NKX6-1 (837288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86057387	86057388	+	IGR	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86057387_86057388insTT								C4orf12 (129219 upstream) : ARHGAP24 (338896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	86069945	86069946	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:86069945_86069946delGT								C4orf12 (141777 upstream) : ARHGAP24 (326338 downstream)																																			---	---	---	---
FAM13A	10144	broad.mit.edu	37	4	89684429	89684432	+	Intron	DEL	TTCA	-	-	rs36161354		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89684429_89684432delTTCA	uc003hse.1	-						FAM13A_uc003hsb.1_Intron|FAM13A_uc003hsd.1_Intron|FAM13A_uc003hsc.1_Intron|FAM13A_uc011cdq.1_Intron|FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsg.1_Intron|FAM13A_uc010ikr.1_Intron	NM_014883	NP_055698			family with sequence similarity 13, member A1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	90111871	90111871	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90111871delT								TIGD2 (75821 upstream) : GPRIN3 (53558 downstream)																																			---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	91129072	91129072	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91129072delG	uc003hsv.3	+						FAM190A_uc003hsu.3_Intron|FAM190A_uc010ikv.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	96741080	96741081	+	IGR	INS	-	AC	AC	rs143141446	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96741080_96741081insAC								UNC5C (270918 upstream) : PDHA2 (20158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	98270483	98270484	+	IGR	INS	-	AT	AT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98270483_98270484insAT								None (None upstream) : C4orf37 (209550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	99372220	99372220	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99372220delT								RAP1GDS1 (7210 upstream) : TSPAN5 (21189 downstream)																																			---	---	---	---
SLC39A8	64116	broad.mit.edu	37	4	103212480	103212481	+	Intron	INS	-	CA	CA	rs149615371	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103212480_103212481insCA	uc003hwb.1	-						SLC39A8_uc011ceo.1_Intron|SLC39A8_uc003hwa.1_Intron|SLC39A8_uc003hwc.2_Intron	NM_022154	NP_071437			solute carrier family 39 (zinc transporter),							integral to membrane|organelle membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	104313208	104313209	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104313208_104313209delTG								CENPE (193642 upstream) : TACR3 (197416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	104480749	104480749	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104480749delC								CENPE (361183 upstream) : TACR3 (29876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	105750086	105750087	+	IGR	INS	-	A	A	rs34496990		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105750086_105750087insA								CXXC4 (334028 upstream) : TET2 (317856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	106266905	106266905	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106266905delT								TET2 (65947 upstream) : PPA2 (23330 downstream)																																			---	---	---	---
AIMP1	9255	broad.mit.edu	37	4	107248412	107248413	+	Intron	INS	-	CT	CT	rs146672534	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107248412_107248413insCT	uc011cfg.1	+						AIMP1_uc003hyg.2_Intron|AIMP1_uc003hyh.2_Intron	NM_001142415	NP_001135887			small inducible cytokine subfamily E, member 1						angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	111254433	111254433	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111254433delT								ELOVL6 (134613 upstream) : ENPEP (142796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	115234021	115234022	+	IGR	DEL	AA	-	-	rs149262717		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115234021_115234022delAA								ARSJ (333143 upstream) : UGT8 (285589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	115319169	115319169	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115319169delG								ARSJ (418291 upstream) : UGT8 (200442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	115390073	115390074	+	IGR	INS	-	A	A	rs141229398	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115390073_115390074insA								ARSJ (489195 upstream) : UGT8 (129537 downstream)																																			---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115965863	115965863	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115965863delA	uc003ibu.2	-						NDST4_uc010imw.2_Intron	NM_022569	NP_072091			heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	117368788	117368789	+	IGR	INS	-	AA	AA	rs145420512	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117368788_117368789insAA								MIR1973 (147864 upstream) : TRAM1L1 (635927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	117385168	117385168	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117385168delA								MIR1973 (164244 upstream) : TRAM1L1 (619548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118606622	118606623	+	IGR	INS	-	C	C	rs140094107	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118606622_118606623insC								TRAM1L1 (599886 upstream) : NDST3 (348150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	120937911	120937911	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120937911delT								PDE5A (387930 upstream) : MAD2L1 (42668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	121135263	121135264	+	IGR	INS	-	TT	TT	rs72353912		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121135263_121135264insTT								MAD2L1 (147250 upstream) : PRDM5 (480666 downstream)																																			---	---	---	---
PRDM5	11107	broad.mit.edu	37	4	121828490	121828490	+	Intron	DEL	A	-	-	rs71597100		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121828490delA	uc003idn.2	-						PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron|PRDM5_uc010inf.2_Intron|PRDM5_uc003idp.1_Intron	NM_018699	NP_061169			PR domain containing 5						histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	122484019	122484020	+	IGR	INS	-	A	A	rs3030414		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122484019_122484020insA								QRFPR (181838 upstream) : ANXA5 (105133 downstream)																																			---	---	---	---
LOC285419	285419	broad.mit.edu	37	4	124731078	124731078	+	Intron	DEL	A	-	-	rs113506903		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124731078delA	uc011cgn.1	+						LOC285419_uc003ifd.2_Intron	NR_027105				Homo sapiens mRNA; cDNA DKFZp686P12109 (from clone DKFZp686P12109).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	124864759	124864759	+	IGR	DEL	T	-	-	rs28886964	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124864759delT								LOC285419 (13241 upstream) : ANKRD50 (720709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	125480953	125480954	+	5'Flank	DEL	AT	-	-	rs145374750		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125480953_125480954delAT	uc003ife.1	-											Homo sapiens cDNA FLJ32893 fis, clone TESTI2004993.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	126212223	126212223	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126212223delT								ANKRD50 (578336 upstream) : FAT4 (25344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	126967682	126967682	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126967682delC								MIR2054 (539220 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	126979128	126979129	+	IGR	INS	-	TA	TA	rs144491418	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126979128_126979129insTA								MIR2054 (550666 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128341271	128341276	+	IGR	DEL	CACACC	-	-	rs71859286		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128341271_128341276delCACACC								None (None upstream) : INTU (212844 downstream)																																			---	---	---	---
LARP1B	55132	broad.mit.edu	37	4	129093070	129093071	+	Intron	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129093070_129093071delTT	uc003iga.2	+						LARP1B_uc003igc.2_Intron|LARP1B_uc003igb.1_Intron	NM_018078	NP_060548			La ribonucleoprotein domain family member 2								RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	129457072	129457072	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129457072delA								PGRMC2 (248124 upstream) : PHF17 (273707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	130260343	130260343	+	IGR	DEL	A	-	-	rs71589038		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130260343delA								C4orf33 (226501 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131045213	131045214	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131045213_131045214insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	132313426	132313426	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132313426delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133463841	133463841	+	IGR	DEL	T	-	-	rs76836129	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133463841delT								None (None upstream) : PCDH10 (606629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135879015	135879015	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135879015delA								PABPC4L (756112 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136701301	136701302	+	IGR	INS	-	A	A	rs139922885	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136701301_136701302insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137402255	137402256	+	IGR	INS	-	A	A	rs140145142	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137402255_137402256insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137510912	137510913	+	IGR	INS	-	TT	TT	rs147717726		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137510912_137510913insTT								None (None upstream) : PCDH18 (929163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137888335	137888336	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137888335_137888336delTG								None (None upstream) : PCDH18 (551740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138103447	138103450	+	IGR	DEL	GTCA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138103447_138103450delGTCA								None (None upstream) : PCDH18 (336626 downstream)																																			---	---	---	---
ELF2	1998	broad.mit.edu	37	4	140013568	140013572	+	Intron	DEL	TACAT	-	-	rs142909700		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140013568_140013572delTACAT	uc003ihp.1	-							NM_201999	NP_973728			E74-like factor 2 (ets domain transcription						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	140129283	140129284	+	IGR	INS	-	GAGA	GAGA	rs143997839	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140129283_140129284insGAGA								ELF2 (30911 upstream) : C4orf49 (58033 downstream)																																			---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140990479	140990484	+	Intron	DEL	AGAAGG	-	-	rs35392493		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140990479_140990484delAGAAGG	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	142172398	142172399	+	IGR	INS	-	T	T	rs113626754		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142172398_142172399insT								ZNF330 (16550 upstream) : IL15 (385355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	142466486	142466487	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142466486_142466487insA								ZNF330 (310638 upstream) : IL15 (91267 downstream)																																			---	---	---	---
INPP4B	8821	broad.mit.edu	37	4	143111899	143111900	+	Intron	DEL	GC	-	-	rs72385038	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143111899_143111900delGC	uc003iix.3	-						INPP4B_uc003iiw.3_Intron|INPP4B_uc011chm.1_Intron|INPP4B_uc011chn.1_Intron|INPP4B_uc011cho.1_Intron|INPP4B_uc011chp.1_Intron	NM_003866	NP_003857			inositol polyphosphate-4-phosphatase, type II,						signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	144244613	144244614	+	IGR	INS	-	T	T	rs71588242		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144244613_144244614insT								USP38 (101473 upstream) : GAB1 (13369 downstream)																																			---	---	---	---
GAB1	2549	broad.mit.edu	37	4	144259267	144259267	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144259267delT	uc003ije.2	+						GAB1_uc003ijd.2_Intron	NM_002039	NP_002030			GRB2-associated binding protein 1 isoform b						cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)																	---	---	---	---
GAB1	2549	broad.mit.edu	37	4	144294198	144294203	+	Intron	DEL	ACACAC	-	-	rs3049717		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144294198_144294203delACACAC	uc003ije.2	+						GAB1_uc003ijd.2_Intron	NM_002039	NP_002030			GRB2-associated binding protein 1 isoform b						cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)																	---	---	---	---
GYPA	2993	broad.mit.edu	37	4	145022103	145022104	+	Intron	INS	-	T	T	rs140408861	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145022103_145022104insT	uc003ijn.2	-											SubName: Full=Glycophorin MiX; Flags: Fragment;						interspecies interaction between organisms	membrane fraction	receptor activity			central_nervous_system(2)	2	all_hematologic(180;0.15)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	148292867	148292868	+	IGR	INS	-	TTT	TTT	rs151228338	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148292867_148292868insTTT								MIR548G (26998 upstream) : EDNRA (109039 downstream)																																			---	---	---	---
NR3C2	4306	broad.mit.edu	37	4	149245020	149245021	+	Intron	INS	-	T	T	rs144759427	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149245020_149245021insT	uc003ilj.3	-						NR3C2_uc003ilk.3_Intron|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892			nuclear receptor subfamily 3, group C, member 2						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	149942047	149942050	+	IGR	DEL	AACA	-	-	rs66484570		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149942047_149942050delAACA								NR3C2 (578404 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	150634913	150634913	+	Intron	DEL	C	-	-	rs34186830		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150634913delC	uc003ill.2	-											Homo sapiens cDNA clone IMAGE:5295442.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	150681175	150681176	+	Intron	INS	-	AAGGA	AAGGA	rs142645861	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150681175_150681176insAAGGA	uc003ill.2	-											Homo sapiens cDNA clone IMAGE:5295442.																														---	---	---	---
DCLK2	166614	broad.mit.edu	37	4	151108046	151108047	+	Intron	INS	-	TGTG	TGTG	rs146351115	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151108046_151108047insTGTG	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350			doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	152029269	152029269	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152029269delT								RPS3A (3467 upstream) : SH3D19 (12164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	152173573	152173573	+	IGR	DEL	T	-	-	rs36035770		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152173573delT								SH3D19 (24391 upstream) : PRSS48 (24752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	152216608	152216608	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152216608delT								PRSS48 (4005 upstream) : FAM160A1 (113790 downstream)																																			---	---	---	---
FAM160A1	729830	broad.mit.edu	37	4	152519231	152519231	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152519231delA	uc003imj.2	+							NM_001109977	NP_001103447			hypothetical protein LOC729830												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	152917308	152917309	+	IGR	INS	-	C	C	rs150727111	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152917308_152917309insC								PET112L (235162 upstream) : FBXW7 (325102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	153905409	153905409	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153905409delC								FHDC1 (4561 upstream) : TRIM2 (168861 downstream)																																			---	---	---	---
RNF175	285533	broad.mit.edu	37	4	154637238	154637239	+	Intron	DEL	AG	-	-	rs147798068		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154637238_154637239delAG	uc003int.2	-						RNF175_uc003inu.1_Intron	NM_173662	NP_775933			ring finger protein 175							integral to membrane	zinc ion binding			ovary(1)|pancreas(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	154847303	154847304	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154847303_154847304delAC								SFRP2 (137075 upstream) : DCHS2 (308223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	155455302	155455305	+	IGR	DEL	TTTT	-	-	rs141678659		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155455302_155455305delTTTT								DCHS2 (42372 upstream) : PLRG1 (2358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	155892287	155892288	+	IGR	INS	-	TGTG	TGTG	rs138804077	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155892287_155892288insTGTG								RBM46 (142323 upstream) : NPY2R (237493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	157330201	157330202	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157330201_157330202insT								CTSO (455153 upstream) : PDGFC (352562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	157392578	157392579	+	IGR	DEL	GT	-	-	rs112705452		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157392578_157392579delGT								CTSO (517530 upstream) : PDGFC (290185 downstream)																																			---	---	---	---
C4orf45	152940	broad.mit.edu	37	4	159877225	159877226	+	Intron	DEL	CT	-	-	rs144358214		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159877225_159877226delCT	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756			hypothetical protein LOC152940												0																		---	---	---	---
C4orf45	152940	broad.mit.edu	37	4	159958932	159958933	+	5'Flank	DEL	AT	-	-	rs10572723		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159958932_159958933delAT	uc003iqf.1	-						C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756			hypothetical protein LOC152940												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	160100357	160100358	+	IGR	INS	-	A	A	rs147222147	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160100357_160100358insA								C4orf45 (76252 upstream) : RAPGEF2 (88640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	160987157	160987159	+	IGR	DEL	TTG	-	-	rs111564880		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160987157_160987159delTTG								RAPGEF2 (705858 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163122612	163122613	+	IGR	INS	-	TTTA	TTTA	rs35338481		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163122612_163122613insTTTA								FSTL5 (37426 upstream) : NAF1 (925247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	163904422	163904424	+	IGR	DEL	TGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:163904422_163904424delTGT								FSTL5 (819236 upstream) : NAF1 (143436 downstream)																																			---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	164540922	164540923	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164540922_164540923insA	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	165404623	165404624	+	IGR	INS	-	TG	TG	rs138267644	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165404623_165404624insTG								MARCH1 (99421 upstream) : TRIM61 (470976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	167062229	167062230	+	IGR	INS	-	TG	TG	rs144191160	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167062229_167062230insTG								TLL1 (37236 upstream) : SPOCK3 (592306 downstream)																																			---	---	---	---
SPOCK3	50859	broad.mit.edu	37	4	167880771	167880771	+	Intron	DEL	A	-	-	rs71604456		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167880771delA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Intron|SPOCK3_uc011cjw.1_Intron	NM_016950	NP_058646			testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)														---	---	---	---
SPOCK3	50859	broad.mit.edu	37	4	167891887	167891887	+	Intron	DEL	A	-	-	rs72102992		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167891887delA	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Intron|SPOCK3_uc011cjw.1_Intron	NM_016950	NP_058646			testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)														---	---	---	---
ANXA10	11199	broad.mit.edu	37	4	169073254	169073254	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169073254delC	uc003irm.2	+							NM_007193	NP_009124			annexin A10								calcium ion binding|calcium-dependent phospholipid binding				0		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)														---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169658677	169658678	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169658677_169658678insT	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	4	171751177	171751179	+	IGR	DEL	AAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171751177_171751179delAAC								AADAT (739805 upstream) : GALNTL6 (983396 downstream)																																			---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173496091	173496094	+	Intron	DEL	ACAC	-	-	rs146621922		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173496091_173496094delACAC	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	174246566	174246567	+	IGR	INS	-	TGA	TGA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:174246566_174246567insTGA								GALNT7 (1449 upstream) : HMGB2 (5960 downstream)																																			---	---	---	---
GPM6A	2823	broad.mit.edu	37	4	176920801	176920801	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176920801delA	uc003iug.2	-						GPM6A_uc003iuh.2_Intron	NM_005277	NP_005268			glycoprotein M6A isoform 1							cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	177738895	177738904	+	IGR	DEL	TGATAGGAGC	-	-	rs72071590		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177738895_177738904delTGATAGGAGC								VEGFC (25000 upstream) : NEIL3 (492087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	177812921	177812922	+	IGR	INS	-	TT	TT	rs145007696	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177812921_177812922insTT								VEGFC (99026 upstream) : NEIL3 (418069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	177864875	177864876	+	IGR	INS	-	A	A	rs138084382		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177864875_177864876insA								VEGFC (150980 upstream) : NEIL3 (366115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181535146	181535151	+	IGR	DEL	TGTGTG	-	-	rs71603108		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181535146_181535151delTGTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183080601	183080604	+	Intron	DEL	GTGT	-	-	rs112827364		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183080601_183080604delGTGT	uc010irv.1	+											Homo sapiens ODZ3 (ODZ3) mRNA, partial cds.						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	184459009	184459014	+	IGR	DEL	GTGTGT	-	-	rs77452826		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184459009_184459014delGTGTGT								ING2 (26760 upstream) : RWDD4A (101775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184654520	184654521	+	IGR	INS	-	C	C	rs147070806	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184654520_184654521insC								C4orf41 (19776 upstream) : STOX2 (171988 downstream)																																			---	---	---	---
ENPP6	133121	broad.mit.edu	37	4	185050436	185050437	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185050436_185050437insA	uc003iwc.2	-							NM_153343	NP_699174			ectonucleotide pyrophosphatase/phosphodiesterase						lipid catabolic process	extracellular region|integral to membrane|plasma membrane				central_nervous_system(1)	1		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	185178524	185178551	+	IGR	DEL	AGGAAGGAAGGAAGGCAGGCAGGCAGGC	-	-	rs28469426	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185178524_185178551delAGGAAGGAAGGAAGGCAGGCAGGCAGGC								ENPP6 (39410 upstream) : IRF2 (130327 downstream)																																			---	---	---	---
ACSL1	2180	broad.mit.edu	37	4	185707571	185707572	+	Intron	INS	-	GCAC	GCAC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185707571_185707572insGCAC	uc003iww.2	-						ACSL1_uc011ckm.1_Intron|ACSL1_uc003iwt.1_Intron|ACSL1_uc003iwu.1_Intron|ACSL1_uc011ckn.1_Intron|ACSL1_uc003iwv.1_Intron	NM_001995	NP_001986			acyl-CoA synthetase long-chain family member 1						digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	185908983	185908984	+	IGR	DEL	GA	-	-	rs146051178		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185908983_185908984delGA								ACSL1 (161768 upstream) : HELT (31011 downstream)																																			---	---	---	---
SORBS2	8470	broad.mit.edu	37	4	186748908	186748913	+	Intron	DEL	CATCAC	-	-	rs139462423		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186748908_186748913delCATCAC	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547			sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	187856871	187856872	+	IGR	INS	-	T	T	rs143044451	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187856871_187856872insT								FAT1 (209021 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188312831	188312835	+	IGR	DEL	AGCAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188312831_188312835delAGCAC								FAT1 (664981 upstream) : ZFP42 (604090 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188445195	188445196	+	IGR	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188445195_188445196delAA								FAT1 (797345 upstream) : ZFP42 (471729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189164866	189164867	+	IGR	INS	-	TG	TG	rs142726918	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189164866_189164867insTG								TRIML1 (96217 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190514054	190514055	+	IGR	DEL	GT	-	-	rs79143395		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190514054_190514055delGT								None (None upstream) : FRG1 (347919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190555264	190555291	+	IGR	DEL	CCTCCAGATTTAGGAGATGTCAAGGGAG	-	-	rs28647764	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190555264_190555291delCCTCCAGATTTAGGAGATGTCAAGGGAG								None (None upstream) : FRG1 (306683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190607276	190607279	+	IGR	DEL	CTCT	-	-	rs62333277		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190607276_190607279delCTCT								None (None upstream) : FRG1 (254695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190651498	190651499	+	IGR	INS	-	AT	AT	rs141849957		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190651498_190651499insAT								None (None upstream) : FRG1 (210475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190678576	190678577	+	IGR	INS	-	AAC	AAC	rs60789578		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190678576_190678577insAAC								None (None upstream) : FRG1 (183397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	543531	543532	+	IGR	INS	-	T	T	rs13174859	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:543531_543532insT								SLC9A3 (18982 upstream) : CEP72 (68873 downstream)																																			---	---	---	---
CEP72	55722	broad.mit.edu	37	5	628914	628915	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:628914_628915insG	uc003jbf.2	+						CEP72_uc011clz.1_Intron	NM_018140	NP_060610			centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	734379	734380	+	IGR	INS	-	AA	AA	rs150828390		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:734379_734380insAA								TPPP (40869 upstream) : ZDHHC11 (61340 downstream)																																			---	---	---	---
NKD2	85409	broad.mit.edu	37	5	1025858	1025859	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1025858_1025859insA	uc003jbt.1	+						NKD2_uc010itf.1_Intron	NM_033120	NP_149111			naked cuticle homolog 2						exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)															---	---	---	---
SLC6A19	340024	broad.mit.edu	37	5	1211932	1211933	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1211932_1211933delTG	uc003jbw.3	+							NM_001003841	NP_001003841			solute carrier family 6, member 19						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	2392667	2392670	+	IGR	DEL	TTCT	-	-	rs113783198		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2392667_2392670delTTCT								IRX4 (509787 upstream) : IRX2 (353611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2901941	2901943	+	IGR	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2901941_2901943delTTG								C5orf38 (146429 upstream) : IRX1 (694225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3212029	3212030	+	IGR	INS	-	GTGT	GTGT	rs139529129	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3212029_3212030insGTGT								C5orf38 (456517 upstream) : IRX1 (384138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3391214	3391214	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3391214delA								C5orf38 (635702 upstream) : IRX1 (204954 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4013381	4013382	+	IGR	INS	-	C	C	rs148319706	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4013381_4013382insC								IRX1 (411865 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4245240	4245240	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4245240delT								IRX1 (643724 upstream) : LOC340094 (789232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5403589	5403590	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5403589_5403590insT								ADAMTS16 (83178 upstream) : KIAA0947 (19217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5934645	5934646	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5934645_5934646delGA								KIAA0947 (444308 upstream) : FLJ33360 (375908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7109711	7109712	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7109711_7109712insA								PAPD7 (352550 upstream) : ADCY2 (286631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7915661	7915661	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7915661delT								MTRR (14428 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8433227	8433228	+	Intron	DEL	CA	-	-	rs2308021		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8433227_8433228delCA	uc003jeh.1	-											Homo sapiens cDNA clone IMAGE:5297486.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	9017578	9017579	+	IGR	INS	-	TTG	TTG	rs148953655	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9017578_9017579insTTG								None (None upstream) : SEMA5A (17559 downstream)																																			---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9256041	9256042	+	Intron	INS	-	A	A	rs139390027	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9256041_9256042insA	uc003jek.2	-							NM_003966	NP_003957			semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DAP	1611	broad.mit.edu	37	5	10733307	10733320	+	Intron	DEL	TGTGTGTGTGTGTA	-	-	rs56888259		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10733307_10733320delTGTGTGTGTGTGTA	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385			death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)																---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11591667	11591668	+	Intron	INS	-	T	T	rs145128846	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11591667_11591668insT	uc003jfa.1	-						CTNND2_uc010itt.2_5'Flank|CTNND2_uc011cmy.1_5'Flank|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	13637900	13637900	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13637900delT								None (None upstream) : DNAH5 (52537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18125921	18125921	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18125921delT								BASP1 (848986 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18390781	18390782	+	IGR	INS	-	GACTG	GACTG	rs142950451	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18390781_18390782insGACTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18699184	18699185	+	IGR	INS	-	T	T	rs137916570	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18699184_18699185insT								None (None upstream) : CDH18 (773972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	19211644	19211644	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19211644delA								None (None upstream) : CDH18 (261513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	20770500	20770500	+	Intron	DEL	A	-	-	rs11310469		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20770500delA	uc003jge.1	+											Homo sapiens cDNA FLJ36043 fis, clone TESTI2017582.																														---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21539615	21539616	+	Intron	INS	-	TA	TA	rs143282782	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21539615_21539616insTA	uc011cnn.1	+						GUSBP1_uc003jgh.3_Intron					Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21563005	21563006	+	Intron	INS	-	AA	AA	rs139587606	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21563005_21563006insAA	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	23717343	23717347	+	IGR	DEL	AAAAG	-	-	rs72429036		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23717343_23717347delAAAAG								PRDM9 (188639 upstream) : CDH10 (769863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	24733154	24733154	+	IGR	DEL	T	-	-	rs33967961		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24733154delT								CDH10 (88243 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25097744	25097745	+	IGR	DEL	AA	-	-	rs67493388		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25097744_25097745delAA								CDH10 (452833 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26163426	26163426	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26163426delT								None (None upstream) : CDH9 (717283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26344834	26344835	+	IGR	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs139518347	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26344834_26344835insTGTGTGTGTG								None (None upstream) : CDH9 (535874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26442188	26442189	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26442188_26442189insT								None (None upstream) : CDH9 (438520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27901417	27901418	+	IGR	INS	-	C	C	rs137901693	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27901417_27901418insC								CDH9 (862728 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28501196	28501199	+	IGR	DEL	ATCT	-	-	rs66545246		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28501196_28501199delATCT								None (None upstream) : None (None downstream)																																			---	---	---	---
CDH6	1004	broad.mit.edu	37	5	31293938	31293938	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31293938delA	uc003jhe.1	+						CDH6_uc003jhd.1_Intron	NM_004932	NP_004923			cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32605206	32605206	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32605206delT								SUB1 (1021 upstream) : NPR3 (105554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	34220599	34220600	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34220599_34220600delAC								C1QTNF3 (177282 upstream) : RAI14 (435833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	34586925	34586926	+	IGR	INS	-	A	A	rs141043402		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34586925_34586926insA								C1QTNF3 (543608 upstream) : RAI14 (69507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	34638683	34638684	+	IGR	INS	-	AA	AA	rs70964502		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34638683_34638684insAA								C1QTNF3 (595366 upstream) : RAI14 (17749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	35521467	35521468	+	IGR	INS	-	AG	AG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35521467_35521468insAG								PRLR (290673 upstream) : SPEF2 (96521 downstream)																																			---	---	---	---
SPEF2	79925	broad.mit.edu	37	5	35711675	35711676	+	Intron	INS	-	TCCC	TCCC	rs144827792	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35711675_35711676insTCCC	uc003jjo.2	+						SPEF2_uc003jjp.1_Intron	NM_024867	NP_079143			KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
RANBP3L	202151	broad.mit.edu	37	5	36299436	36299439	+	Intron	DEL	TATG	-	-	rs2202005		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36299436_36299439delTATG	uc003jkh.2	-						RANBP3L_uc011cow.1_Intron	NM_145000	NP_659437			RAN binding protein 3-like isoform 2						intracellular transport					ovary(1)	1	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	36483102	36483102	+	IGR	DEL	T	-	-	rs76338262		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36483102delT								RANBP3L (181091 upstream) : SLC1A3 (123355 downstream)																																			---	---	---	---
C5orf42	65250	broad.mit.edu	37	5	37204851	37204851	+	Intron	DEL	A	-	-	rs142193429		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37204851delA	uc011cpa.1	-						C5orf42_uc003jks.2_Intron|C5orf42_uc011coz.1_Intron|C5orf42_uc011cpb.1_Intron	NM_023073	NP_075561			hypothetical protein LOC65250											ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	40069973	40069973	+	IGR	DEL	A	-	-	rs78639390		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40069973delA								DAB2 (644638 upstream) : PTGER4 (610059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	40124148	40124148	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40124148delT								DAB2 (698813 upstream) : PTGER4 (555884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	40137600	40137601	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40137600_40137601insC								DAB2 (712265 upstream) : PTGER4 (542431 downstream)																																			---	---	---	---
HEATR7B2	133558	broad.mit.edu	37	5	41036232	41036233	+	Intron	DEL	AC	-	-	rs34287793		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41036232_41036233delAC	uc003jmj.3	-						HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760			HEAT repeat family member 7B2								binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---
ZNF131	7690	broad.mit.edu	37	5	43131781	43131782	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43131781_43131782insA	uc011cpw.1	+						ZNF131_uc010ivl.1_Intron|ZNF131_uc003jnj.3_Intron|ZNF131_uc003jnk.2_Intron|ZNF131_uc003jnn.3_Intron|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423			zinc finger protein 131							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	44302424	44302425	+	IGR	INS	-	CTTT	CTTT	rs55669308		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44302424_44302425insCTTT								NNT (596757 upstream) : FGF10 (2672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44449980	44449981	+	IGR	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44449980_44449981delTT								FGF10 (61196 upstream) : MRPS30 (359046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44722364	44722365	+	IGR	INS	-	TG	TG	rs142195531	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44722364_44722365insTG								FGF10 (333580 upstream) : MRPS30 (86662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44740646	44740646	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44740646delG								FGF10 (351862 upstream) : MRPS30 (68381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	45024874	45024875	+	IGR	INS	-	TG	TG	rs141460303	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45024874_45024875insTG								MRPS30 (209260 upstream) : HCN1 (234478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46172471	46172471	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46172471delA								HCN1 (476251 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49497826	49497827	+	IGR	INS	-	A	A	rs146922281	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49497826_49497827insA								None (None upstream) : EMB (194206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50724364	50724379	+	IGR	DEL	TGTTTGTTGTTGTTGG	-	-	rs55670678		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50724364_50724379delTGTTTGTTGTTGTTGG								ISL1 (33807 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50832375	50832376	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50832375_50832376insT								ISL1 (141818 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50832458	50832458	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50832458delT								ISL1 (141901 upstream) : None (None downstream)																																			---	---	---	---
ITGA1	3672	broad.mit.edu	37	5	52161834	52161835	+	Intron	INS	-	TTTTTTC	TTTTTTC	rs143046695	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52161834_52161835insTTTTTTC	uc003jou.2	+						ITGA1_uc003jov.2_Intron	NM_181501	NP_852478			integrin, alpha 1 precursor						axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	53670472	53670472	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53670472delT								ARL15 (64069 upstream) : HSPB3 (80973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	54258643	54258646	+	IGR	DEL	TGTA	-	-	rs145447921	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54258643_54258646delTGTA								SNX18 (416228 upstream) : ESM1 (15050 downstream)																																			---	---	---	---
ANKRD55	79722	broad.mit.edu	37	5	55469024	55469025	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55469024_55469025insT	uc003jqu.2	-							NM_024669	NP_078945			ankyrin repeat domain 55 isoform 1											skin(1)	1		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)																---	---	---	---
MAP3K1	4214	broad.mit.edu	37	5	56185039	56185039	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56185039delA	uc003jqw.3	+							NM_005921	NP_005912			mitogen-activated protein kinase kinase kinase						cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	56400556	56400556	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56400556delT								MIER3 (133055 upstream) : GPBP1 (69219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	56583707	56583707	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56583707delA								GPBP1 (24297 upstream) : ACTBL2 (192137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	57679586	57679586	+	IGR	DEL	A	-	-	rs139134255		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57679586delA								ACTBL2 (900950 upstream) : PLK2 (70226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	58184883	58184906	+	IGR	DEL	AAGAAAGGAAGGAAGGAAGGAAGG	-	-	rs58863015	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58184883_58184906delAAGAAAGGAAGGAAGGAAGGAAGG								RAB3C (37478 upstream) : PDE4D (79960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	62455404	62455405	+	IGR	INS	-	AGTCAGTCCTATG	AGTCAGTCCTATG	rs140343212	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62455404_62455405insAGTCAGTCCTATG								ISCA1P1 (382234 upstream) : HTR1A (800874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	62734965	62734965	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62734965delT								ISCA1P1 (661795 upstream) : HTR1A (521314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	64781949	64781950	+	IGR	INS	-	T	T	rs5868406		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64781949_64781950insT								ADAMTS6 (4245 upstream) : CENPK (31644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	65173032	65173033	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65173032_65173033insT								NLN (53645 upstream) : ERBB2IP (49351 downstream)																																			---	---	---	---
MAST4	375449	broad.mit.edu	37	5	66291716	66291717	+	Intron	INS	-	AC	AC	rs149712393	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66291716_66291717insAC	uc003jut.1	+						MAST4_uc003jus.2_Intron|MAST4_uc003juu.1_Intron|MAST4_uc011cra.1_Intron	NM_015183	NP_055998			microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	66627507	66627508	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66627507_66627508insT								CD180 (134890 upstream) : PIK3R1 (884096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67062645	67062645	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67062645delA								CD180 (570028 upstream) : PIK3R1 (448959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67735929	67735930	+	IGR	DEL	GT	-	-	rs111593757		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67735929_67735930delGT								PIK3R1 (138282 upstream) : SLC30A5 (653888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	68089462	68089463	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68089462_68089463insA								PIK3R1 (491815 upstream) : SLC30A5 (300355 downstream)																																			---	---	---	---
SV2C	22987	broad.mit.edu	37	5	75584699	75584700	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75584699_75584700insT	uc003kei.1	+							NM_014979	NP_055794			synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)														---	---	---	---
S100Z	170591	broad.mit.edu	37	5	76199556	76199557	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76199556_76199557insT	uc003keq.3	+							NM_130772	NP_570128			S100 calcium binding protein Z								calcium ion binding			ovary(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;8.91e-51)|Epithelial(54;5.43e-45)|all cancers(79;1.82e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76366199	76366200	+	IGR	INS	-	AAG	AAG	rs146971459	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76366199_76366200insAAG								AGGF1 (5164 upstream) : ZBED3 (6332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	76904802	76904802	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76904802delA								WDR41 (116470 upstream) : OTP (19736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	77240742	77240743	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77240742_77240743delAG								TBCA (168557 upstream) : AP3B1 (57408 downstream)																																			---	---	---	---
FAM151B	167555	broad.mit.edu	37	5	79834389	79834390	+	Intron	INS	-	TCCC	TCCC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79834389_79834390insTCCC	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111			hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)														---	---	---	---
RNU5E	26829	broad.mit.edu	37	5	80615783	80615786	+	Intron	DEL	AGAG	-	-	rs72439890		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80615783_80615786delAGAG	uc011cto.1	+							NR_002754				Homo sapiens RNA, U5E small nuclear (RNU5E), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	84763817	84763819	+	IGR	DEL	AAC	-	-	rs57018048		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84763817_84763819delAAC								None (None upstream) : NBPF22P (814443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	86475192	86475193	+	Intron	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86475192_86475193delGA	uc003kit.2	+											Homo sapiens cDNA clone IMAGE:5444809, **** WARNING: chimeric clone ****.																														---	---	---	---
CCNH	902	broad.mit.edu	37	5	86705446	86705447	+	Intron	INS	-	GT	GT	rs147155113	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86705446_86705447insGT	uc003kjb.2	-						CCNH_uc003kiy.1_5'Flank|CCNH_uc003kiz.1_Intron|CCNH_uc003kja.2_Intron	NM_001239	NP_001230			cyclin H						G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cyclin-dependent protein kinase activating kinase holoenzyme complex|holo TFIIH complex	protein kinase binding			ovary(2)|kidney(1)	3		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)									Direct_reversal_of_damage|NER					---	---	---	---
Unknown	0	broad.mit.edu	37	5	88705449	88705450	+	IGR	INS	-	CG	CG	rs28585073	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88705449_88705450insCG								MEF2C (505580 upstream) : CETN3 (984081 downstream)																																			---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89863557	89863557	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89863557delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495			G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM172A	83989	broad.mit.edu	37	5	93375606	93375606	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93375606delA	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431			hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0																		---	---	---	---
C5orf36	285600	broad.mit.edu	37	5	93498170	93498171	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93498170_93498171insT	uc011cuk.1	-						C5orf36_uc003kkn.2_Intron	NM_001145678	NP_001139150			hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)														---	---	---	---
C5orf36	285600	broad.mit.edu	37	5	93825293	93825293	+	Intron	DEL	C	-	-	rs72771684	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93825293delC	uc011cuk.1	-							NM_001145678	NP_001139150			hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)														---	---	---	---
MCTP1	79772	broad.mit.edu	37	5	94465371	94465372	+	Intron	INS	-	T	T	rs150800365	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94465371_94465372insT	uc003kkx.2	-							NM_024717	NP_078993			multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)														---	---	---	---
MCTP1	79772	broad.mit.edu	37	5	94569721	94569722	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94569721_94569722insA	uc003kkx.2	-							NM_024717	NP_078993			multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)														---	---	---	---
PCSK1	5122	broad.mit.edu	37	5	95757105	95757106	+	Intron	INS	-	T	T	rs138794439	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95757105_95757106insT	uc003kls.1	-							NM_000439	NP_000430			proprotein convertase subtilisin/kexin type 1						cell-cell signaling|cellular nitrogen compound metabolic process|energy reserve metabolic process|hormone biosynthetic process|peptide biosynthetic process|peptide hormone processing|regulation of insulin secretion	extracellular space|stored secretory granule|transport vesicle	serine-type endopeptidase activity			ovary(2)	2		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
LIX1	167410	broad.mit.edu	37	5	96477321	96477322	+	Intron	INS	-	T	T	rs35955863		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96477321_96477322insT	uc003kmy.3	-							NM_153234	NP_694966			limb expression 1											ovary(1)	1		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	96905766	96905766	+	IGR	DEL	C	-	-	rs36050021		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96905766delC								RIOK2 (386761 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	97445935	97445936	+	IGR	INS	-	C	C	rs143373206	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97445935_97445936insC								RIOK2 (926930 upstream) : RGMB (659063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	97616436	97616437	+	IGR	INS	-	GATA	GATA	rs141944165	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97616436_97616437insGATA								None (None upstream) : RGMB (488562 downstream)																																			---	---	---	---
CHD1	1105	broad.mit.edu	37	5	98244153	98244153	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98244153delT	uc003knf.2	-							NM_001270	NP_001261			chromodomain helicase DNA binding protein 1						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	98907376	98907376	+	IGR	DEL	A	-	-	rs78649576		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98907376delA								CHD1 (645138 upstream) : LOC100133050 (807833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99313194	99313194	+	IGR	DEL	A	-	-	rs113924512		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99313194delA								None (None upstream) : LOC100133050 (402015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99989696	99989697	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99989696_99989697delCA								FAM174A (67256 upstream) : ST8SIA4 (152943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	103837966	103837969	+	IGR	DEL	TCTC	-	-	rs138155987		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103837966_103837969delTCTC								NUDT12 (939476 upstream) : RAB9BP1 (597206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	110161801	110161802	+	IGR	INS	-	T	T	rs148350127	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110161801_110161802insT								SLC25A46 (63319 upstream) : TSLP (243976 downstream)																																			---	---	---	---
C5orf13	9315	broad.mit.edu	37	5	111281797	111281800	+	Intron	DEL	ACAT	-	-	rs72413130		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111281797_111281800delACAT	uc011cvr.1	-						C5orf13_uc011cvs.1_Intron	NM_001142475	NP_001135947			neuronal protein 3.1 isoform c							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	111783774	111783774	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111783774delT								FLJ11235 (27101 upstream) : APC (259444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	111877519	111877519	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111877519delC								FLJ11235 (120846 upstream) : APC (165699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	112357084	112357085	+	IGR	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112357084_112357085delAA								DCP2 (418 upstream) : MCC (712 downstream)																																			---	---	---	---
MCC	4163	broad.mit.edu	37	5	112486287	112486290	+	Intron	DEL	AAAG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112486287_112486290delAAAG	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378			mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	112832330	112832331	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112832330_112832331delCT								MCC (7803 upstream) : YTHDC2 (17079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	113262253	113262253	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113262253delG								YTHDC2 (331274 upstream) : KCNN2 (435763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	113932744	113932745	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113932744_113932745insA	uc003kqr.1	-											Homo sapiens cDNA FLJ40367 fis, clone TESTI2034785.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	115162071	115162071	+	IGR	DEL	T	-	-	rs79396817		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115162071delT								CDO1 (9666 upstream) : ATG12 (3747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116024079	116024082	+	IGR	DEL	CTAC	-	-	rs2933613		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116024079_116024082delCTAC								SEMA6A (113528 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116432250	116432251	+	IGR	DEL	AC	-	-	rs145327087		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116432250_116432251delAC								SEMA6A (521699 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	118098730	118098730	+	IGR	DEL	C	-	-	rs144301236		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118098730delC								None (None upstream) : DTWD2 (73841 downstream)																																			---	---	---	---
DTWD2	285605	broad.mit.edu	37	5	118302753	118302753	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118302753delA	uc003ksa.2	-							NM_173666	NP_775937			DTW domain containing 2												0		all_epithelial(76;0.0982)|Prostate(80;0.121)		OV - Ovarian serous cystadenocarcinoma(64;0.000228)|Epithelial(69;0.000941)|all cancers(49;0.00939)														---	---	---	---
TNFAIP8	25816	broad.mit.edu	37	5	118674748	118674748	+	Intron	DEL	A	-	-	rs34382017		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118674748delA	uc011cwf.1	+						TNFAIP8_uc003ksf.1_Intron|TNFAIP8_uc003ksg.2_Intron	NM_001077654	NP_001071122			tumor necrosis factor, alpha-induced protein 8						anti-apoptosis|apoptosis|negative regulation of anti-apoptosis	cytoplasm	caspase inhibitor activity|protein binding			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	118773274	118773274	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118773274delC								TNFAIP8 (42981 upstream) : HSD17B4 (14874 downstream)																																			---	---	---	---
PRR16	51334	broad.mit.edu	37	5	119884661	119884662	+	Intron	INS	-	AC	AC	rs138985218	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119884661_119884662insAC	uc003ksq.2	+						PRR16_uc003ksp.2_Intron	NM_016644	NP_057728			proline rich 16											pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)														---	---	---	---
ZNF474	133923	broad.mit.edu	37	5	121471627	121471627	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121471627delA	uc003ksv.2	+							NM_207317	NP_997200			zinc finger protein 474							intracellular	zinc ion binding				0		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)														---	---	---	---
SNCAIP	9627	broad.mit.edu	37	5	121722516	121722516	+	Intron	DEL	A	-	-	rs111712528		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121722516delA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc010jct.2_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron	NM_005460	NP_005451			synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)														---	---	---	---
SNX2	6643	broad.mit.edu	37	5	122159413	122159416	+	Intron	DEL	GTGT	-	-	rs10559761		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122159413_122159416delGTGT	uc003kte.2	+						SNX2_uc011cwn.1_Intron	NM_003100	NP_003091			sorting nexin 2						cell communication|endocytosis|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding|protein transporter activity			kidney(1)	1		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)														---	---	---	---
PRDM6	93166	broad.mit.edu	37	5	122491826	122491827	+	Intron	INS	-	T	T	rs35231752		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122491826_122491827insT	uc003kti.2	+						PRDM6_uc003ktj.2_Intron	NM_001136239	NP_001129711			PR domain containing 6						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	123082896	123082899	+	IGR	DEL	GAGT	-	-	rs151295608	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123082896_123082899delGAGT								CSNK1G3 (130434 upstream) : ZNF608 (889711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	124207892	124207895	+	IGR	DEL	TGTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124207892_124207895delTGTG								ZNF608 (123392 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	124721501	124721502	+	IGR	DEL	GT	-	-	rs11241806	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124721501_124721502delGT								ZNF608 (637001 upstream) : GRAMD3 (974286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125347966	125347967	+	IGR	INS	-	A	A	rs144683356	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125347966_125347967insA								None (None upstream) : GRAMD3 (347821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	126059990	126059991	+	IGR	INS	-	TGTG	TGTG	rs71573976		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126059990_126059991insTGTG								C5orf48 (88016 upstream) : LMNB1 (52842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	126971763	126971764	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126971763_126971764insA								PRRC1 (80985 upstream) : CTXN3 (12949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	128735359	128735359	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128735359delG								ISOC1 (285642 upstream) : ADAMTS19 (60744 downstream)																																			---	---	---	---
ADAMTS19	171019	broad.mit.edu	37	5	129000902	129000902	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129000902delT	uc003kvb.1	+						ADAMTS19_uc010jdh.1_Intron	NM_133638	NP_598377			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)														---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130996911	130996912	+	Intron	DEL	TT	-	-	rs10066812		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130996911_130996912delTT	uc003kvp.1	-						FNIP1_uc003kvs.1_Intron|FNIP1_uc003kvt.1_Intron	NM_016340	NP_057424			PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)														---	---	---	---
TCF7	6932	broad.mit.edu	37	5	133461044	133461044	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133461044delG	uc003kyt.2	+						TCF7_uc003kyu.1_Intron|TCF7_uc003kyv.2_Intron|TCF7_uc003kyw.2_Intron|TCF7_uc003kyx.2_Intron|TCF7_uc003kyy.2_Intron|TCF7_uc003kyz.2_Intron|TCF7_uc003kza.2_Intron	NM_003202	NP_003193			transcription factor 7 (T-cell specific,						cellular response to interleukin-4|immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription regulatory region DNA binding				0		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
CDKL3	51265	broad.mit.edu	37	5	133623586	133623587	+	Intron	INS	-	T	T	rs5871533		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133623586_133623587insT	uc011cxm.1	-						CDKL3_uc011cxn.1_Intron|CDKL3_uc010jdw.2_Intron|CDKL3_uc011cxo.1_Intron|CDKL3_uc011cxp.1_Intron	NM_001113575	NP_001107047			cyclin-dependent kinase-like 3 isoform 1							cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
CDKN2AIPNL	91368	broad.mit.edu	37	5	133740320	133740321	+	Intron	DEL	TT	-	-	rs113061543		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133740320_133740321delTT	uc011cxs.1	-							NM_080656	NP_542387			CDKN2A interacting protein N-terminal like												0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	134354511	134354515	+	IGR	DEL	CCAGG	-	-	rs79734433		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134354511_134354515delCCAGG								CATSPER3 (7126 upstream) : PITX1 (8910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	135917872	135917873	+	IGR	INS	-	T	T	rs138600150	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135917872_135917873insT								TRPC7 (224799 upstream) : SPOCK1 (393115 downstream)																																			---	---	---	---
HSPA9	3313	broad.mit.edu	37	5	137909330	137909331	+	Intron	INS	-	AAA	AAA	rs55663873		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137909330_137909331insAAA	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125			heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	138069937	138069937	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138069937delA								HSPA9 (158822 upstream) : CTNNA1 (19170 downstream)																																			---	---	---	---
SRA1	10011	broad.mit.edu	37	5	139934175	139934176	+	Intron	INS	-	TT	TT	rs150297559	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139934175_139934176insTT	uc003lga.2	-						SRA1_uc003lfz.2_Intron|SRA1_uc010jfm.2_Intron	NM_001035235	NP_001030312			steroid receptor RNA activator 1						apoptosis|cell differentiation|cell proliferation|transcription, DNA-dependent	cytoplasm|ribonucleoprotein complex	receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SLC25A2	83884	broad.mit.edu	37	5	140686275	140686276	+	5'Flank	INS	-	A	A	rs112050038		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140686275_140686276insA	uc003ljf.2	-							NM_031947	NP_114153			solute carrier family 25 member 2						mitochondrial ornithine transport|urea cycle	integral to membrane|mitochondrial inner membrane	L-ornithine transmembrane transporter activity			ovary(1)	1		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	144711203	144711204	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144711203_144711204insT								KCTD16 (854259 upstream) : PRELID2 (427378 downstream)																																			---	---	---	---
SH3RF2	153769	broad.mit.edu	37	5	145429961	145429962	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145429961_145429962insT	uc003lnt.2	+						SH3RF2_uc011dbl.1_Intron|SH3RF2_uc011dbm.1_Intron|SH3RF2_uc003lnu.2_Intron	NM_152550	NP_689763			SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	145669964	145669965	+	IGR	INS	-	A	A	rs17104372	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145669964_145669965insA								RBM27 (1182 upstream) : POU4F3 (48622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	146532212	146532213	+	IGR	INS	-	TGGA	TGGA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146532212_146532213insTGGA								PPP2R2B (71158 upstream) : STK32A (82366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	146936540	146936540	+	IGR	DEL	T	-	-	rs10714741		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146936540delT								DPYSL3 (47116 upstream) : JAKMIP2 (34166 downstream)																																			---	---	---	---
HTR4	3360	broad.mit.edu	37	5	147973914	147973915	+	Intron	INS	-	GTGT	GTGT	rs150109325	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147973914_147973915insGTGT	uc003lpn.2	-						HTR4_uc010jgu.1_Intron|HTR4_uc003lpi.1_Intron|HTR4_uc003lpj.1_Intron|HTR4_uc003lpk.2_Intron|HTR4_uc011dby.1_Intron|HTR4_uc003lpl.2_Intron|HTR4_uc003lpm.2_Intron|HTR4_uc010jgv.2_Intron|HTR4_uc003lpo.1_Intron|SH3TC2_uc003lpp.1_Intron	NM_000870	NP_000861			serotonin 5-HT4 receptor isoform b						G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cell proliferation	endosome|integral to plasma membrane|membrane fraction	serotonin receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cisapride(DB00604)|Rizatriptan(DB00953)|Tegaserod(DB01079)|Zolmitriptan(DB00315)													---	---	---	---
MYOZ3	91977	broad.mit.edu	37	5	150043394	150043394	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150043394delA	uc003lss.2	+						MYOZ3_uc003lsr.2_Intron	NM_001122853	NP_001116325			myozenin 3							sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
MYOZ3	91977	broad.mit.edu	37	5	150052906	150052908	+	Intron	DEL	TTA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150052906_150052908delTTA	uc003lss.2	+						MYOZ3_uc003lsr.2_Intron	NM_001122853	NP_001116325			myozenin 3							sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	151973742	151973743	+	IGR	INS	-	TCTGTG	TCTGTG	rs4476707		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151973742_151973743insTCTGTG								NMUR2 (188902 upstream) : GRIA1 (895432 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	152679579	152679580	+	IGR	DEL	GG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152679579_152679580delGG								NMUR2 (894739 upstream) : GRIA1 (189595 downstream)																																			---	---	---	---
GEMIN5	25929	broad.mit.edu	37	5	154270615	154270616	+	Intron	INS	-	T	T	rs147642619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154270615_154270616insT	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280			gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	154937857	154937857	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154937857delC								KIF4B (540172 upstream) : SGCD (197206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157651156	157651156	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157651156delG								CLINT1 (364988 upstream) : EBF1 (471768 downstream)																																			---	---	---	---
ATP10B	23120	broad.mit.edu	37	5	160153375	160153375	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160153375delT	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429			ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ATP10B	23120	broad.mit.edu	37	5	160155107	160155108	+	Intron	INS	-	T	T	rs137918332	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160155107_160155108insT	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron	NM_025153	NP_079429			ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	161058570	161058571	+	IGR	INS	-	C	C	rs149790095	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161058570_161058571insC								GABRB2 (83440 upstream) : GABRA6 (54087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	163804358	163804358	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163804358delT	uc003lzn.2	+											Homo sapiens, clone IMAGE:4479080, mRNA, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	163878445	163878447	+	Intron	DEL	GAC	-	-	rs150034521		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163878445_163878447delGAC	uc003lzn.2	+											Homo sapiens, clone IMAGE:4479080, mRNA, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	165134098	165134099	+	IGR	INS	-	T	T	rs143950855	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165134098_165134099insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165188327	165188328	+	IGR	INS	-	T	T	rs147589324	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165188327_165188328insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	166371591	166371592	+	IGR	INS	-	A	A	rs143289821	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166371591_166371592insA								None (None upstream) : ODZ2 (340251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	166479827	166479828	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166479827_166479828insA								None (None upstream) : ODZ2 (232015 downstream)																																			---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167806805	167806805	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167806805delA	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	168091517	168091529	+	IGR	DEL	CTTTCCTTCCTTC	-	-	rs139709971	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168091517_168091529delCTTTCCTTCCTTC								PANK3 (84929 upstream) : SLIT3 (1543 downstream)																																			---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168324650	168324651	+	Intron	INS	-	GCGT	GCGT	rs150495154	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168324650_168324651insGCGT	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170495573	170495574	+	Intron	INS	-	TTG	TTG	rs138172487	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170495573_170495574insTTG	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	5	171050294	171050301	+	IGR	DEL	TGGATGGA	-	-	rs144056077	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171050294_171050301delTGGATGGA								FGF18 (166132 upstream) : FBXW11 (238255 downstream)																																			---	---	---	---
STK10	6793	broad.mit.edu	37	5	171550498	171550498	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171550498delT	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171714362	171714363	+	IGR	INS	-	TG	TG	rs145006205	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171714362_171714363insTG								UBTD2 (3567 upstream) : SH3PXD2B (46142 downstream)																																			---	---	---	---
SH3PXD2B	285590	broad.mit.edu	37	5	171838457	171838458	+	Intron	INS	-	GTTA	GTTA	rs147282346	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171838457_171838458insGTTA	uc003mbr.2	-						SH3PXD2B_uc003mbs.1_Intron	NM_001017995	NP_001017995			SH3 and PX domains 2B						adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171978717	171978720	+	IGR	DEL	TTCC	-	-	rs58467067		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171978717_171978720delTTCC								SH3PXD2B (97190 upstream) : NEURL1B (89556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171998109	171998128	+	IGR	DEL	GGAAGGAAGGAAGGAAGGAA	-	-	rs113244801		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171998109_171998128delGGAAGGAAGGAAGGAAGGAA								SH3PXD2B (116582 upstream) : NEURL1B (70148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	172178243	172178244	+	IGR	INS	-	AAGG	AAGG	rs28532090		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172178243_172178244insAAGG								NEURL1B (59712 upstream) : DUSP1 (16858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	172186642	172186645	+	IGR	DEL	GGAA	-	-	rs10603015		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172186642_172186645delGGAA								NEURL1B (68111 upstream) : DUSP1 (8457 downstream)																																			---	---	---	---
ERGIC1	57222	broad.mit.edu	37	5	172283425	172283425	+	Intron	DEL	T	-	-	rs58942619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172283425delT	uc003mbw.3	+							NM_001031711	NP_001026881			endoplasmic reticulum-golgi intermediate						ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	173847661	173847662	+	IGR	INS	-	A	A	rs147705435		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173847661_173847662insA								HMP19 (311480 upstream) : MSX2 (303913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174121629	174121630	+	IGR	INS	-	G	G	rs147086557	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174121629_174121630insG								HMP19 (585448 upstream) : MSX2 (29945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174659237	174659238	+	IGR	INS	-	AAG	AAG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174659237_174659238insAAG								MSX2 (501336 upstream) : DRD1 (208438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	176041174	176041177	+	IGR	DEL	GCGC	-	-	rs72407253		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176041174_176041177delGCGC								GPRIN1 (4043 upstream) : SNCB (6034 downstream)																																			---	---	---	---
NSD1	64324	broad.mit.edu	37	5	176700253	176700255	+	Intron	DEL	GAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176700253_176700255delGAA	uc003mfr.3	+						NSD1_uc003mft.3_Intron|NSD1_uc003mfs.1_Intron|NSD1_uc011dfx.1_Intron	NM_022455	NP_071900			nuclear receptor binding SET domain protein 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)				T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	177806192	177806192	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177806192delA	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
CLK4	57396	broad.mit.edu	37	5	178032131	178032131	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178032131delA	uc003mjf.1	-						CLK4_uc003mjg.1_Intron|CLK4_uc010jku.1_Intron|CLK4_uc003mjh.1_Intron|CLK4_uc010jkv.1_Intron|CLK4_uc011dgg.1_Intron|CLK4_uc011dgh.1_Intron	NM_020666	NP_065717			CDC-like kinase 4							nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(1)	1	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	179088258	179088258	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179088258delT								C5orf60 (16211 upstream) : CANX (37170 downstream)																																			---	---	---	---
RNF130	55819	broad.mit.edu	37	5	179442607	179442607	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442607delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904			ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
RNF130	55819	broad.mit.edu	37	5	179492759	179492760	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179492759_179492760insA	uc003mll.1	-						RNF130_uc003mlm.1_Intron	NM_018434	NP_060904			ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	179884106	179884107	+	IGR	INS	-	AT	AT	rs138536578	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179884106_179884107insAT								GFPT2 (103791 upstream) : CNOT6 (37310 downstream)																																			---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	323976	323977	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:323976_323977insT	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570			dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
EXOC2	55770	broad.mit.edu	37	6	499431	499436	+	Intron	DEL	ACACAC	-	-	rs4061197		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:499431_499436delACACAC	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773			Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	4437704	4437704	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4437704delT								PECI (301873 upstream) : CDYL (268689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	4670667	4670668	+	IGR	DEL	AC	-	-	rs66489141		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4670667_4670668delAC								PECI (534836 upstream) : CDYL (35725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	5041197	5041198	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5041197_5041198insA	uc003mwn.1	+						uc011dhz.1_Intron|uc003mwo.2_Intron					Homo sapiens cDNA FLJ37615 fis, clone BRCOC2011996.																														---	---	---	---
FARS2	10667	broad.mit.edu	37	6	5610540	5610540	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5610540delT	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558			phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)													---	---	---	---
LY86	9450	broad.mit.edu	37	6	6595632	6595634	+	Intron	DEL	AAG	-	-	rs67207440		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6595632_6595634delAAG	uc003mwy.1	+						LOC285780_uc003mww.3_Intron|LOC285780_uc003mwx.2_Intron	NM_004271	NP_004262			MD-1, RP105-associated precursor						apoptosis|cell proliferation|humoral immune response|inflammatory response|innate immune response	extracellular space|plasma membrane					0	Ovarian(93;0.0377)																	---	---	---	---
LY86	9450	broad.mit.edu	37	6	6612034	6612034	+	Intron	DEL	T	-	-	rs35338398		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6612034delT	uc003mwy.1	+						LOC285780_uc003mww.3_Intron|LOC285780_uc003mwx.2_Intron	NM_004271	NP_004262			MD-1, RP105-associated precursor						apoptosis|cell proliferation|humoral immune response|inflammatory response|innate immune response	extracellular space|plasma membrane					0	Ovarian(93;0.0377)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	7263712	7263712	+	IGR	DEL	T	-	-	rs71700782		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7263712delT								RREB1 (12020 upstream) : SSR1 (17578 downstream)																																			---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	7953953	7953953	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7953953delA	uc003mxw.2	-							NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	8225157	8225160	+	IGR	DEL	GTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8225157_8225160delGTGT								EEF1E1 (122329 upstream) : SLC35B3 (186573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8442966	8442967	+	Intron	DEL	GC	-	-	rs139970928		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8442966_8442967delGC	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	8828313	8828314	+	IGR	INS	-	GTG	GTG	rs148388272	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8828313_8828314insGTG								HULC (174236 upstream) : None (None downstream)																																			---	---	---	---
GCNT2	2651	broad.mit.edu	37	6	10565617	10565627	+	Intron	DEL	AGGGAAAGCAG	-	-	rs56211438		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10565617_10565627delAGGGAAAGCAG	uc010joo.2	+						GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Intron|GCNT2_uc003mzd.2_Intron	NM_145649	NP_663624			glucosaminyl (N-acetyl) transferase 2,							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	11595208	11595209	+	IGR	INS	-	T	T	rs35186941		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11595208_11595209insT								TMEM170B (11452 upstream) : C6orf105 (118681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	11612295	11612296	+	IGR	INS	-	T	T	rs111830114		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11612295_11612296insT								TMEM170B (28539 upstream) : C6orf105 (101594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12257273	12257274	+	IGR	INS	-	AG	AG	rs146440409	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12257273_12257274insAG								HIVEP1 (92042 upstream) : EDN1 (33255 downstream)																																			---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	12715053	12715054	+	5'Flank	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12715053_12715054delAC	uc010jpc.2	+						PHACTR1_uc011dir.1_5'Flank|PHACTR1_uc003nag.1_5'Flank|PHACTR1_uc003nah.1_5'Flank	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13231028	13231031	+	Intron	DEL	TGTT	-	-	rs71688869		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13231028_13231031delTGTT	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	13337428	13337429	+	IGR	INS	-	A	A	rs71793684		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13337428_13337429insA								TBC1D7 (8658 upstream) : GFOD1 (26390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	13571381	13571381	+	IGR	DEL	A	-	-	rs35913358		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13571381delA								GFOD1 (83594 upstream) : SIRT5 (3411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	13992833	13992833	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13992833delA								RNF182 (12600 upstream) : CD83 (125032 downstream)																																			---	---	---	---
CD83	9308	broad.mit.edu	37	6	14115090	14115091	+	5'Flank	INS	-	T	T	rs145097633	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14115090_14115091insT	uc003nbi.2	+						CD83_uc003nbh.2_5'Flank	NM_004233	NP_004224			CD83 antigen isoform a						defense response|humoral immune response|signal transduction	integral to plasma membrane					0	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	14470821	14470822	+	IGR	INS	-	T	T	rs143063164	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14470821_14470822insT								CD83 (333675 upstream) : JARID2 (774912 downstream)																																			---	---	---	---
GMPR	2766	broad.mit.edu	37	6	16292140	16292140	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16292140delA	uc003nbs.2	+							NM_006877	NP_006868			guanosine monophosphate reductase						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16431272	16431272	+	Intron	DEL	C	-	-	rs76776226		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16431272delC	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16471422	16471423	+	Intron	INS	-	ACAC	ACAC	rs146506673	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16471422_16471423insACAC	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	17569312	17569313	+	IGR	INS	-	A	A	rs72835469	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17569312_17569313insA								CAP2 (11291 upstream) : FAM8A1 (31205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18996654	18996654	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18996654delT								MIR548A1 (424543 upstream) : ID4 (840963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19832227	19832228	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19832227_19832228insT								None (None upstream) : ID4 (5389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	21616701	21616702	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21616701_21616702insT								SOX4 (17854 upstream) : FLJ22536 (48301 downstream)																																			---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21774111	21774113	+	Intron	DEL	TTG	-	-	rs78619768		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21774111_21774113delTTG	uc010jpp.1	+						FLJ22536_uc003ndj.2_Intron|FLJ22536_uc011djk.1_Intron|FLJ22536_uc011djj.1_Intron					Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21853530	21853544	+	Intron	DEL	GTGGTGGTGGTGGTG	-	-	rs36203111	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21853530_21853544delGTGGTGGTGGTGGTG	uc010jpp.1	+						FLJ22536_uc003ndj.2_Intron|FLJ22536_uc011djk.1_Intron|FLJ22536_uc011djj.1_Intron|FLJ22536_uc003ndk.1_Intron					Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	21944035	21944036	+	Intron	DEL	TT	-	-	rs71993439		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21944035_21944036delTT	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron|FLJ22536_uc011djj.1_Intron|FLJ22536_uc003ndk.1_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	22048637	22048638	+	Intron	INS	-	T	T	rs66726919		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22048637_22048638insT	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	22201432	22201470	+	Intron	DEL	GTCACTAGGGAATTCGGGTTACTGGGGGGATAACTTAAG	-	-	rs1572923		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22201432_22201470delGTCACTAGGGAATTCGGGTTACTGGGGGGATAACTTAAG	uc003ndl.2	+											Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	22368250	22368250	+	IGR	DEL	A	-	-	rs66539659		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22368250delA								PRL (65168 upstream) : HDGFL1 (201428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23303786	23303788	+	IGR	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23303786_23303788delTTG								HDGFL1 (733037 upstream) : NRSN1 (822626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23322938	23322941	+	IGR	DEL	TAAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23322938_23322941delTAAC								HDGFL1 (752189 upstream) : NRSN1 (803473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23732755	23732755	+	IGR	DEL	T	-	-	rs148315351		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23732755delT								None (None upstream) : NRSN1 (393659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	24541170	24541173	+	IGR	DEL	TGTA	-	-	rs143665588		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24541170_24541173delTGTA								ALDH5A1 (3736 upstream) : KIAA0319 (3159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	25227064	25227067	+	IGR	DEL	ACAT	-	-	rs71850538		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25227064_25227067delACAT								CMAH (60271 upstream) : LRRC16A (52581 downstream)																																			---	---	---	---
LRRC16A	55604	broad.mit.edu	37	6	25279840	25279840	+	5'UTR	DEL	T	-	-	rs72361376		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25279840delT	uc011djw.1	+	1					LRRC16A_uc010jpx.2_5'UTR|LRRC16A_uc010jpy.2_5'UTR	NM_017640	NP_060110			leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25721595	25721598	+	IGR	DEL	GACA	-	-	rs71667898		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25721595_25721598delGACA								SCGN (19589 upstream) : HIST1H2AA (4694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	25746903	25746904	+	IGR	INS	-	AACT	AACT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25746903_25746904insAACT								HIST1H2BA (19331 upstream) : SLC17A4 (8023 downstream)																																			---	---	---	---
SLC17A3	10786	broad.mit.edu	37	6	25858428	25858432	+	Intron	DEL	AACAC	-	-	rs113590181		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25858428_25858432delAACAC	uc003nfi.3	-						SLC17A3_uc003nfk.3_Intron|SLC17A3_uc011djz.1_Intron|SLC17A3_uc011dka.1_Intron	NM_006632	NP_006623			solute carrier family 17 (sodium phosphate),						glucose-6-phosphate transport|urate metabolic process	apical plasma membrane|brush border membrane|endoplasmic reticulum membrane|integral to plasma membrane|perinuclear region of cytoplasm	drug transmembrane transporter activity|efflux transmembrane transporter activity|organic anion transmembrane transporter activity|sodium:phosphate symporter activity|toxin transporter activity|urate transmembrane transporter activity|voltage-gated anion channel activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25899430	25899431	+	IGR	DEL	CA	-	-	rs34800930		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25899430_25899431delCA								SLC17A3 (24959 upstream) : SLC17A2 (13560 downstream)																																			---	---	---	---
SLC17A2	10246	broad.mit.edu	37	6	25925739	25925740	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25925739_25925740delAA	uc011dkb.1	-						SLC17A2_uc011dkc.1_Intron|SLC17A2_uc003nfl.2_Intron					SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1																		---	---	---	---
HIST1H4G	8369	broad.mit.edu	37	6	26247783	26247783	+	5'Flank	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26247783delA	uc003nhf.2	-							NM_003547	NP_003538			histone cluster 1, H4g						nucleosome assembly	nucleosome|nucleus	DNA binding				0		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	27405040	27405040	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27405040delT								ZNF391 (35813 upstream) : ZNF184 (13482 downstream)																																			---	---	---	---
ZKSCAN4	387032	broad.mit.edu	37	6	28215270	28215271	+	Intron	INS	-	A	A	rs150929038	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28215270_28215271insA	uc003nks.1	-						ZKSCAN4_uc011dlb.1_Intron	NM_019110	NP_061983			zinc finger with KRAB and SCAN domains 4						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	28911378	28911379	+	IGR	INS	-	AA	AA	rs140310978	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28911378_28911379insAA								TRIM27 (19610 upstream) : ZNF311 (51215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	29096170	29096171	+	IGR	INS	-	AGA	AGA	rs140079096	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29096170_29096171insAGA								OR2J3 (15568 upstream) : OR2J2 (45140 downstream)																																			---	---	---	---
ZFP57	346171	broad.mit.edu	37	6	29648731	29648731	+	Intron	DEL	A	-	-	rs9278239		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29648731delA	uc003nnl.3	-							NM_001109809	NP_001103279			zinc finger protein 57 homolog						DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5																		---	---	---	---
HLA-F	3134	broad.mit.edu	37	6	29700967	29700968	+	Intron	INS	-	AAACAA	AAACAA	rs150309881	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29700967_29700968insAAACAA	uc011dly.1	+						LOC285830_uc003nnp.2_Intron|LOC285830_uc011dlz.1_Intron					Homo sapiens cDNA FLJ39643 fis, clone SMINT2004023, highly similar to HLA class I histocompatibility antigen, alphachain F precursor.						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity				0																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29887744	29887745	+	Intron	INS	-	AA	AA	rs3054701		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29887744_29887745insAA	uc011dmb.1	+						HCG4P6_uc003nog.1_Intron	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29932914	29932915	+	Intron	INS	-	AC	AC	rs144845647	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29932914_29932915insAC	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30196900	30196901	+	IGR	INS	-	TTTG	TTTG	rs144961536	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30196900_30196901insTTTG								TRIM26 (15747 upstream) : HLA-L (30438 downstream)																																			---	---	---	---
GNL1	2794	broad.mit.edu	37	6	30516772	30516773	+	Intron	INS	-	T	T	rs150206392	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30516772_30516773insT	uc003nqh.2	-						GNL1_uc011dmi.1_Intron|GNL1_uc011dmj.1_Intron|GNL1_uc011dmk.1_Intron	NM_005275	NP_005266			guanine nucleotide binding protein-like 1						response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30779372	30779373	+	IGR	INS	-	AAAC	AAAC	rs141439845	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30779372_30779373insAAAC								IER3 (67045 upstream) : DDR1 (71321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30824451	30824452	+	IGR	INS	-	C	C	rs146024775	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30824451_30824452insC								IER3 (112124 upstream) : DDR1 (26242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	30926979	30926979	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30926979delT								DPCR1 (4981 upstream) : MUC21 (24506 downstream)																																			---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31242135	31242137	+	Intron	DEL	CTT	-	-	rs149756751		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31242135_31242137delCTT	uc003ntf.2	-						HLA-C_uc011dnj.1_5'Flank|HLA-C_uc003nsx.2_5'Flank|HLA-C_uc003nsy.2_5'Flank|HLA-C_uc003nsz.2_5'Flank|HLA-C_uc010jsl.2_5'Flank|HLA-C_uc003nta.2_5'Flank|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-C_uc011dnl.1_5'Flank					SubName: Full=MHC class I antigen;						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32496821	32496822	+	Intron	INS	-	A	A	rs139852896	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32496821_32496822insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32535847	32535848	+	Intron	INS	-	A	A	rs116466016		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32535847_32535848insA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32598103	32598103	+	IGR	DEL	A	-	-	rs112761741		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32598103delA								HLA-DRB1 (40541 upstream) : HLA-DQA1 (7080 downstream)																																			---	---	---	---
HLA-DQB1	3119	broad.mit.edu	37	6	32634204	32634204	+	Intron	DEL	C	-	-	rs66662713		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32634204delC	uc003obw.2	-						HLA-DQB1_uc010juc.1_5'Flank|HLA-DQB1_uc003obv.2_Intron|HLA-DQB1_uc011dqd.1_Intron|HLA-DQB1_uc011dqe.1_Intron	NM_002123	NP_002114			major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									Melanoma_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia|T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Sj_gren_syndrome				---	---	---	---
SYNGAP1	8831	broad.mit.edu	37	6	33408466	33408467	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33408466_33408467delTC	uc011dri.1	+						SYNGAP1_uc010juy.2_Intron|SYNGAP1_uc010juz.2_Intron	NM_006772	NP_006763			synaptic Ras GTPase activating protein 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4																		---	---	---	---
C6orf227	401253	broad.mit.edu	37	6	33554802	33554803	+	3'UTR	INS	-	AC	AC	rs2894350		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33554802_33554803insAC	uc003oew.1	-	2					GGNBP1_uc003oev.2_Intron	NR_027908				RecName: Full=Putative uncharacterized protein C6orf227;												0																		---	---	---	---
ITPR3	3710	broad.mit.edu	37	6	33616315	33616315	+	Intron	DEL	T	-	-	rs67986896		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33616315delT	uc011drk.1	+							NM_002224	NP_002215			inositol 1,4,5-triphosphate receptor, type 3						activation of phospholipase C activity|calcium ion transport into cytosol|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|protein heterooligomerization|protein homooligomerization|regulation of insulin secretion|response to calcium ion	apical part of cell|brush border|endoplasmic reticulum membrane|integral to plasma membrane|myelin sheath|neuronal cell body|nuclear outer membrane|platelet dense tubular network membrane	inositol 1,3,4,5 tetrakisphosphate binding|inositol 1,4,5 trisphosphate binding|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|inositol hexakisphosphate binding|intracellular ligand-gated calcium channel activity|protein binding			ovary(6)|lung(5)|central_nervous_system(5)|breast(2)|kidney(1)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33842711	33842712	+	5'Flank	INS	-	GTGT	GTGT	rs146465554	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33842711_33842712insGTGT	uc003ofk.1	-						uc003ofl.1_5'Flank					DQ597035																														---	---	---	---
GRM4	2914	broad.mit.edu	37	6	34011897	34011898	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34011897_34011898delAC	uc003oir.3	-						GRM4_uc011dsn.1_Intron|GRM4_uc010jvh.2_Intron|GRM4_uc010jvi.2_Intron|GRM4_uc003oio.2_Intron|GRM4_uc003oip.2_Intron|GRM4_uc011dsl.1_Intron|GRM4_uc003oiq.2_Intron|GRM4_uc011dsm.1_Intron	NM_000841	NP_000832			glutamate receptor, metabotropic 4 precursor						activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	34221013	34221013	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34221013delC								C6orf1 (4109 upstream) : NUDT3 (34989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	34364093	34364094	+	IGR	DEL	AC	-	-	rs34197731		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34364093_34364094delAC								NUDT3 (3652 upstream) : RPS10 (21139 downstream)																																			---	---	---	---
PACSIN1	29993	broad.mit.edu	37	6	34459392	34459393	+	Intron	INS	-	T	T	rs111923689		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34459392_34459393insT	uc003ojo.2	+							NM_020804	NP_065855			protein kinase C and casein kinase substrate in						endocytosis		protein kinase activity				0																		---	---	---	---
C6orf106	64771	broad.mit.edu	37	6	34628141	34628142	+	Intron	INS	-	A	A	rs76586531		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34628141_34628142insA	uc003ojr.2	-						C6orf106_uc003ojs.2_Intron	NM_024294	NP_077270			chromosome 6 open reading frame 106 isoform a											skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	35170431	35170432	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35170431_35170432delGA								TCP11 (61244 upstream) : SCUBE3 (11758 downstream)																																			---	---	---	---
SCUBE3	222663	broad.mit.edu	37	6	35202406	35202406	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35202406delT	uc003okf.1	+						SCUBE3_uc003okg.1_Intron|SCUBE3_uc003okh.1_Intron	NM_152753	NP_689966			signal peptide, CUB domain, EGF-like 3						protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1																		---	---	---	---
TEAD3	7005	broad.mit.edu	37	6	35461104	35461105	+	Intron	INS	-	AT	AT	rs72550134		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35461104_35461105insAT	uc003oku.3	-						TEAD3_uc010jvx.2_Intron	NM_003214	NP_003205			TEA domain family member 3						female pregnancy|hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
FKBP5	2289	broad.mit.edu	37	6	35582932	35582933	+	Intron	INS	-	AC	AC	rs148530740	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35582932_35582933insAC	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_Intron	NM_001145776	NP_001139248			FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1																		---	---	---	---
C6orf222	389384	broad.mit.edu	37	6	36306170	36306171	+	5'Flank	INS	-	AAAG	AAAG	rs149650645	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36306170_36306171insAAAG	uc003oly.2	-							NM_001010903	NP_001010903			hypothetical protein LOC389384											skin(2)|ovary(1)|breast(1)	4																		---	---	---	---
PPIL1	51645	broad.mit.edu	37	6	36827588	36827589	+	Intron	DEL	TG	-	-	rs71880744		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36827588_36827589delTG	uc003omu.2	-							NM_016059	NP_057143			peptidylprolyl isomerase-like 1						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	37006152	37006153	+	IGR	INS	-	TGCT	TGCT	rs147195780	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37006152_37006153insTGCT								FGD2 (9307 upstream) : PIM1 (131769 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37119175	37119176	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37119175_37119176delTC								FGD2 (122330 upstream) : PIM1 (18746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37392570	37392573	+	IGR	DEL	TTTA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37392570_37392573delTTTA								RNF8 (30057 upstream) : FTSJD2 (8334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37494858	37494859	+	IGR	INS	-	CTTTTCTCC	CTTTTCTCC	rs138251455	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37494858_37494859insCTTTTCTCC								C6orf129 (27158 upstream) : MDGA1 (105425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	37710793	37710794	+	IGR	INS	-	A	A	rs78187769		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37710793_37710794insA								MDGA1 (45027 upstream) : ZFAND3 (76513 downstream)																																			---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39491184	39491185	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39491184_39491185insA	uc003oot.2	-						KIF6_uc010jwz.1_Intron|KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	41279874	41279875	+	IGR	INS	-	CTGTTCCAGAC	CTGTTCCAGAC	rs146906976	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41279874_41279875insCTGTTCCAGAC								TREM1 (25417 upstream) : NCR2 (23653 downstream)																																			---	---	---	---
USP49	25862	broad.mit.edu	37	6	41826388	41826389	+	Intron	INS	-	T	T	rs143236388	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41826388_41826389insT	uc003ori.2	-							NM_018561	NP_061031			ubiquitin thioesterase 49						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
CCND3	896	broad.mit.edu	37	6	41996710	41996710	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41996710delT	uc003orp.2	-						CCND3_uc011duk.1_Intron|CCND3_uc011dum.1_Intron	NM_001136017	NP_001129489			cyclin D3 isoform 1						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)					T	IGH@	MM								---	---	---	---
CUL9	23113	broad.mit.edu	37	6	43165230	43165230	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43165230delT	uc003ouk.2	+						CUL9_uc003oul.2_Intron|CUL9_uc010jyk.2_Intron	NM_015089	NP_055904			p53-associated parkin-like cytoplasmic protein						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	43764669	43764670	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43764669_43764670delGT								VEGFA (10448 upstream) : LOC100132354 (94095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	44753541	44753542	+	IGR	INS	-	T	T	rs149901598	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44753541_44753542insT								CDC5L (338762 upstream) : SUPT3H (23512 downstream)																																			---	---	---	---
RUNX2	860	broad.mit.edu	37	6	45329792	45329794	+	Intron	DEL	AAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45329792_45329794delAAC	uc011dvx.1	+						SUPT3H_uc003oxn.1_Intron|SUPT3H_uc003oxo.2_Intron|SUPT3H_uc011dvv.1_Intron|SUPT3H_uc003oxp.2_Intron|RUNX2_uc011dvy.1_Intron	NM_001024630	NP_001019801			runt-related transcription factor 2 isoform a						negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	45564541	45564542	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45564541_45564542insT								RUNX2 (45723 upstream) : CLIC5 (301648 downstream)																																			---	---	---	---
CYP39A1	51302	broad.mit.edu	37	6	46520810	46520811	+	Intron	INS	-	A	A	rs74946558		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46520810_46520811insA	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677			cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1																		---	---	---	---
PLA2G7	7941	broad.mit.edu	37	6	46672179	46672188	+	3'UTR	DEL	TCTCTCTCTC	-	-	rs10548951		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46672179_46672188delTCTCTCTCTC	uc010jzf.2	-	12						NM_005084	NP_005075			phospholipase A2, group VII						inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding				0			Lung(136;0.192)															---	---	---	---
GPR115	221393	broad.mit.edu	37	6	47678849	47678850	+	Intron	DEL	AA	-	-	rs138891164		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47678849_47678850delAA	uc003oza.1	+						GPR115_uc003oyz.1_Intron|GPR115_uc003ozb.1_Intron	NM_153838	NP_722580			G-protein coupled receptor 115 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	48824689	48824690	+	IGR	INS	-	T	T	rs138200003	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48824689_48824690insT								C6orf138 (745746 upstream) : MUT (574304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	48825258	48825258	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48825258delC								C6orf138 (746315 upstream) : MUT (573736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49040639	49040640	+	IGR	INS	-	GACG	GACG	rs146356771	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49040639_49040640insGACG								C6orf138 (961696 upstream) : MUT (358354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49236154	49236154	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49236154delG								None (None upstream) : MUT (162840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49763628	49763628	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49763628delT								PGK2 (8621 upstream) : CRISP1 (38351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49896278	49896278	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49896278delA								CRISP1 (62060 upstream) : DEFB114 (31728 downstream)																																			---	---	---	---
IL17F	112744	broad.mit.edu	37	6	52103294	52103294	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52103294delA	uc003pam.1	-						IL17F_uc003pal.1_Intron	NM_052872	NP_443104			interleukin 17F precursor						cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	53059832	53059833	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53059832_53059833insA								GCM1 (46208 upstream) : ELOVL5 (72363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53124239	53124239	+	IGR	DEL	A	-	-	rs34618822		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53124239delA								GCM1 (110615 upstream) : ELOVL5 (7957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53489370	53489370	+	IGR	DEL	T	-	-	rs34997040		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53489370delT								GCLC (79539 upstream) : KLHL31 (23330 downstream)																																			---	---	---	---
FAM83B	222584	broad.mit.edu	37	6	54775938	54775939	+	Intron	INS	-	GTGTGT	GTGTGT	rs138421344	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54775938_54775939insGTGTGT	uc003pck.2	+							NM_001010872	NP_001010872			hypothetical protein LOC222584											ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)																	---	---	---	---
BAG2	9532	broad.mit.edu	37	6	57040218	57040219	+	Intron	INS	-	TC	TC	rs144670802	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57040218_57040219insTC	uc003pdr.2	+						BAG2_uc011dxo.1_Intron	NM_004282	NP_004273			BCL2-associated athanogene 2						apoptosis|protein folding		protein binding				0	Lung NSC(77;0.126)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57210261	57210262	+	Intron	INS	-	AT	AT	rs144911799		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57210261_57210262insAT	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57260058	57260059	+	Intron	INS	-	G	G	rs143626187	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57260058_57260059insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57295872	57295873	+	Intron	DEL	AT	-	-	rs147337078		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57295872_57295873delAT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57327689	57327690	+	Intron	INS	-	A	A	rs142591900	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57327689_57327690insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57358075	57358076	+	Intron	INS	-	TC	TC	rs147835952	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57358075_57358076insTC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57375667	57375668	+	Intron	INS	-	G	G	rs150523374		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57375667_57375668insG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57411440	57411441	+	Intron	INS	-	A	A	rs11391617		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57411440_57411441insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57414398	57414399	+	Intron	INS	-	A	A	rs151258963		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57414398_57414399insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57443094	57443094	+	Intron	DEL	A	-	-	rs5876619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57443094delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57456986	57456986	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57456986delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57477669	57477670	+	Intron	INS	-	A	A	rs144786973	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57477669_57477670insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57497226	57497226	+	Intron	DEL	T	-	-	rs33917130		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57497226delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57524791	57524793	+	IGR	DEL	TTT	-	-	rs35354100		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57524791_57524793delTTT								PRIM2 (11416 upstream) : GUSBL2 (721366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57527646	57527646	+	IGR	DEL	G	-	-	rs61665278		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57527646delG								PRIM2 (14271 upstream) : GUSBL2 (718513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57544661	57544664	+	IGR	DEL	AGGG	-	-	rs75928337		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57544661_57544664delAGGG								PRIM2 (31286 upstream) : GUSBL2 (701495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57577557	57577558	+	IGR	INS	-	A	A	rs150323846	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57577557_57577558insA								PRIM2 (64182 upstream) : GUSBL2 (668601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57606558	57606558	+	IGR	DEL	T	-	-	rs74398707		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57606558delT								PRIM2 (93183 upstream) : GUSBL2 (639601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	58497922	58497923	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58497922_58497923delCT								GUSBL2 (210198 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	62240085	62240086	+	IGR	DEL	TC	-	-	rs147375123		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62240085_62240086delTC								None (None upstream) : KHDRBS2 (149779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63968159	63968160	+	IGR	DEL	AT	-	-	rs34447147		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63968159_63968160delAT								KHDRBS2 (972059 upstream) : LGSN (17697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	67439030	67439031	+	IGR	INS	-	TGC	TGC	rs140701575	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67439030_67439031insTGC								MCART3P (939655 upstream) : None (None downstream)																																			---	---	---	---
BAI3	577	broad.mit.edu	37	6	69363293	69363294	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69363293_69363294insT	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
COL19A1	1310	broad.mit.edu	37	6	70866387	70866388	+	Intron	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70866387_70866388delGA	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849			alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	72087631	72087632	+	5'Flank	INS	-	TTCA	TTCA	rs144044160	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72087631_72087632insTTCA	uc011dya.1	-						MIR30C2_hsa-mir-30c-2|MI0000254_5'Flank					DM004170																														---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73504071	73504071	+	Intron	DEL	A	-	-	rs78786594		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73504071delA	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816			potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
CD109	135228	broad.mit.edu	37	6	74507833	74507834	+	Intron	INS	-	T	T	rs67616867		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74507833_74507834insT	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000			CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	74921399	74921400	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74921399_74921400delTG	uc003phr.2	+											Homo sapiens full length insert cDNA clone ZD50H02.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	75506727	75506728	+	IGR	INS	-	C	C	rs74625439	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75506727_75506728insC								CD109 (968687 upstream) : COL12A1 (287315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	77968497	77968500	+	IGR	DEL	TCTT	-	-	rs144647428		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77968497_77968500delTCTT								None (None upstream) : HTR1B (203448 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78204837	78204838	+	IGR	INS	-	T	T	rs144940641	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78204837_78204838insT								HTR1B (31717 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	80485208	80485209	+	IGR	INS	-	A	A	rs71551658		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80485208_80485209insA								RNY4 (33539 upstream) : ELOVL4 (139327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81900211	81900222	+	IGR	DEL	CACACACACACA	-	-	rs9449268	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81900211_81900222delCACACACACACA								BCKDHB (844224 upstream) : FAM46A (555226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82041736	82041737	+	IGR	INS	-	TGTG	TGTG	rs149890506	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82041736_82041737insTGTG								BCKDHB (985749 upstream) : FAM46A (413711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82095705	82095706	+	IGR	DEL	AC	-	-	rs141658651		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82095705_82095706delAC								None (None upstream) : FAM46A (359742 downstream)																																			---	---	---	---
IBTK	25998	broad.mit.edu	37	6	82923672	82923673	+	Intron	INS	-	A	A	rs143811708	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82923672_82923673insA	uc003pjl.1	-						IBTK_uc011dyv.1_Intron|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Intron|IBTK_uc003pjm.2_Intron	NM_015525	NP_056340			inhibitor of Bruton's tyrosine kinase						negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	85079766	85079767	+	IGR	INS	-	A	A	rs142385976		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85079766_85079767insA								KIAA1009 (142431 upstream) : TBX18 (317314 downstream)																																			---	---	---	---
SYNCRIP	10492	broad.mit.edu	37	6	86337405	86337406	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86337405_86337406delCA	uc003pla.2	-						SYNCRIP_uc003pku.2_Intron|SYNCRIP_uc003pkw.2_Intron|SYNCRIP_uc003pky.2_Intron|SYNCRIP_uc003pkv.2_Intron|SYNCRIP_uc003pkx.2_Intron|SYNCRIP_uc003pkz.2_Intron	NM_006372	NP_006363			synaptotagmin binding, cytoplasmic RNA						CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	87048403	87048404	+	IGR	INS	-	CTT	CTT	rs139688318	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87048403_87048404insCTT								SNHG5 (659952 upstream) : HTR1E (598620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87598027	87598027	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87598027delA								None (None upstream) : HTR1E (48997 downstream)																																			---	---	---	---
HTR1E	3354	broad.mit.edu	37	6	87646482	87646482	+	5'Flank	DEL	A	-	-	rs113537151		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87646482delA	uc003pli.2	+							NM_000865	NP_000856			5-hydroxytryptamine (serotonin) receptor 1E						G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)											OREG0017560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	6	87732638	87732645	+	IGR	DEL	AAGGAAGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87732638_87732645delAAGGAAGG								HTR1E (6248 upstream) : CGA (62577 downstream)																																			---	---	---	---
ZNF292	23036	broad.mit.edu	37	6	87924684	87924685	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87924684_87924685insT	uc003plm.3	+						ZNF292_uc003pll.1_Intron	NM_015021	NP_055836			zinc finger protein 292						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	89266761	89266761	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89266761delA								CNR1 (390994 upstream) : RNGTT (53228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89764909	89764909	+	IGR	DEL	T	-	-	rs144212726		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89764909delT								RNGTT (91561 upstream) : PNRC1 (25520 downstream)																																			---	---	---	---
PM20D2	135293	broad.mit.edu	37	6	89857449	89857450	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89857449_89857450insA	uc003pmz.2	+							NM_001010853	NP_001010853			aminoacylase 1-like 2								hydrolase activity				0		all_cancers(76;9.47e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00813)														---	---	---	---
UBE2J1	51465	broad.mit.edu	37	6	90049006	90049006	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90049006delA	uc010kcb.2	-						UBE2J1_uc003pnc.2_Intron	NM_016021	NP_057105			ubiquitin-conjugating enzyme E2, J1							endoplasmic reticulum membrane|integral to membrane	ATP binding|ubiquitin-protein ligase activity				0		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	90616111	90616112	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90616111_90616112insT								GJA10 (10294 upstream) : BACH2 (20136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	92098482	92098483	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92098482_92098483insA								MAP3K7 (801575 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	92654152	92654159	+	IGR	DEL	CACACACA	-	-	rs72109536		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92654152_92654159delCACACACA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93070654	93070655	+	IGR	DEL	AC	-	-	rs112950523		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93070654_93070655delAC								None (None upstream) : EPHA7 (879087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	93507520	93507521	+	IGR	INS	-	AAAC	AAAC	rs144347731	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93507520_93507521insAAAC								None (None upstream) : EPHA7 (442221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96734528	96734529	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96734528_96734529insA								FUT9 (71041 upstream) : KIAA0776 (235173 downstream)																																			---	---	---	---
FHL5	9457	broad.mit.edu	37	6	97032338	97032339	+	Intron	DEL	TG	-	-	rs62412895		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97032338_97032339delTG	uc003pos.1	+						FHL5_uc003pot.1_Intron	NM_020482	NP_065228			activator of cAMP-responsive element modulator							nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	98022858	98022859	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98022858_98022859insT	uc003ppd.1	+											Homo sapiens cDNA FLJ34046 fis, clone FCBBF2007610.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	98191693	98191693	+	IGR	DEL	A	-	-	rs111331239		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98191693delA								C6orf167 (460632 upstream) : MIR2113 (280714 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98688793	98688796	+	IGR	DEL	GGAA	-	-	rs58687659		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98688793_98688796delGGAA								MIR2113 (216296 upstream) : POU3F2 (593784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98735236	98735236	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98735236delA								MIR2113 (262739 upstream) : POU3F2 (547344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	102790343	102790343	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102790343delG								GRIK2 (272386 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	103798974	103798975	+	IGR	INS	-	TGTG	TGTG	rs71547475		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103798974_103798975insTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104789451	104789452	+	IGR	INS	-	T	T	rs146188133	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104789451_104789452insT								None (None upstream) : HACE1 (386516 downstream)																																			---	---	---	---
SOBP	55084	broad.mit.edu	37	6	107827834	107827834	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107827834delA	uc003prx.2	+						SOBP_uc003prw.1_Intron	NM_018013	NP_060483			sine oculis binding protein homolog								metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)														---	---	---	---
SOBP	55084	broad.mit.edu	37	6	107843114	107843127	+	Intron	DEL	ACACACACACACAC	-	-	rs10541374		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107843114_107843127delACACACACACACAC	uc003prx.2	+						SOBP_uc003prw.1_Intron	NM_018013	NP_060483			sine oculis binding protein homolog								metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)														---	---	---	---
LACE1	246269	broad.mit.edu	37	6	108656203	108656204	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108656203_108656204insT	uc003psj.2	+							NM_145315	NP_660358			lactation elevated 1								ATP binding			central_nervous_system(1)	1		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	110216600	110216600	+	IGR	DEL	C	-	-	rs56098004		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110216600delC								FIG4 (69966 upstream) : GPR6 (82909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	110295540	110295541	+	IGR	DEL	GT	-	-	rs35200996		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110295540_110295541delGT								FIG4 (148906 upstream) : GPR6 (3968 downstream)																																			---	---	---	---
WASF1	8936	broad.mit.edu	37	6	110470161	110470162	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110470161_110470162insA	uc003ptv.1	-						WASF1_uc003ptw.1_Intron|WASF1_uc003ptx.1_Intron|WASF1_uc003pty.1_Intron|WASF1_uc003ptz.1_Intron	NM_003931	NP_003922			Wiskott-Aldrich syndrome protein family member						actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding				0		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)														---	---	---	---
CDK19	23097	broad.mit.edu	37	6	111101421	111101421	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111101421delA	uc003puh.1	-						CDK19_uc003pui.1_Intron	NM_015076	NP_055891			cell division cycle 2-like 6 (CDK8-like)								ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SLC16A10	117247	broad.mit.edu	37	6	111481983	111481984	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111481983_111481984delTC	uc003pus.2	+						SLC16A10_uc003pur.3_Intron	NM_018593	NP_061063			solute carrier family 16, member 10						aromatic amino acid transport|cellular nitrogen compound metabolic process|ion transport	basolateral plasma membrane|integral to membrane	amino acid transmembrane transporter activity				0		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	112354679	112354692	+	IGR	DEL	GTCTATCCCTTCCC	-	-	rs10625071		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112354679_112354692delGTCTATCCCTTCCC								FYN (160052 upstream) : WISP3 (20586 downstream)																																			---	---	---	---
C6orf225	619208	broad.mit.edu	37	6	112413082	112413083	+	Intron	DEL	AA	-	-	rs145708686		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112413082_112413083delAA	uc003pvs.2	+							NM_001033564	NP_001028736			hypothetical protein LOC619208												0																		---	---	---	---
LAMA4	3910	broad.mit.edu	37	6	112520622	112520623	+	Intron	INS	-	A	A	rs147918096	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112520622_112520623insA	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676			laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	112868290	112868290	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112868290delT								RFPL4B (195792 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	113924480	113924481	+	IGR	INS	-	T	T	rs146426755	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113924480_113924481insT								None (None upstream) : MARCKS (254046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115275331	115275331	+	IGR	DEL	T	-	-	rs148741350		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115275331delT								HS3ST5 (611791 upstream) : FRK (987362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115650678	115650679	+	IGR	INS	-	A	A	rs145787812	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115650678_115650679insA								HS3ST5 (987138 upstream) : FRK (612014 downstream)																																			---	---	---	---
RSPH4A	345895	broad.mit.edu	37	6	116936370	116936370	+	5'Flank	DEL	A	-	-	rs66647968		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116936370delA	uc003pxe.2	+						RSPH4A_uc010kee.2_5'Flank	NM_001010892	NP_001010892			radial spoke head 4 homolog A isoform 1						cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton|radial spoke					0														Kartagener_syndrome				---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117704316	117704316	+	Intron	DEL	G	-	-	rs4945582	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117704316delG	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935			proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---
Unknown	0	broad.mit.edu	37	6	118203146	118203147	+	IGR	INS	-	TGTG	TGTG	rs139166221	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118203146_118203147insTGTG								NUS1 (171262 upstream) : SLC35F1 (25542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	118203881	118203882	+	IGR	INS	-	T	T	rs146461133	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118203881_118203882insT								NUS1 (171997 upstream) : SLC35F1 (24807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	119054951	119054952	+	IGR	INS	-	T	T	rs35295518		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119054951_119054952insT								C6orf204 (23713 upstream) : ASF1A (160289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	121806375	121806376	+	IGR	INS	-	GGT	GGT	rs149922248	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121806375_121806376insGGT								GJA1 (35503 upstream) : HSF2 (914320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122013461	122013464	+	IGR	DEL	TGTG	-	-	rs71820059		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122013461_122013464delTGTG								GJA1 (242589 upstream) : HSF2 (707232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122014308	122014308	+	IGR	DEL	A	-	-	rs67503226		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122014308delA								GJA1 (243436 upstream) : HSF2 (706388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122518922	122518923	+	IGR	INS	-	AG	AG	rs151178955	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122518922_122518923insAG								GJA1 (748050 upstream) : HSF2 (201773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122523444	122523445	+	IGR	DEL	AC	-	-	rs146978644		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122523444_122523445delAC								GJA1 (752572 upstream) : HSF2 (197251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	123222211	123222223	+	IGR	DEL	CTTCTTCTTCTTT	-	-	rs137905798		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123222211_123222223delCTTCTTCTTCTTT								SMPDL3A (91349 upstream) : CLVS2 (95359 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	126420785	126420785	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126420785delC								TRMT11 (60367 upstream) : CENPW (240468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	127167782	127167795	+	Intron	DEL	TATGTGTATGTGTG	-	-	rs67545555		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127167782_127167795delTATGTGTATGTGTG	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130953453	130953456	+	IGR	DEL	AATC	-	-	rs141559887		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130953453_130953456delAATC								TMEM200A (189245 upstream) : LOC285733 (194868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	130993085	130993085	+	IGR	DEL	T	-	-	rs66757111		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130993085delT								TMEM200A (228877 upstream) : LOC285733 (155239 downstream)																																			---	---	---	---
AKAP7	9465	broad.mit.edu	37	6	131587845	131587845	+	Intron	DEL	G	-	-	rs66531321	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131587845delG	uc003qcm.1	+						AKAP7_uc003qck.2_Intron|AKAP7_uc011ebz.1_Intron|AKAP7_uc003qcl.1_Intron|AKAP7_uc003qcn.1_Intron	NM_138633	NP_619539			A-kinase anchor protein 7 isoform beta						intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding			ovary(2)	2	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	132081403	132081404	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132081403_132081404delCT								ENPP3 (12854 upstream) : ENPP1 (47752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133127353	133127354	+	IGR	INS	-	T	T	rs139289145	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133127353_133127354insT								C6orf192 (7606 upstream) : RPS12 (8354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	134261658	134261658	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134261658delT								TCF21 (42501 upstream) : TBPL1 (11695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	134411671	134411672	+	IGR	DEL	GT	-	-	rs33968679		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134411671_134411672delGT								SLC2A12 (37882 upstream) : SGK1 (78713 downstream)																																			---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136367371	136367371	+	Intron	DEL	A	-	-	rs34990837		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136367371delA	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron|uc003qgs.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136369228	136369231	+	Intron	DEL	AGAC	-	-	rs72347607		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136369228_136369231delAGAC	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron|uc003qgs.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	137889970	137889971	+	IGR	INS	-	GAGA	GAGA	rs149909915	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137889970_137889971insGAGA								OLIG3 (74439 upstream) : TNFAIP3 (298610 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	138942609	138942610	+	IGR	INS	-	T	T	rs138244314		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138942609_138942610insT								NHSL1 (48941 upstream) : CCDC28A (152047 downstream)																																			---	---	---	---
REPS1	85021	broad.mit.edu	37	6	139299431	139299431	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139299431delT	uc003qii.2	-						REPS1_uc003qig.3_Intron|REPS1_uc011edr.1_Intron|REPS1_uc003qij.2_Intron|REPS1_uc003qik.2_Intron	NM_031922	NP_114128			RALBP1 associated Eps domain containing 1							coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)														---	---	---	---
C6orf115	58527	broad.mit.edu	37	6	139358915	139358915	+	Intron	DEL	T	-	-	rs67509144		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139358915delT	uc003qil.2	+						C6orf115_uc003qim.2_Intron	NM_021243	NP_067066			hypothetical protein LOC58527												0				GBM - Glioblastoma multiforme(68;0.000278)|OV - Ovarian serous cystadenocarcinoma(155;0.000413)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	139522623	139522623	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139522623delT								HECA (20678 upstream) : TXLNB (38576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	140674735	140674736	+	IGR	DEL	CT	-	-	rs71803415		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140674735_140674736delCT								CITED2 (978950 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142229770	142229770	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142229770delT	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	143291237	143291238	+	Intron	INS	-	CA	CA	rs139185363	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143291237_143291238insCA	uc003qje.1	-											Homo sapiens cDNA FLJ32928 fis, clone TESTI2007405.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	145872998	145872998	+	IGR	DEL	T	-	-	rs71704949		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145872998delT								UTRN (698830 upstream) : EPM2A (73448 downstream)																																			---	---	---	---
GRM1	2911	broad.mit.edu	37	6	146596306	146596309	+	Intron	DEL	AGAG	-	-	rs113175913		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146596306_146596309delAGAG	uc010khw.1	+						GRM1_uc010khv.1_Intron|GRM1_uc003qll.2_Intron|GRM1_uc011edz.1_Intron|GRM1_uc011eea.1_Intron	NM_000838	NP_000829			glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)													---	---	---	---
GRM1	2911	broad.mit.edu	37	6	146610249	146610250	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146610249_146610250insA	uc010khw.1	+						GRM1_uc010khv.1_Intron|GRM1_uc003qll.2_Intron|GRM1_uc011edz.1_Intron|GRM1_uc011eea.1_Intron	NM_000838	NP_000829			glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	147164228	147164229	+	Intron	INS	-	TT	TT	rs77157220		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147164228_147164229insTT	uc003qls.1	-						uc003qlt.1_Intron					Homo sapiens cDNA FLJ34275 fis, clone FEBRA2003454.																														---	---	---	---
STXBP5	134957	broad.mit.edu	37	6	147534408	147534408	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147534408delT	uc003qlz.2	+						STXBP5_uc010khz.1_Intron|STXBP5_uc003qlx.2_Intron|STXBP5_uc003qly.2_Intron	NM_001127715	NP_001121187			syntaxin binding protein 5 (tomosyn) isoform b						exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	147976286	147976286	+	IGR	DEL	T	-	-	rs71546205		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147976286delT								SAMD5 (85129 upstream) : SASH1 (687443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	147990617	147990617	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147990617delG								SAMD5 (99460 upstream) : SASH1 (673112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148088118	148088122	+	IGR	DEL	ACAAA	-	-	rs149796544		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148088118_148088122delACAAA								SAMD5 (196961 upstream) : SASH1 (575607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148506191	148506191	+	IGR	DEL	T	-	-	rs67113963		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148506191delT								SAMD5 (615034 upstream) : SASH1 (157538 downstream)																																			---	---	---	---
UST	10090	broad.mit.edu	37	6	149161532	149161532	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149161532delA	uc003qmg.2	+							NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
UST	10090	broad.mit.edu	37	6	149240554	149240555	+	Intron	DEL	GT	-	-	rs142983347		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149240554_149240555delGT	uc003qmg.2	+							NM_005715	NP_005706			uronyl-2-sulfotransferase						protein sulfation	Golgi membrane|integral to membrane	sulfotransferase activity			ovary(2)	2		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)														---	---	---	---
TAB2	23118	broad.mit.edu	37	6	149630999	149631000	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149630999_149631000delTG	uc011eec.1	+							NM_015093	NP_055908			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0																		---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149839128	149839128	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149839128delA	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311			peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
MTHFD1L	25902	broad.mit.edu	37	6	151361081	151361084	+	Intron	DEL	CATG	-	-	rs12215772		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151361081_151361084delCATG	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255			methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152053670	152053671	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152053670_152053671delTG	uc003qom.3	+							NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152122186	152122187	+	Intron	INS	-	GT	GT	rs140026555	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152122186_152122187insGT	uc003qom.3	+							NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152180582	152180583	+	Intron	INS	-	A	A	rs141625650	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152180582_152180583insA	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron	NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152851759	152851759	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152851759delT	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153308091	153308092	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153308091_153308092insA								FBXO5 (3351 upstream) : MTRF1L (309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	154283259	154283260	+	IGR	INS	-	AT	AT	rs138793852	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154283259_154283260insAT								RGS17 (830870 upstream) : OPRM1 (48376 downstream)																																			---	---	---	---
IPCEF1	26034	broad.mit.edu	37	6	154538568	154538568	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154538568delA	uc003qpx.2	-						OPRM1_uc003qpt.1_Intron|IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368			phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	154837360	154837360	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154837360delT								CNKSR3 (5607 upstream) : RBM16 (217152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	154924843	154924843	+	IGR	DEL	A	-	-	rs11341552		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154924843delA								CNKSR3 (93090 upstream) : RBM16 (129669 downstream)																																			---	---	---	---
TFB1M	51106	broad.mit.edu	37	6	155612333	155612333	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155612333delA	uc003qqj.3	-						TFB1M_uc003qqk.2_Intron	NM_016020	NP_057104			transcription factor B1, mitochondrial						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	155951091	155951094	+	IGR	DEL	TGTC	-	-	rs66657008		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155951091_155951094delTGTC								NOX3 (174054 upstream) : MIR1202 (316837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156231635	156231636	+	IGR	INS	-	T	T	rs140922030	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156231635_156231636insT								NOX3 (454598 upstream) : MIR1202 (36295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156232958	156232959	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156232958_156232959insA								NOX3 (455921 upstream) : MIR1202 (34972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156524189	156524195	+	IGR	DEL	TGAAACC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156524189_156524195delTGAAACC								MIR1202 (256176 upstream) : ARID1B (574891 downstream)																																			---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	157887078	157887078	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157887078delA	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	158051862	158051863	+	Intron	DEL	CT	-	-	rs112347588		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158051862_158051863delCT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc003qqu.1_RNA	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	158195314	158195315	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158195314_158195315delGA								ZDHHC14 (100338 upstream) : SNX9 (48979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	158380763	158380776	+	IGR	DEL	ACACACACAAACAC	-	-	rs145318353	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158380763_158380776delACACACACAAACAC								SNX9 (14654 upstream) : SYNJ2 (22143 downstream)																																			---	---	---	---
RSPH3	83861	broad.mit.edu	37	6	159413268	159413268	+	Intron	DEL	G	-	-	rs112316691		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159413268delG	uc003qrx.2	-						RSPH3_uc010kju.2_Intron|RSPH3_uc003qry.1_Intron	NM_031924	NP_114130			radial spoke 3 homolog											ovary(1)|skin(1)	2		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.36e-16)|BRCA - Breast invasive adenocarcinoma(81;5.92e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	159803869	159803870	+	IGR	DEL	AC	-	-	rs71683372		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159803869_159803870delAC								FNDC1 (110730 upstream) : SOD2 (296281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160302538	160302539	+	IGR	INS	-	AAC	AAC	rs147658688	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160302538_160302539insAAC								PNLDC1 (60803 upstream) : MAS1 (25435 downstream)																																			---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162194575	162194577	+	Intron	DEL	AAG	-	-	rs67068148		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162194575_162194577delAAG	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162842311	162842312	+	Intron	INS	-	TTTTAT	TTTTAT	rs147489350	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162842311_162842312insTTTTAT	uc003qtx.3	-						PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162904591	162904592	+	Intron	INS	-	GGAG	GGAG	rs142168440	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162904591_162904592insGGAG	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	164034130	164034131	+	IGR	INS	-	CAT	CAT	rs140222388	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164034130_164034131insCAT								QKI (39238 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164309136	164309138	+	IGR	DEL	AAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164309136_164309138delAAA								QKI (314244 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164909933	164909934	+	IGR	DEL	TT	-	-	rs34367527		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164909933_164909934delTT								QKI (915041 upstream) : C6orf118 (783221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166280165	166280165	+	Intron	DEL	C	-	-	rs66681671		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166280165delC	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	166535297	166535297	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166535297delA								LOC441177 (132194 upstream) : T (35789 downstream)																																			---	---	---	---
RPS6KA2	6196	broad.mit.edu	37	6	167268918	167268920	+	Intron	DEL	GAA	-	-	rs13215333		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167268918_167268920delGAA	uc003qvd.1	-						RPS6KA2_uc003qvc.1_Intron	NM_021135	NP_066958			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	167293734	167293734	+	IGR	DEL	A	-	-	rs147143029		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167293734delA								RPS6KA2 (17963 upstream) : RNASET2 (49274 downstream)																																			---	---	---	---
FGFR1OP	11116	broad.mit.edu	37	6	167421961	167421962	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167421961_167421962insT	uc003qvj.2	+						CCR6_uc003qvl.2_Intron|FGFR1OP_uc011egp.1_Intron|FGFR1OP_uc003qvk.2_Intron	NM_007045	NP_008976			FGFR1 oncogene partner isoform a						G2/M transition of mitotic cell cycle|microtubule anchoring|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell proliferation	centrosome|cytosol|nucleus|perinuclear region of cytoplasm	protein homodimerization activity|protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(1)	1		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)				T	FGFR1	MPD|NHL								---	---	---	---
Unknown	0	broad.mit.edu	37	6	168452680	168452680	+	IGR	DEL	T	-	-	rs113220660		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168452680delT								KIF25 (6911 upstream) : FRMD1 (3785 downstream)																																			---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	168919897	168919898	+	Intron	DEL	GA	-	-	rs147173363		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168919897_168919898delGA	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421			SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	169295742	169295745	+	IGR	DEL	TGTG	-	-	rs71676875		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169295742_169295745delTGTG								SMOC2 (227071 upstream) : THBS2 (320131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	170402662	170402663	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170402662_170402663insG								C6orf208 (199693 upstream) : LOC154449 (160759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	567954	567955	+	IGR	INS	-	ATGG	ATGG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:567954_567955insATGG								PDGFA (8473 upstream) : PRKAR1B (21432 downstream)																																			---	---	---	---
HEATR2	54919	broad.mit.edu	37	7	815149	815150	+	Intron	DEL	GT	-	-	rs139886729		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:815149_815150delGT	uc010krz.1	+						HEATR2_uc003siz.2_Intron|HEATR2_uc003sjb.2_Intron|HEATR2_uc003sjc.2_Intron	NM_017802	NP_060272			HEAT repeat containing 2								protein binding			skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)														---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	945408	945408	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945408delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860			centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	946039	946040	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:946039_946040insA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860			centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	1221128	1221129	+	IGR	INS	-	C	C	rs147863939	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1221128_1221129insC								ZFAND2A (21273 upstream) : UNCX (51525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1320766	1320771	+	IGR	DEL	AGCAGC	-	-	rs66672762		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1320766_1320771delAGCAGC								UNCX (44154 upstream) : MICALL2 (153225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1358698	1358699	+	IGR	DEL	AT	-	-	rs111662921		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1358698_1358699delAT								UNCX (82086 upstream) : MICALL2 (115297 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	1927047	1927048	+	Intron	INS	-	TG	TG	rs150697526	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1927047_1927048insTG	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2435270	2435277	+	IGR	DEL	GATAGATG	-	-	rs3074531		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2435270_2435277delGATAGATG								EIF3B (14895 upstream) : CHST12 (7946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	2477318	2477318	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2477318delT	uc003sme.2	+											Homo sapiens, clone IMAGE:4778475, mRNA.																														---	---	---	---
CARD11	84433	broad.mit.edu	37	7	3056221	3056221	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3056221delT	uc003smv.2	-							NM_032415	NP_115791			caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)				Mis		DLBCL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	3105392	3105393	+	IGR	INS	-	AA	AA	rs146178426	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3105392_3105393insAA								CARD11 (21813 upstream) : SDK1 (235687 downstream)																																	OREG0017843	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	7	3299729	3299730	+	IGR	DEL	AC	-	-	rs34135014		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3299729_3299730delAC								CARD11 (216150 upstream) : SDK1 (41350 downstream)																																			---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3384290	3384292	+	Intron	DEL	TTC	-	-	rs35446523		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3384290_3384292delTTC	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	4045026	4045035	+	Intron	DEL	GTGTGTGTGT	-	-	rs72329212		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4045026_4045035delGTGTGTGTGT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4486575	4486576	+	IGR	INS	-	A	A	rs71535114		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4486575_4486576insA								SDK1 (177946 upstream) : FOXK1 (196812 downstream)																																			---	---	---	---
MMD2	221938	broad.mit.edu	37	7	4934154	4934154	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4934154delT	uc003snl.1	-											Homo sapiens cDNA FLJ37205 fis, clone BRALZ2007376, moderately similar to MONOCYTE TO MACROPHAGE DIFFERENTIATION PROTEIN.							integral to membrane	receptor activity			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)														---	---	---	---
CYTH3	9265	broad.mit.edu	37	7	6295340	6295340	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6295340delG	uc003spt.2	-							NM_004227	NP_004218			cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	6605655	6605655	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6605655delT								GRID2IP (14588 upstream) : ZDHHC4 (11410 downstream)																																			---	---	---	---
PMS2CL	441194	broad.mit.edu	37	7	6775132	6775133	+	Intron	INS	-	T	T	rs71539975		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6775132_6775133insT	uc011jxb.1	+						PMS2CL_uc003squ.2_Intron|PMS2CL_uc003sqv.1_Intron					SubName: Full=cDNA FLJ60281, highly similar to PMS1 protein homolog 2;												0																		---	---	---	---
NXPH1	30010	broad.mit.edu	37	7	8576239	8576240	+	Intron	INS	-	A	A	rs143943963	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8576239_8576240insA	uc003srv.2	+						NXPH1_uc011jxh.1_Intron	NM_152745	NP_689958			neurexophilin 1 precursor							extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9661789	9661790	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9661789_9661790delAC								NXPH1 (869197 upstream) : PER4 (12110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9769151	9769161	+	IGR	DEL	AAAAAAAAAAA	-	-	rs71549514		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9769151_9769161delAAAAAAAAAAA								PER4 (93704 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10569562	10569563	+	IGR	INS	-	A	A	rs149152861	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10569562_10569563insA								PER4 (894115 upstream) : NDUFA4 (403252 downstream)																																			---	---	---	---
PHF14	9678	broad.mit.edu	37	7	11063454	11063455	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11063454_11063455insA	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475			PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)														---	---	---	---
SCIN	85477	broad.mit.edu	37	7	12669023	12669024	+	Intron	INS	-	CA	CA	rs147409814	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12669023_12669024insCA	uc003ssn.3	+						SCIN_uc010ktt.2_Intron|SCIN_uc003sso.3_Intron	NM_001112706	NP_001106177			scinderin isoform 1						actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	13037945	13037945	+	IGR	DEL	T	-	-	rs34968966		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13037945delT								ARL4A (307389 upstream) : ETV1 (892913 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14571872	14571873	+	Intron	INS	-	A	A	rs78068167		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14571872_14571873insA	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14880325	14880336	+	Intron	DEL	ACACACACACAC	-	-	rs112652805		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14880325_14880336delACACACACACAC	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron|DGKB_uc011jxv.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
ISPD	729920	broad.mit.edu	37	7	16149783	16149783	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16149783delA	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896			notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1															Multiple Myeloma(15;0.18)			---	---	---	---
SOSTDC1	25928	broad.mit.edu	37	7	16512733	16512733	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16512733delA	uc003sth.2	-							NM_015464	NP_056279			sclerostin domain containing 1 precursor						Wnt receptor signaling pathway					ovary(2)|central_nervous_system(1)	3	Lung NSC(10;0.185)			UCEC - Uterine corpus endometrioid carcinoma (126;0.177)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	16974332	16974333	+	IGR	INS	-	TGTG	TGTG	rs146017115	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16974332_16974333insTGTG								AGR3 (52719 upstream) : AHR (363943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	16992208	16992209	+	IGR	INS	-	ACACACACAC	ACACACACAC	rs138626130	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16992208_16992209insACACACACAC								AGR3 (70595 upstream) : AHR (346067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19681085	19681086	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19681085_19681086insA								FERD3L (496041 upstream) : TWISTNB (53999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20012949	20012949	+	IGR	DEL	T	-	-	rs138016847		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20012949delT								TMEM196 (199733 upstream) : MACC1 (161339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20266581	20266581	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20266581delA								MACC1 (9568 upstream) : ITGB8 (103744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20490364	20490364	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20490364delT								ITGB8 (34986 upstream) : ABCB5 (164881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	20810407	20810408	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20810407_20810408insT								ABCB5 (13771 upstream) : SP8 (11487 downstream)																																			---	---	---	---
RAPGEF5	9771	broad.mit.edu	37	7	22209314	22209316	+	Intron	DEL	AAA	-	-	rs34238182		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22209314_22209316delAAA	uc011jym.1	-						RAPGEF5_uc003svg.2_Intron					Synthetic construct DNA, clone: pF1KSDA0277, Homo sapiens RAPGEF5 gene for Rap guanine nucleotide exchange factor 5, complete cds, without stop codon, in Flexi system.						nervous system development|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	nucleus	GTP-dependent protein binding|Rap guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	23587140	23587141	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23587140_23587141insA								TRA2A (15484 upstream) : CLK2P (37194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26182905	26182906	+	IGR	INS	-	AGAG	AGAG	rs1015535	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26182905_26182906insAGAG								MIR148A (193299 upstream) : NFE2L3 (8941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	28263012	28263013	+	Intron	INS	-	CT	CT	rs140569255	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28263012_28263013insCT	uc011jzq.1	+											SubName: Full=cDNA FLJ59585;																														---	---	---	---
FAM188B	84182	broad.mit.edu	37	7	30872129	30872129	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30872129delT	uc003tbt.2	+						FAM188B_uc010kwe.2_Intron	NM_032222	NP_115598			hypothetical protein LOC84182												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	31763573	31763574	+	IGR	INS	-	C	C	rs139993667	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31763573_31763574insC								C7orf16 (15505 upstream) : PDE1C (29058 downstream)																																			---	---	---	---
AVL9	23080	broad.mit.edu	37	7	32778089	32778090	+	Intron	INS	-	GA	GA	rs148690276	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32778089_32778090insGA	uc011kai.1	+						LOC441208_uc003tcy.3_Intron	NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	33788196	33788208	+	IGR	DEL	TCCCTGTACTCTC	-	-	rs68061152		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33788196_33788208delTCCCTGTACTCTC								BBS9 (142516 upstream) : BMPER (156904 downstream)																																			---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34019592	34019592	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34019592delT	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34141319	34141319	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34141319delG	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	34952861	34952864	+	IGR	DEL	TGTG	-	-	rs71803295		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34952861_34952864delTGTG								NPSR1 (34917 upstream) : DPY19L1 (8217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	36551147	36551148	+	IGR	INS	-	TCAT	TCAT	rs138610550	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36551147_36551148insTCAT								ANLN (57749 upstream) : AOAH (1462 downstream)																																			---	---	---	---
AOAH	313	broad.mit.edu	37	7	36576842	36576843	+	Intron	INS	-	T	T	rs142019726		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36576842_36576843insT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628			acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1																		---	---	---	---
AMPH	273	broad.mit.edu	37	7	38424702	38424703	+	Intron	INS	-	A	A	rs34834299		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38424702_38424703insA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	38747750	38747750	+	IGR	DEL	T	-	-	rs35105985		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38747750delT								FAM183B (21061 upstream) : VPS41 (15794 downstream)																																			---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40123538	40123539	+	Intron	INS	-	G	G	rs147201827	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40123538_40123539insG	uc003thh.3	+						CDK13_uc003thi.3_Intron|CDK13_uc003thj.2_Intron	NM_003718	NP_003709			cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41122910	41122912	+	IGR	DEL	TAA	-	-	rs145780545		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41122910_41122912delTAA								C7orf10 (222553 upstream) : INHBA (605691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41858986	41858986	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41858986delT								LOC285954 (40012 upstream) : GLI3 (141564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	42437429	42437429	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42437429delC								GLI3 (160811 upstream) : C7orf25 (511445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	42450752	42450752	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42450752delT								GLI3 (174134 upstream) : C7orf25 (498122 downstream)																																			---	---	---	---
CAMK2B	816	broad.mit.edu	37	7	44336907	44336909	+	Intron	DEL	AAG	-	-	rs145713689		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44336907_44336909delAAG	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211			calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2																		---	---	---	---
PURB	5814	broad.mit.edu	37	7	44927185	44927186	+	5'Flank	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44927185_44927186delTG	uc003tme.2	-							NM_033224	NP_150093			purine-rich element binding protein B						regulation of myeloid cell differentiation	DNA replication factor A complex	mRNA binding|single-stranded DNA binding|transcription factor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	44981012	44981013	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44981012_44981013insA								PURB (56052 upstream) : MYO1G (21247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45118689	45118690	+	IGR	INS	-	GGG	GGG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45118689_45118690insGGG								CCM2 (2621 upstream) : NACAD (1347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45557516	45557516	+	IGR	DEL	T	-	-	rs150785405		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45557516delT								RAMP3 (333669 upstream) : ADCY1 (56223 downstream)																																			---	---	---	---
ADCY1	107	broad.mit.edu	37	7	45653052	45653052	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45653052delA	uc003tne.3	+						ADCY1_uc003tnd.2_Intron	NM_021116	NP_066939			adenylate cyclase 1						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|calmodulin binding|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6					Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	45923555	45923558	+	IGR	DEL	TCTT	-	-	rs71935217		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45923555_45923558delTCTT								SEPT7P2 (114938 upstream) : IGFBP1 (4401 downstream)																																			---	---	---	---
HUS1	3364	broad.mit.edu	37	7	48010803	48010803	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48010803delA	uc003tod.1	-						HUS1_uc003toe.1_Intron|HUS1_uc011kce.1_Intron	NM_004507	NP_004498			HUS1 checkpoint protein						DNA damage checkpoint|DNA replication	Golgi apparatus|nucleolus|nucleoplasm	protein binding			ovary(2)|lung(2)|kidney(1)	5		Breast(660;0.00139)											Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					---	---	---	---
UPP1	7378	broad.mit.edu	37	7	48135246	48135246	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48135246delT	uc003toj.2	+						UPP1_uc003tok.2_Intron|UPP1_uc003tol.2_Intron|UPP1_uc011kcg.1_Intron|UPP1_uc011kch.1_Intron|UPP1_uc003ton.2_Intron|UPP1_uc003too.2_Intron	NM_181597	NP_853628			uridine phosphorylase 1						nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage	cytosol	uridine phosphorylase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	48154736	48154736	+	IGR	DEL	G	-	-	rs58363728	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48154736delG								UPP1 (6407 upstream) : ABCA13 (56321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49576835	49576835	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49576835delG								CDC14C (609786 upstream) : VWC2 (236422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51406869	51406870	+	IGR	DEL	CC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51406869_51406870delCC								COBL (22354 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51409282	51409283	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51409282_51409283delCA								COBL (24767 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51554321	51554321	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51554321delT								COBL (169806 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51949102	51949103	+	IGR	INS	-	C	C	rs142781969	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51949102_51949103insC								COBL (564587 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52256936	52256939	+	IGR	DEL	AGAG	-	-	rs72473823		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52256936_52256939delAGAG								COBL (872421 upstream) : POM121L12 (846410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52735164	52735165	+	IGR	INS	-	TA	TA	rs149137028	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52735164_52735165insTA								None (None upstream) : POM121L12 (368184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52989354	52989355	+	IGR	INS	-	A	A	rs149691894	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52989354_52989355insA								None (None upstream) : POM121L12 (113994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54137844	54137845	+	IGR	INS	-	CCAA	CCAA	rs144064306	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54137844_54137845insCCAA								None (None upstream) : HPVC1 (131072 downstream)																																			---	---	---	---
EGFR	1956	broad.mit.edu	37	7	55099211	55099212	+	Intron	INS	-	GA	GA	rs144333902	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55099211_55099212insGA	uc003tqk.2	+						EGFR_uc003tqh.2_Intron|EGFR_uc003tqi.2_Intron|EGFR_uc003tqj.2_Intron|EGFR_uc010kzg.1_Intron	NM_005228	NP_005219			epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55719206	55719206	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55719206delC								LOC442308 (4564 upstream) : FKBP9L (29562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55844690	55844691	+	IGR	INS	-	T	T	rs35253524		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55844690_55844691insT								FKBP9L (72430 upstream) : SEPT14 (16546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56403724	56403725	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56403724_56403725insA								PSPH (219634 upstream) : DKFZp434L192 (160191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57252911	57252911	+	IGR	DEL	A	-	-	rs10714949		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57252911delA								ZNF479 (45340 upstream) : ZNF716 (256972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57546165	57546166	+	IGR	INS	-	TGGAA	TGGAA	rs142727527	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57546165_57546166insTGGAA								ZNF716 (12900 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57607514	57607518	+	IGR	DEL	ATTTT	-	-	rs149879721	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57607514_57607518delATTTT								ZNF716 (74249 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57644543	57644544	+	IGR	INS	-	T	T	rs138158983	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57644543_57644544insT								ZNF716 (111278 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57703715	57703716	+	IGR	INS	-	G	G	rs150355087	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57703715_57703716insG								ZNF716 (170450 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57882176	57882177	+	IGR	INS	-	TG	TG	rs143911006	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57882176_57882177insTG								ZNF716 (348911 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61761559	61761559	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61761559delA								None (None upstream) : LOC643955 (990113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61890047	61890047	+	IGR	DEL	T	-	-	rs112301303		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61890047delT								None (None upstream) : LOC643955 (861625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61903103	61903104	+	IGR	INS	-	T	T	rs140478169	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61903103_61903104insT								None (None upstream) : LOC643955 (848568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62981783	62981784	+	IGR	INS	-	TG	TG	rs62476047		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62981783_62981784insTG								LOC100287704 (169632 upstream) : ZNF727 (524037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63373025	63373025	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63373025delC	uc003tsv.2	+											Homo sapiens cDNA clone IMAGE:5296015.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	64027400	64027401	+	IGR	INS	-	T	T	rs35675469		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64027400_64027401insT								ZNF680 (3895 upstream) : ZNF107 (99110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64962868	64962868	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64962868delA								ZNF92 (96871 upstream) : INTS4L2 (149909 downstream)																																			---	---	---	---
VKORC1L1	154807	broad.mit.edu	37	7	65361540	65361543	+	Intron	DEL	TCCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65361540_65361543delTCCT	uc003tul.2	+						VKORC1L1_uc011kds.1_Intron	NM_173517	NP_775788			vitamin K epoxide reductase complex, subunit							integral to membrane					0		Lung NSC(55;0.197)			Menadione(DB00170)|Warfarin(DB00682)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	66439532	66439533	+	IGR	INS	-	T	T	rs140274476	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66439532_66439533insT								C7orf42 (15995 upstream) : SBDS (13157 downstream)																																			---	---	---	---
SBDS	51119	broad.mit.edu	37	7	66459025	66459026	+	Intron	INS	-	C	C	rs35233602		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66459025_66459026insC	uc003tvm.1	-						TYW1_uc003tvn.2_5'Flank|TYW1_uc010lai.2_5'Flank	NM_016038	NP_057122			Shwachman-Bodian-Diamond syndrome protein						bone marrow development|bone mineralization|leukocyte chemotaxis|mature ribosome assembly|mitotic spindle stabilization|positive regulation of translation|ribosomal large subunit biogenesis|rRNA processing	cytoplasm|nucleolus|nucleoplasm|spindle pole	microtubule binding|ribosome binding|rRNA binding			ovary(1)	1								Gene Conversion			AML|MDS			Shwachman-Diamond_syndrome				---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66687854	66687856	+	Intron	DEL	TTT	-	-	rs71052412		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66687854_66687856delTTT	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron|PMS2L4_uc003tvo.2_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	67181579	67181579	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67181579delA								STAG3L4 (395067 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67213691	67213692	+	IGR	DEL	GG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67213691_67213692delGG								STAG3L4 (427179 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67289839	67289839	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67289839delT								STAG3L4 (503327 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68021170	68021171	+	IGR	INS	-	GTTT	GTTT	rs141332417	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68021170_68021171insGTTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68262296	68262297	+	IGR	INS	-	G	G	rs140684855	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68262296_68262297insG								None (None upstream) : AUTS2 (801608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68523209	68523209	+	IGR	DEL	C	-	-	rs11348041		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68523209delC								None (None upstream) : AUTS2 (540696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68719820	68719831	+	IGR	DEL	AAGGAAGAGAGA	-	-	rs73143711	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68719820_68719831delAAGGAAGAGAGA								None (None upstream) : AUTS2 (344074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68920817	68920817	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68920817delA								None (None upstream) : AUTS2 (143088 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69137050	69137050	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69137050delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69725741	69725741	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69725741delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73263039	73263040	+	Intron	INS	-	TTCC	TTCC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73263039_73263040insTTCC	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
GTF2IRD1	9569	broad.mit.edu	37	7	73905031	73905031	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73905031delT	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron	NM_016328	NP_057412			GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4																		---	---	---	---
GTF2I	2969	broad.mit.edu	37	7	74142657	74142658	+	Intron	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74142657_74142658insAA	uc003uau.2	+						GTF2I_uc003uav.2_Intron|GTF2I_uc003uaw.2_Intron|GTF2I_uc003uay.2_Intron|GTF2I_uc003uax.2_Intron|uc003uaz.2_Intron	NM_032999	NP_127492			general transcription factor IIi isoform 1						negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	74286262	74286262	+	IGR	DEL	T	-	-	rs111433198	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74286262delT								GTF2IRD2 (18421 upstream) : STAG3L2 (12584 downstream)																																			---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75219036	75219037	+	Intron	INS	-	A	A	rs143786248	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75219036_75219037insA	uc003uds.1	-						HIP1_uc011kfz.1_Intron	NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
SRRM3	222183	broad.mit.edu	37	7	75886202	75886202	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75886202delT	uc010ldi.2	+							NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0																		---	---	---	---
PMS2L11	441263	broad.mit.edu	37	7	76619060	76619061	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76619060_76619061insT	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	77612634	77612635	+	IGR	INS	-	TTCC	TTCC	rs13240757	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77612634_77612635insTTCC								PHTF2 (25816 upstream) : MAGI2 (33740 downstream)																																			---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78166488	78166491	+	Intron	DEL	ACAC	-	-	rs3086437		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78166488_78166491delACAC	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	79115989	79115990	+	IGR	INS	-	TT	TT	rs139235746	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79115989_79115990insTT								MAGI2 (33099 upstream) : GNAI1 (648150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	79312102	79312103	+	IGR	INS	-	TA	TA	rs140305186	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79312102_79312103insTA								MAGI2 (229212 upstream) : GNAI1 (452037 downstream)																																			---	---	---	---
CD36	948	broad.mit.edu	37	7	80108845	80108845	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80108845delG	uc003uhc.2	+						GNAT3_uc011kgu.1_Intron	NM_001127444	NP_001120916			CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1																		---	---	---	---
SEMA3C	10512	broad.mit.edu	37	7	80386135	80386138	+	Intron	DEL	CACC	-	-	rs143143341		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80386135_80386138delCACC	uc003uhj.2	-						SEMA3C_uc011kgw.1_Intron	NM_006379	NP_006370			semaphorin 3C precursor						immune response|response to drug	membrane	receptor activity			ovary(1)	1																		---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81740880	81740881	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81740880_81740881insT	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	82114032	82114033	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82114032_82114033insT								CACNA2D1 (41001 upstream) : PCLO (269288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84175725	84175726	+	Intron	DEL	GG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84175725_84175726delGG	uc003uia.1	+											Homo sapiens mRNA; cDNA DKFZp686F03118 (from clone DKFZp686F03118).																														---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84680700	84680700	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84680700delG	uc003uic.2	-						SEMA3D_uc010led.2_Intron|SEMA3D_uc010lee.1_Intron	NM_152754	NP_689967			semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	85610328	85610329	+	IGR	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85610328_85610329delCT								SEMA3D (794157 upstream) : GRM3 (662901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	88332851	88332851	+	IGR	DEL	T	-	-	rs67325191		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88332851delT								STEAP4 (396642 upstream) : ZNF804B (55902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89642937	89642938	+	IGR	DEL	AT	-	-	rs112662867		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89642937_89642938delAT								ZNF804B (676593 upstream) : DPY19L2P4 (105776 downstream)																																			---	---	---	---
STEAP1	26872	broad.mit.edu	37	7	89791082	89791082	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89791082delA	uc003ujx.2	+						STEAP1_uc010lem.2_Intron	NM_012449	NP_036581			six transmembrane epithelial antigen of the						electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)																	---	---	---	---
CDK6	1021	broad.mit.edu	37	7	92288921	92288922	+	Intron	INS	-	AC	AC	rs138594284	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92288921_92288922insAC	uc011khw.1	-						CDK6_uc010lez.2_Intron	NM_001259	NP_001250			cyclin-dependent kinase 6						cell dedifferentiation|cell division|G1 phase of mitotic cell cycle|gliogenesis|negative regulation of cell cycle|negative regulation of epithelial cell proliferation|negative regulation of osteoblast differentiation|positive regulation of cell-matrix adhesion|positive regulation of fibroblast proliferation|regulation of erythrocyte differentiation|regulation of gene expression|response to virus	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleus|ruffle	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			central_nervous_system(1)|skin(1)	2	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)					T	MLLT10	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	93941805	93941805	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93941805delA								BET1 (308115 upstream) : COL1A2 (82068 downstream)																																			---	---	---	---
CASD1	64921	broad.mit.edu	37	7	94136702	94136703	+	5'Flank	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94136702_94136703delGT	uc003uni.3	+						CASD1_uc003unh.2_5'Flank|CASD1_uc003unj.3_5'Flank	NM_022900	NP_075051			CAS1 domain containing 1 precursor							integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	95079241	95079242	+	IGR	INS	-	T	T	rs67276495		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95079241_95079242insT								PON2 (14857 upstream) : ASB4 (36042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	95172697	95172697	+	IGR	DEL	T	-	-	rs148868436		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95172697delT								ASB4 (5628 upstream) : PDK4 (40118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	95365342	95365342	+	IGR	DEL	C	-	-	rs36092675		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95365342delC								PDK4 (139417 upstream) : DYNC1I1 (36476 downstream)																																			---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95692442	95692445	+	Intron	DEL	TGTA	-	-	rs112885345		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95692442_95692445delTGTA	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
SLC25A13	10165	broad.mit.edu	37	7	95930944	95930945	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95930944_95930945insT	uc003uof.3	-						SLC25A13_uc003uog.3_Intron|SLC25A13_uc011kik.1_Intron	NM_014251	NP_055066			solute carrier family 25, member 13 isoform 2						ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)													---	---	---	---
SHFM1	7979	broad.mit.edu	37	7	96339292	96339292	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96339292delT	uc003uoi.2	-						SHFM1_uc010lfn.1_5'Flank	NM_006304	NP_006295			split hand/foot malformation type 1						proteolysis	proteasome complex	peptidase activity|protein binding				0	all_cancers(62;4.24e-09)|all_epithelial(64;5.59e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0353)|Lung NSC(181;0.0987)												Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
Unknown	0	broad.mit.edu	37	7	97459858	97459859	+	IGR	INS	-	T	T	rs141711624		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97459858_97459859insT								TAC1 (90076 upstream) : ASNS (21584 downstream)																																			---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98614355	98614355	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98614355delA	uc003ups.2	+											Homo sapiens TRRAP protein (TRRAP) mRNA, complete cds.						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	98895860	98895860	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98895860delT								MYH16 (268 upstream) : ARPC1A (27650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	99139365	99139365	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99139365delA								ZKSCAN5 (7921 upstream) : FAM200A (4559 downstream)																																			---	---	---	---
AP4M1	9179	broad.mit.edu	37	7	99700053	99700054	+	Intron	INS	-	C	C	rs72592400		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99700053_99700054insC	uc003utb.3	+						MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Intron|AP4M1_uc010lgl.1_Intron|AP4M1_uc003utc.3_Intron|AP4M1_uc010lgm.2_Intron|AP4M1_uc003utd.2_Intron|AP4M1_uc011kjh.1_Intron|AP4M1_uc003ute.3_Intron|AP4M1_uc003utf.3_Intron	NM_004722	NP_004713			adaptor-related protein complex 4, mu 1 subunit						intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
CNPY4	245812	broad.mit.edu	37	7	99719672	99719673	+	Intron	INS	-	A	A	rs111511573		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99719672_99719673insA	uc003uto.2	+						TAF6_uc003uti.2_5'Flank|TAF6_uc003utk.2_5'Flank|TAF6_uc011kji.1_5'Flank|TAF6_uc003utj.2_5'Flank|TAF6_uc003utl.2_5'Flank|TAF6_uc003utm.2_5'Flank|TAF6_uc003utn.1_5'Flank	NM_152755	NP_689968			canopy 4 homolog precursor							extracellular region					0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	99727854	99727854	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99727854delT								MBLAC1 (1735 upstream) : C7orf59 (18676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	99744164	99744165	+	IGR	INS	-	A	A	rs142299483	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99744164_99744165insA								MBLAC1 (18045 upstream) : C7orf59 (2365 downstream)																																			---	---	---	---
C7orf59	389541	broad.mit.edu	37	7	99750027	99750028	+	Intron	INS	-	AAAC	AAAC	rs147432716	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99750027_99750028insAAAC	uc003utq.2	+							NM_001008395	NP_001008396			hypothetical protein LOC389541												0																		---	---	---	---
GATS	352954	broad.mit.edu	37	7	99844484	99844484	+	Intron	DEL	T	-	-	rs112862541		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99844484delT	uc003uua.3	-						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc010lgu.2_Intron	NM_178831	NP_849153			GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
C7orf61	402573	broad.mit.edu	37	7	100058212	100058213	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100058212_100058213insA	uc003uuz.1	-							NM_001004323	NP_001004323			hypothetical protein LOC402573												0																		---	---	---	---
TFR2	7036	broad.mit.edu	37	7	100231825	100231826	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100231825_100231826insG	uc003uvv.1	-						TFR2_uc010lhc.1_5'Flank|TFR2_uc003uvu.1_5'Flank	NM_003227	NP_003218			transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100716811	100716812	+	IGR	DEL	AT	-	-	rs139545487	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100716811_100716812delAT								MUC17 (14671 upstream) : TRIM56 (11974 downstream)																																			---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101045927	101045930	+	Intron	DEL	CCTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101045927_101045930delCCTT	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101150209	101150210	+	Intron	INS	-	T	T	rs67323485		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101150209_101150210insT	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
MYL10	93408	broad.mit.edu	37	7	101270418	101270418	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101270418delA	uc003uyr.2	-							NM_138403	NP_612412			myosin, light chain 10, regulatory							mitochondrion	calcium ion binding			ovary(1)|breast(1)	2																		---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101778851	101778852	+	Intron	INS	-	TG	TG	rs144054062	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101778851_101778852insTG	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101783098	101783099	+	Intron	DEL	TT	-	-	rs79237100		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101783098_101783099delTT	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
RASA4	10156	broad.mit.edu	37	7	102347170	102347170	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102347170delT	uc011kld.1	-											Homo sapiens mRNA for KIAA0538 protein, partial cds.						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0																		---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104322068	104322069	+	Intron	INS	-	A	A	rs149115844	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104322068_104322069insA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105302458	105302465	+	Intron	DEL	TTTCTTTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105302458_105302465delTTTCTTTC	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
COG5	10466	broad.mit.edu	37	7	106850635	106850635	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106850635delA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_3'UTR	NM_181733	NP_859422			component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	107283443	107283443	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107283443delT								BCAP29 (19681 upstream) : LOC286002 (13518 downstream)																																			---	---	---	---
NRCAM	4897	broad.mit.edu	37	7	107827496	107827497	+	Intron	DEL	AC	-	-	rs34584179		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107827496_107827497delAC	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209			neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5																		---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111789568	111789568	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111789568delA	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
ZNF277	11179	broad.mit.edu	37	7	111962323	111962324	+	Intron	INS	-	TG	TG	rs142948666	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111962323_111962324insTG	uc003vge.2	+						ZNF277_uc003vgd.2_Intron|ZNF277_uc003vgf.2_Intron|ZNF277_uc003vgg.2_Intron	NM_021994	NP_068834			zinc finger protein (C2H2 type) 277							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	115155507	115155508	+	IGR	INS	-	CA	CA	rs140482645	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115155507_115155508insCA								MDFIC (496244 upstream) : TFEC (419694 downstream)																																			---	---	---	---
TFEC	22797	broad.mit.edu	37	7	115674741	115674742	+	Intron	INS	-	AC	AC	rs138424565	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115674741_115674742insAC	uc011kmw.1	-											SubName: Full=cDNA FLJ55256, highly similar to Homo sapiens transcription factor EC (TFEC), transcript variant 1, mRNA;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
ST7	7982	broad.mit.edu	37	7	116611609	116611610	+	Intron	INS	-	TA	TA	rs139538697	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116611609_116611610insTA	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
ST7	7982	broad.mit.edu	37	7	116746053	116746053	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116746053delT	uc003vin.2	+						ST7_uc011knl.1_Intron|ST7_uc003vio.2_Intron|ST7_uc003viq.2_Intron|ST7_uc011knm.1_Intron|ST7_uc003vir.2_Intron|ST7OT2_uc003viu.2_Intron|ST7_uc011knn.1_Intron	NM_021908	NP_068708			suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	116898469	116898470	+	IGR	INS	-	T	T	rs144127585	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116898469_116898470insT								ST7 (28396 upstream) : WNT2 (18218 downstream)																																			---	---	---	---
WNT2	7472	broad.mit.edu	37	7	116919767	116919768	+	Intron	INS	-	ATA	ATA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116919767_116919768insATA	uc003viz.2	-						WNT2_uc003vja.2_Intron	NM_003391	NP_003382			wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	119778378	119778379	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119778378_119778379delTG								None (None upstream) : KCND2 (135343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119834485	119834485	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119834485delT								None (None upstream) : KCND2 (79237 downstream)																																			---	---	---	---
KCND2	3751	broad.mit.edu	37	7	120047296	120047297	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120047296_120047297insT	uc003vjj.1	+							NM_012281	NP_036413			potassium voltage-gated channel, Shal-related						regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)																	---	---	---	---
C7orf58	79974	broad.mit.edu	37	7	120649660	120649661	+	Intron	INS	-	A	A	rs35238431		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120649660_120649661insA	uc003vjq.3	+						C7orf58_uc003vjr.1_Intron|C7orf58_uc003vjs.3_Intron	NM_024913	NP_079189			hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)																	---	---	---	---
WNT16	51384	broad.mit.edu	37	7	120965177	120965178	+	5'Flank	INS	-	GCGCGC	GCGCGC	rs146463283	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120965177_120965178insGCGCGC	uc003vjv.2	+							NM_016087	NP_057171			wingless-type MMTV integration site family,						anterior/posterior pattern formation|axis specification|axonogenesis|canonical Wnt receptor signaling pathway|keratinocyte differentiation|keratinocyte proliferation|negative regulation of cell death|optic cup formation involved in camera-type eye development|oxidative stress-induced premature senescence|positive regulation of gene expression|positive regulation of JNK cascade|positive regulation of phosphatidylinositol 3-kinase cascade|replicative senescence|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			lung(2)|ovary(2)|large_intestine(1)	5	all_neural(327;0.117)																	---	---	---	---
CADPS2	93664	broad.mit.edu	37	7	122094389	122094390	+	Intron	INS	-	C	C	rs149798742	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122094389_122094390insC	uc010lkp.2	-						CADPS2_uc011knx.1_Intron|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424			Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	123414491	123414491	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123414491delT								WASL (25375 upstream) : HYALP1 (39702 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127197231	127197234	+	IGR	DEL	TGAC	-	-	rs142012502		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127197231_127197234delTGAC								ZNF800 (164464 upstream) : GCC1 (23449 downstream)																																			---	---	---	---
SND1	27044	broad.mit.edu	37	7	127615438	127615439	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127615438_127615439delGT	uc003vmi.2	+						SND1_uc010lle.2_Intron	NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	128076597	128076598	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128076597_128076598insA								IMPDH1 (26561 upstream) : C7orf68 (19286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	128244091	128244092	+	IGR	DEL	AT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128244091_128244092delAT								METTL2B (101114 upstream) : FLJ45340 (37203 downstream)																																			---	---	---	---
KCP	375616	broad.mit.edu	37	7	128522810	128522813	+	Intron	DEL	AAAC	-	-	rs112056580		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128522810_128522813delAAAC	uc011kor.1	-						KCP_uc003vob.1_5'Flank	NM_001135914	NP_001129386			cysteine rich BMP regulator 2 isoform 1							extracellular region				central_nervous_system(1)	1																		---	---	---	---
NRF1	4899	broad.mit.edu	37	7	129266186	129266187	+	Intron	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129266186_129266187insC	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron	NM_005011	NP_005002			nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
TMEM209	84928	broad.mit.edu	37	7	129827492	129827492	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129827492delA	uc003vpn.2	-						TMEM209_uc010lmc.1_Intron	NM_032842	NP_116231			transmembrane protein 209							integral to membrane				ovary(2)|large_intestine(1)	3	Melanoma(18;0.0435)																	---	---	---	---
COPG2	26958	broad.mit.edu	37	7	130268144	130268144	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130268144delC	uc003vqh.1	-							NM_012133	NP_036265			coatomer protein complex, subunit gamma 2						intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat	protein binding|structural molecule activity				0	Melanoma(18;0.0435)																	---	---	---	---
FLJ43663	378805	broad.mit.edu	37	7	130739930	130739931	+	Intron	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130739930_130739931delTT	uc011kpk.1	-						FLJ43663_uc003vqo.1_Intron|FLJ43663_uc003vqp.2_Intron|FLJ43663_uc003vqq.2_Intron	NR_024153				Homo sapiens cDNA FLJ43663 fis, clone SYNOV4005989.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	131438392	131438392	+	IGR	DEL	T	-	-	rs144638874		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131438392delT								PODXL (197016 upstream) : PLXNA4 (369700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	131519471	131519472	+	IGR	INS	-	GT	GT	rs145516214	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131519471_131519472insGT								PODXL (278095 upstream) : PLXNA4 (288620 downstream)																																			---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131926581	131926581	+	Intron	DEL	C	-	-	rs5887558		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131926581delC	uc003vra.3	-							NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132247944	132247944	+	Intron	DEL	T	-	-	rs147356182	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132247944delT	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Intron	NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	132868596	132868597	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132868596_132868597insA								CHCHD3 (101768 upstream) : EXOC4 (69226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132888073	132888074	+	IGR	DEL	TA	-	-	rs4615517		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132888073_132888074delTA								CHCHD3 (121245 upstream) : EXOC4 (49749 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133727893	133727894	+	Intron	INS	-	T	T	rs144491883	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133727893_133727894insT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron|EXOC4_uc011kpq.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	136203098	136203137	+	IGR	DEL	TTCCCTTCCTTTCCTTTCCTTTCCCTTCCCTTCCCTTCCC	-	-	rs142019241	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136203098_136203137delTTCCCTTCCTTTCCTTTCCTTTCCCTTCCCTTCCCTTCCC								LUZP6 (540894 upstream) : CHRM2 (350262 downstream)																																			---	---	---	---
PTN	5764	broad.mit.edu	37	7	136958781	136958782	+	Intron	DEL	CA	-	-	rs35397187		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136958781_136958782delCA	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	137817639	137817639	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137817639delT								AKR1D1 (14589 upstream) : TRIM24 (327440 downstream)																																			---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139253668	139253672	+	3'UTR	DEL	CTTCC	-	-	rs143687373		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139253668_139253672delCTTCC	uc003vvf.3	-	15					HIPK2_uc003vvd.3_3'UTR	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139310267	139310267	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139310267delG	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
SLC37A3	84255	broad.mit.edu	37	7	140099824	140099824	+	5'Flank	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140099824delC	uc003vvo.2	-						SLC37A3_uc003vvp.2_5'Flank|SLC37A3_uc010lnh.2_5'Flank|SLC37A3_uc011kqz.1_5'Flank|SLC37A3_uc011kra.1_5'Flank|SLC37A3_uc011krb.1_5'Flank	NM_207113	NP_996996			solute carrier family 37 (glycerol-3-phosphate						carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)																	---	---	---	---
BRAF	673	broad.mit.edu	37	7	140480742	140480742	+	Intron	DEL	T	-	-	rs71522112		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140480742delT	uc003vwc.3	-							NM_004333	NP_004324			B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	140768390	140768390	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140768390delT								MRPS33 (53609 upstream) : AGK (482688 downstream)																																			---	---	---	---
OR2A9P	441295	broad.mit.edu	37	7	144051940	144051951	+	Intron	DEL	CAACAACAACAT	-	-	rs80228777		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144051940_144051951delCAACAACAACAT	uc003wec.1	-						ARHGEF5_uc003wek.2_5'Flank|ARHGEF5_uc003wel.2_5'Flank					SubName: Full=Seven transmembrane helix receptor;												0																		---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147798136	147798137	+	Intron	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147798136_147798137insC	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	149017660	149017661	+	IGR	INS	-	T	T	rs138693110	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149017660_149017661insT								ZNF212 (64979 upstream) : ZNF777 (110800 downstream)																																			---	---	---	---
GBX1	2636	broad.mit.edu	37	7	150862076	150862077	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150862076_150862077delAC	uc011kvg.1	-							NM_001098834	NP_001092304			gastrulation brain homeo box 1							nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	151981753	151981754	+	Intron	INS	-	T	T	rs144002869	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151981753_151981754insT	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
DPP6	1804	broad.mit.edu	37	7	153871959	153871960	+	Intron	INS	-	T	T	rs147664898	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153871959_153871960insT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	155203595	155203595	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155203595delT								INSIG1 (101653 upstream) : EN2 (47229 downstream)																																			---	---	---	---
RBM33	155435	broad.mit.edu	37	7	155545256	155545257	+	Intron	INS	-	A	A	rs145690049	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155545256_155545257insA	uc010lqk.1	+						RBM33_uc011kvv.1_Intron|RBM33_uc003wmg.2_Intron	NM_053043	NP_444271			RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	156399587	156399587	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156399587delC								C7orf4 (65792 upstream) : C7orf13 (31475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	157082503	157082504	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157082503_157082504insG								UBE3C (20438 upstream) : DNAJB6 (47206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	157222655	157222658	+	IGR	DEL	TCCA	-	-	rs112561895		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157222655_157222658delTCCA								DNAJB6 (12523 upstream) : PTPRN2 (109093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	157292809	157292810	+	IGR	DEL	GC	-	-	rs10579778		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157292809_157292810delGC								DNAJB6 (82677 upstream) : PTPRN2 (38941 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157349924	157349925	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157349924_157349925delCA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|PTPRN2_uc003wnn.2_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	158510191	158510192	+	IGR	INS	-	CTC	CTC	rs140499778	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158510191_158510192insCTC								NCAPG2 (12671 upstream) : ESYT2 (13497 downstream)																																			---	---	---	---
RPL23AP53	644128	broad.mit.edu	37	8	176677	176677	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:176677delT	uc010lra.2	-						RPL23AP53_uc003woq.3_Intron|RPL23AP53_uc010lrb.2_Intron	NR_003572				Homo sapiens cDNA FLJ45055 fis, clone BRAWH3022900.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	304646	304647	+	IGR	INS	-	AA	AA	rs72289521		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:304646_304647insAA								ZNF596 (107314 upstream) : FBXO25 (52161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	774019	774033	+	Intron	DEL	TTTCTTCTTCTTTTT	-	-	rs11274828		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:774019_774033delTTTCTTCTTCTTTTT	uc003wpj.1	+											Homo sapiens cDNA clone IMAGE:4824304.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1197072	1197073	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1197072_1197073insA								ERICH1 (515846 upstream) : DLGAP2 (252496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	1197365	1197365	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1197365delG								ERICH1 (516139 upstream) : DLGAP2 (252204 downstream)																																			---	---	---	---
DLGAP2	9228	broad.mit.edu	37	8	1543201	1543202	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1543201_1543202insT	uc003wpl.2	+						DLGAP2_uc003wpm.2_Intron	NM_004745	NP_004736			discs large-associated protein 2						neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1673183	1673183	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1673183delC								DLGAP2 (16543 upstream) : CLN8 (38687 downstream)																																			---	---	---	---
KBTBD11	9920	broad.mit.edu	37	8	1949207	1949209	+	5'UTR	DEL	ACA	-	-	rs148700242		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1949207_1949209delACA	uc003wpw.3	+	2						NM_014867	NP_055682			kelch repeat and BTB (POZ) domain containing 11											pancreas(1)	1		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.72e-05)|READ - Rectum adenocarcinoma(644;0.0929)|COAD - Colon adenocarcinoma(149;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2591446	2591447	+	IGR	INS	-	TTC	TTC	rs149965996	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2591446_2591447insTTC								MYOM2 (498067 upstream) : CSMD1 (201429 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3422277	3422278	+	Intron	INS	-	G	G	rs148318798	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3422277_3422278insG	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3589565	3589566	+	Intron	INS	-	A	A	rs145613676	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3589565_3589566insA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4039479	4039480	+	Intron	INS	-	GT	GT	rs146690880	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4039479_4039480insGT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4377459	4377460	+	Intron	DEL	GT	-	-	rs112458039		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4377459_4377460delGT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4496773	4496774	+	Intron	INS	-	TT	TT	rs34704649		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4496773_4496774insTT	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	4995079	4995103	+	IGR	DEL	GGAAGGGAAGGGAAGGGAAGGGAAG	-	-	rs13267327		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4995079_4995103delGGAAGGGAAGGGAAGGGAAGGGAAG								CSMD1 (142751 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5648626	5648627	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5648626_5648627delGT								CSMD1 (796298 upstream) : MCPH1 (615494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6215469	6215470	+	IGR	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6215469_6215470insTT								None (None upstream) : MCPH1 (48651 downstream)																																			---	---	---	---
MCPH1	79648	broad.mit.edu	37	8	6497884	6497884	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6497884delC	uc003wqi.2	+						uc003wqm.2_Intron	NM_024596	NP_078872			microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	6726211	6726214	+	IGR	DEL	TTTG	-	-	rs143748846		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6726211_6726214delTTTG								XKR5 (33174 upstream) : DEFB1 (1883 downstream)																																			---	---	---	---
DEFB1	1672	broad.mit.edu	37	8	6731668	6731669	+	Intron	DEL	CG	-	-	rs71214966		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6731668_6731669delCG	uc003wqs.2	-							NM_005218	NP_005209			defensin, beta 1 preproprotein						chemotaxis|defense response to bacterium|G-protein coupled receptor protein signaling pathway|innate immune response	extracellular region					0			STAD - Stomach adenocarcinoma(24;0.0984)	COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.128)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	7999307	7999307	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7999307delC								MIR548I3 (52696 upstream) : FLJ10661 (86785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8082212	8082213	+	IGR	INS	-	T	T	rs34605300		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8082212_8082213insT								MIR548I3 (135601 upstream) : FLJ10661 (3879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8382947	8382948	+	IGR	INS	-	T	T	rs144800265		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8382947_8382948insT								SGK223 (143690 upstream) : CLDN23 (176718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9036174	9036175	+	IGR	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9036174_9036175insAA								PPP1R3B (27090 upstream) : TNKS (377270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9145724	9145734	+	IGR	DEL	TTTTTTTTTTT	-	-	rs34239035		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9145724_9145734delTTTTTTTTTTT								PPP1R3B (136640 upstream) : TNKS (267711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9820776	9820779	+	IGR	DEL	TGTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9820776_9820779delTGTG								MIR124-1 (59794 upstream) : MSRA (91051 downstream)																																			---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10191676	10191703	+	Intron	DEL	GTGTGTGTGTGTGTGTGTATTTATGTGT	-	-	rs57831132	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10191676_10191703delGTGTGTGTGTGTGTGTGTATTTATGTGT	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10281441	10281444	+	Intron	DEL	ATTA	-	-	rs77523487		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10281441_10281444delATTA	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	10348256	10348260	+	Intron	DEL	TACTT	-	-	rs148144648		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10348256_10348260delTACTT	uc010lru.2	-											Homo sapiens cDNA, FLJ97155.																														---	---	---	---
RP1L1	94137	broad.mit.edu	37	8	10481007	10481023	+	Intron	DEL	CACCATGTCCCCAGAAC	-	-	rs112766794		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10481007_10481023delCACCATGTCCCCAGAAC	uc003wtc.2	-							NM_178857	NP_849188			retinitis pigmentosa 1-like 1						intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)														---	---	---	---
C8orf12	83656	broad.mit.edu	37	8	11252542	11252542	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11252542delA	uc003wtu.2	+						C8orf12_uc003wtv.2_Intron	NR_026814				Homo sapiens mRNA for hypothetical protein (C8orf12 gene).												0																		---	---	---	---
FAM167A	83648	broad.mit.edu	37	8	11312687	11312688	+	Intron	INS	-	TGTG	TGTG	rs148734390	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11312687_11312688insTGTG	uc003wtw.2	-							NM_053279	NP_444509			hypothetical protein LOC83648												0																		---	---	---	---
FAM167A	83648	broad.mit.edu	37	8	11313145	11313146	+	Intron	INS	-	GTGT	GTGT	rs150606798	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11313145_11313146insGTGT	uc003wtw.2	-							NM_053279	NP_444509			hypothetical protein LOC83648												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	11817633	11817636	+	IGR	DEL	TTTT	-	-	rs113104201		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11817633_11817636delTTTT								CTSB (91987 upstream) : DEFB136 (13812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11868958	11868960	+	5'Flank	DEL	CCA	-	-	rs150738953		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11868958_11868960delCCA	uc003wuy.1	+											Homo sapiens cDNA FLJ33940 fis, clone CTONG2018069.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11871732	11871732	+	5'UTR	DEL	C	-	-	rs35257263		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11871732delC	uc003wuy.1	+	1										Homo sapiens cDNA FLJ33940 fis, clone CTONG2018069.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12438863	12438864	+	Intron	DEL	AG	-	-	rs77717711		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12438863_12438864delAG	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12442106	12442107	+	Intron	INS	-	T	T	rs147039223		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12442106_12442107insT	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13028822	13028822	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13028822delA	uc003wwm.2	-						DLC1_uc003wwl.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13164093	13164098	+	Intron	DEL	GAGAGA	-	-	rs113721292	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13164093_13164098delGAGAGA	uc003wwm.2	-						DLC1_uc003wwn.2_Intron|DLC1_uc011kxy.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14961636	14961637	+	Intron	INS	-	G	G	rs140133307	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14961636_14961637insG	uc003wwq.2	-							NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16565441	16565442	+	IGR	DEL	AT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16565441_16565442delAT								MSR1 (515141 upstream) : FGF20 (284892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	17310964	17310964	+	IGR	DEL	T	-	-	rs5016043		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17310964delT								MTMR7 (39924 upstream) : SLC7A2 (43636 downstream)																																			---	---	---	---
SLC7A2	6542	broad.mit.edu	37	8	17376128	17376132	+	Intron	DEL	AACAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17376128_17376132delAACAA	uc011kyc.1	+							NM_001008539	NP_001008539			solute carrier family 7, member 2 isoform 2						cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	17709305	17709306	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17709305_17709306insT								MTUS1 (50879 upstream) : FGL1 (12596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	17890591	17890592	+	IGR	INS	-	T	T	rs141304316	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17890591_17890592insT								PCM1 (3136 upstream) : ASAH1 (23333 downstream)																																			---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18848879	18848880	+	Intron	INS	-	AT	AT	rs148053010	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18848879_18848880insAT	uc003wza.2	-							NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	19956396	19956396	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19956396delA								LPL (131627 upstream) : SLC18A1 (45971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20379081	20379082	+	IGR	INS	-	ACAC	ACAC	rs138722695	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20379081_20379082insACAC								LZTS1 (266278 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20702198	20702198	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20702198delT								LZTS1 (589395 upstream) : GFRA2 (847332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21048005	21048005	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21048005delT								LZTS1 (935202 upstream) : GFRA2 (501525 downstream)																																			---	---	---	---
EPB49	2039	broad.mit.edu	37	8	21911615	21911616	+	5'Flank	DEL	AC	-	-	rs71916677		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21911615_21911616delAC	uc011kyt.1	+						EPB49_uc010ltl.2_Intron|EPB49_uc011kys.1_5'Flank|EPB49_uc010ltn.2_5'Flank	NM_001114136	NP_001107608			erythrocyte membrane protein band 4.9 isoform 1						actin filament bundle assembly|actin filament capping	actin cytoskeleton|nucleus	actin binding			central_nervous_system(1)	1				Colorectal(74;9.05e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0631)												OREG0018604	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PIWIL2	55124	broad.mit.edu	37	8	22137494	22137494	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22137494delA	uc003xbn.2	+						PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Intron	NM_018068	NP_060538			piwi-like 2						DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)														---	---	---	---
SORBS3	10174	broad.mit.edu	37	8	22418384	22418387	+	Intron	DEL	GTGC	-	-	rs71975352	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22418384_22418387delGTGC	uc003xbv.2	+						SORBS3_uc011kzk.1_Intron	NM_005775	NP_005766			sorbin and SH3 domain containing 3 isoform 1						muscle contraction|positive regulation of stress fiber assembly	cytoskeleton|cytosol|nucleus	protein binding|structural constituent of cytoskeleton|vinculin binding				0		Prostate(55;0.0421)|Breast(100;0.102)		BRCA - Breast invasive adenocarcinoma(99;0.00566)|Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	22553852	22553852	+	IGR	DEL	T	-	-	rs5890066		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22553852delT								EGR3 (3037 upstream) : PEBP4 (16913 downstream)																																			---	---	---	---
PEBP4	157310	broad.mit.edu	37	8	22687813	22687814	+	Intron	INS	-	TG	TG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22687813_22687814insTG	uc003xcn.1	-							NM_144962	NP_659399			phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	24897047	24897047	+	IGR	DEL	T	-	-	rs112029804		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24897047delT								NEFL (82916 upstream) : DOCK5 (145240 downstream)																																			---	---	---	---
DOCK5	80005	broad.mit.edu	37	8	25247501	25247502	+	Intron	INS	-	A	A	rs141651751		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25247501_25247502insA	uc003xeg.2	+						PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xei.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216			dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)														---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	25621680	25621681	+	Intron	INS	-	AG	AG	rs142453756	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25621680_25621681insAG	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
CCDC25	55246	broad.mit.edu	37	8	27599862	27599863	+	Intron	INS	-	AAAC	AAAC	rs139245376	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27599862_27599863insAAAC	uc003xgc.2	-						CCDC25_uc003xgd.2_Intron|CCDC25_uc011lan.1_Intron|CCDC25_uc011lao.1_Intron|CCDC25_uc003xge.2_Intron	NM_018246	NP_060716			coiled-coil domain containing 25												0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0223)|KIRC - Kidney renal clear cell carcinoma(542;0.11)|Kidney(114;0.131)|Colorectal(74;0.154)														---	---	---	---
C8orf80	389643	broad.mit.edu	37	8	27941836	27941837	+	5'Flank	INS	-	A	A	rs111389665		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27941836_27941837insA	uc003xgm.3	-							NM_001010906	NP_001010906			speckled-like pattern in the germinal center							nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	28052193	28052194	+	IGR	DEL	TG	-	-	rs141272631	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28052193_28052194delTG								ELP3 (3526 upstream) : PNOC (122455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	28504625	28504625	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28504625delT								FZD3 (82666 upstream) : EXTL3 (54528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29473563	29473566	+	IGR	DEL	AGAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29473563_29473566delAGAA								DUSP4 (265378 upstream) : C8orf75 (105212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29559825	29559825	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29559825delA								DUSP4 (351640 upstream) : C8orf75 (18953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	30231303	30231303	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30231303delT								DCTN6 (190244 upstream) : RBPMS (10641 downstream)																																			---	---	---	---
RBPMS	11030	broad.mit.edu	37	8	30256801	30256802	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30256801_30256802insT	uc003xic.1	+						RBPMS_uc003xid.1_Intron|RBPMS_uc003xie.1_Intron|RBPMS_uc011lba.1_Intron|RBPMS_uc003xib.2_Intron	NM_006867	NP_006858			RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)														---	---	---	---
RBPMS	11030	broad.mit.edu	37	8	30339063	30339063	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30339063delT	uc003xic.1	+						RBPMS_uc003xid.1_Intron|RBPMS_uc003xie.1_Intron|RBPMS_uc003xif.1_Intron|RBPMS_uc011lba.1_Intron|RBPMS_uc003xib.2_Intron|RBPMS_uc010lvh.1_Intron	NM_006867	NP_006858			RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31574946	31574946	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31574946delG	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	34416445	34416446	+	IGR	DEL	GT	-	-	rs137940637		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34416445_34416446delGT								DUSP26 (959006 upstream) : UNC5D (676529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34613078	34613079	+	IGR	INS	-	T	T	rs148995911	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34613078_34613079insT								None (None upstream) : UNC5D (479896 downstream)																																			---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35259419	35259419	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35259419delT	uc003xjr.1	+							NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	35836569	35836569	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35836569delT								UNC5D (184389 upstream) : KCNU1 (805273 downstream)																																			---	---	---	---
ERLIN2	11160	broad.mit.edu	37	8	37606775	37606775	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37606775delT	uc003xke.3	+						LOC728024_uc010lvx.1_5'Flank	NM_007175	NP_009106			ER lipid raft associated 2 isoform 1						ER-associated protein catabolic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	protein binding				0		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)															---	---	---	---
EIF4EBP1	1978	broad.mit.edu	37	8	37905009	37905010	+	Intron	INS	-	G	G	rs72605420		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37905009_37905010insG	uc003xks.2	+							NM_004095	NP_004086			eukaryotic translation initiation factor 4E						G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|positive regulation of mitotic cell cycle|TOR signaling cascade|translation	cytosol					0	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)																---	---	---	---
ADAM32	203102	broad.mit.edu	37	8	39042883	39042883	+	Intron	DEL	C	-	-	rs56393535		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39042883delC	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441			a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)															---	---	---	---
ADAM18	8749	broad.mit.edu	37	8	39583776	39583777	+	Intron	INS	-	AC	AC	rs149828836	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39583776_39583777insAC	uc003xni.2	+						ADAM18_uc010lww.2_Intron|ADAM18_uc010lwx.2_Intron	NM_014237	NP_055052			a disintegrin and metalloprotease domain 18						cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	39759680	39759681	+	IGR	INS	-	CTT	CTT	rs148458164	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39759680_39759681insCTT								ADAM2 (63901 upstream) : IDO1 (11647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	40191351	40191351	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40191351delT								C8orf4 (178530 upstream) : ZMAT4 (196765 downstream)																																			---	---	---	---
SLC20A2	6575	broad.mit.edu	37	8	42320018	42320018	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42320018delT	uc010lxl.2	-						SLC20A2_uc010lxm.2_Intron|SLC20A2_uc003xpe.2_Intron|SLC20A2_uc011lcu.1_5'Flank	NM_006749	NP_006740			solute carrier family 20, member 2						interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	42529876	42529877	+	IGR	INS	-	ATGG	ATGG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42529876_42529877insATGG								C8orf40 (121737 upstream) : CHRNB3 (22685 downstream)																																			---	---	---	---
SGK196	84197	broad.mit.edu	37	8	42978201	42978201	+	3'UTR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42978201delT	uc003xpw.2	+	5						NM_032237	NP_115613			protein kinase-like protein SgK196							integral to membrane	ATP binding|protein kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	43255131	43255131	+	IGR	DEL	T	-	-	rs111728208		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43255131delT								POTEA (36803 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	43826359	43826360	+	IGR	INS	-	T	T	rs150763522		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43826359_43826360insT								POTEA (608031 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47879214	47879214	+	IGR	DEL	C	-	-	rs68193308		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47879214delC								BEYLA (111807 upstream) : KIAA0146 (294328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49829652	49829652	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49829652delA								EFCAB1 (181782 upstream) : SNAI2 (587 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51247074	51247075	+	Intron	INS	-	AG	AG	rs34886806		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51247074_51247075insAG	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52504185	52504185	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52504185delT	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52612963	52612964	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52612963_52612964delAC	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	55071869	55071869	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55071869delT								MRPL15 (10795 upstream) : SOX17 (298626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55273994	55274005	+	IGR	DEL	CCTTCCTTCTTT	-	-	rs66756943	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55273994_55274005delCCTTCCTTCTTT								MRPL15 (212920 upstream) : SOX17 (96490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	56005426	56005426	+	IGR	DEL	T	-	-	rs79078320		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56005426delT								RP1 (322895 upstream) : XKR4 (9591 downstream)																																			---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56351897	56351898	+	Intron	INS	-	AATTCTCTAAACAGGG	AATTCTCTAAACAGGG	rs148760052	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56351897_56351898insAATTCTCTAAACAGGG	uc003xsf.2	+							NM_052898	NP_443130			XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
TMEM68	137695	broad.mit.edu	37	8	56680703	56680703	+	Intron	DEL	A	-	-	rs113694786		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56680703delA	uc003xsh.1	-						TMEM68_uc003xsi.1_Intron	NM_152417	NP_689630			transmembrane protein 68							integral to membrane	acyltransferase activity			skin(1)	1			Epithelial(17;0.000361)|all cancers(17;0.00326)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	58069935	58069935	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58069935delT								IMPAD1 (163508 upstream) : C8orf71 (122167 downstream)																																			---	---	---	---
TOX	9760	broad.mit.edu	37	8	60021215	60021216	+	Intron	DEL	AC	-	-	rs72219254		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60021215_60021216delAC	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	60192665	60192665	+	IGR	DEL	T	-	-	rs111745971		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60192665delT								TOX (160898 upstream) : CA8 (908758 downstream)																																			---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61614367	61614368	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61614367_61614368insT	uc003xue.2	+							NM_017780	NP_060250			chromodomain helicase DNA binding protein 7						central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	61945613	61945620	+	IGR	DEL	AGAAAGAT	-	-	rs60907426		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61945613_61945620delAGAAAGAT								CHD7 (166150 upstream) : CLVS1 (254905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62095450	62095451	+	IGR	INS	-	CAA	CAA	rs147175120	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62095450_62095451insCAA								CHD7 (315987 upstream) : CLVS1 (105074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62143845	62143846	+	IGR	INS	-	CA	CA	rs146457029	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62143845_62143846insCA								CHD7 (364382 upstream) : CLVS1 (56679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62720473	62720474	+	IGR	INS	-	GT	GT	rs139636638	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62720473_62720474insGT								ASPH (93274 upstream) : NKAIN3 (441027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	62958659	62958660	+	IGR	INS	-	TG	TG	rs140895064	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62958659_62958660insTG								ASPH (331460 upstream) : NKAIN3 (202841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	63920268	63920268	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63920268delG								NKAIN3 (16640 upstream) : GGH (7375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65013805	65013806	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65013805_65013806insT								YTHDF3 (888460 upstream) : MIR124-2 (277900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65029266	65029267	+	IGR	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65029266_65029267insAA								YTHDF3 (903921 upstream) : MIR124-2 (262439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65344227	65344227	+	IGR	DEL	T	-	-	rs35365673		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65344227delT								MIR124-2 (52413 upstream) : LOC401463 (142641 downstream)																																			---	---	---	---
MTFR1	9650	broad.mit.edu	37	8	66572527	66572527	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66572527delA	uc003xvm.2	+						MTFR1_uc011lep.1_Intron	NM_014637	NP_055452			mitochondrial fission regulator 1 isoform 1							mitochondrion|plasma membrane				pancreas(1)	1			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)															---	---	---	---
COPS5	10987	broad.mit.edu	37	8	67962850	67962851	+	Intron	DEL	GT	-	-	rs72192206		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67962850_67962851delGT	uc003xxe.2	-						COPS5_uc003xxd.2_Intron|COPS5_uc003xxf.2_Intron|COPS5_uc010lyu.1_Intron	NM_006837	NP_006828			COP9 signalosome subunit 5						cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)															---	---	---	---
CPA6	57094	broad.mit.edu	37	8	68590112	68590113	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68590112_68590113insA	uc003xxq.3	-						CPA6_uc003xxr.3_Intron|CPA6_uc003xxs.2_Intron	NM_020361	NP_065094			carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68914364	68914365	+	Intron	INS	-	TTT	TTT	rs142879603	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68914364_68914365insTTT	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	69200003	69200004	+	IGR	DEL	GT	-	-	rs10560228		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69200003_69200004delGT								PREX2 (56106 upstream) : C8orf34 (43453 downstream)																																			---	---	---	---
SULF1	23213	broad.mit.edu	37	8	70491800	70491801	+	Intron	INS	-	C	C	rs28361527		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70491800_70491801insC	uc010lza.1	+						SULF1_uc003xyd.2_Intron|SULF1_uc003xye.2_Intron|SULF1_uc003xyf.2_Intron|SULF1_uc003xyg.2_Intron	NM_015170	NP_055985			sulfatase 1 precursor						apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)															---	---	---	---
SLCO5A1	81796	broad.mit.edu	37	8	70721969	70721970	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70721969_70721970delGT	uc003xyl.2	-						SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Intron|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220			solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	70843274	70843275	+	IGR	INS	-	GA	GA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70843274_70843275insGA								SLCO5A1 (95975 upstream) : PRDM14 (120750 downstream)																																			---	---	---	---
TRPA1	8989	broad.mit.edu	37	8	72958692	72958692	+	Intron	DEL	A	-	-	rs71557018		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72958692delA	uc003xza.2	-						uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628			ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	74106986	74106987	+	IGR	DEL	GT	-	-	rs71561510		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74106986_74106987delGT								C8orf84 (101479 upstream) : RPL7 (95888 downstream)																																			---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74559173	74559174	+	Intron	INS	-	AC	AC	rs142043134	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74559173_74559174insAC	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74653745	74653745	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74653745delT	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Intron|STAU2_uc003xzr.2_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
PI15	51050	broad.mit.edu	37	8	75747247	75747248	+	Intron	INS	-	CTG	CTG	rs145514159	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75747247_75747248insCTG	uc003yal.2	+						uc003yak.1_Intron|PI15_uc003yam.2_Intron	NM_015886	NP_056970			protease inhibitor 15 preproprotein							extracellular region	peptidase inhibitor activity			central_nervous_system(2)|ovary(1)	3	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	76524927	76524927	+	IGR	DEL	A	-	-	rs34428089		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76524927delA								HNF4G (45868 upstream) : LOC100192378 (998188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78080359	78080359	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78080359delT								PEX2 (167835 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78635439	78635439	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78635439delA								PEX2 (722915 upstream) : PKIA (792897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	79076314	79076314	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79076314delA								None (None upstream) : PKIA (352022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80045670	80045670	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80045670delA								IL7 (327912 upstream) : STMN2 (477710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80684842	80684842	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80684842delA	uc003ybn.2	-											Homo sapiens cDNA FLJ30770 fis, clone FEBRA2000734.																														---	---	---	---
MRPS28	28957	broad.mit.edu	37	8	80903059	80903060	+	Intron	INS	-	A	A	rs34065249		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80903059_80903060insA	uc003ybp.2	-						MRPS28_uc003ybo.2_Intron|TPD52_uc010lzr.2_Intron	NM_014018	NP_054737			mitochondrial ribosomal protein S28							mitochondrial small ribosomal subunit					0	Lung NSC(7;1.86e-06)|all_lung(9;6.91e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00769)|Epithelial(68;0.0208)|all cancers(69;0.0805)															---	---	---	---
TPD52	7163	broad.mit.edu	37	8	81053186	81053189	+	Intron	DEL	GTGT	-	-	rs35057641		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81053186_81053189delGTGT	uc003ybs.1	-						TPD52_uc010lzs.1_Intron|TPD52_uc003ybt.1_Intron	NM_001025253	NP_001020424			tumor protein D52 isoform 2						anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	81121521	81121522	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81121521_81121522delTG								TPD52 (37685 upstream) : ZBTB10 (276332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84372019	84372020	+	IGR	DEL	CC	-	-	rs60051271		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84372019_84372020delCC								None (None upstream) : RALYL (723433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	85032798	85032798	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85032798delT								None (None upstream) : RALYL (62655 downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85766591	85766600	+	Intron	DEL	AAGAAAAAGG	-	-	rs72037619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85766591_85766600delAAGAAAAAGG	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85790982	85790984	+	Intron	DEL	AAT	-	-	rs138564300		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85790982_85790984delAAT	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	85969711	85969712	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85969711_85969712delTC								RALYL (135640 upstream) : LRRCC1 (49665 downstream)																																			---	---	---	---
CA13	377677	broad.mit.edu	37	8	86161723	86161724	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86161723_86161724insA	uc003ydg.2	+						CA13_uc003ydf.1_Intron	NM_198584	NP_940986			carbonic anhydrase XIII						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87484887	87484887	+	3'UTR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87484887delT	uc003ydu.2	-	10					FAM82B_uc011lfz.1_3'UTR|FAM82B_uc011lga.1_3'UTR	NM_016033	NP_057117			regulator of microtubule dynamics 1							microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	88907825	88907825	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88907825delA								DCAF4L2 (21529 upstream) : MMP16 (141637 downstream)																																			---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89219924	89219925	+	Intron	INS	-	A	A	rs34890040		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89219924_89219925insA	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	91268895	91268895	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91268895delA								CALB1 (161208 upstream) : TMEM64 (365328 downstream)																																			---	---	---	---
NECAB1	64168	broad.mit.edu	37	8	91866164	91866165	+	Intron	INS	-	G	G	rs148765774	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91866164_91866165insG	uc011lgg.1	+							NM_022351	NP_071746			N-terminal EF-hand calcium binding protein 1						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.0499)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	92561482	92561483	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92561482_92561483insC								SLC26A7 (151102 upstream) : RUNX1T1 (409669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	93365833	93365833	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93365833delC								RUNX1T1 (258127 upstream) : C8orf83 (530032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	93591561	93591562	+	IGR	INS	-	TTTC	TTTC	rs34835405		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93591561_93591562insTTTC								RUNX1T1 (483855 upstream) : C8orf83 (304303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94201477	94201480	+	IGR	DEL	GGAG	-	-	rs2449608		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94201477_94201480delGGAG								C8orf83 (171576 upstream) : FAM92A1 (511293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94535865	94535865	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94535865delT								C8orf83 (505964 upstream) : FAM92A1 (176908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94861577	94861578	+	IGR	INS	-	T	T	rs140581392	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94861577_94861578insT								TMEM67 (31231 upstream) : PDP1 (67505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94944448	94944449	+	IGR	INS	-	CAAA	CAAA	rs148341659	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94944448_94944449insCAAA								PDP1 (6154 upstream) : CDH17 (194945 downstream)																																			---	---	---	---
RAD54B	25788	broad.mit.edu	37	8	95434550	95434550	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95434550delC	uc003ygk.2	-						RAD54B_uc010may.1_Intron|RAD54B_uc003ygl.1_Intron	NM_012415	NP_036547			RAD54 homolog B						double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)										Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
C8orf37	157657	broad.mit.edu	37	8	96283208	96283209	+	5'Flank	DEL	AC	-	-	rs71569117		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96283208_96283209delAC	uc003yho.1	-							NM_177965	NP_808880			hypothetical protein LOC157657												0	Breast(36;3.41e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	96969377	96969385	+	IGR	DEL	CTCCTCCTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96969377_96969385delCTCCTCCTC								C8orf37 (687940 upstream) : GDF6 (185175 downstream)																																			---	---	---	---
PGCP	10404	broad.mit.edu	37	8	98104082	98104083	+	Intron	INS	-	GATG	GATG	rs144392820	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98104082_98104083insGATG	uc003yhw.2	+							NM_016134	NP_057218			plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	98167795	98167795	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98167795delC								PGCP (12074 upstream) : TSPYL5 (117920 downstream)																																			---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100363647	100363652	+	Intron	DEL	AGAGAG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100363647_100363652delAGAGAG	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100690797	100690798	+	Intron	INS	-	T	T	rs11405601		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100690797_100690798insT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
SPAG1	6674	broad.mit.edu	37	8	101192399	101192399	+	Intron	DEL	T	-	-	rs112163846		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101192399delT	uc003yjh.1	+						SPAG1_uc003yjg.1_Intron|SPAG1_uc003yji.1_Intron	NM_172218	NP_757367			sperm associated antigen 1						single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	101579487	101579487	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101579487delG								ANKRD46 (7475 upstream) : SNX31 (5627 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102759422	102759424	+	Intron	DEL	CTC	-	-	rs144585523		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102759422_102759424delCTC	uc003yke.2	-						NCALD_uc003ykf.2_Intron|NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_032041	NP_114430			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102980069	102980072	+	Intron	DEL	ACAC	-	-	rs72380627		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102980069_102980072delACAC	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	104818845	104818846	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104818845_104818846delTG	uc003ylp.2	+							NM_001100117	NP_001093587			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
RIMS2	9699	broad.mit.edu	37	8	105022213	105022216	+	Intron	DEL	GATA	-	-	rs113548968		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105022213_105022216delGATA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492			regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)												HNSCC(12;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	106295913	106295922	+	IGR	DEL	AGATAGATAG	-	-	rs141607704		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106295913_106295922delAGATAGATAG								LRP12 (694693 upstream) : ZFPM2 (35225 downstream)																																			---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106571016	106571017	+	Intron	INS	-	AG	AG	rs79519815		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106571016_106571017insAG	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107591211	107591212	+	Intron	INS	-	TT	TT	rs146593561	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107591211_107591212insTT	uc011lht.1	+						OXR1_uc003ymf.2_Intron	NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107591221	107591222	+	Intron	INS	-	TTC	TTC	rs72406928		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107591221_107591222insTTC	uc011lht.1	+						OXR1_uc003ymf.2_Intron	NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107649558	107649559	+	Intron	DEL	TA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107649558_107649559delTA	uc011lht.1	+						OXR1_uc003ymf.2_Intron|OXR1_uc003ymg.1_Intron	NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	107824619	107824620	+	IGR	INS	-	T	T	rs11447200		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107824619_107824620insT								ABRA (42147 upstream) : ANGPT1 (437091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	108050115	108050116	+	IGR	INS	-	CAC	CAC	rs5893822		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108050115_108050116insCAC								ABRA (267643 upstream) : ANGPT1 (211595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	108076209	108076210	+	IGR	INS	-	T	T	rs142779270	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108076209_108076210insT								ABRA (293737 upstream) : ANGPT1 (185501 downstream)																																			---	---	---	---
ANGPT1	284	broad.mit.edu	37	8	108315806	108315806	+	Intron	DEL	T	-	-	rs3840711		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108315806delT	uc003ymn.2	-						ANGPT1_uc011lhv.1_Intron|ANGPT1_uc003ymo.2_Intron|ANGPT1_uc003ymp.3_Intron	NM_001146	NP_001137			angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)															---	---	---	---
RSPO2	340419	broad.mit.edu	37	8	109078678	109078679	+	Intron	INS	-	T	T	rs146463414	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109078678_109078679insT	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660			R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	110737847	110737848	+	IGR	DEL	CG	-	-	rs71513064		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110737847_110737848delCG								SYBU (33827 upstream) : KCNV1 (241387 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114086396	114086397	+	Intron	DEL	AC	-	-	rs139802519		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114086396_114086397delAC	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115217628	115217629	+	IGR	INS	-	AA	AA	rs113458021		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115217628_115217629insAA								CSMD3 (768386 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115224456	115224457	+	IGR	INS	-	G	G	rs143677992	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115224456_115224457insG								CSMD3 (775214 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116330903	116330904	+	IGR	INS	-	T	T	rs76276625		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116330903_116330904insT								None (None upstream) : TRPS1 (89821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117513329	117513329	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117513329delT								TRPS1 (832101 upstream) : EIF3H (143727 downstream)																																			---	---	---	---
EIF3H	8667	broad.mit.edu	37	8	117766906	117766906	+	Intron	DEL	T	-	-	rs11334894		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117766906delT	uc003yoa.2	-						EIF3H_uc003yob.2_Intron|EIF3H_uc011lhz.1_Intron	NM_003756	NP_003747			eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(3)	3	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	118337987	118337987	+	IGR	DEL	T	-	-	rs71897042		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118337987delT								SLC30A8 (149035 upstream) : MED30 (194978 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	118983933	118983933	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118983933delA	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	120133834	120133835	+	IGR	INS	-	C	C	rs113481085		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120133834_120133835insC								COLEC10 (14639 upstream) : MAL2 (86775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	120206244	120206246	+	IGR	DEL	AAG	-	-	rs34856040		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120206244_120206246delAAG								COLEC10 (87049 upstream) : MAL2 (14364 downstream)																																			---	---	---	---
DEPDC6	64798	broad.mit.edu	37	8	121046342	121046342	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121046342delG	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620			DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
COL14A1	7373	broad.mit.edu	37	8	121199187	121199187	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121199187delA	uc003yox.2	+							NM_021110	NP_066933			collagen, type XIV, alpha 1 precursor						cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122676624	122676624	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122676624delA								HAS2AS (19691 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123298206	123298206	+	IGR	DEL	T	-	-	rs35336562		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123298206delT								HAS2AS (641273 upstream) : ZHX2 (495695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123517209	123517210	+	IGR	INS	-	TT	TT	rs141953266	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123517209_123517210insTT								HAS2AS (860276 upstream) : ZHX2 (276691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123545931	123545932	+	IGR	INS	-	CA	CA	rs143332434	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123545931_123545932insCA								HAS2AS (888998 upstream) : ZHX2 (247969 downstream)																																			---	---	---	---
DERL1	79139	broad.mit.edu	37	8	124038219	124038220	+	Intron	INS	-	A	A	rs75664684		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124038219_124038220insA	uc003ypl.2	-						DERL1_uc003ypm.2_Intron|DERL1_uc011lif.1_Intron|DERL1_uc003ypn.2_Intron	NM_024295	NP_077271			Der1-like domain family, member 1 isoform a						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|intracellular transport of viral proteins in host cell|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	MHC class I protein binding|receptor activity				0	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
ANXA13	312	broad.mit.edu	37	8	124723257	124723258	+	Intron	INS	-	A	A	rs143662702	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124723257_124723258insA	uc003yqu.2	-						ANXA13_uc003yqt.2_Intron	NM_004306	NP_004297			annexin A13 isoform a						cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	125191890	125191891	+	IGR	INS	-	GTGT	GTGT	rs139741594	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125191890_125191891insGTGT								FER1L6 (59589 upstream) : TMEM65 (131270 downstream)																																			---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126181974	126181974	+	Intron	DEL	T	-	-	rs33933127		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126181974delT	uc003yrw.2	+						NSMCE2_uc003yrv.2_Intron	NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
TRIB1	10221	broad.mit.edu	37	8	126440966	126440966	+	5'Flank	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126440966delC	uc003yrx.2	+							NM_025195	NP_079471			G-protein-coupled receptor induced protein						JNK cascade|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell proliferation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|regulation of MAP kinase activity|response to lipopolysaccharide	cytoplasm|nucleus	ATP binding|mitogen-activated protein kinase kinase binding|protein kinase activity|protein kinase inhibitor activity|transcription factor binding|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			lung(1)	1	all_hematologic(1;4.97e-05)|Ovarian(258;0.00167)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	127496746	127496746	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127496746delT								None (None upstream) : FAM84B (67941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127499935	127499935	+	IGR	DEL	C	-	-	rs67496411		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127499935delC								None (None upstream) : FAM84B (64752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127580025	127580026	+	IGR	INS	-	CTTT	CTTT	rs149531186	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127580025_127580026insCTTT								FAM84B (9559 upstream) : LOC727677 (722036 downstream)																																			---	---	---	---
PVT1	5820	broad.mit.edu	37	8	128895364	128895365	+	Intron	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128895364_128895365delAG	uc010mdq.2	+						PVT1_uc010mdp.1_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	129155276	129155277	+	IGR	INS	-	TATG	TATG	rs150429218	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129155276_129155277insTATG								PVT1 (41778 upstream) : MIR1208 (7085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130802688	130802688	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130802688delT								GSDMC (3554 upstream) : FAM49B (51030 downstream)																																			---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131115240	131115243	+	Intron	DEL	CTGT	-	-	rs140425471		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131115240_131115243delCTGT	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	131625131	131625134	+	IGR	DEL	AGAG	-	-	rs143668252		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131625131_131625134delAGAG								ASAP1 (210915 upstream) : ADCY8 (167414 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	131768775	131768776	+	IGR	INS	-	TCCT	TCCT	rs142776061	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131768775_131768776insTCCT								ASAP1 (354559 upstream) : ADCY8 (23772 downstream)																																			---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131882167	131882168	+	Intron	INS	-	TCC	TCC	rs142256411	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131882167_131882168insTCC	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
TG	7038	broad.mit.edu	37	8	134000310	134000311	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134000310_134000311delCA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226			thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
TG	7038	broad.mit.edu	37	8	134093969	134093969	+	Intron	DEL	A	-	-	rs33935978		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134093969delA	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226			thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
WISP1	8840	broad.mit.edu	37	8	134228228	134228229	+	Intron	DEL	AC	-	-	rs71886730		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134228228_134228229delAC	uc003yub.2	+						WISP1_uc003yuc.2_Intron|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron|WISP1_uc003yud.2_Intron	NM_003882	NP_003873			WNT1 inducible signaling pathway protein 1						cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134893711	134893712	+	IGR	INS	-	CCAA	CCAA	rs10676247		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134893711_134893712insCCAA								ST3GAL1 (309528 upstream) : ZFAT (596321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135987951	135987952	+	IGR	INS	-	T	T	rs71924635		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135987951_135987952insT								MIR30D (170763 upstream) : LOC286094 (258422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137064890	137064891	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137064890_137064891delAG								KHDRBS3 (405044 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137273398	137273399	+	IGR	INS	-	C	C	rs149358020	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137273398_137273399insC								KHDRBS3 (613552 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137411973	137411974	+	IGR	INS	-	T	T	rs142842296	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137411973_137411974insT								KHDRBS3 (752127 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	137997857	137997880	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGTGTGT	-	-	rs36215727	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:137997857_137997880delGTGTGTGTGTGTGTGTGTGTGTGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138037451	138037451	+	IGR	DEL	A	-	-	rs112479937		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138037451delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138551600	138551600	+	IGR	DEL	T	-	-	rs67493243		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138551600delT								None (None upstream) : FAM135B (590668 downstream)																																			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139727809	139727809	+	Intron	DEL	T	-	-	rs5895555		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139727809delT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140416111	140416112	+	IGR	INS	-	A	A	rs150720601	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140416111_140416112insA								COL22A1 (489875 upstream) : KCNK9 (196970 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141240886	141240886	+	Intron	DEL	A	-	-	rs67266927		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141240886delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141698566	141698566	+	Intron	DEL	T	-	-	rs34645032		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141698566delT	uc003yvu.2	-						PTK2_uc011ljp.1_Intron|PTK2_uc003yvo.2_Intron|PTK2_uc011ljq.1_Intron|PTK2_uc003yvp.2_Intron|PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	143026915	143026926	+	IGR	DEL	GCATGTGTGTGC	-	-	rs6150864		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143026915_143026926delGCATGTGTGTGC								MIR1302-7 (159241 upstream) : NCRNA00051 (252791 downstream)																																			---	---	---	---
CYP11B2	1585	broad.mit.edu	37	8	143994419	143994420	+	Intron	INS	-	G	G	rs149081590	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143994419_143994420insG	uc003yxk.1	-							NM_000498	NP_000489			cytochrome P450, family 11, subfamily B,						aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|potassium ion homeostasis|regulation of blood volume by renal aldosterone|sodium ion homeostasis|xenobiotic metabolic process		corticosterone 18-monooxygenase activity|electron carrier activity|steroid 11-beta-monooxygenase activity				0	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Candesartan(DB00796)|Metyrapone(DB01011)									Familial_Hyperaldosteronism_type_I				---	---	---	---
SPATC1	375686	broad.mit.edu	37	8	145088566	145088567	+	Intron	INS	-	AAG	AAG	rs144039966	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145088566_145088567insAAG	uc011lkw.1	+						SPATC1_uc011lkx.1_Intron	NM_198572	NP_940974			spermatogenesis and centriole associated 1											ovary(1)|central_nervous_system(1)	2	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
RECQL4	9401	broad.mit.edu	37	8	145738593	145738594	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145738593_145738594delGT	uc003zdj.2	-							NM_004260	NP_004251			RecQ protein-like 4						DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)					N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	146301084	146301084	+	IGR	DEL	G	-	-	rs112733924		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146301084delG								C8orf33 (19669 upstream) : None (None downstream)																																			---	---	---	---
CBWD1	55871	broad.mit.edu	37	9	162575	162575	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:162575delA	uc003zga.3	-						CBWD1_uc010mgs.2_Intron|CBWD1_uc003zgb.3_Intron|CBWD1_uc003zgc.3_Intron|CBWD1_uc011llr.1_Intron	NM_018491	NP_060961			COBW domain containing 1 isoform 1								ATP binding|protein binding			ovary(1)	1	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)														---	---	---	---
DMRT1	1761	broad.mit.edu	37	9	840722	840723	+	5'Flank	DEL	GG	-	-	rs79734253		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:840722_840723delGG	uc003zgv.2	+						DMRT1_uc003zgu.1_5'Flank	NM_021951	NP_068770			doublesex and mab-3 related transcription factor						cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	1023222	1023223	+	IGR	INS	-	G	G	rs141753502	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1023222_1023223insG								DMRT3 (31490 upstream) : DMRT2 (26635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	1169711	1169711	+	IGR	DEL	A	-	-	rs55684104		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1169711delA								DMRT2 (112158 upstream) : SMARCA2 (845631 downstream)																																			---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2169419	2169419	+	Intron	DEL	T	-	-	rs113841957		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2169419delT	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron|SMARCA2_uc011llw.1_Intron|SMARCA2_uc003zhf.2_Intron|SMARCA2_uc011llx.1_Intron|SMARCA2_uc003zhe.2_Intron|SMARCA2_uc003zhg.2_Intron|SMARCA2_uc010mhb.2_Intron	NM_003070	NP_003061			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	2318136	2318137	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2318136_2318137insT								SMARCA2 (124515 upstream) : FLJ35024 (104565 downstream)																																			---	---	---	---
RFX3	5991	broad.mit.edu	37	9	3331056	3331056	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3331056delC	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron|RFX3_uc010mhe.1_Intron	NM_134428	NP_602304			regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)														---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	4270889	4270900	+	Intron	DEL	GTGTGTGTGTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4270889_4270900delGTGTGTGTGTGT	uc003zhx.1	-						GLIS3_uc003zic.1_Intron|GLIS3_uc003zie.1_Intron|GLIS3_uc010mhh.1_Intron|GLIS3_uc003zid.1_Intron|GLIS3_uc010mhi.1_Intron|GLIS3_uc003zif.1_Intron|GLIS3_uc003zig.1_Intron|GLIS3_uc003zih.1_Intron	NM_001042413	NP_001035878			GLIS family zinc finger 3 isoform a						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	4462635	4462648	+	IGR	DEL	ACACGCACACACAC	-	-	rs56233060		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4462635_4462648delACACGCACACACAC								GLIS3 (162600 upstream) : SLC1A1 (27796 downstream)																																			---	---	---	---
JAK2	3717	broad.mit.edu	37	9	5031903	5031903	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5031903delA	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963			Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)			1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				---	---	---	---
UHRF2	115426	broad.mit.edu	37	9	6420707	6420707	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6420707delA	uc003zjy.2	+						UHRF2_uc003zjz.2_Intron	NM_152896	NP_690856			ubiquitin-like with PHD and ring finger domains						cell cycle|cell differentiation|cell proliferation|protein autoubiquitination|regulation of cell cycle|ubiquitin-dependent protein catabolic process	nucleus	DNA binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	6701625	6701625	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6701625delA								GLDC (55933 upstream) : KDM4C (14870 downstream)																																			---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	6899543	6899546	+	Intron	DEL	GTGT	-	-	rs141480562		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6899543_6899546delGTGT	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	12636476	12636476	+	IGR	DEL	A	-	-	rs150608189		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12636476delA								None (None upstream) : TYRP1 (56910 downstream)																																			---	---	---	---
NFIB	4781	broad.mit.edu	37	9	14281819	14281820	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14281819_14281820delCA	uc003zle.2	-						NFIB_uc003zlf.2_Intron|NFIB_uc011lmo.1_Intron	NM_005596	NP_005587			nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)				T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	9	16315659	16315660	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16315659_16315660delGT								C9orf93 (343764 upstream) : BNC2 (93842 downstream)																																			---	---	---	---
DENND4C	55667	broad.mit.edu	37	9	19328648	19328667	+	Intron	DEL	TCTGTCTGTCTATCTATCTA	-	-	rs71335419	by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19328648_19328667delTCTGTCTGTCTATCTATCTA	uc003znq.2	+						DENND4C_uc011lnc.1_Intron	NM_017925	NP_060395			DENN/MADD domain containing 4C							integral to membrane				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	20012559	20012559	+	IGR	DEL	A	-	-	rs80034571		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20012559delA								SLC24A2 (223751 upstream) : MLLT3 (332409 downstream)																																			---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20737545	20737546	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20737545_20737546delAA	uc003zog.1	+							NM_017794	NP_060264			hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
PTPLAD2	401494	broad.mit.edu	37	9	21016781	21016782	+	Intron	INS	-	T	T	rs144746830	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21016781_21016782insT	uc010miq.1	-						PTPLAD2_uc003zoj.1_Intron|PTPLAD2_uc010mir.1_Intron	NM_001010915	NP_001010915			protein tyrosine phosphatase-like A domain						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	lyase activity			skin(1)	1				Lung(24;6.02e-14)|LUSC - Lung squamous cell carcinoma(38;1.29e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	21114201	21114202	+	IGR	DEL	CA	-	-	rs144198147	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21114201_21114202delCA								IFNB1 (36258 upstream) : IFNW1 (26429 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	22422009	22422011	+	IGR	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22422009_22422011delTTG								CDKN2BAS (300918 upstream) : DMRTA1 (24829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	23027797	23027797	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23027797delA								DMRTA1 (575325 upstream) : ELAVL2 (662308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	24308184	24308185	+	IGR	INS	-	TCA	TCA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24308184_24308185insTCA								ELAVL2 (482121 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31449809	31449810	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31449809_31449810delCA								None (None upstream) : ACO1 (934791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31818452	31818453	+	IGR	INS	-	T	T	rs142367480	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31818452_31818453insT								None (None upstream) : ACO1 (566148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32318701	32318701	+	IGR	DEL	G	-	-	rs112171671		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32318701delG								None (None upstream) : ACO1 (65900 downstream)																																			---	---	---	---
DDX58	23586	broad.mit.edu	37	9	32476645	32476645	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32476645delT	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	32665378	32665379	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32665378_32665379delGT								TAF1L (29711 upstream) : TMEM215 (118118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	34860227	34860227	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34860227delA								C9orf144 (21644 upstream) : KIAA1045 (97294 downstream)																																			---	---	---	---
CD72	971	broad.mit.edu	37	9	35614016	35614016	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35614016delA	uc003zxb.2	-						CD72_uc003zxc.1_Intron|CD72_uc010mkt.1_Intron|CD72_uc010mku.2_Intron	NM_001782	NP_001773			CD72 molecule						axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	38120892	38120892	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38120892delA								SHB (51682 upstream) : ALDH1B1 (271810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	38249056	38249056	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38249056delT								SHB (179846 upstream) : ALDH1B1 (143646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	43137368	43137369	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43137368_43137369insT								AQP7P3 (244233 upstream) : LOC642929 (3170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	43155205	43155205	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43155205delA								LOC642929 (9721 upstream) : FAM75A6 (469299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66463156	66463156	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66463156delA	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																														---	---	---	---
LOC442421	442421	broad.mit.edu	37	9	66498655	66498655	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66498655delT	uc004aee.1	+						LOC442421_uc004aed.1_Intron					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	67034781	67034782	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67034781_67034782insA								LOC442421 (531754 upstream) : AQP7P1 (219485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	67337092	67337092	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67337092delT								AQP7P1 (47600 upstream) : FAM27B (455838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68382888	68382889	+	IGR	INS	-	GA	GA	rs150253239		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68382888_68382889insGA								FAM27B (588699 upstream) : MIR1299 (619350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68385963	68385964	+	IGR	INS	-	CC	CC	rs145542014	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68385963_68385964insCC								FAM27B (591774 upstream) : MIR1299 (616275 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68397605	68397606	+	IGR	INS	-	T	T	rs146336066		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68397605_68397606insT								FAM27B (603416 upstream) : MIR1299 (604633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68492312	68492313	+	IGR	INS	-	A	A	rs144278579	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68492312_68492313insA								FAM27B (698123 upstream) : MIR1299 (509926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69810304	69810304	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69810304delT								LOC100133920 (145355 upstream) : FOXD4L5 (365405 downstream)																																			---	---	---	---
C9orf71	169693	broad.mit.edu	37	9	71158193	71158193	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71158193delT	uc004agt.2	-							NM_153237	NP_694969			hypothetical protein LOC169693							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	71886853	71886853	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71886853delT								TJP2 (16735 upstream) : FAM189A2 (52635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	72422571	72422572	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72422571_72422572insT								PTAR1 (47695 upstream) : C9orf135 (13159 downstream)																																			---	---	---	---
C9orf135	138255	broad.mit.edu	37	9	72435348	72435349	+	5'Flank	INS	-	ACACAC	ACACAC	rs71500370		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72435348_72435349insACACAC	uc004ahl.2	+						C9orf135_uc011lrw.1_5'Flank|C9orf135_uc010moq.2_5'Flank|C9orf135_uc011lrx.1_5'Flank|C9orf135_uc010mop.2_5'Flank|uc004ahk.2_Intron	NM_001010940	NP_001010940			hypothetical protein LOC138255							integral to membrane				ovary(1)	1																		---	---	---	---
SMC5	23137	broad.mit.edu	37	9	72958064	72958064	+	Intron	DEL	T	-	-	rs71681650		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72958064delT	uc004ahr.2	+							NM_015110	NP_055925			SMC5 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	76323980	76323980	+	IGR	DEL	T	-	-	rs112359930		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76323980delT								ANXA1 (538673 upstream) : RORB (788272 downstream)																																			---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77447970	77447970	+	Intron	DEL	A	-	-	rs77372814		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77447970delA	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajn.1_Intron	NM_017662	NP_060132			transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	77556109	77556111	+	IGR	DEL	TTG	-	-	rs34034925		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77556109_77556111delTTG								TRPM6 (53099 upstream) : C9orf40 (5389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	78497309	78497310	+	IGR	INS	-	GTGT	GTGT	rs141178417	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78497309_78497310insGTGT								OSTF1 (735196 upstream) : PCSK5 (8250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	80710190	80710190	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80710190delT								GNAQ (63998 upstream) : CEP78 (140801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81861454	81861457	+	IGR	DEL	AAAC	-	-	rs5898623		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81861454_81861457delAAAC								PSAT1 (916447 upstream) : TLE4 (325421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83246200	83246200	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83246200delA								TLE4 (904543 upstream) : TLE1 (952400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83606938	83606938	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83606938delT								None (None upstream) : TLE1 (591662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	85142022	85142022	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85142022delA								FLJ46321 (531852 upstream) : RASEF (455295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	86621058	86621058	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86621058delT								RMI1 (2076 upstream) : SLC28A3 (272034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	87086034	87086037	+	IGR	DEL	ACCC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87086034_87086037delACCC								SLC28A3 (102621 upstream) : NTRK2 (197429 downstream)																																			---	---	---	---
AGTPBP1	23287	broad.mit.edu	37	9	88290938	88290939	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88290938_88290939insA	uc011ltd.1	-						AGTPBP1_uc011ltc.1_Intron|AGTPBP1_uc010mqc.2_Intron|AGTPBP1_uc011lte.1_Intron	NM_015239	NP_056054			ATP/GTP binding protein 1						C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7																		---	---	---	---
NAA35	60560	broad.mit.edu	37	9	88621084	88621085	+	Intron	INS	-	A	A	rs34993101		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88621084_88621085insA	uc004aoi.3	+						NAA35_uc004aoj.3_Intron	NM_024635	NP_078911			corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	89140251	89140252	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89140251_89140252insA								ZCCHC6 (170873 upstream) : GAS1 (419027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89168919	89168919	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89168919delT								ZCCHC6 (199541 upstream) : GAS1 (390360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90877946	90877951	+	IGR	DEL	TCTCTT	-	-	rs58426701		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90877946_90877951delTCTCTT								CDK20 (288279 upstream) : SPIN1 (124889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	93742673	93742673	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93742673delT								SYK (81840 upstream) : AUH (233426 downstream)																																			---	---	---	---
AUH	549	broad.mit.edu	37	9	94117170	94117170	+	Intron	DEL	C	-	-	rs137963221		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94117170delC	uc004arf.3	-						AUH_uc004arg.3_Intron|AUH_uc011ltu.1_Intron	NM_001698	NP_001689			AU RNA binding protein/enoyl-Coenzyme A						branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	94324464	94324495	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94324464_94324495delAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGG								NFIL3 (138320 upstream) : ROR2 (878 downstream)																																			---	---	---	---
IARS	3376	broad.mit.edu	37	9	94987538	94987538	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94987538delT	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Intron	NM_013417	NP_038203			isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)													---	---	---	---
WNK2	65268	broad.mit.edu	37	9	95988197	95988201	+	Intron	DEL	TGTTG	-	-	rs147166290		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95988197_95988201delTGTTG	uc004ati.1	+						WNK2_uc011lud.1_Intron|WNK2_uc004atj.2_Intron|WNK2_uc010mrc.1_Intron	NM_006648	NP_006639			WNK lysine deficient protein kinase 2						intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12																		---	---	---	---
PHF2	5253	broad.mit.edu	37	9	96362498	96362500	+	Intron	DEL	GTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96362498_96362500delGTG	uc004aub.2	+						PHF2_uc011lug.1_Intron	NM_005392	NP_005383			PHD finger protein 2						liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	96472792	96472793	+	IGR	DEL	TG	-	-	rs5899189		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96472792_96472793delTG								PHF2 (30925 upstream) : BARX1 (241118 downstream)																																			---	---	---	---
C9orf3	84909	broad.mit.edu	37	9	97798984	97798985	+	Intron	INS	-	TTTTTTTT	TTTTTTTT	rs7469257		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97798984_97798985insTTTTTTTT	uc004ava.2	+						C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron|C9orf3_uc004avc.2_Intron|C9orf3_uc011luj.1_Intron|C9orf3_uc011luk.1_Intron|C9orf3_uc004avd.2_Intron	NM_032823	NP_116212			aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	98817540	98817541	+	IGR	INS	-	A	A	rs35255909		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98817540_98817541insA								NCRNA00092 (33503 upstream) : HSD17B3 (180048 downstream)																																			---	---	---	---
SLC35D2	11046	broad.mit.edu	37	9	99128799	99128800	+	Intron	INS	-	T	T	rs34820429		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99128799_99128800insT	uc004awc.2	-						SLC35D2_uc010msd.2_Intron|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Intron|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Intron	NM_007001	NP_008932			solute carrier family 35, member D2							Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	99207085	99207085	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99207085delC								ZNF367 (26416 upstream) : HABP4 (5329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	100499402	100499403	+	IGR	INS	-	A	A	rs141862230	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100499402_100499403insA								XPA (39711 upstream) : FOXE1 (116134 downstream)																																			---	---	---	---
TRIM14	9830	broad.mit.edu	37	9	100850628	100850629	+	Intron	INS	-	TTTC	TTTC	rs147344074	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100850628_100850629insTTTC	uc004ayd.2	-						TRIM14_uc004ayf.1_Intron|TRIM14_uc011luz.1_Intron|TRIM14_uc011lva.1_Intron|TRIM14_uc004ayg.1_Intron|TRIM14_uc004ayh.1_Intron|TRIM14_uc004ayi.1_Intron|TRIM14_uc004ayj.1_Intron	NM_033220	NP_150089			tripartite motif protein TRIM14 isoform alpha							cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	101564279	101564279	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101564279delT								ANKS6 (5485 upstream) : GALNT12 (5702 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102028410	102028410	+	IGR	DEL	G	-	-	rs111239544		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102028410delG								SEC61B (35510 upstream) : NR4A3 (555727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	103173517	103173517	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103173517delA								TEX10 (58258 upstream) : C9orf30 (16125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	103448093	103448094	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103448093_103448094insA								MURC (97922 upstream) : LPPR1 (342937 downstream)																																			---	---	---	---
C9orf125	84302	broad.mit.edu	37	9	104242645	104242646	+	Intron	INS	-	TTGT	TTGT	rs148747952	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104242645_104242646insTTGT	uc004bbm.2	-							NM_032342	NP_115718			hypothetical protein LOC84302							integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
RNF20	56254	broad.mit.edu	37	9	104320289	104320289	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104320289delT	uc004bbn.2	+							NM_019592	NP_062538			ring finger protein 20						histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	106173457	106173460	+	IGR	DEL	GCGC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106173457_106173460delGCGC								CYLC2 (392687 upstream) : SMC2 (683081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	107974214	107974217	+	IGR	DEL	CTGA	-	-	rs59652868		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107974214_107974217delCTGA								ABCA1 (283778 upstream) : SLC44A1 (32712 downstream)																																			---	---	---	---
SLC44A1	23446	broad.mit.edu	37	9	108173761	108173764	+	Intron	DEL	GTGC	-	-	rs145848116	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108173761_108173764delGTGC	uc004bco.1	+							NM_080546	NP_536856			CDW92 antigen							integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	108815220	108815221	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108815220_108815221delAG								TMEM38B (277776 upstream) : ZNF462 (810157 downstream)																																			---	---	---	---
ZNF462	58499	broad.mit.edu	37	9	109709759	109709759	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109709759delT	uc004bcz.2	+						ZNF462_uc010mto.2_Intron|ZNF462_uc004bda.2_Intron|ZNF462_uc011lvz.1_Intron|ZNF462_uc004bdb.1_Intron	NM_021224	NP_067047			zinc finger protein 462						transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	109919016	109919016	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109919016delT								ZNF462 (145227 upstream) : RAD23B (126528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110611063	110611064	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110611063_110611064insA								KLF4 (359016 upstream) : None (None downstream)																																			---	---	---	---
UGCG	7357	broad.mit.edu	37	9	114694304	114694304	+	Intron	DEL	A	-	-	rs34569956		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114694304delA	uc004bft.2	+							NM_003358	NP_003349			ceramide glucosyltransferase						epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)													---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114916616	114916616	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114916616delA	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
SNX30	401548	broad.mit.edu	37	9	115541987	115541987	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115541987delA	uc004bgj.3	+							NM_001012994	NP_001013012			sorting nexin family member 30						cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	116554222	116554223	+	IGR	INS	-	A	A	rs138817014		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116554222_116554223insA								RGS3 (194205 upstream) : ZNF618 (84339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	118716837	118716840	+	IGR	DEL	CACA	-	-	rs35919442		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118716837_118716840delCACA								C9orf27 (29460 upstream) : PAPPA (199231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	118757397	118757400	+	IGR	DEL	AAGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118757397_118757400delAAGG								C9orf27 (70020 upstream) : PAPPA (158671 downstream)																																			---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119808234	119808237	+	Intron	DEL	TGTA	-	-	rs144027724		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119808234_119808237delTGTA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121651840	121651841	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121651840_121651841delAC								None (None upstream) : DBC1 (277067 downstream)																																			---	---	---	---
GSN	2934	broad.mit.edu	37	9	124060423	124060424	+	5'Flank	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124060423_124060424delCA	uc004blf.1	+						GSN_uc004bld.1_Intron|GSN_uc010mvq.1_Intron|GSN_uc010mvr.1_Intron|GSN_uc010mvu.1_Intron|GSN_uc010mvt.1_Intron|GSN_uc010mvs.1_Intron|GSN_uc004ble.1_Intron|GSN_uc010mvv.1_Intron|GSN_uc011lyh.1_Intron|GSN_uc011lyi.1_Intron	NM_000177	NP_000168			gelsolin isoform a precursor						actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126237308	126237309	+	Intron	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126237308_126237309delTT	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126369768	126369771	+	Intron	DEL	ACAC	-	-	rs10557656		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126369768_126369771delACAC	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	126898463	126898466	+	IGR	DEL	ATCC	-	-	rs34578293		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126898463_126898466delATCC								LHX2 (103021 upstream) : NEK6 (121420 downstream)																																			---	---	---	---
OLFML2A	169611	broad.mit.edu	37	9	127549029	127549038	+	Intron	DEL	ACACACACAC	-	-	rs149733353		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127549029_127549038delACACACACAC	uc004bov.2	+						OLFML2A_uc010mwr.1_Intron	NM_182487	NP_872293			olfactomedin-like 2A precursor												0																		---	---	---	---
PPP6C	5537	broad.mit.edu	37	9	127915193	127915193	+	Intron	DEL	A	-	-	rs112551024		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127915193delA	uc004bpg.3	-						PPP6C_uc010mwv.2_Intron|PPP6C_uc010mww.2_Intron|PPP6C_uc011lzr.1_Intron	NM_002721	NP_002712			protein phosphatase 6, catalytic subunit isoform						G1/S transition of mitotic cell cycle|protein dephosphorylation	cytosol	metal ion binding|protein binding|protein serine/threonine phosphatase activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128938945	128938947	+	IGR	DEL	CCC	-	-	rs142056313		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128938945_128938947delCCC								PBX3 (209292 upstream) : FAM125B (150181 downstream)																																			---	---	---	---
PTGES2	80142	broad.mit.edu	37	9	130893424	130893443	+	5'Flank	DEL	AGCCAGTGGTTGCAGTAGGC	-	-	rs72466106		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130893424_130893443delAGCCAGTGGTTGCAGTAGGC	uc004bti.2	-						PTGES2_uc004btj.2_5'Flank|PTGES2_uc004btk.2_5'Flank|PTGES2_uc004btl.2_5'Flank|PTGES2_uc004btm.2_5'Flank	NM_025072	NP_079348			prostaglandin E synthase 2						cell redox homeostasis|prostaglandin biosynthetic process	Golgi membrane|integral to membrane|mitochondrion|perinuclear region of cytoplasm	electron carrier activity|prostaglandin-E synthase activity|protein binding|protein disulfide oxidoreductase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	131096529	131096530	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131096529_131096530insT								COQ4 (180 upstream) : SLC27A4 (6310 downstream)																																			---	---	---	---
SLC27A4	10999	broad.mit.edu	37	9	131106797	131106798	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131106797_131106798insA	uc004but.2	+						SLC27A4_uc004buu.2_Intron	NM_005094	NP_005085			solute carrier family 27 (fatty acid						long-chain fatty acid transport|transmembrane transport	integral to membrane	fatty acid transporter activity|nucleotide binding|protein binding				0																		---	---	---	---
LRRC8A	56262	broad.mit.edu	37	9	131646261	131646262	+	Intron	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131646261_131646262insAA	uc004bwl.3	+						CCBL1_uc004bwh.2_5'Flank|CCBL1_uc010myn.2_5'Flank|CCBL1_uc004bwj.2_5'Flank|CCBL1_uc011mbl.1_5'Flank|CCBL1_uc004bwi.2_5'Flank|CCBL1_uc010myo.2_5'Flank|CCBL1_uc004bwk.2_5'Flank|LRRC8A_uc010myp.2_Intron|LRRC8A_uc010myq.2_Intron	NM_019594	NP_062540			leucine rich repeat containing 8 family, member						pre-B cell differentiation	integral to membrane					0																		---	---	---	---
NUP188	23511	broad.mit.edu	37	9	131749343	131749344	+	Intron	INS	-	GAGAGA	GAGAGA	rs137999231	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131749343_131749344insGAGAGA	uc004bws.1	+						NUP188_uc004bwu.2_Intron	NM_015354	NP_056169			nucleoporin 188kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	131995456	131995457	+	IGR	INS	-	CCAT	CCAT	rs138263086	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131995456_131995457insCCAT								IER5L (54916 upstream) : C9orf106 (87838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	132200169	132200172	+	IGR	DEL	AGAG	-	-	rs71798453		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132200169_132200172delAGAG								C9orf106 (115287 upstream) : C9orf50 (174334 downstream)																																			---	---	---	---
ABL1	25	broad.mit.edu	37	9	133733021	133733021	+	Intron	DEL	T	-	-	rs72114999		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133733021delT	uc004bzw.2	+						ABL1_uc004bzv.2_Intron	NM_005157	NP_005148			c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	9	134196323	134196323	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134196323delA								PPAPDC3 (11674 upstream) : BAT2L1 (73277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134225981	134225984	+	IGR	DEL	TTGT	-	-	rs113580810		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134225981_134225984delTTGT								PPAPDC3 (41332 upstream) : BAT2L1 (43616 downstream)																																			---	---	---	---
C9orf171	389799	broad.mit.edu	37	9	135325663	135325664	+	Intron	DEL	AA	-	-	rs112875395		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135325663_135325664delAA	uc004cbn.2	+						C9orf171_uc004cbo.2_Intron	NM_207417	NP_997300			hypothetical protein LOC389799											ovary(4)|large_intestine(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	135573625	135573626	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135573625_135573626insA								GTF3C4 (8157 upstream) : C9orf98 (27339 downstream)																																			---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137576901	137576902	+	Intron	INS	-	T	T	rs145886142		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137576901_137576902insT	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137576972	137576973	+	Intron	INS	-	CATT	CATT	rs141729483		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137576972_137576973insCATT	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137579332	137579332	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137579332delC	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	137838433	137838434	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137838433_137838434delCA								FCN1 (28624 upstream) : OLFM1 (128655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138503817	138503818	+	IGR	INS	-	T	T	rs139486721	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138503817_138503818insT								PAEP (45195 upstream) : GLT6D1 (11684 downstream)																																			---	---	---	---
UBAC1	10422	broad.mit.edu	37	9	138840906	138840906	+	Intron	DEL	A	-	-	rs75535862		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138840906delA	uc004cgt.2	-						UBAC1_uc004cgs.1_Intron|UBAC1_uc004cgu.2_Intron	NM_016172	NP_057256			ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)														---	---	---	---
GPSM1	26086	broad.mit.edu	37	9	139253481	139253481	+	3'UTR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139253481delG	uc004chd.2	+	14					GPSM1_uc011mdu.1_3'UTR|GPSM1_uc004che.2_3'UTR	NM_001145638	NP_001139110			G-protein signaling modulator 1 (AGS3-like, C.						cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	139475999	139476002	+	IGR	DEL	TCAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139475999_139476002delTCAC								NOTCH1 (35761 upstream) : EGFL7 (77306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	139528615	139528615	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139528615delT								NOTCH1 (88377 upstream) : EGFL7 (24693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	140168735	140168736	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140168735_140168736insA								COBRA1 (736 upstream) : C9orf167 (3544 downstream)																																			---	---	---	---
EXD3	54932	broad.mit.edu	37	9	140229535	140229535	+	Intron	DEL	A	-	-	rs79120496		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140229535delA	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron	NM_017820	NP_060290			exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	951601	951619	+	IGR	DEL	GGGAGGAGCTGAGGAGCAA	-	-	rs72388873		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:951601_951619delGGGAGGAGCTGAGGAGCAA								LARP4B (19899 upstream) : GTPBP4 (82730 downstream)																																			---	---	---	---
GTPBP4	23560	broad.mit.edu	37	10	1061538	1061570	+	Intron	DEL	CTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	-	-	rs71731536	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061538_1061570delCTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	uc001ift.2	+						GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473			G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	1783920	1783921	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1783920_1783921delGT								ADARB2 (4202 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2061376	2061376	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2061376delT								ADARB2 (281658 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2156246	2156246	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2156246delC								ADARB2 (376528 upstream) : PFKP (953506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	2676260	2676261	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2676260_2676261delCA								ADARB2 (896542 upstream) : PFKP (433491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3475318	3475319	+	Intron	DEL	GT	-	-	rs10904040		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3475318_3475319delGT	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	4048639	4048640	+	IGR	INS	-	T	T	rs34321345		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4048639_4048640insT								KLF6 (221166 upstream) : LOC100216001 (572804 downstream)																																			---	---	---	---
AKR1C1	1645	broad.mit.edu	37	10	5003911	5003912	+	Intron	INS	-	TTG	TTG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5003911_5003912insTTG	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_5'Flank|AKR1C1_uc009xhx.2_5'Flank|AKR1C1_uc001ihq.2_5'Flank	NM_001353	NP_001344			aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	6446791	6446794	+	IGR	DEL	TTCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6446791_6446794delTTCT								PFKFB3 (169286 upstream) : PRKCQ (22311 downstream)																																			---	---	---	---
PRKCQ	5588	broad.mit.edu	37	10	6543215	6543216	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6543215_6543216insA	uc001ijj.1	-						PRKCQ_uc009xim.1_Intron|PRKCQ_uc001iji.1_Intron|PRKCQ_uc009xin.1_Intron|PRKCQ_uc010qax.1_Intron	NM_006257	NP_006248			protein kinase C, theta						axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6																		---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7216906	7216907	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7216906_7216907delTG	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
SFMBT2	57713	broad.mit.edu	37	10	7441742	7441742	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7441742delG	uc009xio.1	-						SFMBT2_uc001ijn.1_Intron|SFMBT2_uc010qay.1_Intron|SFMBT2_uc001ijo.1_Intron	NM_001029880	NP_001025051			Scm-like with four mbt domains 2						regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	9797059	9797060	+	IGR	INS	-	A	A	rs146416628	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9797059_9797060insA								None (None upstream) : None (None downstream)																																			---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12414755	12414756	+	Intron	INS	-	T	T	rs138858856	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12414755_12414756insT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12569350	12569351	+	Intron	DEL	TT	-	-	rs145976657		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12569350_12569351delTT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
CCDC3	83643	broad.mit.edu	37	10	13002153	13002154	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13002153_13002154delCA	uc001ilq.1	-						CCDC3_uc009xjb.1_Intron|CCDC3_uc001ilr.2_Intron|CCDC3_uc009xjc.1_Intron	NM_031455	NP_113643			coiled-coil domain containing 3 precursor							endoplasmic reticulum|extracellular region				ovary(1)	1		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)															---	---	---	---
MCM10	55388	broad.mit.edu	37	10	13233564	13233567	+	Intron	DEL	AAGC	-	-	rs112703555		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13233564_13233567delAAGC	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428			minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	13318659	13318659	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13318659delA								UCMA (42331 upstream) : PHYH (1138 downstream)																																			---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	14087228	14087228	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14087228delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
NMT2	9397	broad.mit.edu	37	10	15193058	15193059	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15193058_15193059insT	uc001inz.1	-						NMT2_uc001ioa.1_Intron|NMT2_uc009xjo.1_Intron|NMT2_uc010qbz.1_Intron	NM_004808	NP_004799			N-myristoyltransferase 2						N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	15519770	15519773	+	IGR	DEL	TGTG	-	-	rs10533112		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15519770_15519773delTGTG								FAM171A1 (106712 upstream) : ITGA8 (39315 downstream)																																			---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15597701	15597701	+	Intron	DEL	T	-	-	rs66511032		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15597701delT	uc001ioc.1	-						ITGA8_uc010qcb.1_Intron	NM_003638	NP_003629			integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15705950	15705950	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15705950delT	uc001ioc.1	-						ITGA8_uc010qcb.1_Intron	NM_003638	NP_003629			integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
ST8SIA6	338596	broad.mit.edu	37	10	17432861	17432861	+	Intron	DEL	T	-	-	rs146797949		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17432861delT	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron|uc001ipe.2_Intron|uc001ipf.1_Intron	NM_001004470	NP_001004470			ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1																		---	---	---	---
MRC1	4360	broad.mit.edu	37	10	17928294	17928297	+	Intron	DEL	CTTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17928294_17928297delCTTC	uc001ipk.2	+							NM_002438	NP_002429			mannose receptor C type 1 precursor						receptor-mediated endocytosis	endosome membrane|integral to plasma membrane	mannose binding|receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	19010944	19010944	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19010944delT								ARL5B (44004 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19341633	19341634	+	IGR	INS	-	C	C	rs141664279	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19341633_19341634insC								ARL5B (374693 upstream) : PLXDC2 (763738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	20886964	20886965	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20886964_20886965delGT								PLXDC2 (317849 upstream) : NEBL (181940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	22715799	22715800	+	IGR	DEL	GT	-	-	rs112971901		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22715799_22715800delGT								SPAG6 (9261 upstream) : PIP4K2A (107967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	23057369	23057370	+	IGR	DEL	TG	-	-	rs71916898		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23057369_23057370delTG								PIP4K2A (53866 upstream) : ARMC3 (159584 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24471367	24471368	+	Intron	INS	-	CACACA	CACACA	rs12146292	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24471367_24471368insCACACA	uc001irs.2	+							NM_001098500	NP_001091970			sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24679397	24679398	+	Intron	INS	-	GAGA	GAGA	rs72016476		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24679397_24679398insGAGA	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
PRTFDC1	56952	broad.mit.edu	37	10	25229990	25229991	+	Intron	DEL	TT	-	-	rs10828729	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25229990_25229991delTT	uc001ise.1	-						PRTFDC1_uc010qdd.1_Intron|PRTFDC1_uc001isf.1_Intron|PRTFDC1_uc009xkm.1_Intron	NM_020200	NP_064585			phosphoribosyl transferase domain containing 1						adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP salvage|grooming behavior|hypoxanthine metabolic process|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity			ovary(1)	1																		---	---	---	---
ENKUR	219670	broad.mit.edu	37	10	25353752	25353753	+	5'Flank	INS	-	T	T	rs67189021		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25353752_25353753insT	uc001ish.1	-							NM_145010	NP_659447			enkurin							cilium|flagellum	calmodulin binding|SH3 domain binding				0																		---	---	---	---
GPR158	57512	broad.mit.edu	37	10	25827143	25827144	+	Intron	INS	-	GTT	GTT	rs141199361	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25827143_25827144insGTT	uc001isj.2	+							NM_020752	NP_065803			G protein-coupled receptor 158 precursor							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26602698	26602699	+	IGR	INS	-	TGTG	TGTG	rs74126434	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26602698_26602699insTGTG								GAD2 (9207 upstream) : APBB1IP (124567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	26607459	26607460	+	IGR	INS	-	AGGGAGGC	AGGGAGGC	rs140640852	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26607459_26607460insAGGGAGGC								GAD2 (13968 upstream) : APBB1IP (119806 downstream)																																			---	---	---	---
ABI1	10006	broad.mit.edu	37	10	27105916	27105917	+	Intron	DEL	TG	-	-	rs34202054		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27105916_27105917delTG	uc001isx.2	-						ABI1_uc001ite.2_Intron|ABI1_uc010qdh.1_Intron|ABI1_uc010qdi.1_Intron|ABI1_uc001isy.2_Intron|ABI1_uc001ita.2_Intron|ABI1_uc001isz.2_Intron|ABI1_uc001itb.2_Intron|ABI1_uc001itc.2_Intron|ABI1_uc010qdj.1_Intron|ABI1_uc001itd.2_Intron|ABI1_uc010qdk.1_Intron	NM_005470	NP_005461			abl-interactor 1 isoform a						actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	28296194	28296195	+	IGR	DEL	AG	-	-	rs63730460		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28296194_28296195delAG								ARMC4 (8217 upstream) : MPP7 (43728 downstream)																																			---	---	---	---
WAC	51322	broad.mit.edu	37	10	28820771	28820790	+	5'Flank	DEL	ATGGAAAACGTTAGAAAGGG	-	-	rs72293621		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28820771_28820790delATGGAAAACGTTAGAAAGGG	uc001iud.2	+						WAC_uc001iue.2_5'Flank|WAC_uc009xlb.2_5'Flank|WAC_uc001iuf.2_5'Flank|WAC_uc001iug.2_5'Flank|WAC_uc001iuh.2_5'Flank|uc001iuc.2_Intron	NM_016628	NP_057712			WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
WAC	51322	broad.mit.edu	37	10	28824816	28824817	+	Intron	INS	-	T	T	rs144095892	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28824816_28824817insT	uc001iuf.2	+						WAC_uc001iud.2_Intron|WAC_uc001iue.2_Intron|WAC_uc009xlb.2_Intron|WAC_uc001iug.2_Intron|WAC_uc001iuh.2_Intron	NM_016628	NP_057712			WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29128049	29128050	+	IGR	DEL	AC	-	-	rs10556805		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29128049_29128050delAC								BAMBI (156181 upstream) : LYZL1 (449940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29448241	29448241	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29448241delT								BAMBI (476373 upstream) : LYZL1 (129749 downstream)																																			---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29940948	29940949	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29940948_29940949delAC	uc001iuu.1	-						SVIL_uc009xld.1_Intron	NM_003174	NP_003165			supervillin isoform 1						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	30224931	30224932	+	IGR	INS	-	T	T	rs72420102		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30224931_30224932insT								SVIL (199067 upstream) : KIAA1462 (76797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	30272772	30272779	+	IGR	DEL	GAAGGAGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30272772_30272779delGAAGGAGG								SVIL (246908 upstream) : KIAA1462 (28950 downstream)																																			---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30362610	30362611	+	Intron	INS	-	CTTC	CTTC	rs145825538	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362610_30362611insCTTC	uc001iuz.2	-											RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	30774122	30774123	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30774122_30774123insT								MAP3K8 (23361 upstream) : LYZL2 (126586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	30933200	30933200	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30933200delT								LYZL2 (14553 upstream) : ZNF438 (200367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	31940000	31940000	+	IGR	DEL	A	-	-	rs11298896		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31940000delA								ZEB1 (121873 upstream) : ARHGAP12 (155225 downstream)																																			---	---	---	---
ARHGAP12	94134	broad.mit.edu	37	10	32191599	32191599	+	Intron	DEL	A	-	-	rs74527191		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32191599delA	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757			Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	36308961	36308961	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36308961delA								FZD8 (378599 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	37543483	37543483	+	IGR	DEL	T	-	-	rs139776676		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37543483delT								ANKRD30A (21988 upstream) : ZNF248 (546964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38582126	38582126	+	IGR	DEL	A	-	-	rs113706166		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38582126delA								LOC100129055 (78854 upstream) : HSD17B7P2 (63182 downstream)																																			---	---	---	---
HSD17B7P2	158160	broad.mit.edu	37	10	38651872	38651877	+	Intron	DEL	ACAGAC	-	-	rs34199647		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38651872_38651877delACAGAC	uc010qex.1	+						HSD17B7P2_uc001izq.2_Intron|HSD17B7P2_uc001izo.1_Intron|HSD17B7P2_uc001izp.1_Intron					SubName: Full=cDNA FLJ60462, highly similar to 3-keto-steroid reductase (EC 1.1.1.270);												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	38880570	38880570	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38880570delT								LOC399744 (139490 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38905388	38905389	+	IGR	DEL	AA	-	-	rs112078481		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38905388_38905389delAA								LOC399744 (164308 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38946132	38946133	+	IGR	INS	-	CT	CT	rs139041264		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38946132_38946133insCT								LOC399744 (205052 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39091666	39091667	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39091666_39091667insT								LOC399744 (350586 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39118900	39118900	+	IGR	DEL	G	-	-	rs74192178		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39118900delG								LOC399744 (377820 upstream) : None (None downstream)																																			---	---	---	---
LOC441666	441666	broad.mit.edu	37	10	42842682	42842683	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42842682_42842683insA	uc010qey.1	-							NR_024380				Homo sapiens noncoding mRNA sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	43510164	43510164	+	IGR	DEL	A	-	-	rs34102018		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43510164delA								BMS1 (179781 upstream) : RET (62353 downstream)																																			---	---	---	---
SYT15	83849	broad.mit.edu	37	10	46963058	46963059	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46963058_46963059insT	uc001jea.2	-						SYT15_uc001jdz.2_Intron|SYT15_uc001jeb.2_Intron|SYT15_uc010qfp.1_Intron	NM_031912	NP_114118			synaptotagmin XV isoform a							integral to membrane|plasma membrane					0																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47094139	47094140	+	Intron	INS	-	T	T	rs28590570	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47094139_47094140insT	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	47353411	47353412	+	IGR	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47353411_47353412delTT								LOC642826 (109909 upstream) : FAM35B2 (26308 downstream)																																			---	---	---	---
MAPK8	5599	broad.mit.edu	37	10	49540191	49540192	+	Intron	INS	-	G	G	rs140824967	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49540191_49540192insG	uc009xnz.2	+						MAPK8_uc001jgl.2_Intron	NM_139047	NP_620635			mitogen-activated protein kinase 8 isoform JNK1						activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)														---	---	---	---
WDFY4	57705	broad.mit.edu	37	10	49930717	49930718	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49930717_49930718delCA	uc001jha.3	+						WDFY4_uc001jgy.2_Intron	NM_020945	NP_065996			WDFY family member 4							integral to membrane	binding				0																		---	---	---	---
OGDHL	55753	broad.mit.edu	37	10	50972244	50972245	+	5'Flank	DEL	GT	-	-	rs112353657		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50972244_50972245delGT	uc001jie.2	-						OGDHL_uc010qgt.1_5'Flank|OGDHL_uc010qgu.1_5'Flank|OGDHL_uc009xoh.2_5'Flank	NM_018245	NP_060715			oxoglutarate dehydrogenase-like isoform a						glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1																		---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	52748683	52748684	+	5'Flank	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52748683_52748684insA	uc001jjm.2	+						PRKG1_uc010qhp.1_5'Flank	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53080211	53080211	+	Intron	DEL	G	-	-	rs34370245		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53080211delG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53175670	53175671	+	Intron	INS	-	GT	GT	rs141175757	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53175670_53175671insGT	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54301204	54301205	+	IGR	INS	-	T	T	rs143248943	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54301204_54301205insT								DKK1 (223788 upstream) : MBL2 (223936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54329878	54329879	+	IGR	INS	-	A	A	rs67508993		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54329878_54329879insA								DKK1 (252462 upstream) : MBL2 (195262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54418964	54418967	+	IGR	DEL	CACC	-	-	rs146206726	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54418964_54418967delCACC								DKK1 (341548 upstream) : MBL2 (106174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54839554	54839555	+	IGR	DEL	AT	-	-	rs147454230		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54839554_54839555delAT								MBL2 (308094 upstream) : PCDH15 (722980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	55060442	55060453	+	IGR	DEL	TGTGTGTGTGTG	-	-	rs72157274		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55060442_55060453delTGTGTGTGTGTG								MBL2 (528982 upstream) : PCDH15 (502082 downstream)																																			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55683724	55683725	+	Intron	INS	-	T	T	rs147731931	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55683724_55683725insT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55851109	55851109	+	Intron	DEL	T	-	-	rs77591138		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55851109delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58938597	58938597	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58938597delT								ZWINT (817563 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59394360	59394363	+	IGR	DEL	TGTG	-	-	rs10545761		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59394360_59394363delTGTG								None (None upstream) : IPMK (561255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	60201138	60201139	+	IGR	DEL	TT	-	-	rs35058604		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60201138_60201139delTT								TFAM (45242 upstream) : BICC1 (71765 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60378780	60378781	+	Intron	INS	-	T	T	rs144978372	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60378780_60378781insT	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60447813	60447813	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60447813delG	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
FAM13C	220965	broad.mit.edu	37	10	61104045	61104045	+	Intron	DEL	T	-	-	rs112317127		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61104045delT	uc001jkn.2	-						FAM13C_uc001jko.2_Intron|FAM13C_uc010qid.1_Intron|FAM13C_uc010qie.1_Intron|FAM13C_uc010qif.1_Intron|FAM13C_uc001jkp.2_Intron	NM_198215	NP_937858			hypothetical protein LOC220965 isoform 1											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	61406095	61406095	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61406095delT								FAM13C (283434 upstream) : SLC16A9 (4427 downstream)																																			---	---	---	---
ANK3	288	broad.mit.edu	37	10	61824426	61824427	+	Intron	INS	-	ACAACAACA	ACAACAACA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61824426_61824427insACAACAACA	uc001jky.2	-						ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron	NM_020987	NP_066267			ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	62829881	62829881	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62829881delG								RHOBTB1 (68683 upstream) : TMEM26 (336520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	63653787	63653788	+	IGR	DEL	GT	-	-	rs34422922		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63653787_63653788delGT								C10orf107 (127698 upstream) : ARID5B (7655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	63888650	63888651	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63888650_63888651insT								ARID5B (31947 upstream) : RTKN2 (54143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65502136	65502136	+	IGR	DEL	A	-	-	rs34784830		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65502136delA								REEP3 (120165 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65627373	65627374	+	IGR	INS	-	T	T	rs144041533	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65627373_65627374insT								REEP3 (245402 upstream) : ANXA2P3 (957911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66123866	66123866	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66123866delT								REEP3 (741895 upstream) : ANXA2P3 (461419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67488722	67488722	+	IGR	DEL	A	-	-	rs143517548		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67488722delA								ANXA2P3 (902088 upstream) : CTNNA3 (191003 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68124072	68124072	+	Intron	DEL	G	-	-	rs80015282		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68124072delG	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
RUFY2	55680	broad.mit.edu	37	10	70139569	70139570	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70139569_70139570insT	uc001job.2	-						RUFY2_uc001jnz.1_Intron|RUFY2_uc001joa.2_5'Flank|RUFY2_uc001joc.2_Intron|RUFY2_uc010qiw.1_Intron|RUFY2_uc001jod.1_Intron	NM_017987	NP_060457			RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1																		---	---	---	---
RUFY2	55680	broad.mit.edu	37	10	70168781	70168782	+	5'Flank	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70168781_70168782delTG	uc001job.2	-						RUFY2_uc001jnz.1_5'Flank|RUFY2_uc001joc.2_5'Flank|RUFY2_uc010qiw.1_5'Flank|RUFY2_uc001jod.1_5'Flank|RUFY2_uc009xpv.1_5'Flank|RUFY2_uc001joe.1_5'Flank	NM_017987	NP_060457			RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71349300	71349307	+	IGR	DEL	GTGTGTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71349300_71349307delGTGTGTGT								NEUROG3 (16178 upstream) : C10orf35 (40696 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	71785387	71785388	+	IGR	INS	-	TG	TG	rs150506463	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71785387_71785388insTG								COL13A1 (66484 upstream) : H2AFY2 (26969 downstream)																																			---	---	---	---
PPA1	5464	broad.mit.edu	37	10	71989675	71989675	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71989675delT	uc001jqv.1	-							NM_021129	NP_066952			pyrophosphatase 1						diphosphate metabolic process|tRNA aminoacylation for protein translation	cytosol	inorganic diphosphatase activity|magnesium ion binding			breast(1)	1																		---	---	---	---
LRRC20	55222	broad.mit.edu	37	10	72098083	72098085	+	Intron	DEL	CCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72098083_72098085delCCT	uc001jqx.1	-						LRRC20_uc001jqy.1_Intron|LRRC20_uc001jqz.1_Intron	NM_207119	NP_997002			leucine rich repeat containing 20 isoform 1												0																		---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72268564	72268599	+	Intron	DEL	TGTGTGTGTGTGCAGGCCTGTGGGAGCTGCGGAACC	-	-	rs72223134	by1000genomes;byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72268564_72268599delTGTGTGTGTGTGCAGGCCTGTGGGAGCTGCGGAACC	uc001jrd.3	+							NM_014431	NP_055246			KIAA1274											ovary(2)|central_nervous_system(1)	3																		---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72288965	72288966	+	Intron	INS	-	A	A	rs72290492		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72288965_72288966insA	uc001jrd.3	+							NM_014431	NP_055246			KIAA1274											ovary(2)|central_nervous_system(1)	3																		---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74269572	74269572	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74269572delA	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74338356	74338356	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74338356delT	uc001jtb.1	-							NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	74438581	74438582	+	IGR	INS	-	TC	TC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74438581_74438582insTC								CBARA1 (52682 upstream) : CCDC109A (13307 downstream)																																			---	---	---	---
PPP3CB	5532	broad.mit.edu	37	10	75209559	75209560	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75209559_75209560insT	uc001jue.2	-						PPP3CB_uc001juf.2_Intron|PPP3CB_uc001jug.2_Intron|PPP3CB_uc001jui.2_Intron|PPP3CB_uc001juh.2_Intron|PPP3CB_uc010qkj.1_Intron	NM_021132	NP_066955			protein phosphatase 3, catalytic subunit, beta											skin(1)	1	Prostate(51;0.0119)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	75751879	75751880	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75751879_75751880delGT								C10orf55 (69344 upstream) : VCL (3071 downstream)																																			---	---	---	---
VCL	7414	broad.mit.edu	37	10	75861621	75861621	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75861621delT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706			vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)																	---	---	---	---
ADK	132	broad.mit.edu	37	10	75920448	75920449	+	Intron	INS	-	GT	GT	rs117467286	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75920448_75920449insGT	uc001jwi.2	+						ADK_uc010qlb.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	78332843	78332846	+	IGR	DEL	TGTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78332843_78332846delTGTG								C10orf11 (15719 upstream) : KCNMA1 (296513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	78566454	78566455	+	IGR	DEL	GC	-	-	rs147704296		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78566454_78566455delGC								C10orf11 (249330 upstream) : KCNMA1 (62904 downstream)																																			---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78731732	78731733	+	Intron	INS	-	GTGT	GTGT	rs146288616	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78731732_78731733insGTGT	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
RPS24	6229	broad.mit.edu	37	10	79810536	79810536	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79810536delT	uc001jzs.2	+						RPS24_uc001jzt.2_Intron	NM_001142285	NP_001135757			ribosomal protein S24 isoform d						endocrine pancreas development|erythrocyte homeostasis|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleolus	nucleotide binding|structural constituent of ribosome|translation initiation factor binding			skin(1)	1	all_cancers(46;0.0343)|all_epithelial(25;0.000959)|Breast(12;0.00113)|Prostate(51;0.0095)		Epithelial(14;0.00128)|OV - Ovarian serous cystadenocarcinoma(4;0.00248)|all cancers(16;0.00428)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	80036146	80036149	+	Intron	DEL	TCCC	-	-	rs10568657		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80036146_80036149delTCCC	uc010qlp.1	+						uc001jzw.1_Intron					SubName: Full=cDNA FLJ57363;																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	80046029	80046030	+	Intron	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80046029_80046030delAA	uc010qlp.1	+						uc001jzw.1_Intron					SubName: Full=cDNA FLJ57363;																														---	---	---	---
LOC283050	283050	broad.mit.edu	37	10	80706928	80706928	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80706928delA	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	81393193	81393194	+	IGR	INS	-	GT	GT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81393193_81393194insGT								SFTPA1 (17992 upstream) : LOC650623 (49537 downstream)																																			---	---	---	---
ANXA11	311	broad.mit.edu	37	10	81916276	81916277	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81916276_81916277insT	uc001kbq.1	-						ANXA11_uc010qlx.1_Intron|ANXA11_uc001kbr.1_Intron|ANXA11_uc001kbs.1_Intron|ANXA11_uc001kbt.1_Intron|ANXA11_uc010qly.1_Intron|ANXA11_uc009xsq.1_Intron|ANXA11_uc001kbu.1_Intron	NM_145869	NP_665876			annexin A11						cell cycle|cytokinesis, completion of separation|phagocytosis|response to calcium ion	azurophil granule|melanosome|midbody|nuclear envelope|nucleoplasm|phagocytic vesicle|specific granule|spindle	calcium-dependent phospholipid binding|calcium-dependent protein binding|S100 alpha binding			ovary(1)	1	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)															---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84093892	84093893	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84093892_84093893insA	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84309611	84309611	+	Intron	DEL	T	-	-	rs11298582		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84309611delT	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	85687687	85687688	+	IGR	INS	-	T	T	rs150063212	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85687687_85687688insT								NRG3 (940752 upstream) : GHITM (211497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85749686	85749687	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85749686_85749687delTC								None (None upstream) : GHITM (149498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86965824	86965824	+	IGR	DEL	C	-	-	rs113901555		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86965824delC								FAM190B (687548 upstream) : GRID1 (393488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87089654	87089654	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87089654delT								FAM190B (811378 upstream) : GRID1 (269658 downstream)																																			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87371268	87371268	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87371268delT	uc001kdl.1	-						GRID1_uc009xsu.1_Intron|GRID1_uc010qmf.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
AGAP11	119385	broad.mit.edu	37	10	88739784	88739784	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88739784delG	uc001kee.2	+							NM_133447	NP_597704			ankyrin repeat and GTPase domain Arf GTPase						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0																		---	---	---	---
ATAD1	84896	broad.mit.edu	37	10	89562400	89562401	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89562400_89562401insA	uc001key.1	-						ATAD1_uc009xth.1_Intron|ATAD1_uc001kez.1_Intron	NM_032810	NP_116199			ATPase family, AAA domain containing 1							peroxisome	ATP binding|nucleoside-triphosphatase activity			large_intestine(1)|ovary(1)	2		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)														---	---	---	---
LIPA	3988	broad.mit.edu	37	10	91012223	91012225	+	5'Flank	DEL	TGA	-	-	rs74863780		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91012223_91012225delTGA	uc001kga.3	-						LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|LIPA_uc009xtq.2_5'Flank	NM_000235	NP_000226			lipase A precursor						lipid catabolic process	lysosome	lipase activity|sterol esterase activity				0		Colorectal(252;0.0162)		GBM - Glioblastoma multiforme(2;0.00406)														---	---	---	---
SLC16A12	387700	broad.mit.edu	37	10	91197218	91197218	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91197218delG	uc001kgm.2	-						SLC16A12_uc001kgl.2_5'Flank	NM_213606	NP_998771			solute carrier family 16 (monocarboxylic acid							integral to membrane|plasma membrane	symporter activity			skin(1)	1																		---	---	---	---
HTR7	3363	broad.mit.edu	37	10	92579607	92579608	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92579607_92579608insA	uc001kha.2	-						HTR7_uc001kgz.2_Intron|HTR7_uc001khb.2_Intron	NM_019859	NP_062873			5-hydroxytryptamine receptor 7 isoform d						blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	93050119	93050120	+	IGR	INS	-	T	T	rs146789549	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93050119_93050120insT								PCGF5 (6099 upstream) : LOC100188947 (16600 downstream)																																			---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	95946904	95946905	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95946904_95946905delTG	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Intron	NM_016341	NP_057425			phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97103651	97103652	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97103651_97103652insA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97159238	97159239	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97159238_97159239insA	uc001kkp.2	-						SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97192086	97192088	+	Intron	DEL	ACA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97192086_97192088delACA	uc001kkp.2	-						SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron|SORBS1_uc001kkx.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97262755	97262756	+	Intron	INS	-	ACAC	ACAC	rs141109096	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97262755_97262756insACAC	uc001kkw.2	-						SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron|SORBS1_uc001kkx.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
ENTPD1	953	broad.mit.edu	37	10	97566550	97566551	+	Intron	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97566550_97566551delCT	uc001klh.3	+						ENTPD1_uc001kle.1_Intron|ENTPD1_uc001kli.3_Intron|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Intron|ENTPD1_uc010qok.1_Intron|ENTPD1_uc010qol.1_Intron|ENTPD1_uc010qom.1_Intron|ENTPD1_uc010qon.1_Intron|ENTPD1_uc009xva.2_Intron|ENTPD1_uc009xuz.2_Intron	NM_001776	NP_001767			ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)														---	---	---	---
ENTPD1	953	broad.mit.edu	37	10	97605764	97605765	+	Intron	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97605764_97605765insAA	uc001klh.3	+						ENTPD1_uc001kle.1_3'UTR|ENTPD1_uc001kli.3_Intron|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Intron|ENTPD1_uc010qok.1_Intron|ENTPD1_uc010qol.1_Intron|ENTPD1_uc010qom.1_Intron|ENTPD1_uc010qon.1_Intron|ENTPD1_uc009xva.2_Intron|ENTPD1_uc009xuz.2_Intron	NM_001776	NP_001767			ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)														---	---	---	---
ENTPD1	953	broad.mit.edu	37	10	97632435	97632436	+	3'UTR	INS	-	A	A	rs144094509	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97632435_97632436insA	uc001klh.3	+	10					ENTPD1_uc001kli.3_3'UTR|uc001klg.1_Intron|ENTPD1_uc010qoj.1_3'UTR|ENTPD1_uc010qok.1_3'UTR|ENTPD1_uc010qol.1_3'UTR|ENTPD1_uc010qom.1_3'UTR|ENTPD1_uc010qon.1_3'UTR|ENTPD1_uc009xva.2_3'UTR|ENTPD1_uc009xuz.2_RNA	NM_001776	NP_001767			ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)														---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98739920	98739920	+	5'Flank	DEL	A	-	-	rs5787211		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98739920delA	uc001kmv.2	+						C10orf12_uc009xvg.1_Intron	NM_015652	NP_056467			hypothetical protein LOC26148											skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
PI4K2A	55361	broad.mit.edu	37	10	99347273	99347274	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99347273_99347274insT	uc010qoy.1	+						DHDPSL_uc001knx.2_Intron|DHDPSL_uc001kny.2_Intron|DHDPSL_uc001knz.2_Intron|C10orf62_uc001koa.2_5'Flank	NM_018425	NP_060895			phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)														---	---	---	---
PI4K2A	55361	broad.mit.edu	37	10	99392461	99392461	+	Intron	DEL	T	-	-	rs78306903		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99392461delT	uc010qoy.1	+						MORN4_uc001kob.3_Intron|MORN4_uc001koc.3_Intron|MORN4_uc001kod.3_Intron|MORN4_uc001koe.2_Intron|MORN4_uc009xvv.1_Intron	NM_018425	NP_060895			phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100301351	100301351	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100301351delA	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100503451	100503451	+	Intron	DEL	T	-	-	rs34603601		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100503451delT	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
SLC25A28	81894	broad.mit.edu	37	10	101394189	101394190	+	Intron	INS	-	ATAG	ATAG	rs141967171	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101394189_101394190insATAG	uc001kpy.2	-											RecName: Full=Mitoferrin-2; AltName: Full=Mitochondrial iron transporter 2; AltName: Full=Solute carrier family 25 member 28; AltName: Full=Mitochondrial RNA-splicing protein 3/4 homolog;          Short=hMRS3/4;          Short=MRS3/4;						ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	102477974	102477974	+	IGR	DEL	T	-	-	rs11293359		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102477974delT								HIF1AN (164294 upstream) : PAX2 (27494 downstream)																																			---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103275014	103275014	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103275014delT	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	103966009	103966010	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103966009_103966010delAG								NOLC1 (42382 upstream) : ELOVL3 (20133 downstream)																																			---	---	---	---
TMEM180	79847	broad.mit.edu	37	10	104228423	104228424	+	Intron	INS	-	A	A	rs139495724		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104228423_104228424insA	uc001kvt.2	+						TMEM180_uc001kvs.2_Intron|TMEM180_uc010qql.1_Intron|TMEM180_uc010qqm.1_Intron|TMEM180_uc001kvu.2_Intron	NM_024789	NP_079065			transmembrane protein 180							integral to membrane				ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	105058169	105058170	+	IGR	INS	-	G	G	rs148490782	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105058169_105058170insG								INA (8063 upstream) : PCGF6 (4384 downstream)																																			---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106905657	106905657	+	Intron	DEL	G	-	-	rs68167323		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106905657delG	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107269433	107269436	+	IGR	DEL	TTGA	-	-	rs72356499		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107269433_107269436delTTGA								SORCS3 (244440 upstream) : None (None downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108585028	108585029	+	Intron	DEL	TT	-	-	rs72354097		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108585028_108585029delTT	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	109189752	109189752	+	IGR	DEL	C	-	-	rs11314066		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109189752delC								SORCS1 (265460 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	109997009	109997012	+	IGR	DEL	GTGC	-	-	rs5787766	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109997009_109997012delGTGC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	110192584	110192584	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110192584delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	110682007	110682007	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110682007delA								None (None upstream) : XPNPEP1 (942517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111066867	111066867	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111066867delC								None (None upstream) : XPNPEP1 (557657 downstream)																																			---	---	---	---
XPNPEP1	7511	broad.mit.edu	37	10	111675750	111675751	+	Intron	INS	-	TC	TC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111675750_111675751insTC	uc001kyp.1	-						XPNPEP1_uc009xxt.1_Intron|XPNPEP1_uc001kyq.1_Intron|XPNPEP1_uc010qrb.1_Intron	NM_020383	NP_065116			X-prolyl aminopeptidase (aminopeptidase P) 1,						bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)														---	---	---	---
RBM20	282996	broad.mit.edu	37	10	112524032	112524035	+	Intron	DEL	CAAA	-	-	rs147125464		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112524032_112524035delCAAA	uc001kzf.2	+							NM_001134363	NP_001127835			RNA binding motif protein 20							nucleus	nucleotide binding|RNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	113139855	113139856	+	IGR	INS	-	C	C	rs139100276	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113139855_113139856insC								ADRA2A (299195 upstream) : GPAM (769766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	115220253	115220254	+	IGR	INS	-	T	T	rs10885462	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115220253_115220254insT								TCF7L2 (292819 upstream) : HABP2 (92524 downstream)																																			---	---	---	---
C10orf118	55088	broad.mit.edu	37	10	115890363	115890363	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115890363delT	uc001lbb.1	-						C10orf118_uc009xyd.1_Intron|C10orf118_uc001lbc.1_Intron|C10orf118_uc009xye.1_RNA	NM_018017	NP_060487			CTCL tumor antigen L14-2											ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117194539	117194540	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117194539_117194540insT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117287576	117287583	+	Intron	DEL	CTTCCTTT	-	-	rs11279717		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117287576_117287583delCTTCCTTT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
PNLIPRP2	5408	broad.mit.edu	37	10	118394054	118394055	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118394054_118394055delTC	uc001lcq.2	+						PNLIPRP2_uc009xyu.1_Intron|PNLIPRP2_uc009xyv.1_Intron	NM_005396	NP_005387			pancreatic lipase-related protein 2						galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)														---	---	---	---
HSPA12A	259217	broad.mit.edu	37	10	118461634	118461641	+	Intron	DEL	AGAGAGAG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118461634_118461641delAGAGAGAG	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291			heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120170070	120170072	+	IGR	DEL	TTC	-	-	rs10541510		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120170070_120170072delTTC								C10orf84 (68231 upstream) : PRLHR (182844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120757355	120757356	+	IGR	INS	-	T	T	rs11332445		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120757355_120757356insT								C10orf46 (242597 upstream) : NANOS1 (31872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122114156	122114157	+	IGR	DEL	TT	-	-	rs146890294		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122114156_122114157delTT								SEC23IP (412911 upstream) : PPAPDC1A (102309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122356010	122356011	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122356010_122356011insA								PPAPDC1A (6643 upstream) : WDR11 (254684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122933607	122933607	+	IGR	DEL	C	-	-	rs144709860	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122933607delC								WDR11 (264572 upstream) : FGFR2 (304238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123224531	123224531	+	IGR	DEL	T	-	-	rs75730059		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123224531delT								WDR11 (555496 upstream) : FGFR2 (13314 downstream)																																			---	---	---	---
HTRA1	5654	broad.mit.edu	37	10	124227918	124227919	+	Intron	INS	-	TCA	TCA	rs148200348	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124227918_124227919insTCA	uc001lgj.2	+							NM_002775	NP_002766			HtrA serine peptidase 1 precursor						proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	125297555	125297555	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125297555delG								BUB3 (372669 upstream) : GPR26 (128316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	125406198	125406199	+	IGR	INS	-	A	A	rs145731327	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125406198_125406199insA								BUB3 (481312 upstream) : GPR26 (19672 downstream)																																			---	---	---	---
GPR26	2849	broad.mit.edu	37	10	125438819	125438820	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125438819_125438820delTG	uc001lhh.2	+							NM_153442	NP_703143			G protein-coupled receptor 26						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	125928911	125928911	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125928911delA								CHST15 (75705 upstream) : OAT (156961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	125994519	125994520	+	IGR	INS	-	CAC	CAC	rs145726157	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125994519_125994520insCAC								CHST15 (141313 upstream) : OAT (91352 downstream)																																			---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126287567	126287568	+	Intron	INS	-	CCAT	CCAT	rs142766017	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126287567_126287568insCCAT	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409			phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
FAM53B	9679	broad.mit.edu	37	10	126411107	126411107	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126411107delG	uc001lhv.1	-						FAM53B_uc001lhu.1_Intron|FAM53B_uc001lhw.2_Intron	NM_014661	NP_055476			hypothetical protein LOC9679											ovary(1)|pancreas(1)	2		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)														---	---	---	---
ZRANB1	54764	broad.mit.edu	37	10	126657015	126657016	+	Intron	INS	-	T	T	rs7098050	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126657015_126657016insT	uc001lic.2	+						ZRANB1_uc010qug.1_Intron	NM_017580	NP_060050			zinc finger, RAN-binding domain containing 1						positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)														---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126711047	126711083	+	Intron	DEL	GGGTACAGGTCAATGAGGAAGGAAGGAAGGAACAGCA	-	-	rs57308644		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126711047_126711083delGGGTACAGGTCAATGAGGAAGGAAGGAAGGAACAGCA	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126787292	126787293	+	Intron	DEL	AC	-	-	rs67757105		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126787292_126787293delAC	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129127064	129127064	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129127064delT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129149808	129149820	+	Intron	DEL	CCGGTGAGGATGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129149808_129149820delCCGGTGAGGATGG	uc001ljt.2	+						DOCK1_uc010qun.1_Intron|DOCK1_uc009yaq.2_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	129257193	129257194	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129257193_129257194insC								DOCK1 (6412 upstream) : NPS (90419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	129370917	129370918	+	IGR	INS	-	C	C	rs77008995	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129370917_129370918insC								NPS (19982 upstream) : FOXI2 (164620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130115029	130115032	+	Intron	DEL	GTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130115029_130115032delGTGT	uc001lkg.1	+											Homo sapiens cDNA FLJ42232 fis, clone THYMU3000224.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	131787852	131787855	+	IGR	DEL	ACAC	-	-	rs140846817		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131787852_131787855delACAC								EBF3 (25761 upstream) : GLRX3 (146808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132136955	132136956	+	IGR	INS	-	C	C	rs143007168	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132136955_132136956insC								GLRX3 (154171 upstream) : TCERG1L (753700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132284570	132284570	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132284570delA								GLRX3 (301786 upstream) : TCERG1L (606086 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132589441	132589441	+	IGR	DEL	C	-	-	rs138599321		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132589441delC								GLRX3 (606657 upstream) : TCERG1L (301215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132844543	132844544	+	IGR	INS	-	AC	AC	rs150781444	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132844543_132844544insAC								GLRX3 (861759 upstream) : TCERG1L (46112 downstream)																																			---	---	---	---
TCERG1L	256536	broad.mit.edu	37	10	133089048	133089049	+	Intron	INS	-	CATTG	CATTG	rs151260689	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133089048_133089049insCATTG	uc001lkp.2	-							NM_174937	NP_777597			transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	133563423	133563424	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133563423_133563424delGT								TCERG1L (453439 upstream) : PPP2R2D (184536 downstream)																																			---	---	---	---
JAKMIP3	282973	broad.mit.edu	37	10	133952732	133952733	+	Intron	DEL	GT	-	-	rs67132894		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133952732_133952733delGT	uc001lkx.3	+							NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)														---	---	---	---
STK32C	282974	broad.mit.edu	37	10	134099174	134099175	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134099174_134099175insA	uc001lle.1	-						STK32C_uc001lld.1_Intron|STK32C_uc010quu.1_Intron|STK32C_uc009ybc.1_Intron|STK32C_uc009ybd.1_Intron	NM_173575	NP_775846			serine/threonine kinase 32C								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)														---	---	---	---
PRAP1	118471	broad.mit.edu	37	10	135162644	135162646	+	Intron	DEL	CAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135162644_135162646delCAC	uc001lmp.2	+						PRAP1_uc001lmr.2_Intron|PRAP1_uc001lmq.1_5'Flank	NM_145202	NP_660203			proline-rich acidic protein 1 isoform 1							extracellular region					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	135523865	135523866	+	IGR	DEL	GC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135523865_135523866delGC								LOC653544 (28672 upstream) : None (None downstream)																																			---	---	---	---
SCGB1C1	147199	broad.mit.edu	37	11	191898	191898	+	5'Flank	DEL	A	-	-	rs61495142		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:191898delA	uc001loa.1	+							NM_145651	NP_663626			secretoglobin, family 1C, member 1 precursor							extracellular region	binding			skin(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)														---	---	---	---
PSMD13	5719	broad.mit.edu	37	11	242127	242127	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:242127delC	uc001lol.2	+						PSMD13_uc010qvr.1_Intron|PSMD13_uc001loo.2_Intron|PSMD13_uc001lon.2_Intron|PSMD13_uc001lom.2_Intron	NM_002817	NP_002808			proteasome 26S non-ATPase subunit 13 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding			ovary(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	297599	297600	+	IGR	INS	-	GAGA	GAGA	rs142319755	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:297599_297600insGAGA								ATHL1 (1912 upstream) : IFITM5 (603 downstream)																																			---	---	---	---
CDHR5	53841	broad.mit.edu	37	11	622423	622424	+	Intron	INS	-	TT	TT	rs113267764		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:622423_622424insTT	uc001lqj.2	-						CDHR5_uc001lqk.2_Intron|CDHR5_uc009ycc.2_Intron|CDHR5_uc009ycd.2_Intron|CDHR5_uc001lql.2_Intron|CDHR5_uc001lqm.2_Intron|CDHR5_uc009yce.1_Intron	NM_021924	NP_068743			mucin and cadherin-like isoform 1						calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	643329	643329	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:643329delA								DRD4 (2626 upstream) : DEAF1 (896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	1791818	1791818	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1791818delA								CTSD (6596 upstream) : SYT8 (56891 downstream)																																			---	---	---	---
LOC100133545	100133545	broad.mit.edu	37	11	2009034	2009034	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2009034delC	uc010qxh.1	-							NR_024471				full-length cDNA clone CS0DI005YM03 of Placenta Cot 25-normalized of Homo sapiens (human).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	3203315	3203315	+	IGR	DEL	G	-	-	rs33975256		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3203315delG								OSBPL5 (15346 upstream) : C11orf36 (36247 downstream)																																			---	---	---	---
OR51B5	282763	broad.mit.edu	37	11	5491971	5491971	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5491971delT	uc001maq.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567			olfactory receptor, family 51, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
TRIM22	10346	broad.mit.edu	37	11	5711824	5711826	+	Intron	DEL	AGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5711824_5711826delAGA	uc001mbr.2	+						TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Intron|TRIM22_uc010qzm.1_Intron	NM_006074	NP_006065			tripartite motif-containing 22						immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	6719282	6719283	+	IGR	INS	-	G	G	rs139971238	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6719282_6719283insG								MRPL17 (14650 upstream) : GVIN1 (15100 downstream)																																			---	---	---	---
SBF2	81846	broad.mit.edu	37	11	10037359	10037359	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10037359delT	uc001mib.2	-						SBF2_uc001mif.3_Intron	NM_030962	NP_112224			SET binding factor 2						myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	10401778	10401779	+	Intron	INS	-	T	T	rs138928066	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10401778_10401779insT	uc009yfv.1	+											Homo sapiens EST AI652043 alternate transcript 1 mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	10767198	10767199	+	IGR	INS	-	TGTGTGTG	TGTGTGTG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10767198_10767199insTGTGTGTG								MRVI1 (51663 upstream) : CTR9 (5612 downstream)																																			---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11468893	11468894	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11468893_11468894delTC	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13053429	13053429	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13053429delC								RASSF10 (20782 upstream) : ARNTL (245896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	13125535	13125536	+	IGR	INS	-	AAGA	AAGA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13125535_13125536insAAGA								RASSF10 (92888 upstream) : ARNTL (173789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15396756	15396757	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15396756_15396757insT								INSC (128004 upstream) : SOX6 (591239 downstream)																																			---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16000051	16000052	+	Intron	INS	-	CTAT	CTAT	rs112149194		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16000051_16000052insCTAT	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291			SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16395368	16395399	+	Intron	DEL	AGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16395368_16395399delAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGA	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron|SOX6_uc001mmh.1_Intron|SOX6_uc009ygs.2_Intron|SOX6_uc001mmi.3_Intron|SOX6_uc001mmj.2_Intron	NM_001145819	NP_001139291			SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	16791469	16791470	+	IGR	INS	-	A	A	rs72508119		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16791469_16791470insA								C11orf58 (11568 upstream) : PLEKHA7 (9078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	17047804	17047804	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17047804delT								PLEKHA7 (11841 upstream) : RPS13 (48136 downstream)																																			---	---	---	---
SERGEF	26297	broad.mit.edu	37	11	17953605	17953605	+	Intron	DEL	A	-	-	rs149615217		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17953605delA	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron	NM_012139	NP_036271			deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1																		---	---	---	---
PTPN5	84867	broad.mit.edu	37	11	18816387	18816388	+	5'Flank	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18816387_18816388delGT	uc001mpd.2	-						PTPN5_uc001mpb.2_5'Flank|PTPN5_uc001mpc.2_5'Flank|PTPN5_uc001mpe.2_5'Flank|PTPN5_uc010rdj.1_5'Flank|PTPN5_uc001mpf.2_5'Flank|PTPN5_uc010rdk.1_5'Flank	NM_006906	NP_008837			protein-tyrosine-phosphatase non-receptor 5							integral to membrane	phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	18929598	18929598	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18929598delT								PTPN5 (116209 upstream) : MRGPRX1 (25763 downstream)																																			---	---	---	---
E2F8	79733	broad.mit.edu	37	11	19263371	19263371	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19263371delT	uc001mpm.2	-						E2F8_uc009yhv.2_5'Flank|E2F8_uc001mpn.3_5'Flank|E2F8_uc001mpo.1_5'Flank	NM_024680	NP_078956			E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1																		---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	24634892	24634895	+	Intron	DEL	ACAA	-	-	rs147376980		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24634892_24634895delACAA	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	25222635	25222639	+	IGR	DEL	AAGAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25222635_25222639delAAGAA								LUZP2 (118453 upstream) : ANO3 (988190 downstream)																																			---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26350843	26350846	+	5'Flank	DEL	ACAC	-	-	rs57558741		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26350843_26350846delACAC	uc001mqt.3	+						ANO3_uc010rdr.1_Intron	NM_031418	NP_113606			transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
SLC5A12	159963	broad.mit.edu	37	11	26747702	26747709	+	5'Flank	DEL	TTCTTCCT	-	-	rs4259786		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26747702_26747709delTTCTTCCT	uc001mrb.2	-											Homo sapiens mRNA; cDNA DKFZp564G223 (from clone DKFZp564G223).						sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	26807434	26807437	+	IGR	DEL	CCTT	-	-	rs72011107		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26807434_26807437delCCTT								SLC5A12 (62460 upstream) : FIBIN (208191 downstream)																																			---	---	---	---
BBOX1	8424	broad.mit.edu	37	11	27075737	27075738	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27075737_27075738delTG	uc001mre.1	+						BBOX1_uc009yih.1_Intron|BBOX1_uc001mrg.1_5'Flank	NM_003986	NP_003977			gamma-butyrobetaine dioxygenase						carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	27256168	27256170	+	IGR	DEL	AGC	-	-	rs147629085		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27256168_27256170delAGC								BBOX1 (106814 upstream) : CCDC34 (103891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29641175	29641176	+	IGR	INS	-	T	T	rs143547441	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29641175_29641176insT								None (None upstream) : KCNA4 (390590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30886296	30886297	+	Intron	INS	-	T	T	rs138653747	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30886296_30886297insT	uc001mss.1	-						uc009yjj.1_RNA					Homo sapiens mRNA for KIAA1493 protein, partial cds.																														---	---	---	---
DCDC1	341019	broad.mit.edu	37	11	31176824	31176826	+	Intron	DEL	TCA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31176824_31176826delTCA	uc001msu.1	-											SubName: Full=Putative uncharacterized protein ENSP00000343496;						intracellular signal transduction					skin(1)	1	Lung SC(675;0.225)																	---	---	---	---
EIF3M	10480	broad.mit.edu	37	11	32602836	32602837	+	5'Flank	DEL	TG	-	-	rs72190134		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32602836_32602837delTG	uc001mtu.2	+						EIF3M_uc010ref.1_5'Flank	NM_006360	NP_006351			eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)																	---	---	---	---
C11orf41	25758	broad.mit.edu	37	11	33621041	33621042	+	Intron	DEL	AA	-	-	rs138701271		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33621041_33621042delAA	uc001mup.3	+							NM_012194	NP_036326			hypothetical protein LOC25758							integral to membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	35064896	35064897	+	IGR	DEL	GC	-	-	rs72335472		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35064896_35064897delGC								PDHX (47222 upstream) : CD44 (95520 downstream)																																			---	---	---	---
LDLRAD3	143458	broad.mit.edu	37	11	36126756	36126759	+	Intron	DEL	TGTG	-	-	rs148662871		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36126756_36126759delTGTG	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron|LDLRAD3_uc010rfa.1_Intron	NM_174902	NP_777562			low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	37650189	37650190	+	IGR	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37650189_37650190delAA								C11orf74 (953799 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37732850	37732851	+	IGR	INS	-	T	T	rs143298238	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37732850_37732851insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39129460	39129461	+	IGR	INS	-	TTT	TTT	rs35236159		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39129460_39129461insTTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39179985	39179990	+	IGR	DEL	TGTGTT	-	-	rs3979640		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39179985_39179990delTGTGTT								None (None upstream) : LRRC4C (955763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39823872	39823873	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39823872_39823873insA								None (None upstream) : LRRC4C (311880 downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40214868	40214868	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40214868delG	uc001mxa.1	-						LRRC4C_uc001mxc.1_Intron|LRRC4C_uc001mxd.1_Intron|LRRC4C_uc001mxb.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	42571825	42571825	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42571825delT								None (None upstream) : API5 (761680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42961805	42961806	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42961805_42961806insA								None (None upstream) : API5 (371699 downstream)																																			---	---	---	---
TTC17	55761	broad.mit.edu	37	11	43401485	43401486	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43401485_43401486insT	uc001mxi.2	+						TTC17_uc001mxh.2_Intron|TTC17_uc010rfj.1_Intron	NM_018259	NP_060729			tetratricopeptide repeat domain 17								binding			ovary(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	44041841	44041842	+	IGR	INS	-	T	T	rs139108592	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44041841_44041842insT								AG2 (76409 upstream) : ACCSL (27689 downstream)																																			---	---	---	---
PRDM11	56981	broad.mit.edu	37	11	45224295	45224296	+	Intron	DEL	GA	-	-	rs138751225		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45224295_45224296delGA	uc001myo.2	+							NM_020229	NP_064614			PR domain containing 11											upper_aerodigestive_tract(1)	1																		---	---	---	---
CREB3L1	90993	broad.mit.edu	37	11	46316218	46316219	+	Intron	INS	-	G	G	rs144071647	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46316218_46316219insG	uc001ncf.2	+							NM_052854	NP_443086			cAMP responsive element binding protein 3-like						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L1(6)	soft_tissue(6)|ovary(2)	8				GBM - Glioblastoma multiforme(35;0.0285)				T	FUS	myxofibrosarcoma								---	---	---	---
CKAP5	9793	broad.mit.edu	37	11	46820132	46820132	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46820132delA	uc001ndi.1	-						CKAP5_uc009ylg.1_Intron|CKAP5_uc001ndj.1_Intron	NM_001008938	NP_001008938			colonic and hepatic tumor over-expressed protein						cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
LRP4	4038	broad.mit.edu	37	11	46902657	46902658	+	Intron	INS	-	TTAAAT	TTAAAT	rs151207296	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46902657_46902658insTTAAAT	uc001ndn.3	-							NM_002334	NP_002325			low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)														---	---	---	---
CELF1	10658	broad.mit.edu	37	11	47545857	47545857	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47545857delA	uc001nfp.2	-						CELF1_uc001nfn.2_Intron|CELF1_uc001nfo.1_5'Flank|CELF1_uc001nfq.1_Intron	NM_001025596	NP_001020767			CUG triplet repeat, RNA-binding protein 1						embryo development|mRNA splice site selection|regulation of RNA splicing|RNA interference	cytoplasm|nucleus|ribonucleoprotein complex	BRE binding|mRNA binding|nucleotide binding|translation repressor activity, nucleic acid binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
PTPRJ	5795	broad.mit.edu	37	11	48097150	48097151	+	Intron	DEL	TG	-	-	rs1910365	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48097150_48097151delTG	uc001ngp.3	+						PTPRJ_uc001ngo.3_Intron	NM_002843	NP_002834			protein tyrosine phosphatase, receptor type, J						contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	48342432	48342433	+	IGR	INS	-	T	T	rs150320710		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48342432_48342433insT								OR4S1 (13729 upstream) : OR4C3 (4060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48365579	48365579	+	IGR	DEL	G	-	-	rs67239811		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48365579delG								OR4C3 (18099 upstream) : OR4C45 (1323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48384956	48384957	+	IGR	INS	-	C	C	rs150859558	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48384956_48384957insC								OR4C45 (10957 upstream) : OR4A47 (125388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48391286	48391287	+	IGR	INS	-	C	C	rs145762008	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48391286_48391287insC								OR4C45 (17287 upstream) : OR4A47 (119058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48764742	48764742	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48764742delG								OR4A47 (253470 upstream) : FOLH1 (403446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50201542	50201543	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50201542_50201543insT								OR4C12 (197505 upstream) : LOC441601 (37457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50762848	50762849	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50762848_50762849insC								LOC646813 (383045 upstream) : OR4A5 (648599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	55505057	55505058	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55505057_55505058delAC								OR4C6 (70899 upstream) : OR5D13 (35856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	55785500	55785501	+	IGR	DEL	CT	-	-	rs71818800		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55785500_55785501delCT								OR5F1 (23399 upstream) : OR5AS1 (12394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56882265	56882265	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56882265delT								OR5AK2 (124949 upstream) : LRRC55 (66956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	57043008	57043008	+	IGR	DEL	G	-	-	rs11366848		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57043008delG								APLNR (38081 upstream) : TNKS1BP1 (24096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	57390664	57390691	+	IGR	DEL	AGGAAGGAAGGAAGGAAGGAAGGAAGGG	-	-	rs71470280	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57390664_57390691delAGGAAGGAAGGAAGGAAGGAAGGAAGGG								SERPING1 (8338 upstream) : MIR130A (17980 downstream)																																			---	---	---	---
OR9Q1	219956	broad.mit.edu	37	11	57813751	57813752	+	Intron	INS	-	CT	CT	rs148474759	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57813751_57813752insCT	uc001nmj.2	+							NM_001005212	NP_001005212			olfactory receptor, family 9, subfamily Q,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	59305103	59305103	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59305103delA								OR4D9 (21775 upstream) : OSBP (36768 downstream)																																	OREG0020989	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	60810150	60810153	+	IGR	DEL	CTCA	-	-	rs72410937		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60810150_60810153delCTCA								CD6 (22304 upstream) : CD5 (59777 downstream)																																			---	---	---	---
MARK2	2011	broad.mit.edu	37	11	63653011	63653012	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63653011_63653012insA	uc001nxw.2	+						MARK2_uc001nxx.2_Intron|MARK2_uc001nxy.2_Intron|MARK2_uc001nxv.3_Intron|MARK2_uc009yox.2_5'Flank|MARK2_uc001nxz.3_5'Flank	NM_001039469	NP_001034558			MAP/microtubule affinity-regulating kinase 2						cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	65465793	65465794	+	IGR	DEL	AC	-	-	rs4014097		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65465793_65465794delAC								RELA (35350 upstream) : KAT5 (13695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	67280345	67280345	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67280345delA								CDK2AP2 (4230 upstream) : CABP2 (6073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	68009208	68009209	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68009208_68009209insA								SUV420H1 (28140 upstream) : C11orf24 (19596 downstream)																																			---	---	---	---
LRP5	4041	broad.mit.edu	37	11	68172938	68172938	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68172938delA	uc001ont.2	+						LRP5_uc009ysg.2_Intron	NM_002335	NP_002326			low density lipoprotein receptor-related protein						adipose tissue development|bone marrow development|bone morphogenesis|canonical Wnt receptor signaling pathway|cholesterol homeostasis|endocytosis|glucose catabolic process|negative regulation of osteoblast differentiation|negative regulation of protein serine/threonine kinase activity|positive regulation of fat cell differentiation|positive regulation of mesenchymal cell proliferation|positive regulation of mitosis|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of canonical Wnt receptor signaling pathway|retina morphogenesis in camera-type eye|retinal blood vessel morphogenesis|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	endoplasmic reticulum|integral to membrane|plasma membrane|receptor complex	protein binding|receptor activity			lung(2)|skin(2)|ovary(1)|pancreas(1)|breast(1)	7																		---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68257019	68257020	+	Intron	DEL	TT	-	-	rs60973933		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68257019_68257020delTT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	68771768	68771768	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68771768delG								MRGPRD (23313 upstream) : MRGPRF (95 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69239872	69239874	+	5'Flank	DEL	AGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69239872_69239874delAGA	uc001ooz.1	+											Homo sapiens cDNA FLJ37355 fis, clone BRAMY2022980.																														---	---	---	---
PPFIA1	8500	broad.mit.edu	37	11	70217445	70217445	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70217445delG	uc001opo.2	+						PPFIA1_uc001opn.1_Intron|PPFIA1_uc001opp.2_Intron|PPFIA1_uc001opr.2_Intron|PPFIA1_uc001ops.2_5'UTR	NM_003626	NP_003617			PTPRF interacting protein alpha 1 isoform b						cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70445967	70445970	+	Intron	DEL	AAAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70445967_70445970delAAAA	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70469427	70469428	+	Intron	INS	-	GCT	GCT	rs142386950	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70469427_70469428insGCT	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70780351	70780352	+	Intron	INS	-	A	A	rs34233262		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70780351_70780352insA	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	71959036	71959037	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71959036_71959037insT								PHOX2A (3816 upstream) : CLPB (44435 downstream)																																			---	---	---	---
FCHSD2	9873	broad.mit.edu	37	11	72762914	72762917	+	Intron	DEL	ACAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72762914_72762917delACAC	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639			FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)															---	---	---	---
RAB6A	5870	broad.mit.edu	37	11	73409894	73409895	+	Intron	INS	-	T	T	rs66804907		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73409894_73409895insT	uc001oue.2	-						RAB6A_uc001ouf.2_Intron|RAB6A_uc009yts.2_Intron	NM_002869	NP_002860			RAB6A, member RAS oncogene family isoform a						minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0																		---	---	---	---
DNAJB13	374407	broad.mit.edu	37	11	73680791	73680794	+	Intron	DEL	AAAC	-	-	rs34820619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73680791_73680794delAAAC	uc001ouo.2	+							NM_153614	NP_705842			testis spermatogenesis apoptosis-related protein						apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)																	---	---	---	---
PGM2L1	283209	broad.mit.edu	37	11	74046172	74046172	+	3'UTR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74046172delT	uc001ovb.1	-	14						NM_173582	NP_775853			phosphoglucomutase 2-like 1						glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)																	---	---	---	---
PGM2L1	283209	broad.mit.edu	37	11	74103513	74103514	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74103513_74103514insA	uc001ovb.1	-							NM_173582	NP_775853			phosphoglucomutase 2-like 1						glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)																	---	---	---	---
LIPT2	387787	broad.mit.edu	37	11	74205677	74205677	+	5'Flank	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74205677delA	uc010rrk.1	-						uc001ove.2_Intron	NM_001144869	NP_001138341			lipoyl(octanoyl) transferase precursor						lipoate biosynthetic process|protein modification process	mitochondrion	ligase activity|lipoyl(octanoyl) transferase activity|octanoyltransferase activity				0																		---	---	---	---
POLD3	10714	broad.mit.edu	37	11	74303135	74303135	+	5'Flank	DEL	A	-	-	rs75149308		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74303135delA	uc001ovf.1	+						POLD3_uc009yua.1_5'Flank	NM_006591	NP_006582			DNA-directed DNA polymerase delta 3						base-excision repair|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|mismatch repair|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm	DNA-directed DNA polymerase activity|protein binding			kidney(2)|ovary(1)	3	Breast(11;3.21e-06)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	74719603	74719603	+	5'Flank	DEL	T	-	-	rs5792678		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74719603delT	uc010rrm.1	+						uc001ovx.1_5'Flank|uc010rrn.1_5'Flank|uc001ovz.1_5'Flank					DQ588214																														---	---	---	---
AQP11	282679	broad.mit.edu	37	11	77317569	77317570	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77317569_77317570insA	uc001oyj.2	+						AQP11_uc009yuu.2_Intron	NM_173039	NP_766627			aquaporin 11							cell surface|integral to membrane	transporter activity				0	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	79949011	79949014	+	IGR	DEL	TGTG	-	-	rs12287446		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79949011_79949014delTGTG								ODZ4 (797316 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80218196	80218196	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80218196delC								None (None upstream) : None (None downstream)																																			---	---	---	---
RAB30	27314	broad.mit.edu	37	11	82703778	82703779	+	Intron	INS	-	AC	AC	rs141714457	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82703778_82703779insAC	uc001ozu.2	-						RAB30_uc009yve.2_Intron|RAB30_uc010rst.1_Intron|RAB30_uc001ozv.2_Intron|RAB30_uc009yvg.1_Intron	NM_014488	NP_055303			RAB30, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83880138	83880138	+	Intron	DEL	A	-	-	rs148142171		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83880138delA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
EED	8726	broad.mit.edu	37	11	85970434	85970435	+	Intron	INS	-	G	G	rs146263938	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85970434_85970435insG	uc001pbp.2	+						EED_uc010rtm.1_Intron|EED_uc001pbq.2_Intron|EED_uc001pbr.2_Intron|EED_uc001pbs.2_Intron|EED_uc010rtn.1_Intron	NM_003797	NP_003788			embryonic ectoderm development isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|identical protein binding			skin(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	87912523	87912523	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87912523delC								RAB38 (3924 upstream) : CTSC (114238 downstream)																																			---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89106467	89106467	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89106467delC	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627			NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	89373669	89373669	+	IGR	DEL	T	-	-	rs144541989		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89373669delT								NOX4 (50890 upstream) : FOLH1B (18796 downstream)																																			---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92232901	92232902	+	Intron	INS	-	TA	TA	rs140032581		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92232901_92232902insTA	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
Unknown	0	broad.mit.edu	37	11	93682884	93682884	+	IGR	DEL	T	-	-	rs112745460		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93682884delT								C11orf90 (99216 upstream) : HEPHL1 (71494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95180400	95180401	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95180400_95180401insG								SESN3 (214695 upstream) : FAM76B (321705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95435986	95435987	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95435986_95435987delAC								SESN3 (470281 upstream) : FAM76B (66119 downstream)																																			---	---	---	---
MAML2	84441	broad.mit.edu	37	11	95833478	95833480	+	Intron	DEL	TTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95833478_95833480delTTT	uc001pfw.1	-							NM_032427	NP_115803			mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)						T	MECT1|CRTC3	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	11	96685311	96685311	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96685311delA								JRKL (558584 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96715143	96715144	+	IGR	INS	-	TCTG	TCTG	rs11218642		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96715143_96715144insTCTG								JRKL (588416 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96855465	96855466	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96855465_96855466insT								JRKL (728738 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97062626	97062629	+	IGR	DEL	TGAA	-	-	rs149560746		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97062626_97062629delTGAA								JRKL (935899 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97556001	97556002	+	IGR	INS	-	GCTGCT	GCTGCT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97556001_97556002insGCTGCT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97993981	97993982	+	IGR	INS	-	T	T	rs36115164		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97993981_97993982insT								None (None upstream) : CNTN5 (897889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98190539	98190540	+	IGR	INS	-	A	A	rs148007935	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98190539_98190540insA								None (None upstream) : CNTN5 (701331 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99839867	99839868	+	Intron	INS	-	T	T	rs150534280	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99839867_99839868insT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	101216065	101216074	+	IGR	DEL	TGTGTGTGTA	-	-	rs60859259		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101216065_101216074delTGTGTGTGTA								PGR (215521 upstream) : TRPC6 (106222 downstream)																																			---	---	---	---
C11orf70	85016	broad.mit.edu	37	11	101933858	101933859	+	Intron	INS	-	C	C	rs149045964	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101933858_101933859insC	uc001pgp.2	+						C11orf70_uc001pgo.2_Intron|C11orf70_uc001pgq.2_Intron	NM_032930	NP_116319			hypothetical protein LOC85016											skin(1)	1	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)														---	---	---	---
DYNC2H1	79659	broad.mit.edu	37	11	103324862	103324862	+	Intron	DEL	T	-	-	rs141303075		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103324862delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932			dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)														---	---	---	---
PDGFD	80310	broad.mit.edu	37	11	103951413	103951413	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103951413delA	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484			platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	104068474	104068474	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104068474delA								PDGFD (33447 upstream) : CASP12 (687968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	104644903	104644904	+	IGR	DEL	AT	-	-	rs111375092		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104644903_104644904delAT								PDGFD (609876 upstream) : CASP12 (111538 downstream)																																			---	---	---	---
AASDHPPT	60496	broad.mit.edu	37	11	105962732	105962732	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105962732delT	uc001pjc.1	+						AASDHPPT_uc010rvn.1_Intron|AASDHPPT_uc001pjd.1_Intron	NM_015423	NP_056238			aminoadipate-semialdehyde						macromolecule biosynthetic process|pantothenate metabolic process	cytosol	holo-[acyl-carrier-protein] synthase activity|magnesium ion binding|protein binding				0		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.78e-05)|Epithelial(105;0.00622)|all cancers(92;0.041)														---	---	---	---
GUCY1A2	2977	broad.mit.edu	37	11	106726203	106726204	+	Intron	INS	-	T	T	rs144026198	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106726203_106726204insT	uc001pjg.1	-						GUCY1A2_uc010rvo.1_Intron|GUCY1A2_uc009yxn.1_Intron	NM_000855	NP_000846			guanylate cyclase 1, soluble, alpha 2						intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)														---	---	---	---
CUL5	8065	broad.mit.edu	37	11	107931209	107931209	+	Intron	DEL	T	-	-	rs79700611		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107931209delT	uc001pjv.2	+						CUL5_uc001pju.2_Intron	NM_003478	NP_003469			Vasopressin-activated calcium-mobilizing						cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)														---	---	---	---
DDX10	1662	broad.mit.edu	37	11	108791532	108791532	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108791532delT	uc001pkm.2	+						DDX10_uc001pkl.1_3'UTR	NM_004398	NP_004389			DEAD (Asp-Glu-Ala-Asp) box polypeptide 10								ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)				T	NUP98	AML*								---	---	---	---
Unknown	0	broad.mit.edu	37	11	109282709	109282710	+	IGR	DEL	GC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109282709_109282710delGC								DDX10 (471063 upstream) : C11orf87 (10165 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	109575307	109575308	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109575307_109575308delAC								C11orf87 (275469 upstream) : ZC3H12C (388618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	109830023	109830024	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109830023_109830024insT								C11orf87 (530185 upstream) : ZC3H12C (133902 downstream)																																			---	---	---	---
ZC3H12C	85463	broad.mit.edu	37	11	109990122	109990122	+	Intron	DEL	T	-	-	rs36041734		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109990122delT	uc009yxw.2	+						ZC3H12C_uc010rwc.1_Intron	NM_033390	NP_203748			zinc finger CCCH-type containing 12C								endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	110768910	110768911	+	IGR	DEL	GT	-	-	rs143952208		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110768910_110768911delGT								ARHGAP20 (184998 upstream) : C11orf53 (357796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	111181902	111181903	+	IGR	INS	-	GT	GT	rs145073421	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111181902_111181903insGT								C11orf93 (2549 upstream) : POU2AF1 (41080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	111186103	111186103	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111186103delA								C11orf93 (6750 upstream) : POU2AF1 (36880 downstream)																																			---	---	---	---
SIK2	23235	broad.mit.edu	37	11	111543301	111543301	+	Intron	DEL	T	-	-	rs78500721		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111543301delT	uc001plt.2	+							NM_015191	NP_056006			SNF1-like kinase 2						intracellular protein kinase cascade|regulation of insulin receptor signaling pathway	Golgi apparatus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	112205955	112205956	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112205955_112205956delGT								PTS (65278 upstream) : NCAM1 (626039 downstream)																																			---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115046096	115046096	+	3'UTR	DEL	A	-	-	rs113164200		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115046096delA	uc001ppi.3	-	10					CADM1_uc001ppf.3_Intron|CADM1_uc001ppk.3_3'UTR|CADM1_uc001ppj.3_3'UTR|CADM1_uc001pph.3_3'UTR	NM_014333	NP_055148			immunoglobulin superfamily, member 4D isoform 1						adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	115454826	115454826	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115454826delA								CADM1 (79585 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116026377	116026391	+	IGR	DEL	GAGGAGGAAGAAGAG	-	-	rs61897722		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116026377_116026391delGAGGAGGAAGAAGAG								CADM1 (651136 upstream) : BUD13 (592497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116068400	116068401	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116068400_116068401insC								CADM1 (693159 upstream) : BUD13 (550487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116085125	116085126	+	IGR	INS	-	CA	CA	rs150010026	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116085125_116085126insCA								CADM1 (709884 upstream) : BUD13 (533762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116110892	116110892	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116110892delG								CADM1 (735651 upstream) : BUD13 (507996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116467652	116467652	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116467652delA								None (None upstream) : BUD13 (151236 downstream)																																			---	---	---	---
PAFAH1B2	5049	broad.mit.edu	37	11	117032228	117032229	+	Intron	INS	-	T	T	rs35812569		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117032228_117032229insT	uc001pqe.1	+						PAFAH1B2_uc009yzk.1_Intron|PAFAH1B2_uc009yzl.1_Intron|PAFAH1B2_uc009yzm.2_Intron|PAFAH1B2_uc009yzn.2_Intron|PAFAH1B2_uc009yzj.1_Intron	NM_002572	NP_002563			platelet-activating factor acetylhydrolase,						lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity			kidney(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;1.68e-05)|Epithelial(105;0.000162)|all cancers(92;0.00111)				T	IGH@	MLCLS								---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117467100	117467101	+	Intron	INS	-	G	G	rs139281477	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117467100_117467101insG	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744			Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
TMPRSS4	56649	broad.mit.edu	37	11	117961536	117961537	+	Intron	INS	-	AC	AC	rs147068000	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117961536_117961537insAC	uc010rxo.1	+						TMPRSS4_uc010rxp.1_Intron|TMPRSS4_uc010rxq.1_Intron|TMPRSS4_uc010rxr.1_Intron|TMPRSS4_uc010rxs.1_Intron|TMPRSS4_uc009yzu.2_Intron	NM_019894	NP_063947			transmembrane protease, serine 4 isoform 1						proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)														---	---	---	---
MCAM	4162	broad.mit.edu	37	11	119180382	119180384	+	3'UTR	DEL	GGA	-	-	rs3833767		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119180382_119180384delGGA	uc001pwf.2	-	16					MCAM_uc001pwg.1_RNA	NM_006500	NP_006491			melanoma cell adhesion molecule						anatomical structure morphogenesis|cell adhesion	integral to membrane|plasma membrane				ovary(2)|breast(1)|central_nervous_system(1)	4		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)														---	---	---	---
PVRL1	5818	broad.mit.edu	37	11	119593118	119593118	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119593118delG	uc001pwv.2	-						PVRL1_uc001pwu.1_Intron|PVRL1_uc001pww.2_Intron	NM_002855	NP_002846			poliovirus receptor-related 1 isoform 1						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	119880424	119880424	+	IGR	DEL	G	-	-	rs66757045		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119880424delG								PVRL1 (280989 upstream) : TRIM29 (101571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	121265168	121265168	+	IGR	DEL	A	-	-	rs113134718		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121265168delA								SC5DL (81051 upstream) : SORL1 (57793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	121898424	121898425	+	IGR	INS	-	A	A	rs140615536	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121898424_121898425insA								SORL1 (393953 upstream) : LOC399959 (61386 downstream)																																			---	---	---	---
ASAM	79827	broad.mit.edu	37	11	123017583	123017583	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123017583delT	uc001pyt.2	-							NM_024769	NP_079045			adipocyte-specific adhesion molecule precursor							integral to membrane|tight junction					0		Breast(109;0.0025)|Lung NSC(97;0.0179)|all_lung(97;0.0182)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.73e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)														---	---	---	---
GRAMD1B	57476	broad.mit.edu	37	11	123455101	123455102	+	Intron	INS	-	G	G	rs140088482	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123455101_123455102insG	uc001pyx.2	+						GRAMD1B_uc001pyw.2_Intron|GRAMD1B_uc010rzw.1_Intron|GRAMD1B_uc010rzx.1_Intron|GRAMD1B_uc009zbe.1_Intron	NM_020716	NP_065767			GRAM domain containing 1B							integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	123832613	123832614	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123832613_123832614insA								OR6T1 (18068 upstream) : OR10S1 (14789 downstream)																																			---	---	---	---
PKNOX2	63876	broad.mit.edu	37	11	125068737	125068737	+	Intron	DEL	C	-	-	rs1975395		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125068737delC	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron	NM_022062	NP_071345			PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	125941986	125941986	+	IGR	DEL	A	-	-	rs142782202		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125941986delA								CDON (8799 upstream) : RPUSD4 (130004 downstream)																																			---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126729962	126729962	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126729962delT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126736485	126736486	+	Intron	INS	-	T	T	rs149141190	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126736485_126736486insT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127429267	127429268	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127429267_127429268insA								KIRREL3 (555912 upstream) : ETS1 (899388 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128689663	128689668	+	IGR	DEL	CACACG	-	-	rs72126306		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128689663_128689668delCACACG								FLI1 (6502 upstream) : KCNJ1 (18247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	129625469	129625469	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129625469delA								BARX2 (303296 upstream) : TMEM45B (60272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130269098	130269098	+	Intron	DEL	T	-	-	rs68037499		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130269098delT	uc010scb.1	+						uc010scc.1_Intron					Homo sapiens cDNA FLJ34521 fis, clone HLUNG2007041.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	130302851	130302860	+	IGR	DEL	AGTCTCCCAA	-	-	rs11276748		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130302851_130302860delAGTCTCCCAA								ADAMTS8 (4312 upstream) : ADAMTS15 (16009 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	131605730	131605731	+	Intron	DEL	GT	-	-	rs143632739	byFrequency	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131605730_131605731delGT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	164639	164639	+	IGR	DEL	T	-	-	rs5795907		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:164639delT								FAM138D (15227 upstream) : IQSEC3 (11564 downstream)																																			---	---	---	---
NINJ2	4815	broad.mit.edu	37	12	697356	697364	+	Intron	DEL	GGGACGGAG	-	-	rs74475206		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:697356_697364delGGGACGGAG	uc001qil.2	-						NINJ2_uc010sdr.1_Intron|NINJ2_uc010sds.1_Intron	NM_016533	NP_057617			ninjurin 2						nervous system development|neuron cell-cell adhesion|tissue regeneration	integral to plasma membrane				ovary(2)	2	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1589868	1589869	+	Intron	INS	-	GAA	GAA	rs111377772		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1589868_1589869insGAA	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc001qje.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
DCP1B	196513	broad.mit.edu	37	12	2079578	2079578	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2079578delA	uc001qjx.1	-						DCP1B_uc010sdy.1_Intron|uc001qjy.2_5'Flank	NM_152640	NP_689853			decapping enzyme Dcp1b						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)															---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2681633	2681634	+	Intron	INS	-	TCC	TCC	rs147107837	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2681633_2681634insTCC	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	2829188	2829189	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2829188_2829189delAC								CACNA1C (22073 upstream) : FKBP4 (74919 downstream)																																			---	---	---	---
KCNA6	3742	broad.mit.edu	37	12	4936324	4936325	+	Intron	INS	-	TCCTTCCC	TCCTTCCC	rs144885294	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4936324_4936325insTCCTTCCC	uc001qng.2	+							NM_002235	NP_002226			potassium voltage-gated channel, shaker-related							voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3															HNSCC(72;0.22)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	5621035	5621035	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5621035delG								NTF3 (16572 upstream) : ANO2 (50782 downstream)																																	OREG0021611	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ANO2	57101	broad.mit.edu	37	12	6032422	6032423	+	Intron	DEL	AT	-	-	rs71064176	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6032422_6032423delAT	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
CHD4	1108	broad.mit.edu	37	12	6706280	6706280	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6706280delA	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron	NM_001273	NP_001264			chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	7860987	7860987	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7860987delT								GDF3 (12627 upstream) : DPPA3 (3102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	7964544	7964544	+	IGR	DEL	A	-	-	rs35540081		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7964544delA								NANOG (15889 upstream) : SLC2A14 (1854 downstream)																																			---	---	---	---
MAGOHB	55110	broad.mit.edu	37	12	10764790	10764794	+	Intron	DEL	ATAAC	-	-	rs145566457		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10764790_10764794delATAAC	uc001qyq.1	-						MAGOHB_uc001qyr.1_Intron	NM_018048	NP_060518			mago-nashi homolog B						mRNA processing|mRNA transport|RNA splicing	nucleus	RNA binding			breast(1)	1																		---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11244918	11244919	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11244918_11244919insG	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron|TAS2R43_uc001qzq.1_5'Flank	NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
ETV6	2120	broad.mit.edu	37	12	11950226	11950226	+	Intron	DEL	C	-	-	rs60795005		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11950226delC	uc001qzz.2	+							NM_001987	NP_001978			ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)						T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								---	---	---	---
ETV6	2120	broad.mit.edu	37	12	12031759	12031759	+	Intron	DEL	G	-	-	rs61921363		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12031759delG	uc001qzz.2	+						ETV6_uc001raa.1_Intron	NM_001987	NP_001978			ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)						T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								---	---	---	---
LRP6	4040	broad.mit.edu	37	12	12317063	12317063	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12317063delA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327			low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	12439399	12439400	+	IGR	INS	-	A	A	rs11419097		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12439399_12439400insA								LRP6 (19588 upstream) : MANSC1 (42818 downstream)																																			---	---	---	---
GRIN2B	2904	broad.mit.edu	37	12	13858019	13858019	+	Intron	DEL	T	-	-	rs34943652		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13858019delT	uc001rbt.2	-							NM_000834	NP_000825			N-methyl-D-aspartate receptor subunit 2B						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
PTPRO	5800	broad.mit.edu	37	12	15666043	15666050	+	Intron	DEL	AAGGAAGG	-	-	rs11056536		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15666043_15666050delAAGGAAGG	uc001rcv.1	+						PTPRO_uc001rcw.1_Intron|PTPRO_uc001rcu.1_Intron	NM_030667	NP_109592			receptor-type protein tyrosine phosphatase O							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)																---	---	---	---
MGST1	4257	broad.mit.edu	37	12	16519556	16519557	+	Intron	DEL	TG	-	-	rs138119758		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16519556_16519557delTG	uc009zih.1	+											Homo sapiens cDNA FLJ76401 complete cds, highly similar to Homo sapiens microsomal glutathione S-transferase 1 (MGST1), transcript variant 1b, mRNA.						protein homotrimerization|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	glutathione transferase activity				0		Hepatocellular(102;0.121)			Glutathione(DB00143)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	16603774	16603777	+	IGR	DEL	GTGT	-	-	rs144362398		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16603774_16603777delGTGT								MGST1 (80432 upstream) : LMO3 (97530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	17376637	17376638	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17376637_17376638delAG								LMO3 (613879 upstream) : RERGL (857166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	18127122	18127124	+	IGR	DEL	AAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18127122_18127124delAAC								None (None upstream) : RERGL (106680 downstream)																																			---	---	---	---
PLCZ1	89869	broad.mit.edu	37	12	18838804	18838805	+	Intron	DEL	AT	-	-	rs67121601		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18838804_18838805delAT	uc010sid.1	-						PLCZ1_uc001rdv.3_Intron|PLCZ1_uc001rdw.3_Intron|PLCZ1_uc001rdu.1_Intron|PLCZ1_uc009zil.1_Intron	NM_033123	NP_149114			phospholipase C, zeta 1						intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)																	---	---	---	---
PLEKHA5	54477	broad.mit.edu	37	12	19376889	19376889	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19376889delA	uc001reb.2	+						PLEKHA5_uc010sie.1_Intron|PLEKHA5_uc001rea.2_Intron|PLEKHA5_uc009zin.2_Intron|PLEKHA5_uc010sif.1_Intron|PLEKHA5_uc010sig.1_Intron	NM_019012	NP_061885			pleckstrin homology domain containing, family A								1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)																	---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24583981	24583982	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24583981_24583982insA	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	25486663	25486664	+	IGR	INS	-	AA	AA	rs34180389		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25486663_25486664insAA								KRAS (82800 upstream) : IFLTD1 (142352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	25495214	25495215	+	IGR	INS	-	CCTT	CCTT	rs143816709	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25495214_25495215insCCTT								KRAS (91351 upstream) : IFLTD1 (133801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	26003625	26003625	+	IGR	DEL	A	-	-	rs35746494		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26003625delA								IFLTD1 (202137 upstream) : RASSF8 (108344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	26023901	26023902	+	IGR	INS	-	AAAT	AAAT	rs117403427	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26023901_26023902insAAAT								IFLTD1 (222413 upstream) : RASSF8 (88067 downstream)																																			---	---	---	---
SSPN	8082	broad.mit.edu	37	12	26377718	26377719	+	Intron	INS	-	A	A	rs141662503	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26377718_26377719insA	uc001rhe.2	+						SSPN_uc001rhd.2_Intron|SSPN_uc009zjf.2_Intron|SSPN_uc001rhf.3_Intron	NM_005086	NP_005077			sarcospan isoform 1						cell adhesion|muscle contraction	cell junction|dystrophin-associated glycoprotein complex|integral to plasma membrane|postsynaptic membrane|sarcolemma|transport vesicle					0	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27009854	27009854	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27009854delG								ITPR2 (23723 upstream) : C12orf11 (48261 downstream)																																			---	---	---	---
PPFIBP1	8496	broad.mit.edu	37	12	27776659	27776660	+	Intron	INS	-	A	A	rs141702499	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27776659_27776660insA	uc001ric.1	+						PPFIBP1_uc001rhy.1_Intron|PPFIBP1_uc001rhz.1_Intron|PPFIBP1_uc010sjr.1_Intron|PPFIBP1_uc001rib.1_Intron|PPFIBP1_uc001ria.2_Intron|PPFIBP1_uc001rid.1_Intron	NM_003622	NP_003613			PTPRF interacting protein binding protein 1						cell adhesion	plasma membrane	protein binding		PPFIBP1/ALK(3)	soft_tissue(3)|kidney(1)|skin(1)	5	Lung SC(9;0.0873)																	---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29902995	29902996	+	Intron	INS	-	AC	AC	rs144508363	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29902995_29902996insAC	uc001rjb.2	-						TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057			transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	30473334	30473334	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30473334delT								TMTC1 (535642 upstream) : IPO8 (308589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31356714	31356714	+	Intron	DEL	A	-	-	rs11306647		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31356714delA	uc010sjy.1	-											RecName: Full=Ovostatin homolog 1; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	31370163	31370164	+	IGR	INS	-	G	G	rs145605585	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31370163_31370164insG								DDX11 (112438 upstream) : FAM60A (63363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31929904	31929905	+	IGR	INS	-	T	T	rs146368878		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31929904_31929905insT								AMN1 (47796 upstream) : H3F3C (14216 downstream)																																			---	---	---	---
BICD1	636	broad.mit.edu	37	12	32301954	32301955	+	Intron	INS	-	AA	AA	rs139840951		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32301954_32301955insAA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705			bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	33102767	33102767	+	IGR	DEL	T	-	-	rs68044575		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33102767delT								PKP2 (52987 upstream) : SYT10 (425581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33452396	33452397	+	IGR	INS	-	AAGG	AAGG	rs143444187	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33452396_33452397insAAGG								PKP2 (402616 upstream) : SYT10 (75951 downstream)																																			---	---	---	---
SLC2A13	114134	broad.mit.edu	37	12	40435763	40435763	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40435763delC	uc010skm.1	-						SLC2A13_uc001rmf.2_Intron	NM_052885	NP_443117			solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)													HNSCC(50;0.14)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	40842476	40842477	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40842476_40842477insC								LRRK2 (79392 upstream) : CNTN1 (243881 downstream)																																			---	---	---	---
CNTN1	1272	broad.mit.edu	37	12	41246333	41246334	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41246333_41246334insT	uc001rmm.1	+						CNTN1_uc009zjy.1_Intron|CNTN1_uc001rmn.1_Intron|CNTN1_uc001rmo.2_Intron	NM_001843	NP_001834			contactin 1 isoform 1 precursor						axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	42422324	42422325	+	IGR	DEL	CT	-	-	rs146696069		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42422324_42422325delCT								PDZRN4 (453940 upstream) : GXYLT1 (53325 downstream)																																			---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42797502	42797502	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42797502delT	uc001rng.1	+						PPHLN1_uc001rmy.2_Intron|PPHLN1_uc001rne.2_Intron|PPHLN1_uc001rnb.2_Intron|PPHLN1_uc001rnd.2_Intron|PPHLN1_uc001rnc.2_Intron|PPHLN1_uc001rnf.2_Intron|PPHLN1_uc010skq.1_Intron|PPHLN1_uc010skr.1_Intron|PPHLN1_uc010sks.1_Intron|PPHLN1_uc010skt.1_Intron|PPHLN1_uc001rni.1_Intron|PPHLN1_uc001rnh.1_Intron|PPHLN1_uc010sku.1_Intron	NM_016488	NP_057572			periphilin 1 isoform 1						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	43064526	43064527	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43064526_43064527insA								PRICKLE1 (80954 upstream) : ADAMTS20 (683486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43747885	43747886	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43747885_43747886insA								PRICKLE1 (764313 upstream) : ADAMTS20 (127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	44835700	44835701	+	IGR	INS	-	T	T	rs4142768		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44835700_44835701insT								TMEM117 (52160 upstream) : NELL2 (66357 downstream)																																			---	---	---	---
NELL2	4753	broad.mit.edu	37	12	45248582	45248582	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45248582delA	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron|NELL2_uc001roj.2_Intron	NM_001145108	NP_001138580			NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)														---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46288287	46288287	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46288287delT	uc001ros.1	+						ARID2_uc009zkg.1_Intron|ARID2_uc009zkh.1_Intron|ARID2_uc001rou.1_Intron	NM_152641	NP_689854			AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)														---	---	---	---
SENP1	29843	broad.mit.edu	37	12	48438624	48438625	+	3'UTR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48438624_48438625delTG	uc001rqx.2	-	18					SENP1_uc001rqw.2_3'UTR|SENP1_uc001rqy.2_3'UTR|SENP1_uc001rqz.2_3'UTR|SENP1_uc009zkx.2_3'UTR	NM_014554	NP_055369			sentrin/SUMO-specific protease 1						activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	48840997	48840998	+	IGR	INS	-	TGTGTA	TGTGTA	rs71998992		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48840997_48840998insTGTGTA								ZNF641 (95976 upstream) : ANP32D (25450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	49042384	49042385	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49042384_49042385insA								LALBA (78555 upstream) : C12orf41 (4610 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	49145849	49145850	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49145849_49145850insA	uc010slv.1	+						uc001rsg.3_Intron					Homo sapiens cDNA FLJ27495 fis, clone TST03995.																														---	---	---	---
TUBA1B	10376	broad.mit.edu	37	12	49530132	49530135	+	Intron	DEL	TGTG	-	-	rs142693533		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49530132_49530135delTGTG	uc001rto.2	-							NM_006082	NP_006073			tubulin, alpha, ubiquitous						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0																		---	---	---	---
TUBA1B	10376	broad.mit.edu	37	12	49549715	49549715	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49549715delA	uc001rto.2	-							NM_006082	NP_006073			tubulin, alpha, ubiquitous						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0																		---	---	---	---
SPATS2	65244	broad.mit.edu	37	12	49816193	49816193	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49816193delT	uc001rud.2	+						SPATS2_uc001ruc.2_Intron|SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron	NM_023071	NP_075559			spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1																		---	---	---	---
SPATS2	65244	broad.mit.edu	37	12	49904046	49904046	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49904046delA	uc001rud.2	+						SPATS2_uc001rue.2_Intron|SPATS2_uc009zli.1_Intron|SPATS2_uc001ruf.2_Intron|SPATS2_uc001rug.2_Intron	NM_023071	NP_075559			spermatogenesis associated, serine-rich 2							cytoplasm				breast(1)	1																		---	---	---	---
LOC100286844	100286844	broad.mit.edu	37	12	50225727	50225727	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50225727delT	uc010smm.1	+						LOC100286844_uc001rvg.2_Intron|LOC100286844_uc010smn.1_Intron	NR_027500				Homo sapiens cDNA FLJ30580 fis, clone BRAWH2006996.												0																		---	---	---	---
LASS5	91012	broad.mit.edu	37	12	50529092	50529103	+	Intron	DEL	GTGTGTGTGTGT	-	-	rs71890888		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50529092_50529103delGTGTGTGTGTGT	uc001rwd.3	-						LASS5_uc001rwc.2_Intron|LASS5_uc001rwe.3_Intron|LASS5_uc001rwf.3_Intron|LASS5_uc010smq.1_Intron	NM_147190	NP_671723			LAG1 homolog, ceramide synthase 5						ceramide biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity				0																		---	---	---	---
FAM186A	121006	broad.mit.edu	37	12	50791552	50791571	+	5'Flank	DEL	TTTCTCCTTCCTTCCTTCCT	-	-	rs71083562	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50791552_50791571delTTTCTCCTTCCTTCCTTCCT	uc001rwl.2	-							NM_001145475	NP_001138947			family with sequence similarity 186, member A												0																		---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	51108559	51108560	+	Intron	INS	-	A	A	rs145698488	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51108559_51108560insA	uc001rwv.2	+						DIP2B_uc009zlt.2_Intron	NM_173602	NP_775873			DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6																		---	---	---	---
ATF1	466	broad.mit.edu	37	12	51184760	51184760	+	Intron	DEL	C	-	-	rs34298178		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51184760delC	uc001rww.3	+						ATF1_uc010smu.1_Intron	NM_005171	NP_005162			activating transcription factor 1						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329								T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								---	---	---	---
SLC11A2	4891	broad.mit.edu	37	12	51406139	51406140	+	Intron	INS	-	C	C	rs75403319		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51406139_51406140insC	uc001rxe.3	-						SLC11A2_uc001rxd.3_Intron|SLC11A2_uc001rxc.3_Intron|SLC11A2_uc001rxf.2_Intron|SLC11A2_uc001rxh.1_Intron|SLC11A2_uc001rxj.1_Intron|SLC11A2_uc001rxi.2_Intron|SLC11A2_uc001rxk.1_Intron|SLC11A2_uc010smy.1_Intron	NM_000617	NP_000608			solute carrier family 11 (proton-coupled						activation of caspase activity|cellular iron ion homeostasis|cellular response to oxidative stress|detection of oxygen|ferrous iron import|multicellular organismal iron ion homeostasis|response to hypoxia|response to iron ion	apical plasma membrane|basal part of cell|cell surface|cytoplasmic vesicle|early endosome|late endosome|late endosome membrane|lysosomal membrane|lysosome|nucleus|paraferritin complex|perinuclear region of cytoplasm|perinuclear region of cytoplasm|plasma membrane|recycling endosome|trans-Golgi network	cadmium ion transmembrane transporter activity|cadmium ion transmembrane transporter activity|cobalt ion transmembrane transporter activity|copper ion transmembrane transporter activity|ferrous iron transmembrane transporter activity|ferrous iron transmembrane transporter activity|lead ion transmembrane transporter activity|lead ion transmembrane transporter activity|manganese ion transmembrane transporter activity|manganese ion transmembrane transporter activity|nickel ion transmembrane transporter activity|protein binding|solute:hydrogen symporter activity|vanadium ion transmembrane transporter activity|zinc ion transmembrane transporter activity			large_intestine(1)	1																		---	---	---	---
SMAGP	57228	broad.mit.edu	37	12	51644284	51644285	+	Intron	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51644284_51644285insTT	uc001ryc.1	-						SMAGP_uc001ryd.1_Intron|SMAGP_uc001rye.1_Intron|SMAGP_uc001ryf.1_Intron	NM_001033873	NP_001029045			small trans-membrane and glycosylated protein							cytoplasmic vesicle membrane|integral to membrane|plasma membrane					0																		---	---	---	---
KRT75	9119	broad.mit.edu	37	12	52820368	52820370	+	Intron	DEL	TCA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52820368_52820370delTCA	uc001saj.2	-							NM_004693	NP_004684			keratin 75							keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.192)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	53024012	53024013	+	IGR	INS	-	T	T	rs143463996	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53024012_53024013insT								KRT73 (11669 upstream) : KRT2 (14330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	53523261	53523261	+	IGR	DEL	T	-	-	rs34050049		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53523261delT								SOAT2 (4939 upstream) : CSAD (28187 downstream)																																			---	---	---	---
GTSF1	121355	broad.mit.edu	37	12	54868812	54868813	+	5'Flank	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54868812_54868813insTT	uc001sgb.2	-							NM_144594	NP_653195			gametocyte specific factor 1								metal ion binding				0		Myeloproliferative disorder(1001;0.00452)																---	---	---	---
PTGES3	10728	broad.mit.edu	37	12	57059069	57059071	+	Intron	DEL	TTT	-	-	rs71676923		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57059069_57059071delTTT	uc001slu.3	-						PTGES3_uc001slw.3_Intron|PTGES3_uc010sqs.1_Intron|PTGES3_uc001slv.3_Intron|PTGES3_uc010sqt.1_Intron|PTGES3_uc009zox.2_Intron	NM_006601	NP_006592			prostaglandin-E synthase 3						chaperone cofactor-dependent protein refolding|hormone biosynthetic process|prostaglandin biosynthetic process|signal transduction|telomere maintenance	cytosol|telomerase holoenzyme complex	prostaglandin-E synthase activity|telomerase activity|unfolded protein binding				0																		---	---	---	---
KIF5A	3798	broad.mit.edu	37	12	57962509	57962509	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57962509delA	uc001sor.1	+						KIF5A_uc010srr.1_Intron	NM_004984	NP_004975			kinesin family member 5A						blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58065357	58065358	+	IGR	INS	-	AAAG	AAAG	rs150140755		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58065357_58065358insAAAG								B4GALNT1 (38372 upstream) : OS9 (22528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58303852	58303852	+	IGR	DEL	T	-	-	rs35822671		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58303852delT								CTDSP2 (63105 upstream) : XRCC6BP1 (31593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58542881	58542884	+	IGR	DEL	CCTC	-	-	rs71093952		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58542881_58542884delCCTC								XRCC6BP1 (191830 upstream) : LRIG3 (723054 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62126509	62126510	+	Intron	INS	-	TTTT	TTTT	rs146382537	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62126509_62126510insTTTT	uc001sqw.2	-						FAM19A2_uc001sqv.2_Intron|FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63022370	63022370	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63022370delT								MIRLET7I (24821 upstream) : PPM1H (15393 downstream)																																			---	---	---	---
PPM1H	57460	broad.mit.edu	37	12	63086712	63086713	+	Intron	INS	-	AC	AC	rs142817702	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63086712_63086713insAC	uc001srk.3	-							NM_020700	NP_065751			protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)														---	---	---	---
PPM1H	57460	broad.mit.edu	37	12	63289513	63289516	+	Intron	DEL	ACTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63289513_63289516delACTT	uc001srk.3	-							NM_020700	NP_065751			protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63682451	63682451	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63682451delA								AVPR1A (135861 upstream) : DPY19L2 (270242 downstream)																																			---	---	---	---
C12orf56	115749	broad.mit.edu	37	12	64769558	64769559	+	Intron	INS	-	C	C	rs75885292	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64769558_64769559insC	uc001ssa.3	-						uc001srx.2_Intron	NM_001099676	NP_001093146			hypothetical protein LOC115749												0			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	65527519	65527520	+	IGR	INS	-	GGAA	GGAA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65527519_65527520insGGAA								WIF1 (12403 upstream) : LEMD3 (35851 downstream)																																			---	---	---	---
MSRB3	253827	broad.mit.edu	37	12	65682498	65682498	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65682498delC	uc001ssn.2	+						MSRB3_uc001ssm.2_Intron|MSRB3_uc009zqp.2_Intron	NM_198080	NP_932346			methionine sulfoxide reductase B3 isoform 1						protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)														---	---	---	---
IRAK3	11213	broad.mit.edu	37	12	66598555	66598556	+	Intron	INS	-	GCGCGC	GCGCGC	rs142792546	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66598555_66598556insGCGCGC	uc001sth.2	+						IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130			interleukin-1 receptor-associated kinase 3						interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68926683	68926684	+	IGR	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68926683_68926684insTT								MDM1 (200522 upstream) : RAP1B (77968 downstream)																																			---	---	---	---
YEATS4	8089	broad.mit.edu	37	12	69779071	69779072	+	Intron	INS	-	AGAGT	AGAGT	rs142418628	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69779071_69779072insAGAGT	uc001sux.2	+							NM_006530	NP_006521			glioma-amplified sequence-41						histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	70486734	70486734	+	IGR	DEL	A	-	-	rs76699050		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70486734delA								RAB3IP (269752 upstream) : CNOT2 (150043 downstream)																																			---	---	---	---
CNOT2	4848	broad.mit.edu	37	12	70678025	70678025	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70678025delT	uc001svv.2	+						CNOT2_uc009zro.2_Intron|CNOT2_uc009zrp.2_Intron|CNOT2_uc009zrq.2_Intron	NM_014515	NP_055330			CCR4-NOT transcription complex, subunit 2						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)															---	---	---	---
PTPRR	5801	broad.mit.edu	37	12	71061219	71061219	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71061219delC	uc001swi.1	-						PTPRR_uc001swf.1_5'Flank|PTPRR_uc001swg.1_5'Flank|PTPRR_uc001swh.1_Intron|PTPRR_uc009zrs.2_Intron|PTPRR_uc010stq.1_Intron|PTPRR_uc010str.1_Intron	NM_002849	NP_002840			protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---
PTPRR	5801	broad.mit.edu	37	12	71124583	71124584	+	Intron	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71124583_71124584delGA	uc001swi.1	-						PTPRR_uc001swh.1_Intron|PTPRR_uc009zrs.2_Intron|PTPRR_uc010stq.1_Intron|PTPRR_uc010str.1_Intron	NM_002849	NP_002840			protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---
RAB21	23011	broad.mit.edu	37	12	72156881	72156882	+	Intron	INS	-	CA	CA	rs139592746	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72156881_72156882insCA	uc001swt.2	+							NM_014999	NP_055814			RAB21, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0																		---	---	---	---
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	74505829	74505830	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74505829_74505830delTC								None (None upstream) : ATXN7L3B (425721 downstream)																																			---	---	---	---
PHLDA1	22822	broad.mit.edu	37	12	76426111	76426112	+	5'Flank	DEL	GA	-	-	rs77949675		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76426111_76426112delGA	uc001sxu.2	-							NM_007350	NP_031376			pleckstrin homology-like domain, family A,						apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)																---	---	---	---
ZDHHC17	23390	broad.mit.edu	37	12	77200259	77200259	+	Intron	DEL	A	-	-	rs116530809	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77200259delA	uc001syk.1	+						ZDHHC17_uc001syi.1_Intron|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151			huntingtin interacting protein 14						lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0																		---	---	---	---
CSRP2	1466	broad.mit.edu	37	12	77275355	77275355	+	5'Flank	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77275355delA	uc001syl.1	-							NM_001321	NP_001312			cysteine and glycine-rich protein 2						multicellular organismal development	nucleus	zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	77482613	77482614	+	IGR	INS	-	T	T	rs77414413		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77482613_77482614insT								E2F7 (23253 upstream) : NAV3 (742455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77727595	77727595	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77727595delA								E2F7 (268235 upstream) : NAV3 (497474 downstream)																																			---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78224970	78224975	+	5'Flank	DEL	AGAGAC	-	-	rs72186592	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224970_78224975delAGAGAC	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78571789	78571790	+	Intron	DEL	TT	-	-	rs10605359		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78571789_78571790delTT	uc001syp.2	+						NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	78628801	78628810	+	IGR	DEL	ACACACACAC	-	-	rs72401233		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78628801_78628810delACACACACAC								NAV3 (22013 upstream) : SYT1 (628963 downstream)																																			---	---	---	---
TMTC2	160335	broad.mit.edu	37	12	83415875	83415875	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83415875delA	uc001szt.2	+						TMTC2_uc010suk.1_Intron	NM_152588	NP_689801			transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	85698446	85698447	+	IGR	INS	-	GC	GC	rs145096110	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85698446_85698447insGC								ALX1 (2887 upstream) : RASSF9 (499884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	89495912	89495913	+	IGR	INS	-	GC	GC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89495912_89495913insGC								KITLG (521674 upstream) : DUSP6 (245926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91072865	91072866	+	IGR	INS	-	AA	AA	rs146634153	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91072865_91072866insAA								LOC338758 (967137 upstream) : C12orf12 (273127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	91131393	91131394	+	IGR	INS	-	AC	AC	rs66873417		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91131393_91131394insAC								None (None upstream) : C12orf12 (214599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92045825	92045826	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92045825_92045826insT								DCN (469019 upstream) : BTG1 (333040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92159818	92159821	+	IGR	DEL	ACAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92159818_92159821delACAC								DCN (583012 upstream) : BTG1 (219045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	92690852	92690853	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92690852_92690853insA								BTG1 (151179 upstream) : CLLU1OS (123017 downstream)																																			---	---	---	---
CCDC41	51134	broad.mit.edu	37	12	94704170	94704171	+	Intron	INS	-	C	C	rs146705033	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94704170_94704171insC	uc001tdd.2	-						CCDC41_uc001tde.2_Intron|CCDC41_uc009zsw.1_Intron	NM_016122	NP_057206			NY-REN-58 antigen												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	95972341	95972341	+	IGR	DEL	T	-	-	rs34370024		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95972341delT								USP44 (27078 upstream) : NTN4 (79243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	96558468	96558469	+	IGR	INS	-	AC	AC	rs145814025	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96558468_96558469insAC								LTA4H (121170 upstream) : ELK3 (29738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	96899628	96899629	+	Intron	INS	-	A	A	rs149858113	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96899628_96899629insA	uc009ztl.1	+						uc001teq.2_Intron					RecName: Full=Uncharacterized protein C12orf55;																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	98383444	98383449	+	IGR	DEL	AAGGGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98383444_98383449delAAGGGA								RMST (424651 upstream) : LOC100128191 (523304 downstream)																																			---	---	---	---
UTP20	27340	broad.mit.edu	37	12	101769268	101769277	+	Intron	DEL	GGATCATCTG	-	-	rs71947883		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101769268_101769277delGGATCATCTG	uc001tia.1	+							NM_014503	NP_055318			down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	102348021	102348022	+	IGR	DEL	TT	-	-	rs34104378		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102348021_102348022delTT								DRAM1 (30622 upstream) : CCDC53 (58696 downstream)																																			---	---	---	---
TDG	6996	broad.mit.edu	37	12	104368049	104368050	+	Intron	INS	-	TTG	TTG	rs146026004	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104368049_104368050insTTG	uc001tkg.2	+						TDG_uc010swh.1_Intron|TDG_uc009zuk.2_Intron|TDG_uc010swi.1_Intron	NM_003211	NP_003202			thymine-DNA glycosylase						depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)									BER_DNA_glycosylases					---	---	---	---
HCFC2	29915	broad.mit.edu	37	12	104466426	104466427	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104466426_104466427insT	uc001tkj.3	+						HCFC2_uc009zul.2_Intron	NM_013320	NP_037452			host cell factor C2						regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	106934289	106934289	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106934289delC								POLR3B (30315 upstream) : RFX4 (42744 downstream)																																			---	---	---	---
RFX4	5992	broad.mit.edu	37	12	107104292	107104292	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107104292delA	uc001tlr.2	+						RFX4_uc010swv.1_Intron|RFX4_uc001tls.2_Intron|RFX4_uc001tlt.2_Intron|RFX4_uc001tlv.2_Intron	NM_213594	NP_998759			regulatory factor X4 isoform c						transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	107779810	107779811	+	Intron	INS	-	TT	TT	rs143778312	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107779810_107779811insTT	uc001tmk.1	+						BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Intron	NM_001018072	NP_001018082			BTB (POZ) domain containing 11 isoform a							integral to membrane	DNA binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108205757	108205757	+	IGR	DEL	C	-	-	rs140121085		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108205757delC								ASCL4 (35337 upstream) : WSCD2 (317754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	109130067	109130068	+	IGR	DEL	GA	-	-	rs34151365		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109130067_109130068delGA								CORO1C (4772 upstream) : SSH1 (46399 downstream)																																			---	---	---	---
ACACB	32	broad.mit.edu	37	12	109692587	109692587	+	Intron	DEL	T	-	-	rs111235224		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109692587delT	uc001tob.2	+						ACACB_uc001toc.2_Intron|ACACB_uc010sxl.1_Intron|ACACB_uc001tod.2_Intron|ACACB_uc010sxm.1_Intron	NM_001093	NP_001084			acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	109990421	109990421	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109990421delC								UBE3B (15915 upstream) : MMAB (1102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	110333011	110333011	+	IGR	DEL	T	-	-	rs11068802		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110333011delT								GLTP (14718 upstream) : TCHP (5068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	111258323	111258325	+	IGR	DEL	CTT	-	-	rs11830858		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111258323_111258325delCTT								PPP1CC (77566 upstream) : CCDC63 (26486 downstream)																																			---	---	---	---
NAA25	80018	broad.mit.edu	37	12	112517376	112517376	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112517376delA	uc001ttm.2	-						NAA25_uc001ttn.3_Intron|NAA25_uc009zvz.1_Intron|NAA25_uc009zwa.1_Intron	NM_024953	NP_079229			mitochondrial distribution and morphology 20							cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3																		---	---	---	---
IQCD	115811	broad.mit.edu	37	12	113648784	113648785	+	Intron	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113648784_113648785delAG	uc001tuv.1	-						IQCD_uc001tuu.2_Intron	NM_138451	NP_612460			IQ motif containing D											ovary(1)	1																		---	---	---	---
TPCN1	53373	broad.mit.edu	37	12	113732432	113732432	+	Intron	DEL	A	-	-	rs112069191		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113732432delA	uc001tuw.2	+						TPCN1_uc001tux.2_Intron|TPCN1_uc010syu.1_Intron	NM_017901	NP_060371			two pore segment channel 1 isoform 2							endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3																		---	---	---	---
SLC24A6	80024	broad.mit.edu	37	12	113740815	113740816	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113740815_113740816delCA	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235			solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1																		---	---	---	---
SLC24A6	80024	broad.mit.edu	37	12	113755552	113755555	+	Intron	DEL	TTTG	-	-	rs67889592		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113755552_113755555delTTTG	uc001tvc.2	-						SLC24A6_uc001tuz.2_Intron|SLC24A6_uc001tva.2_Intron|SLC24A6_uc001tvb.2_Intron	NM_024959	NP_079235			solute carrier family 24 member 6 precursor						response to stimulus|sodium ion transport	integral to membrane|plasma membrane	calcium:cation antiporter activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	113933962	113933965	+	IGR	DEL	ATCC	-	-	rs12582919	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113933962_113933965delATCC								LHX5 (24085 upstream) : RBM19 (320578 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	114789801	114789802	+	IGR	INS	-	A	A	rs148135863	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114789801_114789802insA								RBM19 (385625 upstream) : TBX5 (1934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115078285	115078320	+	IGR	DEL	TTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCC	-	-	rs11276105	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115078285_115078320delTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCC								TBX5 (232038 upstream) : TBX3 (29739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115445035	115445036	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115445035_115445036delTC								TBX3 (323066 upstream) : MED13L (951347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116095695	116095697	+	IGR	DEL	CTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116095695_116095697delCTT								TBX3 (973726 upstream) : MED13L (300686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116734012	116734015	+	IGR	DEL	TAAA	-	-	rs71917487		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116734012_116734015delTAAA								MED13L (19021 upstream) : NCRNA00173 (237212 downstream)																																			---	---	---	---
TESC	54997	broad.mit.edu	37	12	117515852	117515852	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117515852delC	uc001twh.2	-						TESC_uc001twi.2_Intron	NM_017899	NP_060369			tescalcin						negative regulation of cell proliferation|positive regulation of megakaryocyte differentiation|positive regulation of transcription, DNA-dependent|regulation of cell adhesion mediated by integrin	cytoplasm|lamellipodium|nucleus|plasma membrane|ruffle	calcium ion binding|magnesium ion binding|phosphatase inhibitor activity|protein binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)														---	---	---	---
NOS1	4842	broad.mit.edu	37	12	117729334	117729335	+	Intron	INS	-	T	T	rs74497091		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117729334_117729335insT	uc001twm.1	-							NM_000620	NP_000611			nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)													---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118015172	118015173	+	Intron	DEL	GG	-	-	rs10560858		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118015172_118015173delGG	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	119122703	119122704	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119122703_119122704delAG								SUDS3 (266864 upstream) : SRRM4 (296692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	119212596	119212597	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119212596_119212597delAG								SUDS3 (356757 upstream) : SRRM4 (206799 downstream)																																			---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119833751	119833752	+	Intron	INS	-	T	T	rs138373482	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119833751_119833752insT	uc001txe.2	+						uc001txf.2_Intron	NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
SPPL3	121665	broad.mit.edu	37	12	121224454	121224454	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121224454delT	uc001tzd.2	-						SPPL3_uc009zwz.2_Intron	NM_139015	NP_620584			signal peptide peptidase 3							integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
CAMKK2	10645	broad.mit.edu	37	12	121700315	121700315	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121700315delA	uc001tzu.2	-						CAMKK2_uc001tzt.2_Intron|CAMKK2_uc001tzv.2_Intron|CAMKK2_uc001tzw.2_Intron|CAMKK2_uc001tzx.2_Intron|CAMKK2_uc001tzy.2_Intron|CAMKK2_uc001tzz.1_5'Flank|CAMKK2_uc001uaa.1_Intron|CAMKK2_uc001uab.2_Intron|CAMKK2_uc001uac.2_Intron	NM_006549	NP_006540			calcium/calmodulin-dependent protein kinase						calcium-mediated signaling|MAPKKK cascade|positive regulation of transcription, DNA-dependent|protein autophosphorylation|regulation of protein kinase activity	cytoplasm	ATP binding|calcium ion binding|calmodulin binding|calmodulin-dependent protein kinase activity|protein tyrosine kinase activity			lung(1)|large_intestine(1)|stomach(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
RNF34	80196	broad.mit.edu	37	12	121844086	121844087	+	Intron	INS	-	GTTGTTGTTGTT	GTTGTTGTTGTT	rs144358195	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121844086_121844087insGTTGTTGTTGTT	uc001ual.1	+						RNF34_uc010szw.1_Intron|RNF34_uc001uak.1_Intron|RNF34_uc001uam.1_Intron	NM_025126	NP_079402			ring finger protein 34 isoform 2						apoptosis	endomembrane system|membrane|nuclear speck	ligase activity|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)														---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	121934008	121934008	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121934008delT	uc001uat.2	-						KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
RILPL1	353116	broad.mit.edu	37	12	124013844	124013845	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124013844_124013845insT	uc001ufe.2	-						RILPL1_uc010tas.1_Intron	NM_178314	NP_847884			Rab interacting lysosomal protein-like 1						neuroprotection	cytosol					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)														---	---	---	---
TCTN2	79867	broad.mit.edu	37	12	124189708	124189709	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124189708_124189709insT	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085			tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124918391	124918392	+	Intron	INS	-	ACACACACAC	ACACACACAC	rs66487303		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124918391_124918392insACACACACAC	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729			nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124923507	124923508	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124923507_124923508delAC	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729			nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	125013031	125013031	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125013031delT	uc010tay.1	-						NCOR2_uc010taz.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron	NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125127879	125127880	+	IGR	DEL	GA	-	-	rs74389917		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125127879_125127880delGA								NCOR2 (75869 upstream) : SCARB1 (134295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	125651620	125651621	+	IGR	INS	-	CA	CA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125651620_125651621insCA								AACS (23748 upstream) : TMEM132B (159541 downstream)																																			---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	126000456	126000457	+	Intron	DEL	AC	-	-	rs141263765		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126000456_126000457delAC	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	127591098	127591099	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127591098_127591099insA								LOC100128554 (633768 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127778404	127778404	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127778404delT								LOC100128554 (821074 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128315412	128315412	+	IGR	DEL	A	-	-	rs34149853		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128315412delA								None (None upstream) : TMEM132C (583879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128769520	128769521	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128769520_128769521insA								None (None upstream) : TMEM132C (129770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129319578	129319579	+	IGR	INS	-	A	A	rs35761578		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129319578_129319579insA								SLC15A4 (11037 upstream) : GLT1D1 (18502 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129529677	129529678	+	IGR	INS	-	A	A	rs141137740	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129529677_129529678insA								GLT1D1 (60168 upstream) : TMEM132D (26593 downstream)																																			---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129618662	129618663	+	Intron	DEL	TG	-	-	rs66926555		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129618662_129618663delTG	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129916824	129916851	+	Intron	DEL	ATGGATGGATGCTTGGATGGATGGATGG	-	-	rs72055314	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129916824_129916851delATGGATGGATGCTTGGATGGATGGATGG	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130020322	130020323	+	Intron	INS	-	GT	GT	rs12319033		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130020322_130020323insGT	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130193177	130193181	+	Intron	DEL	CACAC	-	-	rs66493226		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130193177_130193181delCACAC	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130231722	130231723	+	Intron	INS	-	CTCCTTCTCCCTCCTCCCG	CTCCTTCTCCCTCCTCCCG	rs149346895	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130231722_130231723insCTCCTTCTCCCTCCTCCCG	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	130537146	130537146	+	IGR	DEL	C	-	-	rs63090062		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130537146delC								LOC100190940 (10259 upstream) : FZD10 (109886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	130816531	130816531	+	IGR	DEL	C	-	-	rs11309291		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130816531delC								FZD10 (166247 upstream) : PIWIL1 (6083 downstream)																																			---	---	---	---
RIMBP2	23504	broad.mit.edu	37	12	131068766	131068788	+	Intron	DEL	CACCATCACTTCACCACCACCAT	-	-	rs77249458	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131068766_131068788delCACCATCACTTCACCACCACCAT	uc001uim.2	-											RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---
RIMBP2	23504	broad.mit.edu	37	12	131143612	131143613	+	Intron	INS	-	A	A	rs144426540	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131143612_131143613insA	uc001uim.2	-											RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---
GPR133	283383	broad.mit.edu	37	12	131530780	131530780	+	Intron	DEL	C	-	-	rs72149353		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131530780delC	uc001uit.3	+						GPR133_uc010tbm.1_Intron	NM_198827	NP_942122			G protein-coupled receptor 133 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131792640	131792640	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131792640delC								LOC116437 (95165 upstream) : SFRS8 (402995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131811574	131811577	+	IGR	DEL	GATG	-	-	rs138585031		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131811574_131811577delGATG								LOC116437 (114099 upstream) : SFRS8 (384058 downstream)																																			---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19642227	19642229	+	Intron	DEL	ACC	-	-	rs145783560		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19642227_19642229delACC	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19646404	19646404	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19646404delC	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	19938989	19938989	+	IGR	DEL	T	-	-	rs35354109		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19938989delT								LOC100101938 (19876 upstream) : TPTE2 (58032 downstream)																																			---	---	---	---
CRYL1	51084	broad.mit.edu	37	13	21013654	21013654	+	Intron	DEL	A	-	-	rs67005224		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21013654delA	uc001une.2	-						CRYL1_uc001unf.2_Intron|CRYL1_uc001ung.2_Intron|CRYL1_uc010tcp.1_Intron	NM_015974	NP_057058			lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	21107276	21107277	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21107276_21107277delCA								CRYL1 (7264 upstream) : IFT88 (33931 downstream)																																			---	---	---	---
LATS2	26524	broad.mit.edu	37	13	21580347	21580347	+	Intron	DEL	A	-	-	rs72469781		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21580347delA	uc009zzs.2	-						LATS2_uc001unr.3_Intron	NM_014572	NP_055387			LATS, large tumor suppressor, homolog 2						cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)														---	---	---	---
EFHA1	221154	broad.mit.edu	37	13	22075049	22075049	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22075049delC	uc001uof.2	-						EFHA1_uc010tct.1_Intron	NM_152726	NP_689939			EF-hand domain family, member A1								calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22394603	22394603	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22394603delC								FGF9 (115963 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22762869	22762869	+	Intron	DEL	A	-	-	rs36039678		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22762869delA	uc001uoi.2	+											Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
SGCG	6445	broad.mit.edu	37	13	23853848	23853849	+	Intron	INS	-	CCTT	CCTT	rs146797198	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23853848_23853849insCCTT	uc001uom.2	+						SGCG_uc009zzv.2_Intron|SGCG_uc009zzw.2_Intron	NM_000231	NP_000222			gamma sarcoglycan						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)														---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24686457	24686464	+	Intron	DEL	TGCTACTC	-	-	rs67529288		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24686457_24686464delTGCTACTC	uc001upd.1	+						C1QTNF9_uc001upe.2_Intron	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	24930104	24930105	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24930104_24930105delCA								C1QTNF9 (33439 upstream) : PARP4 (64970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	24951142	24951142	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24951142delA								C1QTNF9 (54477 upstream) : PARP4 (43933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	25235030	25235033	+	IGR	DEL	TCTG	-	-	rs150477021		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25235030_25235033delTCTG								LOC374491 (63220 upstream) : ATP12A (19662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	25712625	25712626	+	IGR	INS	-	AAC	AAC	rs150544971	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25712625_25712626insAAC								PABPC3 (39923 upstream) : FAM123A (30047 downstream)																																			---	---	---	---
CDK8	1024	broad.mit.edu	37	13	26832630	26832631	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26832630_26832631delGT	uc001uqr.1	+						CDK8_uc001uqs.1_Intron|CDK8_uc001uqt.1_Intron	NM_001260	NP_001251			cyclin-dependent kinase 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27394326	27394329	+	IGR	DEL	AGAC	-	-	rs139669005	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27394326_27394329delAGAC								GPR12 (59404 upstream) : USP12 (248109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	27864245	27864246	+	IGR	INS	-	T	T	rs145777484	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27864245_27864246insT								RASL11A (16418 upstream) : GTF3A (134435 downstream)																																			---	---	---	---
POLR1D	51082	broad.mit.edu	37	13	28201322	28201322	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28201322delC	uc001urp.2	+						POLR1D_uc010aam.2_Intron|POLR1D_uc001urq.2_Intron	NM_152705	NP_689918			polymerase (RNA) I polypeptide D isoform 2						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity				0		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0758)|OV - Ovarian serous cystadenocarcinoma(117;0.1)|Epithelial(112;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	28260583	28260592	+	IGR	DEL	TGTGTGTGTG	-	-	rs67497109		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28260583_28260592delTGTGTGTGTG								POLR1D (19036 upstream) : GSX1 (106188 downstream)																																			---	---	---	---
PAN3	255967	broad.mit.edu	37	13	28826012	28826013	+	Intron	INS	-	GTTT	GTTT	rs145196105	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28826012_28826013insGTTT	uc001urz.2	+						PAN3_uc010tdo.1_Intron|PAN3_uc001ury.2_Intron|PAN3_uc001urx.2_Intron	NM_175854	NP_787050			PABP1-dependent poly A-specific ribonuclease						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	29113132	29113132	+	IGR	DEL	A	-	-	rs11314622		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29113132delA								FLT1 (43867 upstream) : POMP (120109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	29432912	29432912	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29432912delA								SLC46A3 (139762 upstream) : MTUS2 (165836 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30231070	30231081	+	IGR	DEL	TCTTTCTTTCTT	-	-	rs66509341	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30231070_30231081delTCTTTCTTTCTT								SLC7A1 (61245 upstream) : UBL3 (107465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30440789	30440790	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30440789_30440790delGA								UBL3 (15969 upstream) : KATNAL1 (335978 downstream)																																			---	---	---	---
KATNAL1	84056	broad.mit.edu	37	13	30780063	30780072	+	3'UTR	DEL	GTGTGTGTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30780063_30780072delGTGTGTGTGT	uc001uss.2	-	11					KATNAL1_uc001ust.2_3'UTR	NM_001014380	NP_001014402			katanin p60 subunit A-like 1							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity				0		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)														---	---	---	---
HMGB1	3146	broad.mit.edu	37	13	31108578	31108578	+	Intron	DEL	T	-	-	rs11350642		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31108578delT	uc001usz.2	-							NM_002128	NP_002119			high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	31591119	31591126	+	IGR	DEL	TTCCTTCT	-	-	rs66956577		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31591119_31591126delTTCCTTCT								C13orf26 (41968 upstream) : HSPH1 (119639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	31710149	31710149	+	IGR	DEL	A	-	-	rs80291606		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31710149delA								C13orf26 (160998 upstream) : HSPH1 (616 downstream)																																			---	---	---	---
EEF1DP3	196549	broad.mit.edu	37	13	32505394	32505394	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32505394delT	uc001utu.2	+						EEF1DP3_uc010tdv.1_Intron					Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA clone IMAGE:5267252).												0																		---	---	---	---
EEF1DP3	196549	broad.mit.edu	37	13	32515437	32515437	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32515437delT	uc001utu.2	+						EEF1DP3_uc010tdv.1_Intron					Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA clone IMAGE:5267252).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	34685392	34685397	+	IGR	DEL	GTGTGC	-	-	rs112230307	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34685392_34685397delGTGTGC								RFC3 (144698 upstream) : NBEA (831059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	45326666	45326667	+	IGR	INS	-	G	G	rs138008203	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45326666_45326667insG								TSC22D1 (175965 upstream) : NUFIP1 (186717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	45401473	45401480	+	IGR	DEL	AAAAATAC	-	-	rs67175566		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45401473_45401480delAAAAATAC								TSC22D1 (250772 upstream) : NUFIP1 (111904 downstream)																																			---	---	---	---
KIAA1704	55425	broad.mit.edu	37	13	45601781	45601782	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45601781_45601782insA	uc001uzq.2	+						KIAA1704_uc001uzr.1_Intron|KIAA1704_uc001uzs.2_Intron|KIAA1704_uc001uzt.2_Intron	NM_018559	NP_061029			hypothetical protein LOC55425											pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)														---	---	---	---
C13orf18	80183	broad.mit.edu	37	13	46959801	46959802	+	Intron	INS	-	A	A	rs142413835		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46959801_46959802insA	uc010acl.2	-						C13orf18_uc001vbf.3_Intron|C13orf18_uc001vbg.3_Intron|C13orf18_uc010tfz.1_Intron|C13orf18_uc010acm.2_Intron|C13orf18_uc010acn.2_Intron|C13orf18_uc001vbe.3_Intron|C13orf18_uc001vbh.3_Intron|C13orf18_uc001vbi.3_Intron	NM_025113	NP_079389			hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)														---	---	---	---
HTR2A	3356	broad.mit.edu	37	13	47413113	47413114	+	Intron	DEL	AC	-	-	rs67738033		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47413113_47413114delAC	uc001vbq.2	-						HTR2A_uc001vbr.2_Intron|HTR2A_uc010acr.2_Intron	NM_000621	NP_000612			5-hydroxytryptamine receptor 2A isoform 1						ERK1 and ERK2 cascade|phosphatidylinositol 3-kinase cascade|phosphatidylinositol biosynthetic process|release of sequestered calcium ion into cytosol|response to drug|synaptic transmission	integral to plasma membrane	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding|drug binding|phosphatidylinositol phospholipase C activity|serotonin binding|serotonin receptor activity			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Aripiprazole(DB01238)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Dihydroergotamine(DB00320)|Donepezil(DB00843)|Epinastine(DB00751)|Ergotamine(DB00696)|Fluvoxamine(DB00176)|Mesoridazine(DB00933)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Thiethylperazine(DB00372)|Thioridazine(DB00679)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	48422115	48422115	+	IGR	DEL	C	-	-	rs35905054		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48422115delC								HTR2A (951065 upstream) : SUCLA2 (94677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48682794	48682795	+	IGR	DEL	TT	-	-	rs142908198		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48682794_48682795delTT								MED4 (13543 upstream) : ITM2B (124479 downstream)																																			---	---	---	---
KPNA3	3839	broad.mit.edu	37	13	50302370	50302371	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50302370_50302371insA	uc001vdj.2	-							NM_002267	NP_002258			karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)														---	---	---	---
SERPINE3	647174	broad.mit.edu	37	13	51914045	51914046	+	5'Flank	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51914045_51914046delAC	uc001vfh.2	+						SERPINE3_uc010tgp.1_5'Flank	NM_001101320	NP_001094790			nexin-related serine protease inhibitor						regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)	2																		---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52565232	52565233	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52565232_52565233insA	uc001vfw.2	-						ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Intron|ATP7B_uc001vfy.2_Intron|ATP7B_uc010tgt.1_Intron|ATP7B_uc010tgu.1_Intron|ATP7B_uc010tgv.1_Intron	NM_000053	NP_000044			ATPase, Cu++ transporting, beta polypeptide						ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
Unknown	0	broad.mit.edu	37	13	53804428	53804429	+	IGR	INS	-	TG	TG	rs34857708		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53804428_53804429insTG								OLFM4 (178242 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57299218	57299218	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57299218delA								None (None upstream) : PRR20C (415834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57791110	57791110	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57791110delA								PRR20B (46758 upstream) : PCDH17 (414679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58156229	58156229	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58156229delT								PRR20B (411877 upstream) : PCDH17 (49560 downstream)																																			---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60386383	60386394	+	Intron	DEL	CATCCATCCATC	-	-	rs392166	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60386383_60386394delCATCCATCCATC	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron	NM_001042517	NP_001035982			diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	62455665	62455666	+	IGR	INS	-	TTTT	TTTT	rs143509228	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62455665_62455666insTTTT								PCDH20 (453586 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63635859	63635859	+	IGR	DEL	T	-	-	rs67758040		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63635859delT								None (None upstream) : OR7E156P (675709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63645545	63645548	+	IGR	DEL	CTCT	-	-	rs63539663		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63645545_63645548delCTCT								None (None upstream) : OR7E156P (666020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64256153	64256154	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64256153_64256154insA								None (None upstream) : OR7E156P (55414 downstream)																																			---	---	---	---
DACH1	1602	broad.mit.edu	37	13	72085512	72085512	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72085512delA	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937			dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	73621379	73621380	+	IGR	INS	-	GT	GT	rs145915877	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73621379_73621380insGT								PIBF1 (30790 upstream) : KLF5 (7734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73949440	73949447	+	IGR	DEL	TAGATAGG	-	-	rs141508910	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73949440_73949447delTAGATAGG								KLF5 (297765 upstream) : KLF12 (310703 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75539451	75539451	+	IGR	DEL	A	-	-	rs36074101		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75539451delA								KLF12 (831057 upstream) : LOC647288 (272439 downstream)																																			---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76246939	76246940	+	Intron	INS	-	GA	GA	rs139482239	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76246939_76246940insGA	uc010thv.1	+						LMO7_uc001vjt.1_Intron	NM_005358	NP_005349			LIM domain only 7 isoform 1							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
LMO7	4008	broad.mit.edu	37	13	76341710	76341711	+	Intron	INS	-	A	A	rs141918513	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76341710_76341711insA	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vju.1_Intron	NM_015842	NP_056667			LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	82974776	82974777	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82974776_82974777delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83390906	83390907	+	IGR	DEL	GA	-	-	rs61961332		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83390906_83390907delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84600769	84600769	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84600769delT								SLITRK1 (144241 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84793238	84793238	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84793238delA								SLITRK1 (336710 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87454896	87454897	+	IGR	INS	-	A	A	rs74586436		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87454896_87454897insA								None (None upstream) : SLITRK5 (869973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90575798	90575799	+	IGR	INS	-	ACACACACAC	ACACACACAC	rs138857287	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90575798_90575799insACACACACAC								None (None upstream) : MIR622 (307637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91641731	91641732	+	IGR	INS	-	A	A	rs145943438	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91641731_91641732insA								LOC144776 (62880 upstream) : MIR17HG (358342 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93222268	93222268	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93222268delC	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94176193	94176193	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94176193delG	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94686441	94686442	+	Intron	INS	-	AGAA	AGAA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94686441_94686442insAGAA	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	95469718	95469733	+	Intron	DEL	TATCTATCTATGTATC	-	-	rs149801002	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95469718_95469733delTATCTATCTATGTATC	uc001vmc.2	+											Homo sapiens, clone IMAGE:5728875, mRNA.																														---	---	---	---
DNAJC3	5611	broad.mit.edu	37	13	96338220	96338221	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96338220_96338221insT	uc001vmq.2	+						DNAJC3_uc001vmp.2_Intron|DNAJC3_uc001vmr.2_Intron	NM_006260	NP_006251			DnaJ (Hsp40) homolog, subfamily C, member 3						protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	98504946	98504947	+	IGR	INS	-	TGGA	TGGA	rs138903199	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98504946_98504947insTGGA								RAP2A (384695 upstream) : IPO5 (100982 downstream)																																			---	---	---	---
STK24	8428	broad.mit.edu	37	13	99144331	99144338	+	Intron	DEL	GTGTGTGT	-	-	rs140520220		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99144331_99144338delGTGTGTGT	uc001vnm.1	-						STK24_uc001vnn.1_Intron|STK24_uc010tim.1_Intron	NM_003576	NP_003567			serine/threonine kinase 24 isoform a						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
CLYBL	171425	broad.mit.edu	37	13	100321260	100321261	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100321260_100321261insT	uc001vok.2	+						CLYBL_uc010tix.1_Intron|CLYBL_uc010tiy.1_Intron	NM_206808	NP_996531			citrate lyase beta like precursor						cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
PCCA	5095	broad.mit.edu	37	13	101004654	101004654	+	Intron	DEL	T	-	-	rs78798166		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101004654delT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron|PCCA_uc001vop.2_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	105128420	105128421	+	IGR	INS	-	A	A	rs149778719	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105128420_105128421insA								None (None upstream) : DAOA (989795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107193141	107193144	+	IGR	DEL	TGGA	-	-	rs146231116	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107193141_107193144delTGGA								EFNB2 (5804 upstream) : ARGLU1 (2520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	108559069	108559070	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108559069_108559070insT								FAM155A (39609 upstream) : LIG4 (300724 downstream)																																			---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109277131	109277132	+	Intron	DEL	GA	-	-	rs140015114		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109277131_109277132delGA	uc001vqt.1	+							NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111008059	111008060	+	Intron	INS	-	G	G	rs140407105		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111008059_111008060insG	uc001vqx.2	+							NM_001846	NP_001837			alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	111696810	111696811	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111696810_111696811delCA								ANKRD10 (129394 upstream) : ARHGEF7 (70813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112094128	112094129	+	IGR	INS	-	A	A	rs35294584		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112094128_112094129insA								C13orf16 (97535 upstream) : SOX1 (627784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112745095	112745098	+	IGR	DEL	GAAA	-	-	rs71823784	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112745095_112745098delGAAA								SOX1 (19075 upstream) : C13orf28 (285571 downstream)																																			---	---	---	---
PROZ	8858	broad.mit.edu	37	13	113816154	113816155	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113816154_113816155insT	uc001vta.1	+						PROZ_uc010agr.1_Intron	NM_003891	NP_003882			protein Z, vitamin K-dependent plasma						blood coagulation|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.216)	all cancers(43;0.104)		Menadione(DB00170)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	115071500	115071501	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115071500_115071501insT								UPF3A (219 upstream) : ZNF828 (8464 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19086379	19086379	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19086379delG								None (None upstream) : OR11H12 (291215 downstream)																																			---	---	---	---
OR4M1	441670	broad.mit.edu	37	14	20246040	20246041	+	5'Flank	INS	-	TG	TG	rs144598174	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20246040_20246041insTG	uc010tku.1	+							NM_001005500	NP_001005500			olfactory receptor, family 4, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	21744292	21744293	+	IGR	INS	-	T	T	rs148655399	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21744292_21744293insT								HNRNPC (6654 upstream) : RPGRIP1 (11843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	22025336	22025337	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22025336_22025337insT								SALL2 (19999 upstream) : OR10G3 (12598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	22536762	22536763	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22536762_22536763delGT	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wcy.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	23323970	23323971	+	IGR	INS	-	A	A	rs72415241		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23323970_23323971insA								MMP14 (7168 upstream) : LRP10 (16989 downstream)																																			---	---	---	---
C14orf93	60686	broad.mit.edu	37	14	23474167	23474170	+	Intron	DEL	ACAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23474167_23474170delACAC	uc001wid.1	-						C14orf93_uc001wig.2_Intron|C14orf93_uc001wih.2_Intron|C14orf93_uc001wie.2_Intron|C14orf93_uc001wia.3_Intron|C14orf93_uc001wif.2_Intron	NM_021944	NP_068763			hypothetical protein LOC60686 precursor							extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	29358021	29358022	+	IGR	DEL	AC	-	-	rs71436370		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29358021_29358022delAC								C14orf23 (94022 upstream) : PRKD1 (687667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	29782648	29782649	+	IGR	INS	-	T	T	rs71436396		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29782648_29782649insT								C14orf23 (518649 upstream) : PRKD1 (263040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	29852061	29852062	+	IGR	DEL	GT	-	-	rs35494615		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29852061_29852062delGT								C14orf23 (588062 upstream) : PRKD1 (193627 downstream)																																			---	---	---	---
SCFD1	23256	broad.mit.edu	37	14	31144860	31144860	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31144860delC	uc001wqm.1	+						SCFD1_uc001wqn.1_Intron|SCFD1_uc010tpg.1_Intron|SCFD1_uc010tph.1_Intron|SCFD1_uc010amf.1_Intron|SCFD1_uc010tpi.1_Intron|SCFD1_uc010amd.1_Intron|SCFD1_uc010ame.1_Intron	NM_016106	NP_057190			vesicle transport-related protein isoform a						post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)														---	---	---	---
NUBPL	80224	broad.mit.edu	37	14	32221070	32221071	+	Intron	INS	-	GG	GG	rs149294141	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32221070_32221071insGG	uc001wrk.3	+						NUBPL_uc010amj.2_Intron|NUBPL_uc010tpl.1_Intron	NM_025152	NP_079428			nucleotide binding protein-like						mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	32890115	32890116	+	Intron	INS	-	TG	TG	rs143889304	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32890115_32890116insTG	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33192762	33192765	+	Intron	DEL	TTTA	-	-	rs2383374		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33192762_33192765delTTTA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33207853	33207853	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33207853delT	uc001wrq.2	+							NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33298732	33298732	+	Intron	DEL	A	-	-	rs143653426		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33298732delA	uc001wrq.2	+							NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	33434018	33434019	+	Intron	INS	-	A	A	rs71432097		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33434018_33434019insA	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34669510	34669513	+	IGR	DEL	GATG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669510_34669513delGATG								EGLN3 (249223 upstream) : C14orf147 (232632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34810105	34810106	+	IGR	INS	-	G	G	rs74330387		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34810105_34810106insG								EGLN3 (389818 upstream) : C14orf147 (92039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	34850152	34850155	+	IGR	DEL	TGTC	-	-	rs72155917		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34850152_34850155delTGTC								EGLN3 (429865 upstream) : C14orf147 (51990 downstream)																																			---	---	---	---
EAPP	55837	broad.mit.edu	37	14	35003340	35003340	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35003340delC	uc001wsd.1	-							NM_018453	NP_060923			E2F-associated phosphoprotein						negative regulation of transcription elongation from RNA polymerase II promoter|positive regulation of cell proliferation|positive regulation of transcription elongation from RNA polymerase II promoter	Golgi apparatus|nucleus|plasma membrane				ovary(1)	1	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)														---	---	---	---
SNX6	58533	broad.mit.edu	37	14	35062611	35062611	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35062611delT	uc001wsf.1	-						SNX6_uc001wse.1_Intron|SNX6_uc010tpm.1_Intron|SNX6_uc010amm.1_Intron	NM_152233	NP_689419			sorting nexin 6 isoform b						cell communication|intracellular protein transport|negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent|negative regulation of transforming growth factor beta receptor signaling pathway|retrograde transport, endosome to Golgi	cytoplasmic vesicle membrane|early endosome membrane|nucleus	phosphatidylinositol binding|protein homodimerization activity				0	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)														---	---	---	---
BRMS1L	84312	broad.mit.edu	37	14	36301127	36301127	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36301127delA	uc001wtl.2	+						BRMS1L_uc010tpx.1_Intron	NM_032352	NP_115728			breast cancer metastasis-suppressor 1-like						regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				skin(1)	1	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	36686394	36686395	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36686394_36686395delCA								BRMS1L (345226 upstream) : MBIP (81369 downstream)																																			---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37284537	37284537	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37284537delA	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
SEC23A	10484	broad.mit.edu	37	14	39558674	39558691	+	Intron	DEL	GCTTCCTGTGCTCCTGAA	-	-	rs147225378		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39558674_39558691delGCTTCCTGTGCTCCTGAA	uc001wup.1	-						SEC23A_uc010tqa.1_Intron|SEC23A_uc010tqb.1_Intron|SEC23A_uc010tqc.1_Intron	NM_006364	NP_006355			SEC23-related protein A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|Golgi membrane|smooth endoplasmic reticulum membrane	protein binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	39841506	39841507	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39841506_39841507insA								CTAGE5 (21111 upstream) : FBXO33 (25371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40091917	40091917	+	IGR	DEL	T	-	-	rs76108767		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40091917delT								FBXO33 (190213 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44018100	44018101	+	IGR	INS	-	AGAG	AGAG	rs140640741	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44018100_44018101insAGAG								None (None upstream) : FSCB (955254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44438956	44438958	+	IGR	DEL	AGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44438956_44438958delAGA								None (None upstream) : FSCB (534397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44667587	44667588	+	IGR	INS	-	TG	TG	rs144509098	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44667587_44667588insTG								None (None upstream) : FSCB (305767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44884583	44884583	+	IGR	DEL	A	-	-	rs71446113		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44884583delA								None (None upstream) : FSCB (88772 downstream)																																			---	---	---	---
FAM179B	23116	broad.mit.edu	37	14	45480989	45480990	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45480989_45480990delTG	uc001wvv.2	+						FAM179B_uc001wvw.2_Intron|FAM179B_uc010anc.2_Intron	NM_015091	NP_055906			hypothetical protein LOC23116								binding			skin(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	49296753	49296756	+	IGR	DEL	GTGT	-	-	rs150986881		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49296753_49296756delGTGT								None (None upstream) : SDCCAG1 (736271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	49748035	49748035	+	IGR	DEL	A	-	-	rs10713270		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49748035delA								None (None upstream) : SDCCAG1 (284992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	50337417	50337417	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50337417delT								SDCCAG1 (17878 upstream) : ARF6 (22319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54259510	54259510	+	IGR	DEL	T	-	-	rs34367859		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54259510delT								DDHD1 (639464 upstream) : BMP4 (156947 downstream)																																			---	---	---	---
FBXO34	55030	broad.mit.edu	37	14	55816879	55816879	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55816879delA	uc001xbu.2	+						FBXO34_uc001xbv.2_5'Flank|FBXO34_uc010aoo.2_Intron	NM_017943	NP_060413			F-box only protein 34											ovary(2)|lung(2)|skin(1)	5																		---	---	---	---
KTN1	3895	broad.mit.edu	37	14	56072978	56072978	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56072978delC	uc001xcb.2	+						KTN1_uc001xce.2_Intron|KTN1_uc001xcc.2_Intron|KTN1_uc001xcd.2_Intron|KTN1_uc010trb.1_Intron	NM_182926	NP_891556			kinectin 1 isoform a						microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7								T	RET	papillary thryoid								---	---	---	---
Unknown	0	broad.mit.edu	37	14	57372114	57372115	+	Intron	INS	-	AAG	AAG	rs71450310		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57372114_57372115insAAG	uc001xcr.1	+											Homo sapiens cDNA clone IMAGE:5492202, partial cds.																														---	---	---	---
SLC38A6	145389	broad.mit.edu	37	14	61533232	61533233	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61533232_61533233insA	uc001xfh.1	+						SLC38A6_uc001xfi.2_Intron|SLC38A6_uc001xfk.2_Intron|SLC38A6_uc010trz.1_Intron	NM_153811	NP_722518			solute carrier family 38, member 6						amino acid transport|sodium ion transport	integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0981)														---	---	---	---
PRKCH	5583	broad.mit.edu	37	14	61986592	61986592	+	Intron	DEL	A	-	-	rs35383143		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61986592delA	uc001xfn.2	+						PRKCH_uc010tsa.1_Intron|PRKCH_uc010tsb.1_Intron	NM_006255	NP_006246			protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	64292996	64292997	+	IGR	INS	-	A	A	rs146850824	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64292996_64292997insA								SGPP1 (98240 upstream) : SYNE2 (26686 downstream)																																			---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64449256	64449256	+	Intron	DEL	G	-	-	rs58023000		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64449256delG	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
MTHFD1	4522	broad.mit.edu	37	14	64874264	64874264	+	Intron	DEL	C	-	-	rs140253775		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64874264delC	uc001xhb.2	+						MTHFD1_uc010aqe.2_Intron|MTHFD1_uc010aqf.2_Intron	NM_005956	NP_005947			methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)													---	---	---	---
MTHFD1	4522	broad.mit.edu	37	14	64922925	64922925	+	Intron	DEL	C	-	-	rs3842326		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64922925delC	uc001xhb.2	+						MTHFD1_uc010aqf.2_Intron|ZBTB25_uc001xhc.2_Intron	NM_005956	NP_005947			methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	65678387	65678388	+	IGR	DEL	GT	-	-	rs59818405		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65678387_65678388delGT								MAX (109160 upstream) : LOC645431 (198925 downstream)																																			---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67144413	67144413	+	Intron	DEL	T	-	-	rs33911475		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67144413delT	uc001xiy.2	+						GPHN_uc001xiw.2_Intron|GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67514051	67514052	+	Intron	INS	-	TG	TG	rs113455063		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67514051_67514052insTG	uc001xiy.2	+						GPHN_uc001xiw.2_Intron|GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron|GPHN_uc010tsu.1_Intron	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67591531	67591532	+	Intron	INS	-	T	T	rs140984622	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67591531_67591532insT	uc001xiy.2	+						GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron|GPHN_uc010tsu.1_Intron	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67599196	67599196	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67599196delT	uc001xiy.2	+						GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron|GPHN_uc010tsu.1_Intron	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
FAM71D	161142	broad.mit.edu	37	14	67692643	67692644	+	Intron	INS	-	GTGT	GTGT	rs149052016	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67692643_67692644insGTGT	uc001xja.1	+						FAM71D_uc010aqn.1_Intron	NM_173526	NP_775797			hypothetical protein LOC161142											ovary(1)	1		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)														---	---	---	---
SIPA1L1	26037	broad.mit.edu	37	14	72095054	72095054	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72095054delC	uc001xms.2	+						SIPA1L1_uc001xmt.2_Intron|SIPA1L1_uc001xmu.2_Intron|SIPA1L1_uc001xmv.2_Intron|SIPA1L1_uc010ttm.1_Intron	NM_015556	NP_056371			signal-induced proliferation-associated 1 like						actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72769390	72769391	+	Intron	DEL	AC	-	-	rs34627833		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72769390_72769391delAC	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74094524	74094524	+	IGR	DEL	T	-	-	rs151224301		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74094524delT								ACOT6 (7934 upstream) : DNAL1 (17054 downstream)																																			---	---	---	---
DNAL1	83544	broad.mit.edu	37	14	74125865	74125867	+	Intron	DEL	TTT	-	-	rs36115036		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74125865_74125867delTTT	uc001xoq.3	+						DNAL1_uc010aru.2_Intron|DNAL1_uc010arv.2_Intron	NM_031427	NP_113615			axonemal dynein light chain 1												0				BRCA - Breast invasive adenocarcinoma(234;0.00384)|KIRC - Kidney renal clear cell carcinoma(182;0.095)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74916313	74916314	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74916313_74916314insA								TMEM90A (23508 upstream) : NPC2 (30330 downstream)																																			---	---	---	---
BATF	10538	broad.mit.edu	37	14	76007999	76008003	+	Intron	DEL	TTTTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76007999_76008003delTTTTG	uc001xrr.2	+							NM_006399	NP_006390			basic leucine zipper transcription factor,							nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.028)														---	---	---	---
C14orf179	112752	broad.mit.edu	37	14	76508450	76508451	+	Intron	INS	-	ACAC	ACAC	rs147000718	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76508450_76508451insACAC	uc010asm.1	+						C14orf179_uc001xsf.2_Intron|C14orf179_uc010asl.1_Intron|C14orf179_uc001xsg.2_Intron|C14orf179_uc010tve.1_Intron|C14orf179_uc001xse.2_Intron	NM_001102564	NP_001096034			hypothetical protein LOC112752 isoform 2						cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)														---	---	---	---
KIAA1737	85457	broad.mit.edu	37	14	77571590	77571591	+	Intron	INS	-	TG	TG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77571590_77571591insTG	uc001xtd.2	+						KIAA1737_uc001xtc.1_Intron	NM_033426	NP_219494			KIAA1737 protein												0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)														---	---	---	---
ISM2	145501	broad.mit.edu	37	14	77949268	77949268	+	Intron	DEL	G	-	-	rs11349402		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77949268delG	uc001xtz.2	-						ISM2_uc001xua.2_Intron|ISM2_uc001xty.2_Intron|ISM2_uc010tvl.1_Intron	NM_199296	NP_954993			isthmin 2 homolog isoform 1							extracellular region				skin(1)	1																		---	---	---	---
SPTLC2	9517	broad.mit.edu	37	14	77997764	77997766	+	Intron	DEL	TTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77997764_77997766delTTC	uc001xub.2	-							NM_004863	NP_004854			serine palmitoyltransferase, long chain base							integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups			upper_aerodigestive_tract(1)|ovary(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	78842363	78842364	+	Intron	DEL	AT	-	-	rs149397071		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78842363_78842364delAT	uc001xum.1	+											Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79694131	79694138	+	Intron	DEL	TCCTCCCT	-	-	rs61995409		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79694131_79694138delTCCTCCCT	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79947479	79947479	+	Intron	DEL	T	-	-	rs34480702		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79947479delT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	80403919	80403920	+	IGR	INS	-	AGAC	AGAC	rs138459072	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80403919_80403920insAGAC								NRXN3 (73161 upstream) : DIO2 (259950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	80730107	80730108	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80730107_80730108delAC	uc001xuw.1	+											Homo sapiens, clone IMAGE:5167652, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	80824770	80824771	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80824770_80824771insA	uc001xuw.1	+											Homo sapiens, clone IMAGE:5167652, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	83567074	83567077	+	IGR	DEL	TCTA	-	-	rs3045971		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83567074_83567077delTCTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	83722481	83722482	+	IGR	INS	-	AACAACAAC	AACAACAAC	rs145280102	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83722481_83722482insAACAACAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
FLRT2	23768	broad.mit.edu	37	14	86053631	86053632	+	Intron	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86053631_86053632insAA	uc001xvr.2	+						FLRT2_uc010atd.2_Intron	NM_013231	NP_037363			fibronectin leucine rich transmembrane protein 2						cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	86659741	86659742	+	IGR	INS	-	ACAC	ACAC	rs138978389	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86659741_86659742insACAC								FLRT2 (565472 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87093654	87093655	+	IGR	INS	-	ACCATT	ACCATT	rs142235085	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87093654_87093655insACCATT								FLRT2 (999385 upstream) : None (None downstream)																																			---	---	---	---
KCNK10	54207	broad.mit.edu	37	14	88647733	88647734	+	3'UTR	INS	-	GT	GT	rs140942030	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88647733_88647734insGT	uc001xwo.2	-	7					KCNK10_uc001xwm.2_3'UTR|KCNK10_uc001xwn.2_3'UTR	NM_021161	NP_066984			potassium channel, subfamily K, member 10						signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	90688684	90688685	+	IGR	INS	-	A	A	rs144411645	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90688684_90688685insA								KCNK13 (36489 upstream) : PSMC1 (34209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90838759	90838759	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90838759delT								C14orf102 (40480 upstream) : CALM1 (24614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90853130	90853130	+	IGR	DEL	G	-	-	rs34595809		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90853130delG								C14orf102 (54851 upstream) : CALM1 (10243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90897065	90897066	+	IGR	DEL	GG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90897065_90897066delGG								CALM1 (22455 upstream) : TTC7B (109867 downstream)																																			---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92324310	92324313	+	Intron	DEL	TTTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92324310_92324313delTTTG	uc001xzv.3	-							NM_001128596	NP_001122068			tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
TRIP11	9321	broad.mit.edu	37	14	92487750	92487750	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92487750delG	uc001xzy.2	-							NM_004239	NP_004230			thyroid hormone receptor interactor 11						transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)				T	PDGFRB	AML								---	---	---	---
SLC24A4	123041	broad.mit.edu	37	14	92881407	92881408	+	Intron	INS	-	CGA	CGA	rs139511113	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92881407_92881408insCGA	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932			solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)														---	---	---	---
ITPK1	3705	broad.mit.edu	37	14	93509359	93509360	+	Intron	INS	-	A	A	rs146222393	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93509359_93509360insA	uc001ybg.2	-						ITPK1_uc001ybe.2_Intron|ITPK1_uc001ybf.2_Intron|ITPK1_uc001ybh.2_Intron	NM_014216	NP_055031			inositol 1,3,4-triphosphate 5/6 kinase isoform						blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	94324673	94324674	+	IGR	DEL	TG	-	-	rs34655202		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94324673_94324674delTG								PRIMA1 (69907 upstream) : C14orf86 (46402 downstream)																																			---	---	---	---
ASB2	51676	broad.mit.edu	37	14	94422868	94422869	+	Intron	INS	-	G	G	rs148782507	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94422868_94422869insG	uc001ycc.1	-						ASB2_uc001ycd.2_Intron|ASB2_uc001yce.1_5'Flank	NM_016150	NP_057234			ankyrin repeat and SOCS box-containing protein						intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	96661176	96661176	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96661176delA								C14orf132 (101043 upstream) : BDKRB2 (9959 downstream)																																			---	---	---	---
BDKRB2	624	broad.mit.edu	37	14	96679833	96679842	+	Intron	DEL	ACACACACAC	-	-	rs66460667		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96679833_96679842delACACACACAC	uc010avm.1	+						BDKRB2_uc010avl.1_Intron|BDKRB2_uc010twu.1_Intron|BDKRB2_uc001yfg.2_Intron	NM_000623	NP_000614			bradykinin receptor B2						arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97036715	97036716	+	IGR	INS	-	TA	TA	rs140710594	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97036715_97036716insTA								PAPOLA (3269 upstream) : VRK1 (226968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99025097	99025098	+	IGR	INS	-	T	T	rs148774842	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99025097_99025098insT								C14orf64 (580636 upstream) : C14orf177 (152852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99429704	99429706	+	IGR	DEL	GAG	-	-	rs2933338	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99429704_99429706delGAG								C14orf177 (245607 upstream) : BCL11B (205921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99570886	99570895	+	IGR	DEL	TGATGGGAGT	-	-	rs111831164		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99570886_99570895delTGATGGGAGT								C14orf177 (386789 upstream) : BCL11B (64732 downstream)																																			---	---	---	---
WARS	7453	broad.mit.edu	37	14	100805462	100805463	+	Intron	DEL	AC	-	-	rs148214214		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100805462_100805463delAC	uc001yhf.1	-						WARS_uc001yhe.1_Intron|WARS_uc001yhg.1_Intron|WARS_uc001yhh.1_Intron|WARS_uc001yhi.1_Intron|WARS_uc001yhj.1_Intron|WARS_uc001yhk.1_Intron|WARS_uc001yhl.1_Intron	NM_173701	NP_776049			tryptophanyl-tRNA synthetase isoform a						angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	101343383	101343384	+	IGR	INS	-	TCC	TCC	rs147955027	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101343383_101343384insTCC								MIR665 (1942 upstream) : RTL1 (3608 downstream)																																			---	---	---	---
DYNC1H1	1778	broad.mit.edu	37	14	102475843	102475843	+	Intron	DEL	T	-	-	rs34292577		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102475843delT	uc001yks.2	+							NM_001376	NP_001367			cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10																		---	---	---	---
ZNF839	55778	broad.mit.edu	37	14	102782904	102782905	+	5'Flank	INS	-	GT	GT	rs144408761	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102782904_102782905insGT	uc001ylo.2	+							NM_018335	NP_060805			zinc finger protein 839							intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	103551053	103551054	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103551053_103551054delTC								CDC42BPB (27311 upstream) : C14orf73 (15427 downstream)																																			---	---	---	---
PPP1R13B	23368	broad.mit.edu	37	14	104300919	104300923	+	Intron	DEL	TTTTT	-	-	rs12881563		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104300919_104300923delTTTTT	uc001yof.1	-						PPP1R13B_uc001yog.1_Intron	NM_015316	NP_056131			apoptosis-stimulating protein of p53, 1						apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)																---	---	---	---
KIF26A	26153	broad.mit.edu	37	14	104632515	104632516	+	Intron	INS	-	CAGGGGCCA	CAGGGGCCA	rs11281316		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104632515_104632516insCAGGGGCCA	uc001yos.3	+							NM_015656	NP_056471			kinesin family member 26A						blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	104993519	104993520	+	IGR	INS	-	AC	AC	rs142807611	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104993519_104993520insAC								KIF26A (346285 upstream) : C14orf180 (52536 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106574979	106574979	+	RNA	DEL	C	-	-	rs35144709		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106574979delC	uc010tyt.1	-	1353		c.28857delG								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20318583	20318583	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20318583delA								None (None upstream) : GOLGA6L6 (418511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20467498	20467498	+	IGR	DEL	G	-	-	rs7168907		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20467498delG								None (None upstream) : GOLGA6L6 (269596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20631617	20631618	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20631617_20631618insT	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22100340	22100340	+	IGR	DEL	T	-	-	rs138282930		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22100340delT								CXADRP2 (83462 upstream) : LOC727924 (177692 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22305874	22305875	+	Intron	DEL	CT	-	-	rs145001744		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22305874_22305875delCT	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22333592	22333594	+	Intron	DEL	ATG	-	-	rs111877525		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22333592_22333594delATG	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22373440	22373441	+	Intron	INS	-	TTTC	TTTC	rs142435459	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22373440_22373441insTTTC	uc001yuc.1	+						LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22448021	22448022	+	IGR	INS	-	GCG	GCG	rs138115341	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22448021_22448022insGCG								OR4N3P (33636 upstream) : MIR1268 (65207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22538094	22538095	+	IGR	INS	-	C	C	rs7183041		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22538094_22538095insC								MIR1268 (24814 upstream) : GOLGA8DP (164190 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22559728	22559728	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22559728delA								MIR1268 (46448 upstream) : GOLGA8DP (142557 downstream)																																			---	---	---	---
NIPA2	81614	broad.mit.edu	37	15	23023491	23023491	+	Intron	DEL	A	-	-	rs79654821		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23023491delA	uc001yux.2	-						NIPA2_uc001yuy.2_Intron|NIPA2_uc001yuz.2_Intron|NIPA2_uc001yva.2_Intron|NIPA2_uc001yvb.2_Intron|NIPA2_uc010ayb.2_Intron	NM_030922	NP_112184			non imprinted in Prader-Willi/Angelman syndrome							early endosome|integral to membrane|plasma membrane				haematopoietic_and_lymphoid_tissue(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	24331982	24331983	+	IGR	INS	-	A	A	rs141285446	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24331982_24331983insA								NDN (399532 upstream) : PWRN2 (77943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	26654871	26654871	+	IGR	DEL	A	-	-	rs113031284		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26654871delA								ATP10A (544554 upstream) : GABRB3 (133824 downstream)																																			---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28309504	28309505	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28309504_28309505delTC	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266			oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
FAM189A1	23359	broad.mit.edu	37	15	29582037	29582038	+	Intron	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29582037_29582038delGA	uc010azk.1	-							NM_015307	NP_056122			hypothetical protein LOC23359							integral to membrane					0																		---	---	---	---
TJP1	7082	broad.mit.edu	37	15	30042212	30042213	+	Intron	INS	-	T	T	rs76041825		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30042212_30042213insT	uc001zcr.2	-						TJP1_uc010azl.2_Intron|TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248			tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)														---	---	---	---
TJP1	7082	broad.mit.edu	37	15	30104061	30104062	+	Intron	INS	-	AATG	AATG	rs141716074	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30104061_30104062insAATG	uc001zcr.2	-						TJP1_uc001zcq.2_Intron|TJP1_uc001zcs.2_Intron	NM_003257	NP_003248			tight junction protein 1 isoform a						cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)														---	---	---	---
MTMR15	22909	broad.mit.edu	37	15	31206525	31206526	+	Intron	INS	-	T	T	rs148634369	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31206525_31206526insT	uc001zff.2	+						MTMR15_uc001zfe.2_Intron	NM_014967	NP_055782			myotubularin related protein 15 isoform a						double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)									Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
TRPM1	4308	broad.mit.edu	37	15	31378237	31378238	+	Intron	INS	-	A	A	rs148887135	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31378237_31378238insA	uc001zfm.2	-						TRPM1_uc001zfn.3_Intron	NM_002420	NP_002411			transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	31573101	31573102	+	IGR	DEL	TG	-	-	rs147849071	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31573101_31573102delTG								TRPM1 (179177 upstream) : KLF13 (45981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	32197510	32197511	+	IGR	INS	-	AC	AC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32197510_32197511insAC								OTUD7A (34518 upstream) : CHRNA7 (125215 downstream)																																			---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33630531	33630532	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33630531_33630532insG	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33693205	33693206	+	Intron	INS	-	T	T	rs148547073	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33693205_33693206insT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
FAM82A2	55177	broad.mit.edu	37	15	41041105	41041106	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41041105_41041106insT	uc001zmo.1	-						FAM82A2_uc001zmp.1_Intron|FAM82A2_uc001zmq.1_Intron	NM_018145	NP_060615			family with sequence similarity 82, member A2						apoptosis|cell differentiation	integral to membrane|microtubule|mitochondrial membrane|nucleus|spindle pole	protein binding				0																		---	---	---	---
EHD4	30844	broad.mit.edu	37	15	42260652	42260652	+	Intron	DEL	T	-	-	rs11291085		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42260652delT	uc001zot.2	-						EHD4_uc001zou.2_Intron	NM_139265	NP_644670			EH-domain containing 4						endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	42354434	42354434	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42354434delA								PLA2G4E (51989 upstream) : PLA2G4D (5448 downstream)																																			---	---	---	---
TP53BP1	7158	broad.mit.edu	37	15	43799339	43799339	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43799339delT	uc001zrs.2	-							NM_005657	NP_005648			tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)									Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					---	---	---	---
ELL3	80237	broad.mit.edu	37	15	44067304	44067304	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44067304delA	uc001zsw.1	-						ELL3_uc001zsv.1_Intron|ELL3_uc001zsx.1_Intron|uc001zsy.2_5'Flank	NM_025165	NP_079441			elongation factor RNA polymerase II-like 3						positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				ovary(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)														---	---	---	---
CASC4	113201	broad.mit.edu	37	15	44693465	44693465	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44693465delT	uc001zto.1	+						CASC4_uc001ztp.2_Intron|CASC4_uc001ztq.2_Intron	NM_138423	NP_612432			cancer susceptibility candidate 4 isoform a							integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)														---	---	---	---
SPG11	80208	broad.mit.edu	37	15	44878181	44878182	+	Intron	INS	-	T	T	rs141231954		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44878181_44878182insT	uc001ztx.2	-						SPG11_uc010bdw.2_5'Flank|SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zty.1_Intron	NM_025137	NP_079413			spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)														---	---	---	---
GATM	2628	broad.mit.edu	37	15	45656732	45656733	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45656732_45656733insA	uc001zvc.2	-						GATM_uc001zvb.2_Intron|GATM_uc010uev.1_Intron	NM_001482	NP_001473			L-arginine:glycine amidinotransferase precursor						creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)													---	---	---	---
PLDN	26258	broad.mit.edu	37	15	45897793	45897794	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45897793_45897794insT	uc001zvq.2	+						PLDN_uc001zvr.2_Intron|PLDN_uc001zvs.2_Intron	NM_012388	NP_036520			pallidin						post-Golgi vesicle-mediated transport|synaptic vesicle docking involved in exocytosis	BLOC-1 complex|endomembrane system|membrane	identical protein binding|syntaxin-13 binding			skin(1)	1		Lung NSC(122;1.6e-06)|all_lung(180;1.13e-05)|Melanoma(134;0.027)		all cancers(107;6.58e-18)|GBM - Glioblastoma multiforme(94;5.91e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	45989156	45989159	+	IGR	DEL	CCTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45989156_45989159delCCTC								SQRDL (5678 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46061000	46061016	+	IGR	DEL	TCCATAATAGCCTCTCC	-	-	rs67805448		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46061000_46061016delTCCATAATAGCCTCTCC								SQRDL (77522 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	47051810	47051817	+	IGR	DEL	ACACACAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47051810_47051817delACACACAC								None (None upstream) : SEMA6D (424586 downstream)																																			---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	47478811	47478811	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47478811delG	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	47914417	47914417	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47914417delG	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48058484	48058484	+	Intron	DEL	G	-	-	rs528882	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058484delG	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871			semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	50457974	50457975	+	IGR	INS	-	A	A	rs149427453	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50457974_50457975insA								ATP8B4 (46555 upstream) : SLC27A2 (16418 downstream)																																			---	---	---	---
SLC27A2	11001	broad.mit.edu	37	15	50495575	50495576	+	Intron	DEL	AT	-	-	rs35530838		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50495575_50495576delAT	uc001zxw.2	+						SLC27A2_uc010bes.2_Intron|SLC27A2_uc001zxx.2_Intron	NM_003645	NP_003636			solute carrier family 27 (fatty acid						bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)														---	---	---	---
WDR72	256764	broad.mit.edu	37	15	53840218	53840219	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53840218_53840219insT	uc002acj.2	-							NM_182758	NP_877435			WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	54080573	54080573	+	IGR	DEL	A	-	-	rs5812713		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54080573delA								WDR72 (28714 upstream) : UNC13C (224528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	54145198	54145199	+	IGR	INS	-	T	T	rs112095433		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54145198_54145199insT								WDR72 (93339 upstream) : UNC13C (159902 downstream)																																			---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54576825	54576826	+	Intron	INS	-	CA	CA	rs143612333	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54576825_54576826insCA	uc002ack.2	+						UNC13C_uc002acl.2_Intron	NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54733516	54733516	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54733516delT	uc002ack.2	+							NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	54998313	54998314	+	IGR	INS	-	GCGC	GCGC	rs146153393	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54998313_54998314insGCGC								UNC13C (77508 upstream) : RSL24D1 (475207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	55045718	55045718	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55045718delA								UNC13C (124913 upstream) : RSL24D1 (427803 downstream)																																			---	---	---	---
PRTG	283659	broad.mit.edu	37	15	56004098	56004099	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56004098_56004099insA	uc002adg.2	-							NM_173814	NP_776175			protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56566922	56566923	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56566922_56566923insT								RFX7 (31439 upstream) : TEX9 (90721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	58658958	58658959	+	IGR	INS	-	T	T	rs145392766	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58658958_58658959insT								ALDH1A2 (87496 upstream) : LIPC (43816 downstream)																																			---	---	---	---
ADAM10	102	broad.mit.edu	37	15	58960818	58960819	+	Intron	INS	-	C	C	rs141179349	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58960818_58960819insC	uc002afd.1	-						ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Intron	NM_001110	NP_001101			ADAM metallopeptidase domain 10 precursor						cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	59884429	59884430	+	IGR	INS	-	TCTT	TCTT	rs71860044		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59884429_59884430insTCTT								FAM81A (68678 upstream) : GCNT3 (19552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	61819056	61819059	+	IGR	DEL	TGTG	-	-	rs149110389		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61819056_61819059delTGTG								RORA (297554 upstream) : VPS13C (325533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62813670	62813671	+	IGR	INS	-	G	G	rs150393188	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62813670_62813671insG								C2CD4B (356188 upstream) : MGC15885 (115700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62815174	62815179	+	IGR	DEL	CACACT	-	-	rs68133247		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62815174_62815179delCACACT								C2CD4B (357692 upstream) : MGC15885 (114192 downstream)																																			---	---	---	---
MIR422A	494334	broad.mit.edu	37	15	64163831	64163831	+	5'Flank	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64163831delG	hsa-mir-422a|MI0001444	-																							0																		---	---	---	---
DAPK2	23604	broad.mit.edu	37	15	64217874	64217875	+	Intron	INS	-	GCGC	GCGC	rs147933961	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64217874_64217875insGCGC	uc002amr.2	-						DAPK2_uc010uim.1_Intron	NM_014326	NP_055141			death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)														---	---	---	---
DIS3L	115752	broad.mit.edu	37	15	66621933	66621933	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66621933delT	uc010ujm.1	+						DIS3L_uc002app.2_Intron|DIS3L_uc010bho.2_Intron	NM_001143688	NP_001137160			DIS3 mitotic control homolog (S.						rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	67127012	67127012	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67127012delG								SMAD6 (52677 upstream) : SMAD3 (231183 downstream)																																			---	---	---	---
AAGAB	79719	broad.mit.edu	37	15	67531036	67531037	+	Intron	INS	-	T	T	rs35798981		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67531036_67531037insT	uc002aqk.3	-						AAGAB_uc002aql.2_Intron|AAGAB_uc010uju.1_Intron	NM_024666	NP_078942			alpha- and gamma-adaptin-binding protein p34						protein transport	cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	68800524	68800525	+	IGR	INS	-	A	A	rs71770361		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68800524_68800525insA								ITGA11 (76032 upstream) : CORO2B (71048 downstream)																																			---	---	---	---
CORO2B	10391	broad.mit.edu	37	15	68889419	68889419	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68889419delT	uc002arj.3	+							NM_006091	NP_006082			coronin, actin binding protein, 2B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	69389992	69389993	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69389992_69389993insC								TMEM84 (1831 upstream) : GLCE (62980 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70594996	70594999	+	IGR	DEL	ATGG	-	-	rs112069030		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70594996_70594999delATGG								TLE3 (204740 upstream) : UACA (351896 downstream)																																			---	---	---	---
MYO9A	4649	broad.mit.edu	37	15	72300777	72300778	+	Intron	INS	-	GT	GT	rs72481197		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72300777_72300778insGT	uc002atl.3	-						MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Intron|MYO9A_uc002atn.1_Intron	NM_006901	NP_008832			myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	72707692	72707693	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72707692_72707693insA								TMEM202 (6985 upstream) : ARIH1 (58974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	72730699	72730699	+	IGR	DEL	T	-	-	rs148242250		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72730699delT								TMEM202 (29992 upstream) : ARIH1 (35968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	73145263	73145263	+	IGR	DEL	T	-	-	rs139014423		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73145263delT								ADPGK (68596 upstream) : NEO1 (199612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	73319515	73319516	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73319515_73319516insT								ADPGK (242848 upstream) : NEO1 (25359 downstream)																																			---	---	---	---
NPTN	27020	broad.mit.edu	37	15	73899897	73899898	+	Intron	INS	-	C	C	rs144739283	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73899897_73899898insC	uc002avs.2	-						NPTN_uc010bjc.2_Intron|NPTN_uc002avt.2_Intron|NPTN_uc002avr.2_Intron|NPTN_uc010ula.1_Intron	NM_012428	NP_036560			neuroplastin isoform b precursor						elevation of cytosolic calcium ion concentration|homophilic cell adhesion|long-term synaptic potentiation|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of long-term neuronal synaptic plasticity|positive regulation of neuron projection development|positive regulation of protein phosphorylation	integral to membrane|plasma membrane|presynaptic membrane	cell adhesion molecule binding|type 1 fibroblast growth factor receptor binding				0																		---	---	---	---
SCAMP2	10066	broad.mit.edu	37	15	75158292	75158319	+	Intron	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAG	-	-	rs67717107		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75158292_75158319delGAAGGAAGGAAGGAAGGAAGGAAGGAAG	uc002azb.1	-						SCAMP2_uc010bkg.1_Intron	NM_005697	NP_005688			secretory carrier membrane protein 2						post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1																		---	---	---	---
SIN3A	25942	broad.mit.edu	37	15	75727292	75727293	+	Intron	INS	-	A	A	rs76776902		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75727292_75727293insA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron|SIN3A_uc002bak.3_Intron	NM_015477	NP_056292			transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75754331	75754332	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75754331_75754332insT								SIN3A (6207 upstream) : PTPN9 (5131 downstream)																																			---	---	---	---
SNX33	257364	broad.mit.edu	37	15	75944347	75944348	+	Intron	INS	-	T	T	rs67428485		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75944347_75944348insT	uc002bau.2	+						SNX33_uc002bav.2_Intron	NM_153271	NP_695003			sorting nexin 33						cell communication		phosphatidylinositol binding|protein binding			ovary(1)	1																		---	---	---	---
UBE2Q2	92912	broad.mit.edu	37	15	76174881	76174881	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76174881delA	uc002bbg.2	+						UBE2Q2_uc002bbh.2_Intron|UBE2Q2_uc010umn.1_Intron|UBE2Q2_uc002bbi.2_Intron	NM_173469	NP_775740			ubiquitin-conjugating enzyme E2Q 2 isoform 1						protein K48-linked ubiquitination	cytoplasm	ATP binding|ubiquitin-protein ligase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	77827755	77827758	+	IGR	DEL	TTCC	-	-	rs35988929		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77827755_77827758delTTCC								HMG20A (49812 upstream) : LINGO1 (77611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	78048828	78048831	+	IGR	DEL	ACAC	-	-	rs148532162		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78048828_78048831delACAC								LINGO1 (60353 upstream) : LOC645752 (157728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	79118133	79118134	+	IGR	INS	-	AC	AC	rs139035985	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79118133_79118134insAC								ADAMTS7 (14360 upstream) : MORF4L1 (47038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	79835254	79835254	+	IGR	DEL	T	-	-	rs11307168		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79835254delT								KIAA1024 (70612 upstream) : MTHFS (302066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	80586278	80586278	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80586278delT	uc002bfo.2	-											Homo sapiens cDNA FLJ40463 fis, clone TESTI2042149.																														---	---	---	---
ARNT2	9915	broad.mit.edu	37	15	80807231	80807234	+	Intron	DEL	AAAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80807231_80807234delAAAC	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677			aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	83880329	83880330	+	IGR	INS	-	AC	AC	rs139259689	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83880329_83880330insAC								HDGFRP3 (4008 upstream) : BNC1 (44325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	83989524	83989527	+	IGR	DEL	AGAC	-	-	rs138406451		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83989524_83989527delAGAC								BNC1 (36056 upstream) : SH3GL3 (126564 downstream)																																			---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84419314	84419315	+	Intron	INS	-	T	T	rs141203940	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84419314_84419315insT	uc002bjz.3	+						ADAMTSL3_uc002bjy.1_Intron|ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	84727258	84727258	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84727258delA								ADAMTSL3 (18667 upstream) : LOC388152 (140342 downstream)																																			---	---	---	---
ALPK3	57538	broad.mit.edu	37	15	85393789	85393790	+	Intron	INS	-	T	T	rs76525192		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85393789_85393790insT	uc002ble.2	+							NM_020778	NP_065829			alpha-kinase 3						heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)															---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	85933807	85933808	+	Intron	INS	-	A	A	rs138374485	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85933807_85933808insA	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	86870159	86870160	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86870159_86870160insT	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87403945	87403946	+	Intron	DEL	GT	-	-	rs142010256		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87403945_87403946delGT	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	87682783	87682784	+	IGR	INS	-	T	T	rs3064742		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87682783_87682784insT								AGBL1 (110500 upstream) : NCRNA00052 (437376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	88153839	88153839	+	IGR	DEL	T	-	-	rs11325967		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88153839delT								NCRNA00052 (30922 upstream) : NTRK3 (266149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	89139367	89139376	+	Intron	DEL	TTCCCTTCCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89139367_89139376delTTCCCTTCCT	uc002bms.1	-											Homo sapiens cDNA FLJ30187 fis, clone BRACE2001239.																														---	---	---	---
C15orf42	90381	broad.mit.edu	37	15	90139154	90139154	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90139154delT	uc002boe.2	+							NM_152259	NP_689472			leucine-rich repeat kinase 1						cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	90479328	90479335	+	IGR	DEL	ACACACAG	-	-	rs10541504		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90479328_90479335delACACACAG								AP3S2 (23106 upstream) : ZNF710 (65417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90669413	90669414	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90669413_90669414insA								IDH2 (23705 upstream) : SEMA4B (58738 downstream)																																			---	---	---	---
SLCO3A1	28232	broad.mit.edu	37	15	92605047	92605048	+	Intron	INS	-	T	T	rs138053867	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92605047_92605048insT	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	93886791	93886793	+	Intron	DEL	AAA	-	-	rs141119386		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93886791_93886793delAAA	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	94139378	94139378	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94139378delA								RGMA (506945 upstream) : MCTP2 (635423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94513787	94513787	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94513787delA	uc002btf.1	+											Homo sapiens cDNA clone IMAGE:4827883.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	94651191	94651191	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94651191delA								None (None upstream) : MCTP2 (123610 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97464696	97464697	+	IGR	DEL	TA	-	-	rs58778018		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97464696_97464697delTA								SPATA8 (135852 upstream) : LOC91948 (821149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97610889	97610896	+	IGR	DEL	TTCCTTCT	-	-	rs72438368		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97610889_97610896delTTCCTTCT								SPATA8 (282045 upstream) : LOC91948 (674950 downstream)																																			---	---	---	---
LOC91948	91948	broad.mit.edu	37	15	98409875	98409876	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98409875_98409876insA	uc002buh.1	-						LOC91948_uc002bug.1_Intron	NR_024173				SubName: Full=Putative uncharacterized protein ENSP00000381347;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	101198343	101198344	+	IGR	DEL	TG	-	-	rs72055394		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101198343_101198344delTG								ASB7 (6441 upstream) : ALDH1A3 (221665 downstream)																																			---	---	---	---
WASH3P	374666	broad.mit.edu	37	15	102499126	102499127	+	5'Flank	INS	-	GCT	GCT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102499126_102499127insGCT	uc002cdi.2	+						WASH3P_uc010bpk.1_5'Flank|WASH3P_uc010bpl.1_5'Flank|WASH3P_uc010utt.1_5'Flank|WASH3P_uc010utu.1_5'Flank	NR_003659				RecName: Full=WAS protein family homolog 2; AltName: Full=Protein FAM39B; AltName: Full=CXYorf1-like protein on chromosome 2;												0																		---	---	---	---
NPRL3	8131	broad.mit.edu	37	16	155508	155509	+	Intron	INS	-	CT	CT	rs146371565	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:155508_155509insCT	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc010uuc.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818			conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1																		---	---	---	---
WDR24	84219	broad.mit.edu	37	16	742049	742050	+	5'Flank	INS	-	CCTC	CCTC	rs111680668		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:742049_742050insCCTC	uc002ciz.1	-							NM_032259	NP_115635			WD repeat domain 24											ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	1083458	1083459	+	IGR	INS	-	CCAT	CCAT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1083458_1083459insCCAT								SOX8 (46480 upstream) : LOC146336 (30625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	1163909	1163909	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1163909delC								C1QTNF8 (17665 upstream) : CACNA1H (39332 downstream)																																			---	---	---	---
IFT140	9742	broad.mit.edu	37	16	1615512	1615512	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1615512delA	uc002cmb.2	-						IFT140_uc002clz.2_Intron	NM_014714	NP_055529			intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)																---	---	---	---
CRAMP1L	57585	broad.mit.edu	37	16	1672592	1672592	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1672592delC	uc010uvh.1	+							NM_020825	NP_065876			Crm, cramped-like							nucleus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	1978193	1978194	+	IGR	INS	-	TA	TA	rs4027416		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1978193_1978194insTA								HS3ST6 (9962 upstream) : SEPX1 (10041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	2268543	2268543	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2268543delT								PGP (3721 upstream) : E4F1 (5024 downstream)																																			---	---	---	---
SRL	6345	broad.mit.edu	37	16	4247597	4247598	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4247597_4247598insT	uc002cvz.3	-						SRL_uc002cvy.3_Intron	NM_001098814	NP_001092284			sarcalumenin							sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	4363395	4363396	+	IGR	INS	-	T	T	rs113173847		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4363395_4363396insT								TFAP4 (40394 upstream) : GLIS2 (18829 downstream)																																			---	---	---	---
GLYR1	84656	broad.mit.edu	37	16	4875658	4875658	+	Intron	DEL	T	-	-	rs112834357		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4875658delT	uc002cxx.3	-						GLYR1_uc002cxy.2_Intron|GLYR1_uc002cxz.1_Intron|GLYR1_uc002cya.2_Intron|GLYR1_uc010uxv.1_Intron	NM_032569	NP_115958			cytokine-like nuclear factor n-pac						pentose-phosphate shunt	nucleus	coenzyme binding|DNA binding|methylated histone residue binding|phosphogluconate dehydrogenase (decarboxylating) activity				0																		---	---	---	---
NAGPA	51172	broad.mit.edu	37	16	5082492	5082493	+	Intron	INS	-	C	C	rs8059946		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5082492_5082493insC	uc002cyg.2	-						ALG1_uc002cyj.2_5'Flank|NAGPA_uc002cyf.2_Intron|NAGPA_uc002cyh.2_Intron|NAGPA_uc002cyi.2_Intron|NAGPA_uc010uxx.1_Intron	NM_016256	NP_057340			N-acetylglucosamine-1-phosphodiester						carbohydrate metabolic process|lysosome organization|protein modification process|protein targeting to lysosome	Golgi cisterna membrane|integral to membrane	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity				0					N-Acetyl-D-glucosamine(DB00141)													---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6943304	6943304	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6943304delA	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7467535	7467536	+	Intron	INS	-	TGTGTT	TGTGTT	rs144296523	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7467535_7467536insTGTGTT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7684390	7684391	+	Intron	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7684390_7684391insTT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	7862344	7862344	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7862344delT								A2BP1 (99004 upstream) : TMEM114 (757159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8306896	8306897	+	IGR	INS	-	C	C	rs148355080	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8306896_8306897insC								A2BP1 (543556 upstream) : TMEM114 (312606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8593443	8593464	+	IGR	DEL	CTTGCGTCATGCAATGGTGCAC	-	-	rs58465368		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8593443_8593464delCTTGCGTCATGCAATGGTGCAC								A2BP1 (830103 upstream) : TMEM114 (26039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	8763374	8763375	+	IGR	INS	-	T	T	rs142816819	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8763374_8763375insT								C16orf68 (19888 upstream) : ABAT (5069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9618201	9618202	+	IGR	INS	-	CTTTTCCTTCCTTCCTTT	CTTTTCCTTCCTTCCTTT	rs140437457	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9618201_9618202insCTTTTCCTTCCTTCCTTT								C16orf72 (404656 upstream) : GRIN2A (229065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9769209	9769210	+	IGR	INS	-	T	T	rs146712357	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9769209_9769210insT								C16orf72 (555664 upstream) : GRIN2A (78057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10336918	10336918	+	IGR	DEL	A	-	-	rs35802777		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10336918delA								GRIN2A (60307 upstream) : ATF7IP2 (142994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	11609702	11609736	+	IGR	DEL	GCCCGGCCCAGCCCAGCCCAGCCCAGCCCAGCCCA	-	-	rs75270661	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11609702_11609736delGCCCGGCCCAGCCCAGCCCAGCCCAGCCCAGCCCA								C16orf75 (164085 upstream) : LITAF (31846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	11688163	11688163	+	IGR	DEL	T	-	-	rs35496392		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11688163delT								LITAF (6841 upstream) : SNN (74138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	14097472	14097475	+	IGR	DEL	GGCC	-	-	rs10567044		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14097472_14097475delGGCC								ERCC4 (51267 upstream) : MKL2 (67721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	14126875	14126875	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14126875delT								ERCC4 (80670 upstream) : MKL2 (38321 downstream)																																			---	---	---	---
PARN	5073	broad.mit.edu	37	16	14636162	14636163	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14636162_14636163insT	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	15401467	15401468	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15401467_15401468delAC								PDXDC1 (168272 upstream) : MPV17L (88143 downstream)																																			---	---	---	---
MYH11	4629	broad.mit.edu	37	16	15832962	15832962	+	Intron	DEL	T	-	-	rs66933654		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15832962delT	uc002ddy.2	-						MYH11_uc002ddv.2_Intron|MYH11_uc002ddw.2_Intron|MYH11_uc002ddx.2_Intron|MYH11_uc010bvg.2_Intron	NM_002474	NP_002465			smooth muscle myosin heavy chain 11 isoform						axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15								T	CBFB	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	16	16004371	16004371	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16004371delA								C16orf63 (21924 upstream) : ABCC1 (39063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17652135	17652136	+	IGR	INS	-	A	A	rs141000153	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17652135_17652136insA								XYLT1 (87397 upstream) : NOMO2 (859047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17654034	17654039	+	IGR	DEL	GTGTAG	-	-	rs5815911	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17654034_17654039delGTGTAG								XYLT1 (89296 upstream) : NOMO2 (857144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18121378	18121378	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18121378delG								XYLT1 (556640 upstream) : NOMO2 (389805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	18960007	18960008	+	IGR	DEL	CC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18960007_18960008delCC								SMG1 (22281 upstream) : TMC7 (35248 downstream)																																			---	---	---	---
GPR139	124274	broad.mit.edu	37	16	20058438	20058439	+	Intron	INS	-	TG	TG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20058438_20058439insTG	uc002dgu.1	-						GPR139_uc010vaw.1_Intron	NM_001002911	NP_001002911			G protein-coupled receptor 139							integral to membrane|plasma membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20134485	20134486	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20134485_20134486delTC								GPR139 (49385 upstream) : GP2 (187326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20146999	20147000	+	IGR	INS	-	CC	CC	rs150555024	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20146999_20147000insCC								GPR139 (61899 upstream) : GP2 (174812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20249395	20249396	+	IGR	INS	-	TACT	TACT	rs146229007	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20249395_20249396insTACT								GPR139 (164295 upstream) : GP2 (72416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20369956	20369956	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20369956delA								UMOD (5919 upstream) : PDILT (536 downstream)																																			---	---	---	---
LOC81691	81691	broad.mit.edu	37	16	20825217	20825218	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20825217_20825218insA	uc002dhv.2	+						ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Intron|LOC81691_uc002dhw.2_Intron|LOC81691_uc002dhy.3_Intron	NM_030941	NP_112203			exonuclease NEF-sp isoform 1							nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	21555514	21555514	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21555514delT	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22644167	22644167	+	IGR	DEL	T	-	-	rs72371297		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22644167delT								LOC653786 (55981 upstream) : HS3ST2 (181693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	23018342	23018343	+	IGR	DEL	AT	-	-	rs67366929		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23018342_23018343delAT								HS3ST2 (90685 upstream) : USP31 (54386 downstream)																																			---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23203399	23203400	+	Intron	INS	-	A	A	rs138716791	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23203399_23203400insA	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	23270122	23270125	+	IGR	DEL	TCTC	-	-	rs111487022		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23270122_23270125delTCTC								SCNN1G (41922 upstream) : SCNN1B (43466 downstream)																																			---	---	---	---
ARHGAP17	55114	broad.mit.edu	37	16	24948027	24948027	+	Intron	DEL	A	-	-	rs72226804		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24948027delA	uc002dnb.2	-						ARHGAP17_uc002dmy.2_5'UTR|ARHGAP17_uc002dmz.2_Intron|ARHGAP17_uc002dna.2_Intron|ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron	NM_001006634	NP_001006635			nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	25300771	25300774	+	IGR	DEL	TTCT	-	-	rs8044599		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25300771_25300774delTTCT								ZKSCAN2 (31916 upstream) : HS3ST4 (402573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26821441	26821444	+	IGR	DEL	GAAG	-	-	rs62031283		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26821441_26821444delGAAG								HS3ST4 (672433 upstream) : C16orf82 (256775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26824812	26824837	+	IGR	DEL	TAGTGTGGATATAGTGTGGACATGGG	-	-	rs150456480	by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26824812_26824837delTAGTGTGGATATAGTGTGGACATGGG								HS3ST4 (675804 upstream) : C16orf82 (253382 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26939315	26939318	+	IGR	DEL	GAAA	-	-	rs10574808	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26939315_26939318delGAAA								HS3ST4 (790307 upstream) : C16orf82 (138901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27027783	27027785	+	IGR	DEL	CCC	-	-	rs10538188		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27027783_27027785delCCC								HS3ST4 (878775 upstream) : C16orf82 (50434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	28828643	28828644	+	Intron	INS	-	T	T	rs151028385		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28828643_28828644insT	uc010vct.1	-						uc002dqx.1_RNA					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29670754	29670754	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29670754delA	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29771411	29771412	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29771411_29771412insA	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31261450	31261451	+	IGR	INS	-	T	T	rs112030988		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31261450_31261451insT								TRIM72 (24940 upstream) : ITGAM (9837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	31648348	31648349	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31648348_31648349insA								CSDAP1 (67503 upstream) : KIAA0664P3 (63585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32152597	32152597	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32152597delA								ZNF267 (223971 upstream) : HERC2P4 (10013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32831636	32831636	+	IGR	DEL	C	-	-	rs113971358		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32831636delC								TP53TG3B (142758 upstream) : SLC6A10P (57161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33337174	33337174	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33337174delG								SLC6A10P (440711 upstream) : MIR1826 (628334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33412502	33412502	+	IGR	DEL	A	-	-	rs112970301		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33412502delA								SLC6A10P (516039 upstream) : MIR1826 (553006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33416645	33416646	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33416645_33416646insT								SLC6A10P (520182 upstream) : MIR1826 (548862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33545140	33545141	+	IGR	INS	-	ATA	ATA	rs112883565		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33545140_33545141insATA								SLC6A10P (648677 upstream) : MIR1826 (420367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33831935	33831936	+	IGR	INS	-	T	T	rs147532074		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33831935_33831936insT								SLC6A10P (935472 upstream) : MIR1826 (133572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33906139	33906139	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33906139delA								None (None upstream) : MIR1826 (59369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33937348	33937349	+	IGR	DEL	TT	-	-	rs111232160		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33937348_33937349delTT								None (None upstream) : MIR1826 (28159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33938724	33938724	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33938724delA								None (None upstream) : MIR1826 (26784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951847	33951847	+	IGR	DEL	T	-	-	rs78456927	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951847delT								None (None upstream) : MIR1826 (13661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33953097	33953098	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33953097_33953098insC								None (None upstream) : MIR1826 (12410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34183942	34183942	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34183942delT								MIR1826 (218350 upstream) : UBE2MP1 (219860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	35225221	35225222	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:35225221_35225222insC								LOC146481 (510254 upstream) : None (None downstream)																																			---	---	---	---
ANKRD26P1	124149	broad.mit.edu	37	16	46508955	46508955	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46508955delG	uc002eeb.3	-						ANKRD26P1_uc010cbd.2_Intron	NR_026556				Homo sapiens cDNA FLJ43980 fis, clone TESTI4018806.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	47076703	47076704	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47076703_47076704delAG								DNAJA2 (69078 upstream) : NETO2 (38738 downstream)																																			---	---	---	---
ITFG1	81533	broad.mit.edu	37	16	47265734	47265734	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47265734delC	uc002eet.2	-						ITFG1_uc010vgg.1_Intron|ITFG1_uc010vgh.1_Intron	NM_030790	NP_110417			integrin alpha FG-GAP repeat containing 1							extracellular region|integral to membrane				ovary(1)|central_nervous_system(1)	2		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	48096342	48096343	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48096342_48096343delTC								PHKB (360909 upstream) : ABCC12 (20541 downstream)																																			---	---	---	---
HEATR3	55027	broad.mit.edu	37	16	50109224	50109225	+	Intron	INS	-	A	A	rs138610891		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50109224_50109225insA	uc002efw.2	+						HEATR3_uc002efx.2_Intron	NM_182922	NP_891552			HEAT repeat containing 3								binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	50515697	50515704	+	IGR	DEL	GTGTGTGC	-	-	rs58089996		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50515697_50515704delGTGTGTGC								BRD7 (112868 upstream) : NKD1 (66537 downstream)																																			---	---	---	---
NKD1	85407	broad.mit.edu	37	16	50632140	50632141	+	Intron	INS	-	TG	TG	rs139365098	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50632140_50632141insTG	uc002egg.1	+							NM_033119	NP_149110			naked cuticle homolog 1						Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	51074929	51074930	+	IGR	INS	-	GGAG	GGAG	rs145692350	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51074929_51074930insGGAG								CYLD (239083 upstream) : SALL1 (94956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51282371	51282382	+	IGR	DEL	TTTCCCTTTCCT	-	-	rs142602614		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51282371_51282382delTTTCCCTTTCCT								SALL1 (97188 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51968291	51968292	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51968291_51968292delGA								SALL1 (783108 upstream) : TOX3 (503626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52156157	52156160	+	IGR	DEL	GTGC	-	-	rs72162293	by1000genomes;byFrequency	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52156157_52156160delGTGC								SALL1 (970974 upstream) : TOX3 (315758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	53623780	53623781	+	IGR	INS	-	TT	TT	rs144442453	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53623780_53623781insTT								AKTIP (86610 upstream) : RPGRIP1L (10042 downstream)																																			---	---	---	---
RPGRIP1L	23322	broad.mit.edu	37	16	53725022	53725022	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53725022delT	uc002ehp.2	-						RPGRIP1L_uc002eho.3_Intron|RPGRIP1L_uc010vgy.1_Intron|RPGRIP1L_uc010cbx.2_Intron|RPGRIP1L_uc010vgz.1_Intron|RPGRIP1L_uc002ehq.1_Intron	NM_015272	NP_056087			RPGRIP1-like isoform a						negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	54595082	54595083	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54595082_54595083delCA								IRX3 (274704 upstream) : IRX5 (370028 downstream)																																			---	---	---	---
OGFOD1	55239	broad.mit.edu	37	16	56503762	56503763	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56503762_56503763insA	uc002ejb.2	+						OGFOD1_uc002ejc.2_Intron	NM_018233	NP_060703			2-oxoglutarate and iron-dependent oxygenase								iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	59210246	59210247	+	IGR	DEL	AA	-	-	rs34899461		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59210246_59210247delAA								GOT2 (442000 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59605474	59605474	+	IGR	DEL	T	-	-	rs11352507		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59605474delT								GOT2 (837228 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	61102575	61102577	+	IGR	DEL	AGA	-	-	rs148139578		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61102575_61102577delAGA								None (None upstream) : CDH8 (584658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63813465	63813466	+	IGR	DEL	AC	-	-	rs35424496		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63813465_63813466delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63930052	63930052	+	IGR	DEL	A	-	-	rs11287115		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63930052delA								None (None upstream) : None (None downstream)																																			---	---	---	---
CDH11	1009	broad.mit.edu	37	16	65067173	65067176	+	Intron	DEL	ACAT	-	-	rs66774155		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65067173_65067176delACAT	uc002eoi.2	-						CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Intron	NM_001797	NP_001788			cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66134577	66134577	+	IGR	DEL	A	-	-	rs113684568		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66134577delA								LOC283867 (524374 upstream) : CDH5 (265948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66203502	66203503	+	IGR	INS	-	GAG	GAG	rs77356033	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66203502_66203503insGAG								LOC283867 (593299 upstream) : CDH5 (197022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66529791	66529791	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66529791delG								BEAN (13047 upstream) : TK2 (13561 downstream)																																			---	---	---	---
CBFB	865	broad.mit.edu	37	16	67098807	67098808	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67098807_67098808insT	uc002era.2	+						CBFB_uc002erb.2_Intron|CBFB_uc010vja.1_Intron	NM_001755	NP_001746			core-binding factor, beta subunit isoform 2						transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)				T	MYH11	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	16	68043639	68043640	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68043639_68043640insT								DPEP2 (9150 upstream) : DDX28 (11534 downstream)																																			---	---	---	---
WWP2	11060	broad.mit.edu	37	16	69956152	69956152	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69956152delA	uc002exu.1	+						WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron|WWP2_uc010vln.1_Intron|WWP2_uc002exw.1_5'Flank	NM_007014	NP_008945			WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6																		---	---	---	---
PDPR	55066	broad.mit.edu	37	16	70166562	70166562	+	Intron	DEL	C	-	-	rs11297876		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70166562delC	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron|PDPR_uc002eyg.1_Intron	NM_017990	NP_060460			pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)														---	---	---	---
SF3B3	23450	broad.mit.edu	37	16	70608982	70608982	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70608982delA	uc002ezf.2	+	26						NM_012426	NP_036558			splicing factor 3b, subunit 3						protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	73209280	73209281	+	IGR	INS	-	AAAC	AAAC	rs146469590	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73209280_73209281insAAAC								HTA (81610 upstream) : None (None downstream)																																			---	---	---	---
FA2H	79152	broad.mit.edu	37	16	74800913	74800913	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74800913delA	uc002fde.1	-						FA2H_uc010vmy.1_Intron	NM_024306	NP_077282			fatty acid 2-hydroxylase						cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity				0																		---	---	---	---
WDR59	79726	broad.mit.edu	37	16	74943867	74943868	+	Intron	INS	-	TT	TT	rs113238843		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74943867_74943868insTT	uc002fdh.1	-						WDR59_uc002fdi.2_Intron|WDR59_uc002fdg.1_Intron	NM_030581	NP_085058			WD repeat domain 59											ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	76113699	76113700	+	IGR	INS	-	A	A	rs115644890	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76113699_76113700insA								TERF2IP (422371 upstream) : CNTNAP4 (197476 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76151753	76151753	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76151753delA								TERF2IP (460425 upstream) : CNTNAP4 (159423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79445134	79445135	+	IGR	INS	-	T	T	rs141822344	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79445134_79445135insT								WWOX (198571 upstream) : MAF (182611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	80607609	80607610	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80607609_80607610delAC								DYNLRB2 (23070 upstream) : CDYL2 (30068 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83343414	83343415	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83343414_83343415insT	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83463117	83463118	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83463117_83463118delAC	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	84964186	84964199	+	IGR	DEL	GTGTGGGTGAGTGG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84964186_84964199delGTGTGGGTGAGTGG								CRISPLD2 (21070 upstream) : ZDHHC7 (43868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	84990301	84990302	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84990301_84990302insA								CRISPLD2 (47185 upstream) : ZDHHC7 (17765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85004274	85004275	+	IGR	INS	-	CTT	CTT	rs139987481	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85004274_85004275insCTT								CRISPLD2 (61158 upstream) : ZDHHC7 (3792 downstream)																																	OREG0023993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	16	85004278	85004279	+	IGR	INS	-	TTA	TTA	rs56042983		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85004278_85004279insTTA								CRISPLD2 (61162 upstream) : ZDHHC7 (3788 downstream)																																	OREG0023993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KIAA0513	9764	broad.mit.edu	37	16	85107554	85107555	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85107554_85107555insT	uc002fiu.2	+						KIAA0513_uc002fis.3_Intron|KIAA0513_uc010voj.1_Intron|KIAA0513_uc002fit.2_Intron	NM_014732	NP_055547			hypothetical protein LOC9764							cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	85271458	85271458	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85271458delA								FAM92B (125344 upstream) : KIAA0182 (373571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85511161	85511162	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85511161_85511162insT								FAM92B (365047 upstream) : KIAA0182 (133867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86097024	86097025	+	IGR	INS	-	GT	GT	rs5818571		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86097024_86097025insGT								IRF8 (140815 upstream) : LOC732275 (268431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86214802	86214803	+	IGR	INS	-	AC	AC	rs148076016	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86214802_86214803insAC								IRF8 (258593 upstream) : LOC732275 (150653 downstream)																																			---	---	---	---
ZCCHC14	23174	broad.mit.edu	37	16	87527394	87527394	+	5'Flank	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87527394delT	uc002fjz.1	-						ZCCHC14_uc002fka.1_5'Flank|uc002fkc.1_5'Flank	NM_015144	NP_055959			zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	88147767	88147768	+	IGR	INS	-	ACTGCGGGGGTCTCGGGGGAGAATGACAGGGACCACACTCACTC	ACTGCGGGGGTCTCGGGGGAGAATGACAGGGACCACACTCACTC	rs28516742		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88147767_88147768insACTGCGGGGGTCTCGGGGGAGAATGACAGGGACCACACTCACTC								BANP (36844 upstream) : ZNF469 (346111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88278000	88278003	+	IGR	DEL	TGGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88278000_88278003delTGGA								BANP (167077 upstream) : ZNF469 (215876 downstream)																																			---	---	---	---
ZFPM1	161882	broad.mit.edu	37	16	88538762	88538763	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88538762_88538763insT	uc002fkv.2	+							NM_153813	NP_722520			zinc finger protein, multitype 1						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|transcription factor binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0478)														---	---	---	---
SNAI3	333929	broad.mit.edu	37	16	88744235	88744237	+	3'UTR	DEL	GTG	-	-	rs145748802		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88744235_88744237delGTG	uc002flj.2	-	3					MGC23284_uc002fli.3_Intron	NM_178310	NP_840101			snail homolog 3						oxidation-reduction process		copper ion binding|DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.048)														---	---	---	---
ACSF3	197322	broad.mit.edu	37	16	89179145	89179146	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89179145_89179146delTC	uc002fmp.2	+						ACSF3_uc010cig.1_Intron|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_Intron|ACSF3_uc002fmr.1_Intron	NM_174917	NP_777577			acyl-CoA synthetase family member 3 precursor						fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	89670177	89670178	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89670177_89670178insA								CPNE7 (6524 upstream) : DPEP1 (9538 downstream)																																			---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89679869	89679882	+	Intron	DEL	CTCTCTCCCTCCTG	-	-	rs111857923		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89679869_89679882delCTCTCTCCCTCCTG	uc010cin.2	+							NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	89745827	89745827	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89745827delA								C16orf55 (8152 upstream) : CDK10 (7249 downstream)																																			---	---	---	---
SPIRE2	84501	broad.mit.edu	37	16	89937495	89937495	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89937495delA	uc002foz.1	+	15					SPIRE2_uc010ciw.1_3'UTR|SPIRE2_uc002fpa.1_3'UTR|SPIRE2_uc010cix.1_3'UTR|TCF25_uc010vpp.1_5'Flank|TCF25_uc002fpb.2_5'Flank	NM_032451	NP_115827			spire homolog 2						transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)														---	---	---	---
VPS53	55275	broad.mit.edu	37	17	557991	557992	+	Intron	INS	-	G	G	rs71145760		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:557991_557992insG	uc002frn.2	-						VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759			vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)														---	---	---	---
VPS53	55275	broad.mit.edu	37	17	576351	576352	+	Intron	INS	-	A	A	rs144893124	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:576351_576352insA	uc002frn.2	-						VPS53_uc002frk.2_Intron|VPS53_uc010cjo.1_Intron|VPS53_uc002frl.2_Intron|VPS53_uc002frm.2_Intron|VPS53_uc002fro.2_Intron|VPS53_uc010cjp.1_Intron	NM_018289	NP_060759			vacuolar protein sorting 53 isoform 2						protein transport	endosome membrane|Golgi apparatus					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)														---	---	---	---
NXN	64359	broad.mit.edu	37	17	795510	795511	+	Intron	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:795510_795511insC	uc002fsa.2	-						NXN_uc002fsb.1_Intron	NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
TIMM22	29928	broad.mit.edu	37	17	897516	897519	+	5'Flank	DEL	ACAT	-	-	rs144033044		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:897516_897519delACAT	uc002fsc.2	+							NM_013337	NP_037469			translocase of inner mitochondrial membrane 22						transmembrane transport	integral to membrane|mitochondrial inner membrane	protein transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)														---	---	---	---
ABR	29	broad.mit.edu	37	17	960890	960909	+	Intron	DEL	TGTGTGTATGTGTGTGTGTG	-	-	rs66533232		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:960890_960909delTGTGTGTATGTGTGTGTGTG	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010vqg.1_Intron|ABR_uc002fsg.2_Intron|ABR_uc002fsh.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
ABR	29	broad.mit.edu	37	17	1023136	1023137	+	Intron	INS	-	A	A	rs141082808	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1023136_1023137insA	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010cjq.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
RTN4RL1	146760	broad.mit.edu	37	17	1856195	1856196	+	Intron	INS	-	C	C	rs150803349	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1856195_1856196insC	uc002ftp.2	-							NM_178568	NP_848663			reticulon 4 receptor-like 1 precursor						axon regeneration	anchored to plasma membrane	receptor activity				0																		---	---	---	---
RTN4RL1	146760	broad.mit.edu	37	17	1909034	1909035	+	Intron	DEL	TC	-	-	rs71941732		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1909034_1909035delTC	uc002ftp.2	-							NM_178568	NP_848663			reticulon 4 receptor-like 1 precursor						axon regeneration	anchored to plasma membrane	receptor activity				0																		---	---	---	---
SMG6	23293	broad.mit.edu	37	17	2013579	2013579	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2013579delA	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
SMG6	23293	broad.mit.edu	37	17	2103820	2103821	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2103820_2103821insA	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2886514	2886514	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2886514delT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900			RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2917277	2917278	+	Intron	DEL	AG	-	-	rs71843136		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2917277_2917278delAG	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900			RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
TRPV3	162514	broad.mit.edu	37	17	3422999	3423002	+	Intron	DEL	GATG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3422999_3423002delGATG	uc002fvt.1	-						TRPV3_uc002fvs.1_Intron|TRPV3_uc010vrh.1_Intron|TRPV3_uc010vri.1_Intron|TRPV3_uc010vrj.1_Intron|TRPV3_uc010vrk.1_Intron|TRPV3_uc010vrl.1_Intron|TRPV3_uc010vrm.1_Intron|TRPV3_uc002fvr.2_Intron|TRPV3_uc002fvu.2_Intron|TRPV3_uc010vrn.1_Intron	NM_145068	NP_659505			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)													---	---	---	---
ITGAE	3682	broad.mit.edu	37	17	3682349	3682349	+	Intron	DEL	A	-	-	rs139549154		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3682349delA	uc002fwo.3	-							NM_002208	NP_002199			integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)														---	---	---	---
ZZEF1	23140	broad.mit.edu	37	17	3965090	3965090	+	Intron	DEL	C	-	-	rs112047906		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3965090delC	uc002fxe.2	-						ZZEF1_uc002fxh.2_Intron|ZZEF1_uc002fxi.2_Intron|ZZEF1_uc002fxj.1_Intron	NM_015113	NP_055928			zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
INCA1	388324	broad.mit.edu	37	17	4895948	4895949	+	Intron	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4895948_4895949delCT	uc002gaj.2	-						INCA1_uc002gak.2_Intron|INCA1_uc002gal.2_Intron|INCA1_uc002gam.2_Intron	NM_213726	NP_998891			inhibitor of CDK, cyclin A1 interacting protein							nucleus					0																		---	---	---	---
NUP88	4927	broad.mit.edu	37	17	5320152	5320153	+	Intron	INS	-	T	T	rs11391160		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5320152_5320153insT	uc002gbo.1	-						NUP88_uc010vsx.1_Intron|NUP88_uc010cle.1_Intron|NUP88_uc010vsy.1_Intron|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523			nucleoporin 88kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	6177782	6177784	+	IGR	DEL	TCA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6177782_6177784delTCA								WSCD1 (150037 upstream) : AIPL1 (149276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	6249410	6249413	+	IGR	DEL	ACAT	-	-	rs72264331	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6249410_6249413delACAT								WSCD1 (221665 upstream) : AIPL1 (77647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	6268611	6268614	+	IGR	DEL	AGGC	-	-	rs12939794	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6268611_6268614delAGGC								WSCD1 (240866 upstream) : AIPL1 (58446 downstream)																																			---	---	---	---
ALOX12	239	broad.mit.edu	37	17	6906751	6906751	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6906751delT	uc002gdx.3	+						uc002gdy.1_Intron	NM_000697	NP_000688			arachidonate 12-lipoxygenase						anti-apoptosis|cellular component movement|fatty acid oxidation|leukotriene biosynthetic process|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of cell proliferation|superoxide anion generation	cytosol|sarcolemma	arachidonate 12-lipoxygenase activity|hepoxilin-epoxide hydrolase activity|iron ion binding|lipoxygenase activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
NEURL4	84461	broad.mit.edu	37	17	7232716	7232717	+	5'Flank	INS	-	G	G	rs148251846	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7232716_7232717insG	uc002gga.1	-						NEURL4_uc002ggb.1_5'Flank|NEURL4_uc002ggc.1_5'Flank	NM_032442	NP_115818			neuralized homolog 4 isoform 1								protein binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
ZBTB4	57659	broad.mit.edu	37	17	7367751	7367752	+	Intron	DEL	AA	-	-	rs147066597		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7367751_7367752delAA	uc002ghc.3	-						ZBTB4_uc002ghd.3_Intron	NM_001128833	NP_001122305			zinc finger and BTB domain containing 4						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)														---	---	---	---
TNFSF12-TNFSF13	407977	broad.mit.edu	37	17	7451453	7451454	+	5'Flank	INS	-	GTCC	GTCC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7451453_7451454insGTCC	uc002ghi.1	+						TNFSF12_uc002ghg.2_5'Flank|TNFSF12_uc002ghh.2_5'Flank	NM_172089	NP_742086			TNFSF12-TNFSF13 protein						immune response	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0		Prostate(122;0.157)																---	---	---	---
ALOX12B	242	broad.mit.edu	37	17	7990546	7990557	+	Intron	DEL	ACACACACAGAC	-	-	rs72449480		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7990546_7990557delACACACACAGAC	uc002gjy.1	-						hsa-mir-4314|MI0015846_5'Flank	NM_001139	NP_001130			arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0															Multiple Myeloma(8;0.094)			---	---	---	---
ODF4	146852	broad.mit.edu	37	17	8242555	8242556	+	5'Flank	INS	-	T	T	rs71947619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8242555_8242556insT	uc002gle.1	+							NM_153007	NP_694552			outer dense fiber of sperm tails 4						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)	1																		---	---	---	---
PIK3R5	23533	broad.mit.edu	37	17	8848236	8848236	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8848236delT	uc010vuz.1	-						PIK3R5_uc002glu.3_Intron|PIK3R5_uc010coa.1_Intron|PIK3R5_uc010cob.1_Intron	NM_001142633	NP_001136105			phosphoinositide-3-kinase, regulatory subunit 5						platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
NTN1	9423	broad.mit.edu	37	17	8955280	8955281	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8955280_8955281insT	uc002glw.3	+							NM_004822	NP_004813			netrin 1 precursor						apoptosis|axon guidance		protein binding				0																		---	---	---	---
MYH13	8735	broad.mit.edu	37	17	10267942	10267943	+	Intron	INS	-	AG	AG	rs143161675	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10267942_10267943insAG	uc002gmk.1	-							NM_003802	NP_003793			myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	10511762	10511762	+	RNA	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10511762delT	uc002gml.1	+	8		c.720delT								Homo sapiens cDNA FLJ40181 fis, clone TESTI2018178.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	10642553	10642560	+	IGR	DEL	CCTTCCTT	-	-	rs72385561		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10642553_10642560delCCTTCCTT								TMEM220 (8907 upstream) : PIRT (83233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	10768799	10768800	+	IGR	DEL	AG	-	-	rs147997140		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10768799_10768800delAG								PIRT (27381 upstream) : SHISA6 (375940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	10779996	10779997	+	IGR	INS	-	T	T	rs141141005	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10779996_10779997insT								PIRT (38578 upstream) : SHISA6 (364743 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13262993	13262994	+	IGR	INS	-	T	T	rs146847944	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13262993_13262994insT								ELAC2 (341634 upstream) : HS3ST3A1 (136012 downstream)																																			---	---	---	---
HS3ST3A1	9955	broad.mit.edu	37	17	13498403	13498404	+	Intron	INS	-	T	T	rs142122607	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13498403_13498404insT	uc002gob.1	-							NM_006042	NP_006033			heparan sulfate D-glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
ZSWIM7	125150	broad.mit.edu	37	17	15881022	15881023	+	3'UTR	INS	-	A	A	rs138180293		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15881022_15881023insA	uc002gpe.2	-	6					ZSWIM7_uc002gpf.2_3'UTR|ZSWIM7_uc002gpg.2_Intron	NM_001042698	NP_001036163			zinc finger, SWIM-type containing 7						DNA recombination|DNA repair	nucleus	zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0827)														---	---	---	---
TTC19	54902	broad.mit.edu	37	17	15922908	15922909	+	Intron	DEL	TG	-	-	rs145732991		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15922908_15922909delTG	uc002gph.1	+						TTC19_uc010cox.1_Intron	NM_017775	NP_060245			tetratricopeptide repeat domain 19						cell cycle|cytokinesis|mitochondrial respiratory chain complex III assembly	centrosome|midbody|mitochondrial inner membrane	protein binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)														---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	15945474	15945475	+	Intron	INS	-	AAAG	AAAG	rs145971376	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15945474_15945475insAAAG	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpl.2_Intron|NCOR1_uc002gpm.2_Intron|NCOR1_uc010vwb.1_Intron|NCOR1_uc010coy.2_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16068048	16068049	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16068048_16068049insA	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
PIGL	9487	broad.mit.edu	37	17	16216242	16216243	+	Intron	DEL	AG	-	-	rs67815125		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16216242_16216243delAG	uc002gpv.2	+						PIGL_uc010vwd.1_Intron	NM_004278	NP_004269			phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	N-acetylglucosaminylphosphatidylinositol deacetylase activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)														---	---	---	---
C17orf76	388341	broad.mit.edu	37	17	16348166	16348167	+	Intron	INS	-	T	T	rs34805026		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16348166_16348167insT	uc010cph.1	-						C17orf76_uc002gqh.2_Intron|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|C17orf76_uc002gqg.1_Intron	NM_001113567	NP_001107039			hypothetical protein LOC388341 isoform 1												0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)														---	---	---	---
CCDC144A	9720	broad.mit.edu	37	17	16664647	16664648	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16664647_16664648insA	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510			coiled-coil domain containing 144A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	16927431	16927431	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16927431delT								TNFRSF13B (52029 upstream) : MPRIP (18676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	18551311	18551312	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18551311_18551312delTG								TBC1D28 (3571 upstream) : ZNF286B (10430 downstream)																																			---	---	---	---
CCDC144C	348254	broad.mit.edu	37	17	20280158	20280159	+	Intron	INS	-	GC	GC	rs139801618		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20280158_20280159insGC	uc010cqy.1	+							NR_023380				Homo sapiens cDNA FLJ59693 complete cds, moderately similar to Ankyrin repeat domain-containing protein 26.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	20713836	20713836	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20713836delT								LGALS9B (342988 upstream) : CCDC144NL (52874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	20760008	20760008	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20760008delA								LGALS9B (389160 upstream) : CCDC144NL (6702 downstream)																																			---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20770890	20770890	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20770890delA	uc002gyf.2	-						uc002gyg.1_5'Flank|uc002gyh.1_5'Flank	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20772154	20772155	+	Intron	INS	-	A	A	rs140129415		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20772154_20772155insA	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	21514204	21514204	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21514204delG								C17orf51 (36473 upstream) : FAM27L (311166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21515725	21515726	+	IGR	INS	-	TA	TA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21515725_21515726insTA								C17orf51 (37994 upstream) : FAM27L (309644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21667930	21667930	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21667930delA								C17orf51 (190199 upstream) : FAM27L (157440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21827945	21827946	+	IGR	DEL	TG	-	-	rs67407943		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21827945_21827946delTG								FAM27L (1442 upstream) : FLJ36000 (76116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22176132	22176132	+	IGR	DEL	A	-	-	rs112062309		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22176132delA								FLJ36000 (263062 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25280643	25280643	+	IGR	DEL	G	-	-	rs112681301		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25280643delG								None (None upstream) : WSB1 (340463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25281690	25281691	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25281690_25281691insA								None (None upstream) : WSB1 (339415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25365135	25365135	+	IGR	DEL	C	-	-	rs71359205		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25365135delC								None (None upstream) : WSB1 (255971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25395843	25395843	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25395843delC								None (None upstream) : WSB1 (225263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25781237	25781237	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25781237delA								WSB1 (140592 upstream) : KSR1 (17799 downstream)																																			---	---	---	---
C17orf63	55731	broad.mit.edu	37	17	27101164	27101165	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27101164_27101165insT	uc002hct.1	-						C17orf63_uc010wax.1_Intron|C17orf63_uc010way.1_Intron|C17orf63_uc002hcw.2_Intron	NM_018182	NP_060652			hypothetical protein LOC55731											ovary(1)	1	all_epithelial(6;5.06e-20)|Lung NSC(42;0.01)		Epithelial(11;3.38e-06)|all cancers(11;2.46e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.104)															---	---	---	---
CCDC55	84081	broad.mit.edu	37	17	28477409	28477409	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28477409delT	uc002heu.2	+						CCDC55_uc002hev.2_Intron|CCDC55_uc010wbl.1_Intron|CCDC55_uc010wbm.1_Intron	NM_032141	NP_115517			coiled-coil domain containing 55 isoform 1						developmental process|nucleocytoplasmic transport|regulation of alternative nuclear mRNA splicing, via spliceosome	nuclear speck|ribonucleoprotein complex	mRNA binding|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	30053339	30053339	+	IGR	DEL	T	-	-	rs11327384		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30053339delT								MIR365-2 (150799 upstream) : C17orf79 (125546 downstream)																																			---	---	---	---
SUZ12	23512	broad.mit.edu	37	17	30310293	30310294	+	Intron	INS	-	T	T	rs34878231		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30310293_30310294insT	uc002hgs.2	+						SUZ12_uc002hgt.2_Intron	NM_015355	NP_056170			joined to JAZF1						negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)						T	JAZF1	endometrial stromal tumours								---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	31168795	31168798	+	Intron	DEL	AGGA	-	-	rs111839050		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31168795_31168798delAGGA	uc002hho.1	-						MYO1D_uc002hhp.1_Intron|MYO1D_uc010wcb.1_Intron	NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31730328	31730329	+	Intron	INS	-	C	C	rs143349613	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31730328_31730329insC	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
GGNBP2	79893	broad.mit.edu	37	17	34930247	34930247	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34930247delT	uc002hnb.2	+						GGNBP2_uc002hna.2_Intron|GGNBP2_uc002hnc.1_5'Flank	NM_024835	NP_079111			zinc finger protein 403						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	35035116	35035116	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35035116delT								MRM1 (69710 upstream) : LHX1 (259383 downstream)																																			---	---	---	---
LOC284100	284100	broad.mit.edu	37	17	36211381	36211382	+	Intron	DEL	CT	-	-	rs111642177		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36211381_36211382delCT	uc002hom.1	-						LOC284100_uc002hon.1_Intron					Homo sapiens cDNA FLJ37577 fis, clone BRCOC2003513, moderately similar to 14-3-3 protein epsilon (14-3-3E).												0																		---	---	---	---
LOC284100	284100	broad.mit.edu	37	17	36237852	36237853	+	Intron	INS	-	AAC	AAC	rs150955768	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36237852_36237853insAAC	uc002hon.1	-							NR_024178				Homo sapiens cDNA FLJ37577 fis, clone BRCOC2003513, moderately similar to 14-3-3 protein epsilon (14-3-3E).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	36316750	36316750	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36316750delT								TBC1D3 (21652 upstream) : MRPL45 (136248 downstream)																																			---	---	---	---
TBC1D3	729873	broad.mit.edu	37	17	36375921	36375921	+	5'Flank	DEL	A	-	-	rs33929137		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36375921delA	uc010wdn.1	-						uc002hpx.2_Intron					Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
PLXDC1	57125	broad.mit.edu	37	17	37247141	37247142	+	Intron	DEL	TC	-	-	rs66505513	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37247141_37247142delTC	uc002hrg.2	-						uc002hrf.1_Intron|PLXDC1_uc002hrh.2_Intron|PLXDC1_uc002hri.2_Intron|PLXDC1_uc002hrj.1_Intron|PLXDC1_uc002hrk.1_Intron	NM_020405	NP_065138			plexin domain containing 1 precursor						angiogenesis	cytoplasm|extracellular region|integral to membrane|tight junction				ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	37328992	37328995	+	IGR	DEL	ACAC	-	-	rs10540812		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37328992_37328995delACAC								ARL5C (5674 upstream) : CACNB1 (714 downstream)																																			---	---	---	---
CDK12	51755	broad.mit.edu	37	17	37652048	37652048	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37652048delA	uc010cvv.2	+						CDK12_uc010wef.1_Intron|CDK12_uc002hrw.3_Intron	NM_016507	NP_057591			Cdc2-related kinase, arginine/serine-rich						mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19															TCGA Ovarian(9;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	37745821	37745822	+	IGR	INS	-	AAAT	AAAT	rs139502270	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37745821_37745822insAAAT								CDK12 (55022 upstream) : NEUROD2 (14200 downstream)																																			---	---	---	---
KRTAP9-9	81870	broad.mit.edu	37	17	39402885	39402885	+	Intron	DEL	G	-	-	rs58161938		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39402885delG	uc010wfq.1	+							NM_030975	NP_112237			keratin associated protein 9-9							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	39457426	39457426	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39457426delG								KRTAP9-9 (44811 upstream) : KRTAP17-1 (13745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	39947052	39947053	+	IGR	INS	-	CGCG	CGCG	rs149875156	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39947052_39947053insCGCG								JUP (4088 upstream) : SC65 (11153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	40708031	40708034	+	5'Flank	DEL	AAGA	-	-	rs139366873		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40708031_40708034delAAGA	uc002hzy.2	-											Homo sapiens cDNA FLJ32461 fis, clone SKNMC1000168.																														---	---	---	---
BRCA1	672	broad.mit.edu	37	17	41308261	41308262	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41308261_41308262insA	uc010whp.1	-						uc002idi.1_Intron	NM_007298	NP_009229			breast cancer 1, early onset isoform 4						androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)				D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41379361	41379362	+	Intron	INS	-	AT	AT	rs111980608		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41379361_41379362insAT	uc002ido.2	-						uc010wia.1_5'Flank					Homo sapiens cDNA clone IMAGE:5169062, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	41708390	41708391	+	IGR	INS	-	TCTTCT	TCTTCT	rs72208449		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41708390_41708391insTCTTCT								ETV4 (84628 upstream) : MEOX1 (9376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41798732	41798733	+	IGR	INS	-	A	A	rs111642523		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41798732_41798733insA								MEOX1 (59470 upstream) : SOST (32366 downstream)																																			---	---	---	---
CD300LG	146894	broad.mit.edu	37	17	41929576	41929576	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41929576delT	uc002iem.2	+						CD300LG_uc002iel.1_Intron|CD300LG_uc010czk.2_Intron|CD300LG_uc010wil.1_Intron|CD300LG_uc010czl.2_Intron	NM_145273	NP_660316			CD300 molecule-like family member g precursor							apical plasma membrane|basolateral plasma membrane|integral to membrane|multivesicular body membrane	receptor activity				0		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	43000527	43000528	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43000527_43000528insC								GFAP (7613 upstream) : KIF18B (1551 downstream)																																			---	---	---	---
LOC100128977	100128977	broad.mit.edu	37	17	43947880	43947881	+	Intron	DEL	GT	-	-	rs55852552		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43947880_43947881delGT	uc010wjz.1	-							NR_024559				Homo sapiens cDNA clone IMAGE:4819956.												0																		---	---	---	---
MAPT	4137	broad.mit.edu	37	17	44080466	44080467	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44080466_44080467delGT	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519			microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44204787	44204787	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44204787delG	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
ITGB3	3690	broad.mit.edu	37	17	45377700	45377701	+	Intron	INS	-	GC	GC	rs113076632		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377700_45377701insGC	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203			integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	45564852	45564853	+	Intron	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45564852_45564853delTT	uc002ilp.1	-						uc002ilq.2_Intron					Homo sapiens cDNA clone IMAGE:5266250, containing frame-shift errors.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	47603596	47603600	+	IGR	DEL	CTTTA	-	-	rs150530049		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47603596_47603600delCTTTA								NGFR (11231 upstream) : NXPH3 (49698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	48292460	48292460	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48292460delT								COL1A1 (13460 upstream) : TMEM92 (59377 downstream)																																			---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49040756	49040756	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49040756delA	uc002itc.2	-	30					SPAG9_uc002itb.2_3'UTR|SPAG9_uc002itd.2_3'UTR|SPAG9_uc002ita.2_3'UTR	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
SPAG9	9043	broad.mit.edu	37	17	49081423	49081423	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49081423delC	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000			sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	49500446	49500446	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49500446delC								UTP18 (125156 upstream) : CA10 (207229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	49627802	49627802	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49627802delG								UTP18 (252512 upstream) : CA10 (79873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50364797	50364797	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50364797delT								CA10 (127420 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50399448	50399449	+	IGR	INS	-	T	T	rs75011781		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50399448_50399449insT								CA10 (162071 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50818938	50818939	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50818938_50818939insA								CA10 (581561 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52930866	52930867	+	IGR	INS	-	CAGA	CAGA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52930866_52930867insCAGA								None (None upstream) : TOM1L1 (47185 downstream)																																			---	---	---	---
TOM1L1	10040	broad.mit.edu	37	17	53030584	53030585	+	Intron	INS	-	A	A	rs143941205	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53030584_53030585insA	uc002iud.2	+						TOM1L1_uc010dca.1_Intron|TOM1L1_uc010wnb.1_Intron|TOM1L1_uc010wnc.1_Intron|TOM1L1_uc010dbz.2_Intron|TOM1L1_uc010wnd.1_Intron|COX11_uc010wne.1_Intron|COX11_uc010wnf.1_Intron|COX11_uc002iue.2_Intron	NM_005486	NP_005477			target of myb1-like 1						intracellular protein transport|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway	cytosol|endosome membrane|Golgi stack|lysosome	SH3 domain binding|ubiquitin binding			ovary(1)	1																		---	---	---	---
STXBP4	252983	broad.mit.edu	37	17	53081544	53081544	+	Intron	DEL	A	-	-	rs79704629		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53081544delA	uc002iuf.1	+						STXBP4_uc010dcc.1_Intron|STXBP4_uc010dcd.1_Intron	NM_178509	NP_848604			syntaxin binding protein 4							cytoplasm	calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	53282905	53282906	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53282905_53282906delCA								STXBP4 (41456 upstream) : HLF (59415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	53571687	53571688	+	IGR	INS	-	A	A	rs147657873	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53571687_53571688insA								MMD (72346 upstream) : TMEM100 (225302 downstream)																																			---	---	---	---
RNF126P1	376412	broad.mit.edu	37	17	55120344	55120345	+	5'Flank	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55120344_55120345insT	uc002iuw.2	+							NR_002818				Homo sapiens ring finger protein 126 pseudogene 1, mRNA (cDNA clone IMAGE:5166840), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	55776396	55776407	+	IGR	DEL	GAGAGAGAGAGT	-	-	rs72400722		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55776396_55776407delGAGAGAGAGAGT								MSI2 (19097 upstream) : MRPS23 (140437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	55843303	55843304	+	IGR	INS	-	A	A	rs142781783	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55843303_55843304insA								MSI2 (86004 upstream) : MRPS23 (73540 downstream)																																			---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56688244	56688245	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56688244_56688245insA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56718005	56718006	+	Intron	INS	-	GTGA	GTGA	rs150602548	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56718005_56718006insGTGA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
RAD51C	5889	broad.mit.edu	37	17	56794133	56794134	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56794133_56794134insT	uc002iwu.2	+						RAD51C_uc010woa.1_Intron|RAD51C_uc010ddc.2_Intron|RAD51C_uc002iwv.2_Intron|RAD51C_uc002iww.2_Intron	NM_058216	NP_478123			RAD51 homolog C isoform 1						blood coagulation|DNA repair	mitochondrion|nucleoplasm|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)												Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2				---	---	---	---
YPEL2	388403	broad.mit.edu	37	17	57472599	57472600	+	Intron	INS	-	AG	AG	rs138785195	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57472599_57472600insAG	uc002ixm.1	+							NM_001005404	NP_001005404			yippee-like 2							nucleolus					0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)																	---	---	---	---
USP32	84669	broad.mit.edu	37	17	58463380	58463381	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58463380_58463381delAC	uc002iyo.1	-						USP32_uc010wov.1_Intron	NM_032582	NP_115971			ubiquitin specific protease 32						protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	58608746	58608747	+	IGR	DEL	TT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58608746_58608747delTT								APPBP2 (5166 upstream) : PPM1D (68807 downstream)																																			---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59085275	59085276	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59085275_59085276insA	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59475234	59475237	+	5'Flank	DEL	ACAC	-	-	rs35898829		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59475234_59475237delACAC	uc010wox.1	+						TBX2_uc002ize.2_5'Flank|TBX2_uc002izg.2_5'Flank	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59480289	59480308	+	Intron	DEL	GATAGAGAGAGAGAGAGAGA	-	-	rs72277883		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480289_59480308delGATAGAGAGAGAGAGAGAGA	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59846305	59846306	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59846305_59846306insA	uc002izk.1	-						BRIP1_uc002izl.1_Intron	NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59901119	59901120	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59901119_59901120delAC	uc002izk.1	-							NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
MARCH10	162333	broad.mit.edu	37	17	60852868	60852868	+	Intron	DEL	C	-	-	rs138680582	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60852868delC	uc010ddr.2	-						MARCH10_uc002jag.3_Intron|MARCH10_uc010dds.2_Intron|MARCH10_uc002jah.2_Intron	NM_001100875	NP_001094345			ring finger protein 190								ligase activity|zinc ion binding				0																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61166046	61166046	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61166046delA	uc002jal.3	+							NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61243671	61243676	+	Intron	DEL	AGAGAG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61243671_61243676delAGAGAG	uc002jal.3	+							NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61417821	61417822	+	Intron	INS	-	G	G	rs149241724	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61417821_61417822insG	uc002jal.3	+						TANC2_uc010wpe.1_Intron	NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
AMZ2P1	201283	broad.mit.edu	37	17	62973864	62973864	+	5'Flank	DEL	T	-	-	rs111405188		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62973864delT	uc002jez.3	-						AMZ2P1_uc002jfa.3_5'Flank|AMZ2P1_uc002jfb.3_5'Flank|AMZ2P1_uc010del.2_5'Flank					Homo sapiens cDNA FLJ32065 fis, clone OCBBF1000086, weakly similar to Archeobacterial metalloproteinase-like protein 2 (EC 3.-.-.-).												0																		---	---	---	---
AXIN2	8313	broad.mit.edu	37	17	63611581	63611582	+	Intron	INS	-	CA	CA	rs148176927	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63611581_63611582insCA	uc010den.1	-							NM_004655	NP_004646			axin 2						cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2														Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63789696	63789697	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63789696_63789697delTC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
BPTF	2186	broad.mit.edu	37	17	65904607	65904608	+	Intron	INS	-	T	T	rs34537462		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65904607_65904608insT	uc002jgf.2	+						BPTF_uc002jge.2_Intron	NM_182641	NP_872579			bromodomain PHD finger transcription factor						brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	66482528	66482535	+	IGR	DEL	TCTTTCTT	-	-	rs71848381		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66482528_66482535delTCTTTCTT								WIPI1 (28875 upstream) : PRKAR1A (25575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	66659558	66659558	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66659558delT								FAM20A (62463 upstream) : ABCA8 (203875 downstream)																																			---	---	---	---
MAP2K6	5608	broad.mit.edu	37	17	67531120	67531120	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67531120delT	uc002jij.2	+							NM_002758	NP_002749			mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	68580703	68580703	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68580703delC								KCNJ2 (404522 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69481929	69481930	+	IGR	INS	-	A	A	rs113893013		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69481929_69481930insA								None (None upstream) : SOX9 (635231 downstream)																																			---	---	---	---
FAM104A	84923	broad.mit.edu	37	17	71220961	71220965	+	Intron	DEL	CAGCA	-	-	rs10547050		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71220961_71220965delCAGCA	uc002jji.3	-						FAM104A_uc002jjj.3_Intron	NM_032837	NP_116226			hypothetical protein LOC84923 isoform 2												0			LUSC - Lung squamous cell carcinoma(166;0.197)															---	---	---	---
SDK2	54549	broad.mit.edu	37	17	71570234	71570235	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71570234_71570235insG	uc010dfm.2	-							NM_001144952	NP_001138424			sidekick 2						cell adhesion	integral to membrane				ovary(2)	2																		---	---	---	---
SRP68	6730	broad.mit.edu	37	17	74066932	74066933	+	Intron	DEL	CA	-	-	rs149561801		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74066932_74066933delCA	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron	NM_014230	NP_055045			signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	74648132	74648133	+	IGR	INS	-	AATG	AATG	rs141491864	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74648132_74648133insAATG								ST6GALNAC1 (8238 upstream) : MXRA7 (23676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75952405	75952406	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75952405_75952406insT								FLJ45079 (72236 upstream) : TNRC6C (47912 downstream)																																			---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77333338	77333338	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77333338delA	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	77910735	77910740	+	RNA	DEL	GTGTGC	-	-	rs71281811		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77910735_77910740delGTGTGC	uc002jxg.1	-	1		c.1538_1543delGCACAC								Homo sapiens cDNA FLJ20748 fis, clone HEP05772.																														---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78329807	78329808	+	Intron	INS	-	T	T	rs142616352		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78329807_78329808insT	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhw.1_Intron	NM_020914	NP_065965			ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---
FOXK2	3607	broad.mit.edu	37	17	80544424	80544425	+	Intron	INS	-	A	A	rs113255929		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544424_80544425insA	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505			forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)															---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80806939	80806940	+	Intron	INS	-	CG	CG	rs57126469		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80806939_80806940insCG	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984			beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	80954563	80954564	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80954563_80954564insA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron|B3GNTL1_uc002kge.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	81005899	81005902	+	Intron	DEL	TCTC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81005899_81005902delTCTC	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	881490	881491	+	IGR	INS	-	TG	TG	rs141022932	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:881490_881491insTG								YES1 (68948 upstream) : ADCYAP1 (23453 downstream)																																			---	---	---	---
SMCHD1	23347	broad.mit.edu	37	18	2749467	2749467	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2749467delA	uc002klm.3	+						SMCHD1_uc002klk.3_Intron|SMCHD1_uc002kll.3_Intron	NM_015295	NP_056110			structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0																		---	---	---	---
EMILIN2	84034	broad.mit.edu	37	18	2905780	2905781	+	Intron	DEL	TG	-	-	rs138391028		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2905780_2905781delTG	uc002kln.2	+							NM_032048	NP_114437			elastin microfibril interfacer 2 precursor						cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			skin(2)|ovary(1)	3				READ - Rectum adenocarcinoma(2;0.1)														---	---	---	---
TGIF1	7050	broad.mit.edu	37	18	3448107	3448108	+	Intron	INS	-	T	T	rs143973647	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3448107_3448108insT	uc002klv.2	+						TGIF1_uc002klu.2_Intron|TGIF1_uc002klx.2_5'Flank|TGIF1_uc002klw.2_5'Flank|TGIF1_uc010dkm.1_5'Flank|TGIF1_uc002kly.2_5'Flank	NM_173207	NP_775299			TG-interacting factor isoform b						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4006649	4006649	+	Intron	DEL	T	-	-	rs33937231		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4006649delT	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4306427	4306430	+	Intron	DEL	GTGT	-	-	rs151166062		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4306427_4306430delGTGT	uc010wyz.1	-							NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4326498	4326498	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4326498delC	uc010wyz.1	-							NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	5903507	5903508	+	IGR	INS	-	AA	AA	rs143816273	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5903507_5903508insAA								TMEM200C (11404 upstream) : L3MBTL4 (51198 downstream)																																			---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7689147	7689148	+	Intron	INS	-	T	T	rs149010072	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7689147_7689148insT	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
TWSG1	57045	broad.mit.edu	37	18	9339202	9339203	+	Intron	INS	-	A	A	rs111937336		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9339202_9339203insA	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699			twisted gastrulation precursor											ovary(1)|pancreas(1)	2																		---	---	---	---
TWSG1	57045	broad.mit.edu	37	18	9396146	9396146	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9396146delA	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699			twisted gastrulation precursor											ovary(1)|pancreas(1)	2																		---	---	---	---
RAB31	11031	broad.mit.edu	37	18	9712724	9712740	+	Intron	DEL	TGCGTGCACTTAAAAAC	-	-	rs6146211		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9712724_9712740delTGCGTGCACTTAAAAAC	uc002kog.2	+							NM_006868	NP_006859			RAB31, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	11053853	11053853	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11053853delA								FAM38B (351874 upstream) : GNAL (635283 downstream)																																			---	---	---	---
GNAL	2774	broad.mit.edu	37	18	11696503	11696504	+	Intron	INS	-	A	A	rs71367577		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11696503_11696504insA	uc002kqc.2	+							NM_182978	NP_892023			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	11946037	11946038	+	IGR	INS	-	GT	GT	rs138636467	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11946037_11946038insGT								MPPE1 (37396 upstream) : IMPA2 (35019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	12785130	12785130	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12785130delT								PSMG2 (59393 upstream) : PTPN2 (351 downstream)																																			---	---	---	---
C18orf1	753	broad.mit.edu	37	18	13591432	13591433	+	Intron	DEL	TG	-	-	rs137990374		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13591432_13591433delTG	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146			hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	14975544	14975545	+	IGR	INS	-	G	G	rs146263650	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14975544_14975545insG								ANKRD30B (122807 upstream) : LOC644669 (338010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15173121	15173122	+	IGR	INS	-	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15173121_15173122insC								ANKRD30B (320384 upstream) : LOC644669 (140433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15404673	15404674	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15404673_15404674delTG								LOC644669 (78755 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15407196	15407197	+	IGR	DEL	CA	-	-	rs150221454		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15407196_15407197delCA								LOC644669 (81278 upstream) : None (None downstream)																																			---	---	---	---
MIB1	57534	broad.mit.edu	37	18	19363628	19363628	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19363628delT	uc002ktq.2	+						MIB1_uc002ktp.2_Intron	NM_020774	NP_065825			mindbomb homolog 1						Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	20406456	20406457	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20406456_20406457delGT								CTAGE1 (408578 upstream) : RBBP8 (106838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20620081	20620082	+	IGR	INS	-	GAAA	GAAA	rs10682726		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20620081_20620082insGAAA								RBBP8 (13636 upstream) : CABLES1 (94446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	21076284	21076284	+	IGR	DEL	T	-	-	rs112846402		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21076284delT								RIOK3 (13187 upstream) : C18orf8 (7178 downstream)																																			---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21684652	21684653	+	Intron	INS	-	TG	TG	rs149739004	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21684652_21684653insTG	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21709757	21709757	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21709757delG	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	25121690	25121691	+	Intron	INS	-	AC	AC	rs144016852	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25121690_25121691insAC	uc002kwf.1	-											Homo sapiens cDNA FLJ45994 fis, clone SKMUS2009557.																														---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25752041	25752044	+	Intron	DEL	GTGT	-	-	rs72438915		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25752041_25752044delGTGT	uc002kwg.2	-							NM_001792	NP_001783			cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	26861568	26861569	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26861568_26861569insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27457407	27457408	+	IGR	INS	-	G	G	rs141116334	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27457407_27457408insG								None (None upstream) : MIR302F (421468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27675317	27675317	+	IGR	DEL	T	-	-	rs35233460		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27675317delT								None (None upstream) : MIR302F (203559 downstream)																																			---	---	---	---
DSG3	1830	broad.mit.edu	37	18	29031351	29031351	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29031351delT	uc002kws.2	+							NM_001944	NP_001935			desmoglein 3 preproprotein						cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)															---	---	---	---
RNF125	54941	broad.mit.edu	37	18	29635550	29635550	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29635550delA	uc002kxf.1	+							NM_017831	NP_060301			ring finger protein 125						negative regulation of type I interferon production	intracellular	ligase activity|zinc ion binding				0																		---	---	---	---
GALNT1	2589	broad.mit.edu	37	18	33203279	33203279	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33203279delT	uc010dmu.2	+						GALNT1_uc002kyz.3_Intron	NM_020474	NP_065207			polypeptide N-acetylgalactosaminyltransferase 1						protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2																		---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	33924373	33924374	+	Intron	INS	-	A	A	rs75320956		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33924373_33924374insA	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron	NM_025135	NP_079411			formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
CELF4	56853	broad.mit.edu	37	18	35102482	35102483	+	Intron	INS	-	CA	CA	rs144071944	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35102482_35102483insCA	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565			bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	36335193	36335193	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36335193delA								None (None upstream) : LOC647946 (451695 downstream)																																			---	---	---	---
LOC647946	647946	broad.mit.edu	37	18	37318954	37318955	+	Intron	DEL	TG	-	-	rs113115185		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37318954_37318955delTG	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	41148044	41148044	+	IGR	DEL	T	-	-	rs34014826		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41148044delT								SYT4 (290429 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	41399277	41399277	+	IGR	DEL	T	-	-	rs34740847		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41399277delT								SYT4 (541662 upstream) : SETBP1 (860861 downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42335446	42335447	+	Intron	DEL	TT	-	-	rs112797626		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42335446_42335447delTT	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42527457	42527458	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42527457_42527458insT	uc010dni.2	+							NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
C18orf25	147339	broad.mit.edu	37	18	43815638	43815641	+	Intron	DEL	TTCT	-	-	rs142133670		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43815638_43815641delTTCT	uc002lbw.2	+						C18orf25_uc002lbx.2_Intron	NM_145055	NP_659492			ARKadia-like 1 isoform a											central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	45293754	45293754	+	IGR	DEL	A	-	-	rs12457164		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45293754delA								IER3IP1 (591009 upstream) : SMAD2 (65713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	45982432	45982433	+	IGR	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs151123488	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45982432_45982433insTGTGTGTGTG								ZBTB7C (46769 upstream) : KIAA0427 (82994 downstream)																																			---	---	---	---
DYM	54808	broad.mit.edu	37	18	46889027	46889027	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46889027delA	uc002ldi.1	-						DYM_uc010xdf.1_Intron	NM_017653	NP_060123			dymeclin							Golgi apparatus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	47272567	47272568	+	IGR	INS	-	T	T	rs141976939	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47272567_47272568insT								LIPG (153291 upstream) : ACAA2 (37307 downstream)																																			---	---	---	---
MBD1	4152	broad.mit.edu	37	18	47808208	47808217	+	5'Flank	DEL	GCGGTCTCCA	-	-	rs150192868	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47808208_47808217delGCGGTCTCCA	uc010dow.1	-						MBD1_uc002leg.2_5'Flank|MBD1_uc010xdi.1_5'Flank|MBD1_uc002leh.3_5'Flank|MBD1_uc002len.2_5'Flank|MBD1_uc002lei.3_5'Flank|MBD1_uc002lej.3_5'Flank|MBD1_uc002lek.3_5'Flank|MBD1_uc002lel.3_5'Flank|MBD1_uc002lem.3_5'Flank|MBD1_uc010xdj.1_5'Flank|MBD1_uc010xdk.1_5'Flank|MBD1_uc010dox.1_5'Flank|MBD1_uc002leo.2_5'Flank	NM_015846	NP_056671			methyl-CpG binding domain protein 1 isoform 1						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	49566112	49566112	+	IGR	DEL	A	-	-	rs113803368		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49566112delA								MEX3C (842422 upstream) : DCC (300459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	49792833	49792833	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49792833delA								None (None upstream) : DCC (73738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	52394050	52394050	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52394050delT								C18orf26 (127326 upstream) : RAB27B (101790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	53524588	53524588	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53524588delA								TCF4 (221403 upstream) : TXNL1 (745467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	54707179	54707192	+	IGR	DEL	GCGCATGCACACAC	-	-	rs111913465		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54707179_54707192delGCGCATGCACACAC								WDR7 (10143 upstream) : ST8SIA3 (312529 downstream)																																			---	---	---	---
SEC11C	90701	broad.mit.edu	37	18	56818195	56818195	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56818195delT	uc002lht.2	+						SEC11C_uc010dpo.1_Intron|SEC11C_uc010xej.1_Intron	NM_033280	NP_150596			SEC11-like 3						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	serine-type peptidase activity				0		Colorectal(73;0.175)																---	---	---	---
CPLX4	339302	broad.mit.edu	37	18	56964511	56964511	+	Intron	DEL	T	-	-	rs142082605		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56964511delT	uc002lhy.2	-							NM_181654	NP_857637			complexin 4 precursor						exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding			ovary(1)	1		Colorectal(73;0.175)																---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57360188	57360203	+	Intron	DEL	GCACACACACACACAC	-	-	rs1652073	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57360188_57360203delGCACACACACACACAC	uc002lib.2	-							NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	58335956	58335956	+	IGR	DEL	T	-	-	rs11322730		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58335956delT								MC4R (295955 upstream) : CDH20 (665032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	58463299	58463302	+	IGR	DEL	TTTG	-	-	rs140745013		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58463299_58463302delTTTG								MC4R (423298 upstream) : CDH20 (537686 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	60268834	60268834	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60268834delA								ZCCHC2 (14872 upstream) : PHLPP1 (113900 downstream)																																			---	---	---	---
BCL2	596	broad.mit.edu	37	18	60865411	60865412	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60865411_60865412delAC	uc002lit.1	-						BCL2_uc002liu.1_Intron	NM_000633	NP_000624			B-cell lymphoma protein 2 alpha isoform						activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)			T	IGH@	NHL|CLL								---	---	---	---
Unknown	0	broad.mit.edu	37	18	61501019	61501022	+	IGR	DEL	ACTT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61501019_61501022delACTT								SERPINB7 (28416 upstream) : SERPINB2 (53917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61928030	61928031	+	Intron	INS	-	A	A	rs144975642	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61928030_61928031insA	uc002ljx.2	+						uc002ljy.2_5'Flank					Homo sapiens hypothetical protein LOC284294, mRNA (cDNA clone IMAGE:4823205).																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	63994520	63994521	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63994520_63994521insT								CDH7 (446346 upstream) : CDH19 (176800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	66767834	66767835	+	IGR	INS	-	T	T	rs144708684	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66767834_66767835insT								CCDC102B (45408 upstream) : DOK6 (300456 downstream)																																			---	---	---	---
RTTN	25914	broad.mit.edu	37	18	67858781	67858782	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67858781_67858782insA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc002lkq.1_Intron	NM_173630	NP_775901			rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	68261508	68261508	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68261508delT								SOCS6 (264074 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	69318431	69318432	+	IGR	DEL	AA	-	-	rs58508455		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69318431_69318432delAA								None (None upstream) : CBLN2 (885483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	69958905	69958908	+	IGR	DEL	ACAA	-	-	rs5826138		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69958905_69958908delACAA								None (None upstream) : CBLN2 (245007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	73682953	73682953	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73682953delA								C18orf62 (543364 upstream) : ZNF516 (388666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	74504663	74504663	+	IGR	DEL	T	-	-	rs5826477		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74504663delT								LOC284276 (232880 upstream) : ZNF236 (31453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75112230	75112231	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75112230_75112231delAC								GALR1 (130136 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75173709	75173710	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75173709_75173710delTG								GALR1 (191615 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76722078	76722083	+	IGR	DEL	ACTCTC	-	-	rs72439716		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76722078_76722083delACTCTC								None (None upstream) : SALL3 (18192 downstream)																																			---	---	---	---
ODF3L2	284451	broad.mit.edu	37	19	464891	464894	+	Intron	DEL	GATG	-	-	rs71989644		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:464891_464894delGATG	uc002lor.2	-						ODF3L2_uc010drp.2_Intron	NM_182577	NP_872383			outer dense fiber of sperm tails 3-like 2												0																		---	---	---	---
SBNO2	22904	broad.mit.edu	37	19	1166615	1166622	+	Intron	DEL	CGCACACA	-	-	rs66576460		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1166615_1166622delCGCACACA	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778			strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ADAMTSL5	339366	broad.mit.edu	37	19	1509610	1509611	+	Intron	INS	-	GGAA	GGAA	rs141155053	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1509610_1509611insGGAA	uc002ltd.2	-						ADAMTSL5_uc010dsl.2_Intron|ADAMTSL5_uc010xgq.1_Intron	NM_213604	NP_998769			ADAMTS-like 5 precursor							proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ATCAY	85300	broad.mit.edu	37	19	3915554	3915554	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3915554delT	uc002lyy.3	+						ATCAY_uc010xhz.1_Intron|ATCAY_uc010dts.2_Intron	NM_033064	NP_149053			caytaxin						transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	4150591	4150592	+	IGR	INS	-	T	T	rs71339098		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4150591_4150592insT								MAP2K2 (26465 upstream) : CREB3L3 (3037 downstream)																																			---	---	---	---
ANKRD24	170961	broad.mit.edu	37	19	4197563	4197566	+	Intron	DEL	GAAT	-	-	rs141307548		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4197563_4197566delGAAT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_5'Flank	NM_133475	NP_597732			ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)														---	---	---	---
FSD1	79187	broad.mit.edu	37	19	4303516	4303517	+	5'Flank	INS	-	A	A	rs72212815		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4303516_4303517insA	uc002lzy.2	+						TMIGD2_uc002lzx.1_5'Flank|TMIGD2_uc010dtv.1_5'Flank|FSD1_uc010xie.1_5'Flank|FSD1_uc010xif.1_5'Flank|FSD1_uc002lzz.2_5'Flank	NM_024333	NP_077309			fibronectin type III and SPRY domain containing						cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
C19orf10	56005	broad.mit.edu	37	19	4668862	4668862	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4668862delT	uc002may.2	-							NM_019107	NP_061980			hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)														---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5326801	5326804	+	Intron	DEL	GGAG	-	-	rs112523885	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5326801_5326804delGGAG	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841			protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
MLLT1	4298	broad.mit.edu	37	19	6247887	6247888	+	Intron	INS	-	TTTG	TTTG	rs141160792	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6247887_6247888insTTTG	uc002mek.2	-							NM_005934	NP_005925			myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1								T	MLL	AL								---	---	---	---
INSR	3643	broad.mit.edu	37	19	7229340	7229343	+	Intron	DEL	GATA	-	-	rs71944075		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7229340_7229343delGATA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	7440265	7440273	+	IGR	DEL	AAGAAAAGG	-	-	rs10692421		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7440265_7440273delAAGAAAAGG								INSR (146254 upstream) : ARHGEF18 (7447 downstream)																																			---	---	---	---
EVI5L	115704	broad.mit.edu	37	19	7908122	7908123	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7908122_7908123delGT	uc002min.2	+							NM_145245	NP_660288			ecotropic viral integration site 5-like isoform							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9006152	9006153	+	Intron	INS	-	AA	AA			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006152_9006153insAA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966			mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9092185	9092186	+	5'Flank	DEL	CT	-	-	rs113487983		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9092185_9092186delCT	uc002mkp.2	-							NM_024690	NP_078966			mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	9109296	9109297	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9109296_9109297insA								MUC16 (17278 upstream) : OR1M1 (94624 downstream)																																			---	---	---	---
ZNF560	147741	broad.mit.edu	37	19	9607611	9607611	+	Intron	DEL	A	-	-	rs113085830		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9607611delA	uc002mlp.1	-						ZNF560_uc010dwr.1_Intron	NM_152476	NP_689689			zinc finger protein 560						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6																		---	---	---	---
ZNF561	93134	broad.mit.edu	37	19	9719470	9719470	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9719470delA	uc002mlu.2	-	6					ZNF561_uc010dwu.2_3'UTR|ZNF561_uc010xkr.1_3'UTR	NM_152289	NP_689502			zinc finger protein 561						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DNMT1	1786	broad.mit.edu	37	19	10273317	10273317	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10273317delG	uc002mng.2	-						DNMT1_uc010xlc.1_Intron|DNMT1_uc002mnh.2_Intron|DNMT1_uc010xld.1_Intron|DNMT1_uc002mnk.2_Intron	NM_001379	NP_001370			DNA (cytosine-5-)-methyltransferase 1 isoform b						chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)													---	---	---	---
AP1M2	10053	broad.mit.edu	37	19	10690210	10690210	+	Intron	DEL	A	-	-	rs60987736		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10690210delA	uc002mpc.2	-						AP1M2_uc002mpd.2_Intron	NM_005498	NP_005489			adaptor-related protein complex 1, mu 2 subunit						cellular membrane organization|post-Golgi vesicle-mediated transport|protein targeting|regulation of defense response to virus by virus|vesicle targeting|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(2)	2			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)															---	---	---	---
TSPAN16	26526	broad.mit.edu	37	19	11408630	11408631	+	Intron	INS	-	T	T	rs146250346	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11408630_11408631insT	uc002mqv.1	+						TSPAN16_uc002mqu.1_Intron	NM_012466	NP_036598			transmembrane 4 superfamily member 16							integral to membrane				skin(1)	1																		---	---	---	---
ZNF788	388507	broad.mit.edu	37	19	12200973	12200976	+	5'Flank	DEL	TTTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12200973_12200976delTTTG	uc002mtd.2	+						ZNF788_uc002mtc.1_5'Flank	NR_027049				RecName: Full=Zinc finger protein 788;												0																		---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13549923	13549923	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13549923delT	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	13824785	13824785	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13824785delA								CACNA1A (207511 upstream) : CCDC130 (17789 downstream)																																			---	---	---	---
PRKACA	5566	broad.mit.edu	37	19	14222210	14222210	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14222210delA	uc002myc.2	-						PRKACA_uc002myb.2_Intron|PRKACA_uc010xnm.1_Intron	NM_002730	NP_002721			cAMP-dependent protein kinase catalytic subunit						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|gluconeogenesis|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|regulation of insulin secretion|transmembrane transport|triglyceride catabolic process|water transport	cAMP-dependent protein kinase complex|centrosome|cytosol|nucleoplasm|plasma membrane	ATP binding|cAMP-dependent protein kinase activity|cAMP-dependent protein kinase inhibitor activity|protein kinase binding			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	15245542	15245543	+	IGR	DEL	AG	-	-	rs71168577		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15245542_15245543delAG								ILVBL (8965 upstream) : NOTCH3 (24902 downstream)																																			---	---	---	---
AKAP8	10270	broad.mit.edu	37	19	15469171	15469171	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15469171delT	uc002nav.2	-						AKAP8_uc010dzy.2_Intron	NM_005858	NP_005849			A-kinase anchor protein 8						signal transduction	nuclear matrix				ovary(1)|breast(1)	2																		---	---	---	---
LOC126536	126536	broad.mit.edu	37	19	16127497	16127503	+	Intron	DEL	TGCCCTT	-	-	rs111815826	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16127497_16127503delTGCCCTT	uc002nbw.2	+						LOC126536_uc002nbz.1_5'Flank	NR_026828				Homo sapiens cDNA FLJ46374 fis, clone TESTI4052217.												0																		---	---	---	---
EPS15L1	58513	broad.mit.edu	37	19	16575612	16575612	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16575612delC	uc002ndz.1	-						EPS15L1_uc002ndx.2_Intron|EPS15L1_uc002ndy.2_Intron|EPS15L1_uc010xpf.1_Intron|EPS15L1_uc002nea.1_Intron|EPS15L1_uc010eah.1_Intron|EPS15L1_uc002nec.1_Intron	NM_021235	NP_067058			epidermal growth factor receptor pathway						endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	17852171	17852171	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17852171delC								MAP1S (6847 upstream) : FCHO1 (6356 downstream)																																			---	---	---	---
FKBP8	23770	broad.mit.edu	37	19	18656310	18656311	+	5'Flank	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18656310_18656311insT	uc002njk.1	-						FKBP8_uc010xqi.1_5'Flank|FKBP8_uc002njj.1_5'Flank|FKBP8_uc002njl.1_5'Flank|FKBP8_uc002njm.1_5'Flank|FKBP8_uc010ebr.1_5'Flank	NM_012181	NP_036313			FK506-binding protein 8						apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1																		---	---	---	---
SLC25A42	284439	broad.mit.edu	37	19	19177830	19177831	+	Intron	INS	-	A	A	rs140150789		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19177830_19177831insA	uc002nlf.1	+							NM_178526	NP_848621			solute carrier family 25, member 42						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)															---	---	---	---
SLC25A42	284439	broad.mit.edu	37	19	19177839	19177840	+	Intron	INS	-	C	C	rs11419955		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19177839_19177840insC	uc002nlf.1	+							NM_178526	NP_848621			solute carrier family 25, member 42						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)															---	---	---	---
GATAD2A	54815	broad.mit.edu	37	19	19498866	19498866	+	Intron	DEL	C	-	-	rs756998		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19498866delC	uc010xqt.1	+						GATAD2A_uc010xqu.1_Intron	NM_017660	NP_060130			GATA zinc finger domain containing 2A						DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	19970038	19970039	+	IGR	INS	-	A	A	rs34661226		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19970038_19970039insA								ZNF506 (37478 upstream) : ZNF253 (6675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	20928713	20928714	+	IGR	INS	-	G	G	rs143151121	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20928713_20928714insG								ZNF626 (84311 upstream) : ZNF85 (177366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	21817605	21817605	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21817605delG								ZNF429 (78537 upstream) : ZNF100 (89239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	21871207	21871207	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21871207delT								ZNF429 (132139 upstream) : ZNF100 (35637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23012031	23012032	+	IGR	DEL	AA	-	-	rs74175708		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23012031_23012032delAA								ZNF99 (59247 upstream) : ZNF91 (509387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24483926	24483926	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24483926delT								LOC100101266 (137677 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27761042	27761042	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27761042delT								None (None upstream) : LOC148189 (520360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27845351	27845352	+	IGR	DEL	AA	-	-	rs71221284		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27845351_27845352delAA								None (None upstream) : LOC148189 (436050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27871042	27871042	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27871042delT								None (None upstream) : LOC148189 (410360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28484895	28484896	+	IGR	INS	-	A	A	rs150515106	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28484895_28484896insA								LOC148189 (200047 upstream) : LOC148145 (971144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29481412	29481413	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29481412_29481413insA								LOC148145 (21357 upstream) : UQCRFS1 (216754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29642726	29642727	+	IGR	INS	-	A	A	rs147598908	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29642726_29642727insA								LOC148145 (182671 upstream) : UQCRFS1 (55440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30069795	30069796	+	IGR	INS	-	A	A	rs142538886	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30069795_30069796insA								VSTM2B (14569 upstream) : POP4 (27374 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31083598	31083599	+	IGR	INS	-	T	T	rs71867059		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31083598_31083599insT								ZNF536 (34633 upstream) : DKFZp566F0947 (557184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32375096	32375096	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32375096delA								TSHZ3 (534906 upstream) : ZNF507 (461418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32656680	32656680	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32656680delA								TSHZ3 (816490 upstream) : ZNF507 (179834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33028637	33028637	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33028637delA								DPY19L3 (53401 upstream) : PDCD5 (43467 downstream)																																			---	---	---	---
TDRD12	91646	broad.mit.edu	37	19	33224376	33224377	+	Intron	INS	-	A	A	rs112344619		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33224376_33224377insA	uc002ntq.2	+						TDRD12_uc002ntr.3_Intron					RecName: Full=Tudor domain-containing protein 12; AltName: Full=ES cell-associated transcript 8 protein;								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	Esophageal squamous(110;0.137)																	---	---	---	---
CCDC123	84902	broad.mit.edu	37	19	33431672	33431672	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33431672delT	uc002nty.2	-						CCDC123_uc002ntx.2_Intron|CCDC123_uc010edg.2_Intron|CCDC123_uc002ntz.1_Intron|CCDC123_uc002nua.2_Intron|CCDC123_uc002nub.1_Intron	NM_032816	NP_116205			coiled-coil domain containing 123							centrosome|spindle pole					0	Esophageal squamous(110;0.137)																	---	---	---	---
PEPD	5184	broad.mit.edu	37	19	33913742	33913745	+	Intron	DEL	ATCC	-	-	rs67527887		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33913742_33913745delATCC	uc002nur.3	-						PEPD_uc010xrr.1_Intron|PEPD_uc010xrs.1_Intron	NM_000285	NP_000276			prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34389506	34389507	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34389506_34389507insT								KCTD15 (82841 upstream) : LSM14A (273845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	37753117	37753118	+	Intron	INS	-	C	C	rs143805706	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37753117_37753118insC	uc002ofv.2	+											Homo sapiens, clone IMAGE:5247201, mRNA.																														---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38608260	38608261	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38608260_38608261insA	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
NFKBIB	4793	broad.mit.edu	37	19	39395390	39395393	+	Intron	DEL	TTGT	-	-	rs68113781		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39395390_39395393delTTGT	uc002ojw.2	+						NFKBIB_uc010egk.1_Intron|NFKBIB_uc002ojx.2_Intron|NFKBIB_uc002ojy.2_Intron	NM_002503	NP_002494			nuclear factor of kappa light polypeptide gene						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleus	protein binding|signal transducer activity|transcription coactivator activity			lung(1)|kidney(1)	2	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	39508538	39508538	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39508538delC								FBXO17 (42158 upstream) : FBXO27 (6126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	40532964	40532964	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40532964delT								ZNF546 (9450 upstream) : ZNF780B (1204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	40798170	40798170	+	IGR	DEL	A	-	-	rs113906060		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40798170delA								AKT2 (6905 upstream) : C19orf47 (28803 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	42680233	42680233	+	IGR	DEL	G	-	-	rs71336805		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42680233delG								POU2F2 (43603 upstream) : DEDD2 (22519 downstream)																																			---	---	---	---
PSG5	5673	broad.mit.edu	37	19	43689582	43689582	+	Intron	DEL	C	-	-	rs67188908		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43689582delC	uc002ovu.2	-						PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_5'Flank|PSG5_uc002ovx.2_Intron|PSG5_uc002ovv.2_Intron|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772			pregnancy specific beta-1-glycoprotein 5						female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	44084890	44084891	+	Intron	INS	-	A	A	rs147797828	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44084890_44084891insA	uc002owu.1	+						uc002owv.1_Intron					RecName: Full=Uncharacterized protein ENSP00000244321; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	44202102	44202103	+	IGR	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44202102_44202103delTG								PLAUR (27600 upstream) : IRGC (18111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	45189554	45189555	+	IGR	INS	-	T	T	rs74841669		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45189554_45189555insT								CEACAM19 (1929 upstream) : CEACAM16 (12803 downstream)																																			---	---	---	---
PVRL2	5819	broad.mit.edu	37	19	45378525	45378526	+	Intron	INS	-	T	T	rs79725873		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45378525_45378526insT	uc002ozw.1	+						PVRL2_uc002ozv.2_Intron	NM_001042724	NP_001036189			poliovirus receptor related 2 isoform delta						adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)														---	---	---	---
PPP1R13L	10848	broad.mit.edu	37	19	45884088	45884089	+	Intron	DEL	AC	-	-	rs112933504		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45884088_45884089delAC	uc002pbn.2	-						PPP1R13L_uc002pbm.2_Intron|PPP1R13L_uc002pbo.2_Intron	NM_006663	NP_006654			protein phosphatase 1, regulatory subunit 13						apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)														---	---	---	---
GPR4	2828	broad.mit.edu	37	19	46100331	46100332	+	Intron	INS	-	T	T	rs111853044		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46100331_46100332insT	uc002pcm.2	-						OPA3_uc010xxk.1_Intron	NM_005282	NP_005273			G protein-coupled receptor 4							integral to plasma membrane	G-protein coupled receptor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)														---	---	---	---
CCDC8	83987	broad.mit.edu	37	19	46913901	46913902	+	3'UTR	INS	-	GCC	GCC	rs142683177	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46913901_46913902insGCC	uc002pep.2	-	1						NM_032040	NP_114429			coiled-coil domain containing 8							plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47385396	47385396	+	IGR	DEL	T	-	-	rs111690310		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47385396delT								AP2S1 (31193 upstream) : GRLF1 (36537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	47391211	47391211	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47391211delT								AP2S1 (37008 upstream) : GRLF1 (30722 downstream)																																			---	---	---	---
GRLF1	2909	broad.mit.edu	37	19	47419606	47419607	+	5'Flank	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47419606_47419607insT	uc010ekv.2	+							NM_004491	NP_004482			glucocorticoid receptor DNA binding factor 1						axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)														---	---	---	---
GRLF1	2909	broad.mit.edu	37	19	47507171	47507176	+	3'UTR	DEL	ACACGC	-	-	rs145676771	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47507171_47507176delACACGC	uc010ekv.2	+	6						NM_004491	NP_004482			glucocorticoid receptor DNA binding factor 1						axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47741767	47741767	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47741767delT								BBC3 (5744 upstream) : CCDC9 (17964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	48461352	48461352	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48461352delT								SNAR-C3 (7681 upstream) : BSPH1 (9951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	48987550	48987550	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48987550delA								CYTH2 (1980 upstream) : LMTK3 (980 downstream)																																			---	---	---	---
LMTK3	114783	broad.mit.edu	37	19	49007047	49007048	+	Intron	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49007047_49007048delTC	uc002pjk.2	-							NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)														---	---	---	---
NUCB1	4924	broad.mit.edu	37	19	49414649	49414653	+	Intron	DEL	TTTCT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49414649_49414653delTTTCT	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175			nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)														---	---	---	---
DHDH	27294	broad.mit.edu	37	19	49443785	49443785	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49443785delA	uc002ple.1	+							NM_014475	NP_055290			dimeric dihydrodiol dehydrogenase						carbohydrate metabolic process		binding|D-xylose 1-dehydrogenase (NADP+) activity|electron carrier activity|NAD(P)+ transhydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	49524922	49524923	+	IGR	DEL	AG	-	-	rs71698135		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49524922_49524923delAG								LHB (4575 upstream) : CGB (1204 downstream)																																			---	---	---	---
SNRNP70	6625	broad.mit.edu	37	19	49598793	49598794	+	Intron	INS	-	T	T	rs71900442		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49598793_49598794insT	uc002pmk.2	+						SNRNP70_uc002pmh.1_Intron|SNRNP70_uc002pmi.1_Intron|SNRNP70_uc002pml.2_Intron|SNRNP70_uc002pmm.2_Intron	NM_003089	NP_003080			U1 small nuclear ribonucleoprotein 70 kDa						nuclear mRNA splicing, via spliceosome|regulation of RNA splicing	nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
SLC17A7	57030	broad.mit.edu	37	19	49947383	49947384	+	5'Flank	INS	-	CTT	CTT	rs138140864	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49947383_49947384insCTT	uc002pnp.2	-						uc002pnr.1_RNA	NM_020309	NP_064705			solute carrier family 17, member 7						glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)														---	---	---	---
MED25	81857	broad.mit.edu	37	19	50323083	50323083	+	Intron	DEL	T	-	-	rs11288478		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50323083delT	uc002ppw.1	+						MED25_uc010ybe.1_Intron|MED25_uc010enl.1_3'UTR	NM_030973	NP_112235			mediator complex subunit 25						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm				ovary(1)	1		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)														---	---	---	---
VRK3	51231	broad.mit.edu	37	19	50498875	50498876	+	Intron	INS	-	C	C	rs149585797	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50498875_50498876insC	uc002prg.2	-						VRK3_uc002prh.1_Intron|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Intron|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Intron|VRK3_uc010ent.1_Intron|VRK3_uc002prl.2_Intron|VRK3_uc010ybn.1_Intron	NM_016440	NP_057524			vaccinia related kinase 3 isoform 1							nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)														---	---	---	---
VRK3	51231	broad.mit.edu	37	19	50504798	50504799	+	Intron	INS	-	C	C	rs147190770	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50504798_50504799insC	uc002prg.2	-						VRK3_uc002prh.1_Intron|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Intron|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Intron|VRK3_uc010ent.1_Intron|VRK3_uc002prl.2_Intron|VRK3_uc010ybn.1_Intron	NM_016440	NP_057524			vaccinia related kinase 3 isoform 1							nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)														---	---	---	---
LRRC4B	94030	broad.mit.edu	37	19	51044440	51044441	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51044440_51044441insA	uc002pss.2	-							NM_001080457	NP_001073926			leucine rich repeat containing 4B precursor							cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	51315336	51315373	+	IGR	DEL	GAGGACCATCCCAGGCAGGGAGGACCATCCCAGGGAGT	-	-	rs74823650	by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51315336_51315373delGAGGACCATCCCAGGCAGGGAGGACCATCCCAGGGAGT								C19orf48 (7362 upstream) : KLK1 (7031 downstream)																																			---	---	---	---
ZNF766	90321	broad.mit.edu	37	19	52789441	52789442	+	Intron	INS	-	C	C	rs149933354	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52789441_52789442insC	uc002pyr.1	+						ZNF766_uc002pys.1_Intron|ZNF766_uc002pyt.1_Intron	NM_001010851	NP_001010851			zinc finger protein 766						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	53790018	53790018	+	IGR	DEL	T	-	-	rs79875786		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53790018delT								VN1R4 (19100 upstream) : BIRC8 (2838 downstream)																																			---	---	---	---
PRKCG	5582	broad.mit.edu	37	19	54394697	54394698	+	Intron	INS	-	T	T	rs11378432		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54394697_54394698insT	uc002qcq.1	+						PRKCG_uc010eqz.1_Intron|PRKCG_uc010yef.1_Intron|PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730			protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54518650	54518651	+	IGR	INS	-	TCCTTTC	TCCTTTC	rs72530631		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54518650_54518651insTCCTTTC								CACNG6 (2732 upstream) : VSTM1 (25434 downstream)																																			---	---	---	---
EPS8L1	54869	broad.mit.edu	37	19	55587649	55587649	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55587649delG	uc002qis.3	+						EPS8L1_uc010ess.1_Intron|EPS8L1_uc010est.1_Intron|EPS8L1_uc010yfr.1_Intron|EPS8L1_uc010esu.1_5'Flank	NM_133180	NP_573441			epidermal growth factor receptor pathway							cytoplasm					0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	55682835	55682838	+	IGR	DEL	AAGT	-	-	rs72065818		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55682835_55682838delAAGT								C19orf51 (4817 upstream) : SYT5 (1631 downstream)																																			---	---	---	---
HSPBP1	23640	broad.mit.edu	37	19	55788861	55788862	+	Intron	INS	-	G	G	rs147038820	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55788861_55788862insG	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron	NM_012267	NP_036399			hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	55978044	55978045	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55978044_55978045delGT								ISOC2 (4995 upstream) : ZNF628 (9654 downstream)																																			---	---	---	---
ZSCAN5A	79149	broad.mit.edu	37	19	56756492	56756493	+	Intron	INS	-	ATTA	ATTA	rs143729158	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56756492_56756493insATTA	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279			zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
ZFP28	140612	broad.mit.edu	37	19	57061045	57061046	+	Intron	INS	-	A	A	rs79526765		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57061045_57061046insA	uc002qnj.2	+						ZFP28_uc002qni.2_Intron|uc002qnk.1_Intron	NM_020828	NP_065879			zinc finger protein 28						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	57484786	57484788	+	IGR	DEL	GGA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57484786_57484788delGGA								MIMT1 (124864 upstream) : USP29 (146721 downstream)																																			---	---	---	---
ZNF805	390980	broad.mit.edu	37	19	57763003	57763003	+	Intron	DEL	T	-	-	rs147680286		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57763003delT	uc010ygt.1	+						ZNF805_uc010ygu.1_Intron	NM_001023563	NP_001018857			zinc finger protein 805 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF587	84914	broad.mit.edu	37	19	58263236	58263236	+	Intron	DEL	G	-	-	rs142835793		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58263236delG	uc002qqb.2	+						ZNF776_uc002qpx.2_Intron|ZNF776_uc002qqa.2_Intron	NM_032828	NP_116217			zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	58936839	58936840	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58936839_58936840insT								ZNF584 (7149 upstream) : ZNF132 (7342 downstream)																																			---	---	---	---
RBCK1	10616	broad.mit.edu	37	20	401109	401110	+	Intron	INS	-	G	G	rs142244126	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:401109_401110insG	uc002wdp.3	+						RBCK1_uc010zpm.1_Intron|RBCK1_uc002wdq.3_Intron|RBCK1_uc010fzy.2_Intron|RBCK1_uc002wdr.3_Intron	NM_031229	NP_112506			RanBP-type and C3HC4-type zinc finger containing						interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	783250	783250	+	IGR	DEL	A	-	-	rs78106329		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:783250delA								C20orf54 (34022 upstream) : FAM110A (31106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	910297	910297	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:910297delT								ANGPT4 (13337 upstream) : RSPO4 (28801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1235305	1235306	+	IGR	INS	-	T	T	rs142754247	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1235305_1235306insT								RAD21L1 (160 upstream) : SNPH (11654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1664616	1664616	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1664616delA								SIRPG (26191 upstream) : SIRPA (210197 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1683251	1683263	+	IGR	DEL	TAGCTCTACCAGT	-	-	rs35946389		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1683251_1683263delTAGCTCTACCAGT								SIRPG (44826 upstream) : SIRPA (191550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	2056544	2056549	+	IGR	DEL	ACACAC	-	-	rs72165579		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2056544_2056549delACACAC								PDYN (81841 upstream) : STK35 (25979 downstream)																																			---	---	---	---
VPS16	64601	broad.mit.edu	37	20	2823490	2823491	+	Intron	INS	-	GATA	GATA	rs151161007	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2823490_2823491insGATA	uc002whe.2	+						FAM113A_uc002wgz.1_5'Flank|FAM113A_uc002whb.1_5'Flank|FAM113A_uc002wha.1_5'Flank|FAM113A_uc010zqa.1_5'Flank|FAM113A_uc002whc.1_5'Flank|VPS16_uc002whf.2_Intron|VPS16_uc002whd.2_Intron	NM_022575	NP_072097			vacuolar protein sorting 16 isoform 1						intracellular protein transport	early endosome|HOPS complex|late endosome membrane|lysosomal membrane|recycling endosome				ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3492086	3492086	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3492086delT	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5372469	5372470	+	IGR	INS	-	AAC	AAC	rs143810707	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5372469_5372470insAAC								PROKR2 (75091 upstream) : LOC149837 (106748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6047155	6047156	+	IGR	INS	-	CA	CA	rs138699351	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6047155_6047156insCA								LRRN4 (12461 upstream) : FERMT1 (8337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7610731	7610732	+	IGR	INS	-	GT	GT	rs138655920	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7610731_7610732insGT								BMP2 (849821 upstream) : HAO1 (252899 downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8379414	8379414	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8379414delT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8752508	8752509	+	Intron	INS	-	TTCCTTCCTTCCTTCG	TTCCTTCCTTCCTTCG	rs145086644	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8752508_8752509insTTCCTTCCTTCCTTCG	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PAK7	57144	broad.mit.edu	37	20	9801509	9801509	+	Intron	DEL	C	-	-	rs71331385		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9801509delC	uc002wnl.2	-						PAK7_uc002wnk.2_Intron|PAK7_uc002wnj.2_Intron|PAK7_uc010gby.1_Intron	NM_020341	NP_065074			p21-activated kinase 7								ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	10132959	10132959	+	Intron	DEL	A	-	-	rs113357616		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10132959delA	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	10140126	10140127	+	Intron	DEL	GG	-	-	rs71332913		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10140126_10140127delGG	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	10328833	10328834	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10328833_10328834delAC								SNAP25 (40768 upstream) : MKKS (56999 downstream)																																			---	---	---	---
C20orf94	128710	broad.mit.edu	37	20	10466267	10466267	+	Intron	DEL	A	-	-	rs111933045		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10466267delA	uc010zre.1	+							NM_001009608	NP_001009608			hypothetical protein LOC128710								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	11192288	11192291	+	IGR	DEL	TGTA	-	-	rs60865372		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11192288_11192291delTGTA								JAG1 (537594 upstream) : BTBD3 (679186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11207861	11207861	+	IGR	DEL	G	-	-	rs6134162	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11207861delG								JAG1 (553167 upstream) : BTBD3 (663616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12380448	12380449	+	IGR	INS	-	A	A	rs146109357	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12380448_12380449insA								BTBD3 (473206 upstream) : SPTLC3 (609178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12384268	12384269	+	IGR	INS	-	A	A	rs147564625	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12384268_12384269insA								BTBD3 (477026 upstream) : SPTLC3 (605358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12531255	12531256	+	IGR	DEL	TA	-	-	rs73615542		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12531255_12531256delTA								BTBD3 (624013 upstream) : SPTLC3 (458371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12632142	12632142	+	IGR	DEL	G	-	-	rs71338115		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12632142delG								BTBD3 (724900 upstream) : SPTLC3 (357485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12854079	12854080	+	IGR	DEL	GG	-	-	rs142894918	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12854079_12854080delGG								BTBD3 (946837 upstream) : SPTLC3 (135547 downstream)																																			---	---	---	---
TASP1	55617	broad.mit.edu	37	20	13422941	13422942	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13422941_13422942delAC	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron	NM_017714	NP_060184			taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0																		---	---	---	---
SEL1L2	80343	broad.mit.edu	37	20	13853640	13853640	+	Intron	DEL	T	-	-	rs11479774		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13853640delT	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505			sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2																		---	---	---	---
SEL1L2	80343	broad.mit.edu	37	20	13861246	13861247	+	Intron	INS	-	CATC	CATC	rs144638702	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13861246_13861247insCATC	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505			sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2																		---	---	---	---
SEL1L2	80343	broad.mit.edu	37	20	13866683	13866683	+	Intron	DEL	A	-	-	rs11476832		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13866683delA	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505			sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2																		---	---	---	---
SEL1L2	80343	broad.mit.edu	37	20	13934753	13934753	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13934753delT	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505			sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14028650	14028651	+	Intron	INS	-	T	T	rs143046922	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14028650_14028651insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wos.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15694638	15694639	+	Intron	INS	-	CG	CG	rs146331658	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15694638_15694639insCG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	16148723	16148724	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16148723_16148724insT								MACROD2 (114884 upstream) : KIF16B (104025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	16196553	16196553	+	IGR	DEL	A	-	-	rs35546395		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16196553delA								MACROD2 (162714 upstream) : KIF16B (56196 downstream)																																			---	---	---	---
PCSK2	5126	broad.mit.edu	37	20	17214213	17214213	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17214213delG	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585			proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
PCSK2	5126	broad.mit.edu	37	20	17415020	17415021	+	Intron	INS	-	GCA	GCA	rs150853665	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17415020_17415021insGCA	uc002wpm.2	+						PCSK2_uc002wpl.2_Intron|PCSK2_uc010zrm.1_Intron	NM_002594	NP_002585			proprotein convertase subtilisin/kexin type 2						enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	17468989	17468990	+	IGR	DEL	AC	-	-	rs11468172		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17468989_17468990delAC								PCSK2 (3769 upstream) : BFSP1 (5561 downstream)																																			---	---	---	---
DSTN	11034	broad.mit.edu	37	20	17553964	17553964	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17553964delT	uc002wpr.2	+						DSTN_uc002wpq.2_Intron	NM_006870	NP_006861			destrin isoform a						actin filament severing|actin polymerization or depolymerization		actin binding			large_intestine(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	17883643	17883644	+	IGR	INS	-	TT	TT	rs144673695	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17883643_17883644insTT								BANF2 (167126 upstream) : SNX5 (38602 downstream)																																			---	---	---	---
DTD1	92675	broad.mit.edu	37	20	18732138	18732138	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18732138delT	uc002wrf.3	+							NM_080820	NP_543010			D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	18985463	18985463	+	IGR	DEL	T	-	-	rs11476814		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18985463delT								C20orf79 (190430 upstream) : SLC24A3 (207827 downstream)																																			---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19438042	19438042	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19438042delA	uc002wrl.2	+							NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	19840923	19840923	+	IGR	DEL	C	-	-	rs113617865		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19840923delC								SLC24A3 (137383 upstream) : RIN2 (29287 downstream)																																			---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20163359	20163360	+	Intron	INS	-	TAGAAGCAAT	TAGAAGCAAT	rs145170175	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20163359_20163360insTAGAAGCAAT	uc002wru.2	+						C20orf26_uc010zse.1_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20317987	20317990	+	Intron	DEL	TGGG	-	-	rs138008701	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20317987_20317990delTGGG	uc002wru.2	+						C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	21513893	21513900	+	IGR	DEL	GTGTGTGT	-	-	rs113871495	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21513893_21513900delGTGTGTGT								NKX2-2 (19229 upstream) : PAX1 (172397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21568998	21568998	+	IGR	DEL	T	-	-	rs67486386		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21568998delT								NKX2-2 (74334 upstream) : PAX1 (117299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21647811	21647811	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21647811delT								NKX2-2 (153147 upstream) : PAX1 (38486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22404855	22404855	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22404855delA								LOC284788 (3574 upstream) : C20orf56 (136339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23141803	23141804	+	IGR	INS	-	G	G	rs147503338	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23141803_23141804insG								CD93 (74826 upstream) : NXT1 (189569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24707416	24707417	+	IGR	DEL	GA	-	-	rs2143822		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24707416_24707417delGA								TMEM90B (60249 upstream) : CST7 (222449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24759045	24759046	+	IGR	INS	-	GG	GG	rs143673560	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24759045_24759046insGG								TMEM90B (111878 upstream) : CST7 (170820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24829240	24829240	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24829240delG								TMEM90B (182073 upstream) : CST7 (100626 downstream)																																			---	---	---	---
ACSS1	84532	broad.mit.edu	37	20	25017641	25017642	+	Intron	INS	-	AAGG	AAGG	rs146710264	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25017641_25017642insAAGG	uc002wub.2	-						ACSS1_uc002wuc.2_Intron|ACSS1_uc010gdc.2_Intron	NM_032501	NP_115890			acyl-CoA synthetase short-chain family member 1						acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25834734	25834735	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25834734_25834735delCA	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25909148	25909149	+	IGR	DEL	TG	-	-	rs28749330	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25909148_25909149delTG								FAM182B (60362 upstream) : LOC100134868 (81286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25911087	25911087	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25911087delG								FAM182B (62301 upstream) : LOC100134868 (79348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26145851	26145851	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26145851delA								C20orf191 (51174 upstream) : MIR663 (42971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29465493	29465493	+	IGR	DEL	G	-	-	rs147354254		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29465493delG								None (None upstream) : FRG1B (146386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29473737	29473737	+	IGR	DEL	A	-	-	rs76313482		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29473737delA								None (None upstream) : FRG1B (138142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29557938	29557939	+	IGR	INS	-	TCA	TCA	rs144548611	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29557938_29557939insTCA								None (None upstream) : FRG1B (53940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29585105	29585105	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29585105delC								None (None upstream) : FRG1B (26774 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29613774	29613777	+	Intron	DEL	TACT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29613774_29613777delTACT	uc002wvm.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_5'Flank	NR_003579				Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	29823940	29823941	+	IGR	INS	-	TGGAATGGAA	TGGAATGGAA	rs7345394	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29823940_29823941insTGGAATGGAA								FRG1B (170032 upstream) : DEFB115 (21526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31216465	31216488	+	IGR	DEL	ACACACACACACACACACACACAG	-	-	rs72453088		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31216465_31216488delACACACACACACACACACACACAG								C20orf112 (92265 upstream) : C20orf203 (4174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31537807	31537808	+	Intron	INS	-	AAAC	AAAC	rs141786896	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31537807_31537808insAAAC	uc010zub.1	+							NM_001143967	NP_001137439			EF-hand calcium binding domain 8																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	31551795	31551800	+	IGR	DEL	TTCTCC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31551795_31551800delTTCTCC								MAPRE1 (113585 upstream) : SUN5 (19782 downstream)																																			---	---	---	---
CDK5RAP1	51654	broad.mit.edu	37	20	31978080	31978081	+	Intron	INS	-	A	A	rs113894811		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31978080_31978081insA	uc010gek.2	-						CDK5RAP1_uc002wyy.2_Intron|CDK5RAP1_uc002wyz.2_Intron|CDK5RAP1_uc002wza.2_Intron|CDK5RAP1_uc010gel.2_Intron|CDK5RAP1_uc010gem.2_Intron|CDK5RAP1_uc002wzc.1_Intron|CDK5RAP1_uc010gen.2_Intron	NM_016408	NP_057492			CDK5 regulatory subunit associated protein 1						brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	32050298	32050298	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32050298delG								SNTA1 (18600 upstream) : CBFA2T2 (27630 downstream)																																			---	---	---	---
PIGU	128869	broad.mit.edu	37	20	33188846	33188847	+	Intron	DEL	AA	-	-	rs71694844		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33188846_33188847delAA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0																		---	---	---	---
TRPC4AP	26133	broad.mit.edu	37	20	33611933	33611934	+	Intron	INS	-	T	T	rs11473089		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33611933_33611934insT	uc002xbk.2	-						TRPC4AP_uc010zuq.1_Intron|TRPC4AP_uc002xbl.2_Intron|TRPC4AP_uc010zur.1_Intron|TRPC4AP_uc002xbm.1_Intron	NM_015638	NP_056453			TRPC4-associated protein isoform a						protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
TRPC4AP	26133	broad.mit.edu	37	20	33614025	33614026	+	Intron	INS	-	T	T	rs147526735		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33614025_33614026insT	uc002xbk.2	-						TRPC4AP_uc010zuq.1_Intron|TRPC4AP_uc002xbl.2_Intron|TRPC4AP_uc010zur.1_Intron|TRPC4AP_uc002xbm.1_Intron	NM_015638	NP_056453			TRPC4-associated protein isoform a						protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
C20orf4	25980	broad.mit.edu	37	20	34830287	34830289	+	Intron	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34830287_34830289delTTG	uc002xfc.1	+						C20orf4_uc002xfd.1_Intron|C20orf4_uc002xfe.1_Intron	NM_015511	NP_056326			hypothetical protein LOC25980												0	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)																---	---	---	---
C20orf4	25980	broad.mit.edu	37	20	34844862	34844863	+	Intron	DEL	TG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34844862_34844863delTG	uc002xfd.1	+							NM_015511	NP_056326			hypothetical protein LOC25980												0	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36137304	36137305	+	IGR	INS	-	T	T	rs148220918	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36137304_36137305insT								SRC (103485 upstream) : BLCAP (8515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37067069	37067070	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37067069_37067070insA								LOC388796 (3051 upstream) : SNHG11 (8227 downstream)																																			---	---	---	---
DHX35	60625	broad.mit.edu	37	20	37665369	37665370	+	Intron	INS	-	AAAAAAAAAAA	AAAAAAAAAAA	rs145606450		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37665369_37665370insAAAAAAAAAAA	uc002xjh.2	+						DHX35_uc010zwa.1_Intron|DHX35_uc010zwb.1_Intron|DHX35_uc010zwc.1_Intron	NM_021931	NP_068750			DEAH (Asp-Glu-Ala-His) box polypeptide 35							catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	38449897	38449898	+	IGR	INS	-	A	A	rs140208729	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38449897_38449898insA								LOC339568 (596506 upstream) : MAFB (864621 downstream)																																			---	---	---	---
PLCG1	5335	broad.mit.edu	37	20	39790875	39790875	+	Intron	DEL	G	-	-	rs148867612		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39790875delG	uc002xjp.1	+						PLCG1_uc002xjo.1_Intron|PLCG1_uc010zwe.1_5'Flank	NM_182811	NP_877963			phospholipase C, gamma 1 isoform b						activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	40010589	40010589	+	IGR	DEL	T	-	-	rs112600324		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40010589delT								EMILIN3 (15091 upstream) : CHD6 (20581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	40463432	40463432	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40463432delC								CHD6 (216299 upstream) : PTPRT (237961 downstream)																																			---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42304401	42304402	+	Intron	INS	-	TG	TG	rs139927212	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42304401_42304402insTG	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron|MYBL2_uc002xla.1_Intron	NM_002466	NP_002457			MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	42375708	42375708	+	IGR	DEL	G	-	-	rs67675099		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42375708delG								GTSF1L (20066 upstream) : TOX2 (167784 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42427701	42427702	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42427701_42427702insT								GTSF1L (72059 upstream) : TOX2 (115790 downstream)																																			---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42630318	42630334	+	Intron	DEL	CTCTGTGCCAGCACCTG	-	-	rs56771554		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42630318_42630334delCTCTGTGCCAGCACCTG	uc002xlf.3	+						TOX2_uc010ggo.2_Intron|TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron|TOX2_uc002xlg.2_Intron	NM_001098798	NP_001092268			TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	42921165	42921169	+	IGR	DEL	AGAGG	-	-	rs72113476		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42921165_42921169delAGAGG								GDAP1L1 (12154 upstream) : FITM2 (14028 downstream)																																			---	---	---	---
HNF4A	3172	broad.mit.edu	37	20	43033675	43033684	+	Intron	DEL	TGTGTGTGCT	-	-	rs36230418		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43033675_43033684delTGTGTGTGCT	uc002xma.2	+						HNF4A_uc010zwo.1_Intron|HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|uc002xlw.1_5'Flank|HNF4A_uc002xly.2_Intron|HNF4A_uc002xlz.2_Intron|HNF4A_uc010ggq.2_Intron	NM_000457	NP_000448			hepatocyte nuclear factor 4 alpha isoform b						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	43920774	43920775	+	IGR	INS	-	A	A	rs71339842		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43920774_43920775insA								SLPI (37568 upstream) : MATN4 (1312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	44077730	44077731	+	IGR	INS	-	T	T	rs59507091	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44077730_44077731insT								PIGT (22846 upstream) : WFDC2 (20663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	45104410	45104410	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45104410delC								LOC100240726 (10479 upstream) : ZNF334 (25299 downstream)																																			---	---	---	---
SLC2A10	81031	broad.mit.edu	37	20	45343872	45343873	+	Intron	INS	-	GTTT	GTTT	rs146667736	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45343872_45343873insGTTT	uc002xsl.2	+							NM_030777	NP_110404			solute carrier family 2 member 10							endomembrane system|integral to membrane|perinuclear region of cytoplasm|plasma membrane	D-glucose transmembrane transporter activity|sugar:hydrogen symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	45417866	45417867	+	IGR	DEL	GA	-	-	rs144801853	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45417866_45417867delGA								SLC2A10 (52883 upstream) : EYA2 (105396 downstream)																																			---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45896241	45896241	+	Intron	DEL	G	-	-	rs72290601		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45896241delG	uc002xta.1	-						ZMYND8_uc010ghq.1_Intron|ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540			zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45974250	45974251	+	Intron	INS	-	T	T	rs34294941		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45974250_45974251insT	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc010ghs.1_Intron|ZMYND8_uc002xth.2_Intron	NM_012408	NP_036540			zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
NCOA3	8202	broad.mit.edu	37	20	46136354	46136355	+	Intron	INS	-	TTG	TTG	rs141339561	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46136354_46136355insTTG	uc002xtk.2	+						NCOA3_uc010ght.1_Intron|NCOA3_uc002xtl.2_Intron|NCOA3_uc002xtm.2_Intron|NCOA3_uc002xtn.2_Intron	NM_181659	NP_858045			nuclear receptor coactivator 3 isoform a						androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5																		---	---	---	---
PTGIS	5740	broad.mit.edu	37	20	48132581	48132581	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48132581delT	uc002xut.2	-						PTGIS_uc010zyi.1_Intron	NM_000961	NP_000952			prostaglandin I2 synthase						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)													---	---	---	---
PTGIS	5740	broad.mit.edu	37	20	48136874	48136874	+	Intron	DEL	T	-	-	rs111820055		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48136874delT	uc002xut.2	-						PTGIS_uc010zyi.1_Intron	NM_000961	NP_000952			prostaglandin I2 synthase						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	48341677	48341677	+	IGR	DEL	G	-	-	rs11475573		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48341677delG								B4GALT5 (11256 upstream) : SLC9A8 (87573 downstream)																																			---	---	---	---
TMEM189-UBE2V1	387522	broad.mit.edu	37	20	48730303	48730304	+	Intron	INS	-	ATTC	ATTC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48730303_48730304insATTC	uc002xvf.2	-						UBE2V1_uc002xvb.2_5'Flank|UBE2V1_uc002xva.2_5'Flank|UBE2V1_uc002xvc.2_Intron|UBE2V1_uc002xvd.2_Intron|UBE2V1_uc002xve.2_Intron	NM_199203	NP_954673			TMEM189-UBE2V1 readthrough transcript						cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein K63-linked ubiquitination|regulation of DNA repair|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-UEV1A complex|ubiquitin ligase complex	acid-amino acid ligase activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)															---	---	---	---
ATP9A	10079	broad.mit.edu	37	20	50252339	50252340	+	Intron	INS	-	GGAGGGAGGAAG	GGAGGGAGGAAG	rs141656779	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50252339_50252340insGGAGGGAGGAAG	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036			ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50557203	50557204	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50557203_50557204insT								SALL4 (138155 upstream) : ZFP64 (143347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	50884277	50884278	+	IGR	INS	-	TTTC	TTTC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50884277_50884278insTTTC								ZFP64 (75753 upstream) : TSHZ2 (704599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51379696	51379696	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51379696delT								ZFP64 (571172 upstream) : TSHZ2 (209181 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51778452	51778452	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51778452delT	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52368836	52368837	+	IGR	INS	-	GTGTGT	GTGTGT	rs145200930	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52368836_52368837insGTGTGT								ZNF217 (158035 upstream) : SUMO1P1 (122205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52455174	52455175	+	IGR	INS	-	AC	AC	rs141559658	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52455174_52455175insAC								ZNF217 (244373 upstream) : SUMO1P1 (35867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52455204	52455205	+	IGR	DEL	CG	-	-	rs11467800	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52455204_52455205delCG								ZNF217 (244403 upstream) : SUMO1P1 (35837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52737837	52737838	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52737837_52737838insT								BCAS1 (50533 upstream) : CYP24A1 (32150 downstream)																																			---	---	---	---
DOK5	55816	broad.mit.edu	37	20	53220842	53220842	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53220842delT	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901			docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53507246	53507246	+	IGR	DEL	T	-	-	rs149621397	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53507246delT								DOK5 (239537 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53553407	53553408	+	IGR	INS	-	T	T	rs74181008		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53553407_53553408insT								DOK5 (285698 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53867898	53867907	+	IGR	DEL	CACACATGCG	-	-	rs114914340	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53867898_53867907delCACACATGCG								DOK5 (600189 upstream) : CBLN4 (704590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54049591	54049594	+	IGR	DEL	AAAC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54049591_54049594delAAAC								DOK5 (781882 upstream) : CBLN4 (522903 downstream)																																			---	---	---	---
AURKA	6790	broad.mit.edu	37	20	54952841	54952842	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54952841_54952842insA	uc002xxd.1	-						AURKA_uc002xxe.1_Intron|AURKA_uc002xxf.1_Intron|AURKA_uc002xxg.1_Intron|AURKA_uc002xxh.1_Intron|AURKA_uc002xxi.1_Intron|AURKA_uc002xxj.1_Intron|AURKA_uc002xxk.1_Intron|AURKA_uc010zzd.1_Intron	NM_198433	NP_940835			serine/threonine protein kinase 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)															---	---	---	---
BMP7	655	broad.mit.edu	37	20	55805492	55805502	+	Intron	DEL	CTCAGTCAACC	-	-	rs150083464		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55805492_55805502delCTCAGTCAACC	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Intron	NM_001719	NP_001710			bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57026726	57026728	+	IGR	DEL	TCT	-	-	rs72301542		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57026726_57026728delTCT								VAPB (4765 upstream) : APCDD1L (7698 downstream)																																			---	---	---	---
TH1L	51497	broad.mit.edu	37	20	57567904	57567904	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57567904delA	uc002yag.2	+						TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327			TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)															---	---	---	---
EDN3	1908	broad.mit.edu	37	20	57896663	57896664	+	Intron	INS	-	G	G	rs148681039	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57896663_57896664insG	uc002yap.2	+						EDN3_uc002yao.1_Intron|EDN3_uc002yaq.2_Intron|EDN3_uc002yar.2_Intron|EDN3_uc002yas.2_Intron	NM_000114	NP_000105			endothelin 3 isoform 1 preproprotein						cell surface receptor linked signaling pathway|inositol phosphate-mediated signaling|neutrophil chemotaxis|peptide hormone secretion|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of leukocyte chemotaxis|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space|soluble fraction	endothelin B receptor binding|hormone activity			skin(1)	1	all_lung(29;0.0115)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	59577886	59577886	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59577886delA								MIR646 (694261 upstream) : CDH4 (249673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59606216	59606221	+	IGR	DEL	CCCTGG	-	-	rs11469436		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59606216_59606221delCCCTGG								MIR646 (722591 upstream) : CDH4 (221338 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60330425	60330426	+	Intron	DEL	CA	-	-	rs112783033		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60330425_60330426delCA	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
GATA5	140628	broad.mit.edu	37	20	61047898	61047907	+	Intron	DEL	GCATAAACCT	-	-	rs149679951		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61047898_61047907delGCATAAACCT	uc002ycx.1	-							NM_080473	NP_536721			GATA binding protein 5						blood coagulation|intestinal epithelial cell differentiation|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding				0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)															---	---	---	---
NTSR1	4923	broad.mit.edu	37	20	61379528	61379528	+	Intron	DEL	A	-	-	rs3082316		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61379528delA	uc002ydf.2	+							NM_002531	NP_002522			neurotensin receptor 1							endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	61743091	61743091	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61743091delT								HAR1A (7354 upstream) : MIR124-3 (66761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	62018958	62018959	+	IGR	DEL	CC	-	-	rs56910649		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62018958_62018959delCC								CHRNA4 (9469 upstream) : KCNQ2 (18583 downstream)																																			---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62060619	62060620	+	Intron	INS	-	C	C	rs148989379	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62060619_62060620insC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	62217380	62217380	+	IGR	DEL	A	-	-	rs35574157		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62217380delA								PRIC285 (11788 upstream) : GMEB2 (1575 downstream)																																			---	---	---	---
GMEB2	26205	broad.mit.edu	37	20	62240392	62240392	+	Intron	DEL	A	-	-	rs55700463		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62240392delA	uc002yfp.1	-						GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516			glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)															---	---	---	---
ZBTB46	140685	broad.mit.edu	37	20	62391818	62391818	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62391818delG	uc002ygv.1	-						ZBTB46_uc002ygu.2_Intron	NM_025224	NP_079500			zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	62488889	62488890	+	IGR	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62488889_62488890insTT								ZBTB46 (26292 upstream) : C20orf135 (3676 downstream)																																			---	---	---	---
TPD52L2	7165	broad.mit.edu	37	20	62520824	62520842	+	Intron	DEL	CACTGCCCTTCCTGGTCCC	-	-	rs36224634	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62520824_62520842delCACTGCCCTTCCTGGTCCC	uc002yhc.2	+						TPD52L2_uc002ygy.2_Intron|TPD52L2_uc002ygz.2_Intron|TPD52L2_uc002yha.2_Intron|TPD52L2_uc002yhb.2_Intron|TPD52L2_uc002yhd.2_Intron|TPD52L2_uc011abk.1_Intron|TPD52L2_uc011abl.1_Intron|TPD52L2_uc002yhe.2_Intron	NM_003288	NP_003279			tumor protein D52-like 2 isoform e						regulation of cell proliferation	perinuclear region of cytoplasm	protein binding|protein homodimerization activity			ovary(1)|skin(1)	2	all_cancers(38;1.3e-12)|all_epithelial(29;2.23e-14)|Lung NSC(23;5.92e-10)|all_lung(23;2.08e-09)																	---	---	---	---
OPRL1	4987	broad.mit.edu	37	20	62720255	62720256	+	Intron	INS	-	TCTGTGCAGAGTGGCCAGGA	TCTGTGCAGAGTGGCCAGGA	rs62218113		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62720255_62720256insTCTGTGCAGAGTGGCCAGGA	uc002yic.2	+						OPRL1_uc002yid.2_Intron	NM_182647	NP_872588			opiate receptor-like 1						elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9652852	9652852	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9652852delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9653641	9653642	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9653641_9653642insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9869406	9869406	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9869406delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9983985	9983985	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9983985delA								None (None upstream) : TPTE (922758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10633109	10633109	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10633109delC								None (None upstream) : TPTE (273634 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11023566	11023566	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11023566delC	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11045506	11045507	+	Intron	INS	-	A	A	rs144248158		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11045506_11045507insA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11052980	11052984	+	Intron	DEL	TAATC	-	-	rs148507295		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11052980_11052984delTAATC	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11155723	11155725	+	IGR	DEL	TAT	-	-	rs139704350		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11155723_11155725delTAT								BAGE (56786 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14347310	14347310	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14347310delT								None (None upstream) : C21orf99 (63177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14363881	14363882	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14363881_14363882delAG								None (None upstream) : C21orf99 (46605 downstream)																																			---	---	---	---
C21orf99	149992	broad.mit.edu	37	21	14473639	14473639	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14473639delG	uc002yja.3	+							NR_026916				Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	16456784	16456785	+	IGR	DEL	GG	-	-	rs77348278		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16456784_16456785delGG								NRIP1 (19658 upstream) : USP25 (645711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	18040489	18040491	+	IGR	DEL	CTC	-	-	rs144416465		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18040489_18040491delCTC								C21orf34 (58395 upstream) : CXADR (844839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21507185	21507186	+	IGR	INS	-	CACA	CACA	rs149581362	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21507185_21507186insCACA								None (None upstream) : C21orf131 (607728 downstream)																																			---	---	---	---
C21orf131	387486	broad.mit.edu	37	21	22140547	22140548	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22140547_22140548insA	uc002ykz.3	-						C21orf131_uc002yky.3_Intron|C21orf131_uc002yla.3_Intron|C21orf131_uc002ylb.3_Intron|C21orf131_uc002ylc.3_Intron	NR_024090				Homo sapiens cDNA FLJ37207 fis, clone BRALZ2007576.												0																		---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22680390	22680391	+	Intron	INS	-	AC	AC	rs143153728	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22680390_22680391insAC	uc002yld.1	+						NCAM2_uc011acb.1_Intron|NCAM2_uc011acc.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	23965601	23965602	+	IGR	DEL	TT	-	-	rs146470238		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23965601_23965602delTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24487620	24487627	+	IGR	DEL	TGTGTGTG	-	-	rs67889024		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24487620_24487627delTGTGTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24922640	24922641	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs8132027	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24922640_24922641insTTCCTTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26283252	26283253	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26283252_26283253delCA								None (None upstream) : NCRNA00158 (474881 downstream)																																			---	---	---	---
CYYR1	116159	broad.mit.edu	37	21	27867872	27867872	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27867872delA	uc002ymd.2	-						CYYR1_uc011ack.1_Intron|CYYR1_uc002yme.2_Intron	NM_052954	NP_443186			cysteine and tyrosine-rich 1 protein precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	33241471	33241476	+	IGR	DEL	GTGTGG	-	-	rs113575745		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33241471_33241476delGTGTGG								SFRS15 (137040 upstream) : HUNK (4152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33389512	33389514	+	IGR	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33389512_33389514delTTG								HUNK (13136 upstream) : NCRNA00159 (63115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	34348863	34348864	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34348863_34348864delCA								C21orf62 (162810 upstream) : OLIG2 (49375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	34509517	34509518	+	IGR	INS	-	T	T	rs143357738	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34509517_34509518insT								OLIG1 (64790 upstream) : C21orf54 (28259 downstream)																																			---	---	---	---
C21orf82	114036	broad.mit.edu	37	21	35559322	35559322	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35559322delA	uc002yts.2	+							NR_027266				Homo sapiens C21orf82 protein (C21orf82) mRNA, complete cds.												0																		---	---	---	---
TTC3	7267	broad.mit.edu	37	21	38536643	38536643	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38536643delT	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron|TTC3_uc002ywd.1_Intron	NM_001001894	NP_001001894			tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	40354322	40354322	+	IGR	DEL	A	-	-	rs72189136		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40354322delA								ETS2 (157446 upstream) : PSMG1 (193068 downstream)																																			---	---	---	---
SH3BGR	6450	broad.mit.edu	37	21	40866155	40866157	+	Intron	DEL	TCC	-	-	rs967235		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40866155_40866157delTCC	uc002yya.2	+						SH3BGR_uc002yxz.2_Intron	NM_007341	NP_031367			SH3-binding domain and glutamic acid-rich						protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)														---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42178285	42178286	+	Intron	INS	-	A	A	rs139851471	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42178285_42178286insA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	42392924	42392943	+	IGR	DEL	AAGAAAGAAAGAAAGAAAGA	-	-	rs9978700		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42392924_42392943delAAGAAAGAAAGAAAGAAAGA								DSCAM (173885 upstream) : C21orf130 (120484 downstream)																																			---	---	---	---
MX1	4599	broad.mit.edu	37	21	42814056	42814056	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42814056delA	uc002yzh.2	+						MX1_uc002yzi.2_Intron|MX1_uc010goq.2_Intron	NM_001144925	NP_001138397			myxovirus resistance protein 1						induction of apoptosis|response to virus|type I interferon-mediated signaling pathway	cytosol	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	43146751	43146753	+	IGR	DEL	CTT	-	-	rs11909515		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43146751_43146753delCTT								NCRNA00112 (9010 upstream) : RIPK4 (12776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	43197875	43197882	+	IGR	DEL	CACACACA	-	-	rs113426892		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43197875_43197882delCACACACA								RIPK4 (10626 upstream) : PRDM15 (20505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44756088	44756096	+	IGR	DEL	CACCACCAA	-	-	rs72268009	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756088_44756096delCACCACCAA								CRYAA (163175 upstream) : SIK1 (78302 downstream)																																			---	---	---	---
PCBP3	54039	broad.mit.edu	37	21	47230132	47230133	+	Intron	INS	-	TG	TG	rs149677854	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47230132_47230133insTG	uc010gqb.2	+							NM_020528	NP_065389			poly(rC) binding protein 3 isoform 1						mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	47366639	47366639	+	IGR	DEL	T	-	-	rs113415035		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47366639delT								PCBP3 (4272 upstream) : COL6A1 (35024 downstream)																																			---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47410379	47410423	+	Intron	DEL	AATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGA	-	-	rs72435610	by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410379_47410423delAATGGGGCGAGATGGGGAGGGACGGAGTGGACGGCGTGAAGGTGA	uc002zhu.1	+							NM_001848	NP_001839			collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47424275	47424287	+	3'UTR	DEL	CTCCTGCCCTGCC	-	-	rs67179338		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47424275_47424287delCTCCTGCCCTGCC	uc002zhu.1	+	35					COL6A1_uc010gqd.1_3'UTR|COL6A1_uc002zhv.1_3'UTR|COL6A1_uc002zhw.1_3'UTR	NM_001848	NP_001839			collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
C21orf56	84221	broad.mit.edu	37	21	47590592	47590592	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47590592delT	uc011afu.1	-						C21orf56_uc002zii.2_Intron	NM_001142854	NP_001136326			hypothetical protein LOC84221 isoform 1								protein binding			skin(1)	1	Breast(49;0.214)			Colorectal(79;0.241)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	17326476	17326477	+	IGR	DEL	CA	-	-	rs71653091		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17326476_17326477delCA								HSFYL1 (16251 upstream) : GAB4 (116352 downstream)																																			---	---	---	---
BCL2L13	23786	broad.mit.edu	37	22	18205142	18205143	+	Intron	DEL	GG	-	-	rs113458410		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18205142_18205143delGG	uc002zmw.2	+						BCL2L13_uc002zmx.2_Intron|BCL2L13_uc002zmy.2_Intron|BCL2L13_uc010gqy.2_Intron|BCL2L13_uc011agk.1_Intron|BCL2L13_uc010gqz.2_Intron|BCL2L13_uc002zmz.2_Intron|BCL2L13_uc002zna.2_Intron	NM_015367	NP_056182			BCL2-like 13 (apoptosis facilitator)						induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)														---	---	---	---
FLJ41941	100192420	broad.mit.edu	37	22	18516684	18516684	+	Intron	DEL	C	-	-	rs5747448	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18516684delC	uc002zno.1	+							NR_024417				Homo sapiens cDNA FLJ41941 fis, clone PERIC2007914.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	19313013	19313013	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19313013delC								CLTCL1 (33774 upstream) : HIRA (5211 downstream)																																			---	---	---	---
COMT	1312	broad.mit.edu	37	22	19945690	19945691	+	Intron	DEL	TT	-	-	rs361708		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19945690_19945691delTT	uc002zqu.2	+						COMT_uc002zqt.2_Intron|COMT_uc002zqv.2_Intron|COMT_uc002zqw.2_Intron|COMT_uc011ahd.1_Intron|COMT_uc002zqx.2_Intron	NM_000754	NP_000745			catechol-O-methyltransferase isoform MB-COMT						neurotransmitter biosynthetic process|neurotransmitter catabolic process|xenobiotic metabolic process	cytosol|integral to membrane|intracellular membrane-bounded organelle|microsome|plasma membrane|soluble fraction	catechol O-methyltransferase activity|magnesium ion binding|protein binding			ovary(1)	1	Colorectal(54;0.0993)				Carbidopa(DB00190)|Conjugated Estrogens(DB00286)|Diethylstilbestrol(DB00255)|Dobutamine(DB00841)|Dopamine(DB00988)|Entacapone(DB00494)|Folic Acid(DB00158)|L-Valine(DB00161)|Levodopa(DB01235)|Methyldopa(DB00968)|Modafinil(DB00745)|Morphine(DB00295)|S-Adenosylmethionine(DB00118)|Tolcapone(DB00323)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	21483628	21483629	+	5'Flank	INS	-	G	G	rs2930777		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21483628_21483629insG	uc010gsw.1	-											SubName: Full=HCG2019008, isoform CRA_d; SubName: Full=Putative uncharacterized protein ENSP00000324580;																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	21579167	21579168	+	IGR	DEL	AT	-	-	rs415287		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21579167_21579168delAT								LOC400891 (160712 upstream) : POM121L8P (57546 downstream)																																			---	---	---	---
PPIL2	23759	broad.mit.edu	37	22	22032945	22032945	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22032945delC	uc010gtj.1	+						PPIL2_uc002zvh.3_Intron|PPIL2_uc002zvi.3_Intron|PPIL2_uc002zvg.3_Intron|PPIL2_uc011aij.1_Intron	NM_148175	NP_680480			peptidylprolyl isomerase-like 2 isoform a						blood coagulation|leukocyte migration|protein folding|protein polyubiquitination	Golgi lumen|nucleus|ubiquitin ligase complex	peptidyl-prolyl cis-trans isomerase activity|ubiquitin-ubiquitin ligase activity			ovary(2)	2	Colorectal(54;0.105)																	---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22394291	22394292	+	Intron	INS	-	G	G	rs72564444	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22394291_22394292insG	uc011aim.1	+						uc002zvu.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
DDT	1652	broad.mit.edu	37	22	24259944	24259944	+	Intron	DEL	A	-	-	rs143284253		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24259944delA	uc011ajf.1	-							NM_001355	NP_001346			D-dopachrome tautomerase						melanin biosynthetic process	cytoplasm	D-dopachrome decarboxylase activity|dopachrome isomerase activity|protein binding				0																		---	---	---	---
UPB1	51733	broad.mit.edu	37	22	24872280	24872280	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24872280delA	uc003aae.2	+						C22orf45_uc003aad.1_Intron					SubName: Full=cDNA FLJ14215 fis, clone NT2RP3003665, highly similar to Beta-ureidopropionase (EC 3.5.1.6);						pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	beta-ureidopropionase activity|metal ion binding			ovary(2)	2	Colorectal(2;0.0339)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	25921976	25921977	+	IGR	INS	-	A	A	rs139753830	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25921976_25921977insA								LRP5L (144432 upstream) : ADRBK2 (38884 downstream)																																			---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26688111	26688112	+	Intron	INS	-	AAGG	AAGG	rs638297	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26688111_26688112insAAGG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_5'Flank|SEZ6L_uc010gvc.1_5'Flank	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	26841298	26841299	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26841298_26841299insA								ASPHD2 (320 upstream) : HPS4 (6148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27359663	27359663	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27359663delC								MIAT (244714 upstream) : MN1 (784603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27440023	27440024	+	IGR	INS	-	ATCC	ATCC	rs66849036		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27440023_27440024insATCC								MIAT (325074 upstream) : MN1 (704242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27885175	27885176	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27885175_27885176delAC								MIAT (770226 upstream) : MN1 (259090 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27904560	27904561	+	IGR	INS	-	AC	AC	rs151250032	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27904560_27904561insAC								MIAT (789611 upstream) : MN1 (239705 downstream)																																			---	---	---	---
MN1	4330	broad.mit.edu	37	22	28168841	28168843	+	Intron	DEL	CAT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28168841_28168843delCAT	uc003adj.2	-						MN1_uc010gvg.2_Intron	NM_002430	NP_002421			meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10								T	ETV6	AML|meningioma								---	---	---	---
LOC284900	284900	broad.mit.edu	37	22	28323037	28323038	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28323037_28323038insT	uc003ado.2	+							NR_026963				Homo sapiens mRNA for KIAA1648 protein, partial cds.												0																		---	---	---	---
TTC28	23331	broad.mit.edu	37	22	28841850	28841851	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28841850_28841851delAC	uc003adp.3	-							NM_001145418	NP_001138890			tetratricopeptide repeat domain 28								binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	29594103	29594108	+	IGR	DEL	TTCTTC	-	-	rs71324742		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29594103_29594108delTTCTTC								KREMEN1 (29782 upstream) : EMID1 (7845 downstream)																																			---	---	---	---
RASL10A	10633	broad.mit.edu	37	22	29712234	29712234	+	5'Flank	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29712234delG	uc003aff.2	-						RASL10A_uc003afg.2_5'Flank	NM_006477	NP_006468			RAS-related on chromosome 22 isoform a						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
ASCC2	84164	broad.mit.edu	37	22	30194325	30194325	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30194325delG	uc003agr.2	-						ASCC2_uc003ags.2_Intron|ASCC2_uc003agt.2_Intron|ASCC2_uc011akr.1_Intron	NM_032204	NP_115580			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)															---	---	---	---
TCN2	6948	broad.mit.edu	37	22	31017457	31017458	+	Intron	INS	-	TTA	TTA	rs8139921	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31017457_31017458insTTA	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346			transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
OSBP2	23762	broad.mit.edu	37	22	31214271	31214271	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31214271delT	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron	NM_030758	NP_110385			oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2																		---	---	---	---
OSBP2	23762	broad.mit.edu	37	22	31298115	31298127	+	Intron	DEL	AAAAAAAAAAACC	-	-	rs138451610	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298115_31298127delAAAAAAAAAAACC	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385			oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2																		---	---	---	---
EIF4ENIF1	56478	broad.mit.edu	37	22	31870050	31870051	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31870050_31870051insT	uc003akz.1	-						EIF4ENIF1_uc003ala.1_Intron|EIF4ENIF1_uc003alb.1_Intron|EIF4ENIF1_uc003alc.1_Intron	NM_019843	NP_062817			eukaryotic translation initiation factor 4E							nucleus	protein binding|protein transporter activity			ovary(1)	1																		---	---	---	---
TOM1	10043	broad.mit.edu	37	22	35739362	35739363	+	Intron	INS	-	CT	CT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35739362_35739363insCT	uc003ann.2	+						TOM1_uc011ami.1_Intron|TOM1_uc011amj.1_Intron|TOM1_uc003ans.2_Intron|TOM1_uc011amk.1_Intron|TOM1_uc003anp.2_Intron|TOM1_uc011aml.1_Intron|TOM1_uc003ano.2_Intron|TOM1_uc003anq.2_Intron|TOM1_uc003anr.2_Intron	NM_005488	NP_005479			target of myb1 isoform 1						endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	35849332	35849333	+	IGR	INS	-	AG	AG	rs142483922	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35849332_35849333insAG								MCM5 (28838 upstream) : RASD2 (88019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35997870	35997871	+	IGR	INS	-	TG	TG	rs147336697		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35997870_35997871insTG								RASD2 (47827 upstream) : MB (4941 downstream)																																			---	---	---	---
APOL6	80830	broad.mit.edu	37	22	36049940	36049941	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36049940_36049941delGT	uc003aoe.2	+						APOL6_uc003aod.2_Intron	NM_030641	NP_085144			apolipoprotein L6						lipoprotein metabolic process	cytoplasm|extracellular region	lipid binding|lipid transporter activity				0																		---	---	---	---
RBM9	23543	broad.mit.edu	37	22	36245320	36245321	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36245320_36245321delAC	uc003aon.3	-						RBM9_uc010gwu.2_Intron|RBM9_uc003aoo.3_Intron	NM_001082578	NP_001076047			RNA binding motif protein 9 isoform 5						estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	37355099	37355118	+	IGR	DEL	GGGTGGATGGATGGATGGAG	-	-	rs111652953		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37355099_37355118delGGGTGGATGGATGGATGGAG								CSF2RB (18622 upstream) : C22orf33 (32043 downstream)																																			---	---	---	---
MPST	4357	broad.mit.edu	37	22	37418031	37418031	+	Intron	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37418031delG	uc003aqj.2	+						TST_uc003aqg.2_5'Flank|TST_uc003aqh.2_5'Flank|MPST_uc003aqi.1_Intron|MPST_uc003aqm.2_Intron|MPST_uc011amu.1_Intron|MPST_uc003aql.2_Intron|MPST_uc003aqn.2_5'Flank|MPST_uc003aqo.2_5'Flank	NM_001130517	NP_001123989			mercaptopyruvate sulfurtransferase isoform 2						cyanate catabolic process|response to toxin		3-mercaptopyruvate sulfurtransferase activity|thiosulfate sulfurtransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	37619044	37619045	+	IGR	INS	-	TT	TT			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37619044_37619045insTT								SSTR3 (10691 upstream) : RAC2 (2267 downstream)																																			---	---	---	---
MAFF	23764	broad.mit.edu	37	22	38606631	38606634	+	Intron	DEL	GTGT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38606631_38606634delGTGT	uc011anp.1	+						MAFF_uc003avc.2_Intron|MAFF_uc011anq.1_Intron|MAFF_uc011anr.1_Intron|MAFF_uc003avd.2_5'Flank	NM_001161572	NP_001155044			transcription factor MAFF isoform a						blood coagulation|parturition|transcription from RNA polymerase II promoter	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.045)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	40386527	40386528	+	IGR	INS	-	A	A	rs112172522		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40386527_40386528insA								GRAP2 (6171 upstream) : FAM83F (4425 downstream)																																			---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40502242	40502242	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40502242delT	uc003aym.2	+							NM_001024843	NP_001020014			trinucleotide repeat containing 6B isoform 3						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
XPNPEP3	63929	broad.mit.edu	37	22	41264433	41264434	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41264433_41264434delGT	uc003azh.2	+						XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_Intron|XPNPEP3_uc010gyh.1_Intron	NM_022098	NP_071381			X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0																		---	---	---	---
MEI1	150365	broad.mit.edu	37	22	42127055	42127056	+	Intron	INS	-	T	T	rs71680942		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42127055_42127056insT	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726			meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
SERHL	94009	broad.mit.edu	37	22	42939481	42939481	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42939481delT	uc011apm.1	+											RecName: Full=Serine hydrolase-like protein;          EC=3.1.-.-;												0																		---	---	---	---
PACSIN2	11252	broad.mit.edu	37	22	43343681	43343681	+	5'Flank	DEL	T	-	-	rs148517295	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43343681delT	uc010gzg.2	-						PACSIN2_uc003bdg.3_Intron|PACSIN2_uc003bde.3_Intron|PACSIN2_uc003bdf.3_Intron	NM_007229	NP_009160			protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)																---	---	---	---
KIAA1644	85352	broad.mit.edu	37	22	44685346	44685347	+	Intron	INS	-	TG	TG	rs143356791	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44685346_44685347insTG	uc003bet.2	-							NM_001099294	NP_001092764			hypothetical protein LOC85352 precursor							integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)																---	---	---	---
NUP50	10762	broad.mit.edu	37	22	45577017	45577019	+	Intron	DEL	CCC	-	-	rs66468525		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45577017_45577019delCCC	uc003bfr.2	+						NUP50_uc003bfs.2_Intron|NUP50_uc011aqn.1_Intron|NUP50_uc003bft.2_Intron|NUP50_uc011aqo.1_Intron	NM_007172	NP_009103			nucleoporin 50kDa isoform b						carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)														---	---	---	---
ATXN10	25814	broad.mit.edu	37	22	46172386	46172386	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46172386delT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368			ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	46256096	46256098	+	IGR	DEL	GTA	-	-	rs3051963		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46256096_46256098delGTA								ATXN10 (15267 upstream) : WNT7B (60150 downstream)																																			---	---	---	---
CELSR1	9620	broad.mit.edu	37	22	46873255	46873255	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46873255delA	uc003bhw.1	-							NM_014246	NP_055061			cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)														---	---	---	---
GRAMD4	23151	broad.mit.edu	37	22	47038981	47038982	+	Intron	INS	-	ATCC	ATCC	rs72346004		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47038981_47038982insATCC	uc003bhx.2	+						GRAMD4_uc010had.2_Intron	NM_015124	NP_055939			death-inducing-protein						apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	47642377	47642378	+	IGR	DEL	TG	-	-	rs66615517		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47642377_47642378delTG								TBC1D22A (72655 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	48210304	48210305	+	Intron	INS	-	TG	TG	rs10639631		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48210304_48210305insTG	uc003bik.1	+											Homo sapiens cDNA FLJ35788 fis, clone TESTI2005683.																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	48335939	48335942	+	IGR	DEL	GTGA	-	-	rs9615690		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48335939_48335942delGTGA								TBC1D22A (766217 upstream) : FAM19A5 (549346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49395047	49395050	+	IGR	DEL	CACA	-	-	rs143860587		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49395047_49395050delCACA								FAM19A5 (247305 upstream) : C22orf34 (413126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49583871	49583872	+	IGR	INS	-	GTGATTCACTCACCTCCCTCCAGGTCCCTCCAAACCCCTTCCC	GTGATTCACTCACCTCCCTCCAGGTCCCTCCAAACCCCTTCCC	rs66754461		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49583871_49583872insGTGATTCACTCACCTCCCTCCAGGTCCCTCCAAACCCCTTCCC								FAM19A5 (436129 upstream) : C22orf34 (224304 downstream)																																			---	---	---	---
ZBED4	9889	broad.mit.edu	37	22	50281674	50281674	+	3'UTR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50281674delC	uc003bix.2	+	2						NM_014838	NP_055653			zinc finger, BED-type containing 4							cytoplasm|nucleus	DNA binding|metal ion binding|protein dimerization activity			ovary(2)	2		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
SAPS2	9701	broad.mit.edu	37	22	50818661	50818661	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50818661delT	uc003blb.1	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003blc.2_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493			SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	423399	423400	+	IGR	INS	-	TC	TC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:423399_423400insTC								PPP2R3B (75772 upstream) : SHOX (161679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	562920	562921	+	IGR	INS	-	TC	TC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:562920_562921insTC								PPP2R3B (215293 upstream) : SHOX (22158 downstream)																																			---	---	---	---
CRLF2	64109	broad.mit.edu	37	X	1333433	1333433	+	5'Flank	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1333433delA	uc004cpm.1	-											Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)						Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	X	1451433	1451433	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1451433delT								CSF2RA (22605 upstream) : IL3RA (4076 downstream)																																			---	---	---	---
SLC25A6	293	broad.mit.edu	37	X	1509471	1509471	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1509471delA	uc004cpt.2	-						SLC25A6_uc004cpu.2_Intron	NM_001636	NP_001627			adenine nucleotide translocator 3						active induction of host immune response by virus|apoptosis|energy reserve metabolic process|regulation of insulin secretion|viral infectious cycle	integral to membrane|mitochondrial inner membrane presequence translocase complex	ATP:ADP antiporter activity|protein binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)													---	---	---	---
P2RY8	286530	broad.mit.edu	37	X	1602776	1602776	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1602776delA	uc004cpz.2	-							NM_178129	NP_835230			G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)						T	CRLF2	B-ALL|Downs associated ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	X	1853964	1853977	+	IGR	DEL	CCTCCTTCTTTCCC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1853964_1853977delCCTCCTTCTTTCCC								ASMT (91991 upstream) : DHRSX (283580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1980642	1980643	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1980642_1980643insT								ASMT (218669 upstream) : DHRSX (156914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	3334504	3334505	+	IGR	DEL	TG	-	-	rs71713541		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3334504_3334505delTG								MXRA5 (69820 upstream) : PRKX (187908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	4532988	4532989	+	IGR	DEL	GA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:4532988_4532989delGA								PRKX (901327 upstream) : None (None downstream)																																			---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12211954	12211955	+	Intron	INS	-	A	A	rs5933966		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12211954_12211955insA	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543			FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
FRMPD4	9758	broad.mit.edu	37	X	12699815	12699816	+	Intron	INS	-	AC	AC	rs71887316		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12699815_12699816insAC	uc004cuz.1	+						FRMPD4_uc011mij.1_Intron	NM_014728	NP_055543			FERM and PDZ domain containing 4						positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	12999599	12999600	+	IGR	INS	-	TTG	TTG	rs140093891		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12999599_12999600insTTG								TLR8 (58313 upstream) : FAM9C (54137 downstream)																																			---	---	---	---
AP1S2	8905	broad.mit.edu	37	X	15874911	15874912	+	5'Flank	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15874911_15874912insT	uc004cxi.2	-						AP1S2_uc010nex.2_5'Flank|AP1S2_uc011mis.1_5'Flank|AP1S2_uc011mit.1_5'Flank|AP1S2_uc011miu.1_5'Flank	NM_003916	NP_003907			adaptor-related protein complex 1 sigma 2						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	AP-type membrane coat adaptor complex|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein transporter activity				0	Hepatocellular(33;0.183)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	16334280	16334281	+	IGR	INS	-	CACA	CACA	rs112027141		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16334280_16334281insCACA								GRPR (162640 upstream) : CTPS2 (271843 downstream)																																			---	---	---	---
REPS2	9185	broad.mit.edu	37	X	17082046	17082047	+	Intron	INS	-	ACAC	ACAC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17082046_17082047insACAC	uc004cxv.1	+						REPS2_uc004cxw.1_Intron|REPS2_uc011miw.1_Intron	NM_004726	NP_004717			RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)																	---	---	---	---
NHS	4810	broad.mit.edu	37	X	17718561	17718562	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17718561_17718562insA	uc004cxx.2	+						NHS_uc011mix.1_Intron|NHS_uc004cxy.2_Intron|NHS_uc004cxz.2_Intron|NHS_uc004cya.2_Intron	NM_198270	NP_938011			Nance-Horan syndrome protein isoform 1							nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)																	---	---	---	---
CDKL5	6792	broad.mit.edu	37	X	18492019	18492020	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18492019_18492020insT	uc004cym.2	+						CDKL5_uc004cyn.2_Intron	NM_003159	NP_003150			cyclin-dependent kinase-like 5						neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	19342633	19342634	+	IGR	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19342633_19342634delAA								GPR64 (201956 upstream) : PDHA1 (19377 downstream)																																			---	---	---	---
SH3KBP1	30011	broad.mit.edu	37	X	19784354	19784354	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19784354delT	uc004czm.2	-						SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098			SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	20660345	20660345	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20660345delT								RPS6KA3 (374822 upstream) : CNKSR2 (732635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	21059234	21059236	+	IGR	DEL	TTG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21059234_21059236delTTG								RPS6KA3 (773711 upstream) : CNKSR2 (333744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	22030576	22030576	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22030576delA								SMS (17622 upstream) : PHEX (20345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	23172197	23172197	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23172197delA								DDX53 (151993 upstream) : PTCHD1 (180788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	23514902	23514903	+	IGR	DEL	AA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23514902_23514903delAA								PTCHD1 (99985 upstream) : PRDX4 (170742 downstream)																																			---	---	---	---
APOO	79135	broad.mit.edu	37	X	23913282	23913283	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23913282_23913283delCA	uc004dax.2	-						APOO_uc004day.3_Intron	NM_024122	NP_077027			apolipoprotein O precursor						lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0																		---	---	---	---
PCYT1B	9468	broad.mit.edu	37	X	24597239	24597239	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24597239delA	uc004dbi.2	-						PCYT1B_uc004dbk.3_Intron|PCYT1B_uc004dbj.2_Intron	NM_004845	NP_004836			choline phosphate cytidylyltransferase 1 beta							endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)													---	---	---	---
POLA1	5422	broad.mit.edu	37	X	24976793	24976794	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24976793_24976794delAC	uc004dbl.2	+							NM_016937	NP_058633			DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)													---	---	---	---
DMD	1756	broad.mit.edu	37	X	32191133	32191134	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32191133_32191134insA	uc004dda.1	-						DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc010ngn.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	36836144	36836144	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36836144delA								CXorf30 (432711 upstream) : FAM47C (190326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	40088384	40088385	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40088384_40088385insA								BCOR (51802 upstream) : ATP6AP2 (351831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	40296263	40296266	+	IGR	DEL	TCTA	-	-	rs2961379		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40296263_40296266delTCTA								BCOR (259681 upstream) : ATP6AP2 (143950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	40311730	40311733	+	IGR	DEL	TCTT	-	-	rs151095796		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40311730_40311733delTCTT								BCOR (275148 upstream) : ATP6AP2 (128483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	41234510	41234511	+	IGR	INS	-	T	T	rs141327447		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41234510_41234511insT								DDX3X (10786 upstream) : NYX (72202 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	43758744	43758745	+	IGR	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43758744_43758745delAC								MAOB (17023 upstream) : NDP (49279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	43953572	43953573	+	IGR	INS	-	T	T	rs150082238		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43953572_43953573insT								NDP (120651 upstream) : EFHC2 (53556 downstream)																																			---	---	---	---
EFHC2	80258	broad.mit.edu	37	X	44157615	44157615	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44157615delA	uc004dgb.3	-							NM_025184	NP_079460			EF-hand domain (C-terminal) containing 2								calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	46250192	46250195	+	IGR	DEL	TTAA	-	-	rs10582403		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46250192_46250195delTTAA								MIR222 (643662 upstream) : ZNF673 (56429 downstream)																																			---	---	---	---
ZNF673	55634	broad.mit.edu	37	X	46307049	46307052	+	Intron	DEL	TGAT	-	-	rs150180592		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46307049_46307052delTGAT	uc004dgn.3	+						ZNF673_uc004dgp.3_Intron|ZNF673_uc010nhl.2_Intron|ZNF673_uc004dgm.3_Intron	NM_001129898	NP_001123370			zinc finger family member 673 isoform 1						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0																		---	---	---	---
CHST7	56548	broad.mit.edu	37	X	46443865	46443865	+	Intron	DEL	G	-	-	rs11311886		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46443865delG	uc004dgt.2	+							NM_019886	NP_063939			chondroitin 6-sulfotransferase 7						chondroitin sulfate biosynthetic process|N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity|N-acetylglucosamine 6-O-sulfotransferase activity			breast(3)	3																		---	---	---	---
RBM10	8241	broad.mit.edu	37	X	47036114	47036115	+	Intron	DEL	TC	-	-	rs71692336		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47036114_47036115delTC	uc004dhf.2	+						RBM10_uc004dhe.1_Intron|RBM10_uc004dhg.2_Intron|RBM10_uc004dhh.2_Intron|RBM10_uc010nhq.2_Intron|RBM10_uc004dhi.2_Intron	NM_005676	NP_005667			RNA binding motif protein 10 isoform 1						mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	53963085	53963086	+	IGR	INS	-	A	A	rs74439447		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53963085_53963086insA								HUWE1 (249412 upstream) : PHF8 (28 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	57867039	57867040	+	IGR	DEL	GT	-	-	rs148644686		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57867039_57867040delGT								ZXDB (243133 upstream) : ZXDA (67158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	57977062	57977063	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57977062_57977063insT								ZXDA (39995 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	64036134	64036134	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64036134delC								MTMR8 (420823 upstream) : ZC4H2 (100128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	66596259	66596259	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66596259delA								EDA2R (737151 upstream) : AR (167615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68087147	68087147	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68087147delA								EFNB1 (21118 upstream) : PJA1 (293435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68482358	68482359	+	IGR	INS	-	TG	TG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68482358_68482359insTG								PJA1 (97018 upstream) : FAM155B (242719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68561072	68561073	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68561072_68561073delTC								PJA1 (175732 upstream) : FAM155B (164005 downstream)																																			---	---	---	---
NHSL2	340527	broad.mit.edu	37	X	71192716	71192717	+	Intron	INS	-	TG	TG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71192716_71192717insTG	uc011mqa.1	+							NM_001013627	NP_001013649			NHS-like 2												0	Renal(35;0.156)																	---	---	---	---
NHSL2	340527	broad.mit.edu	37	X	71250902	71250902	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71250902delA	uc011mqa.1	+							NM_001013627	NP_001013649			NHS-like 2												0	Renal(35;0.156)																	---	---	---	---
NHSL2	340527	broad.mit.edu	37	X	71310623	71310624	+	Intron	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71310623_71310624delGT	uc011mqa.1	+							NM_001013627	NP_001013649			NHS-like 2												0	Renal(35;0.156)																	---	---	---	---
KIAA2022	340533	broad.mit.edu	37	X	74124543	74124544	+	Intron	DEL	CT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74124543_74124544delCT	uc004eby.2	-							NM_001008537	NP_001008537			hypothetical protein LOC340533						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	75166477	75166477	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75166477delA								MAGEE2 (161406 upstream) : CXorf26 (226294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	79317669	79317669	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79317669delC								TBX22 (30401 upstream) : FAM46D (273334 downstream)																																			---	---	---	---
BRWD3	254065	broad.mit.edu	37	X	79982491	79982492	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79982491_79982492insA	uc004edt.2	-						BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984			bromodomain and WD repeat domain containing 3											ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	80298074	80298075	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:80298074_80298075insA								BRWD3 (232841 upstream) : HMGN5 (71125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	81291332	81291333	+	IGR	INS	-	T	T	rs36060227		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:81291332_81291333insT								SH3BGRL (737290 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	81329384	81329386	+	IGR	DEL	AAA	-	-	rs12557971		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:81329384_81329386delAAA								SH3BGRL (775342 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	81372775	81372776	+	IGR	INS	-	C	C	rs142111866		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:81372775_81372776insC								SH3BGRL (818733 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	83909603	83909604	+	IGR	INS	-	GC	GC	rs4039359		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83909603_83909604insGC								HDX (152145 upstream) : UBE2DNL (279553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	89213269	89213270	+	IGR	INS	-	AC	AC	rs68187753		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89213269_89213270insAC								TGIF2LX (35389 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	89458542	89458545	+	IGR	DEL	CTTT	-	-	rs72206424		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89458542_89458545delCTTT								TGIF2LX (280662 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	90324618	90324619	+	IGR	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90324618_90324619insG								None (None upstream) : PABPC5 (364978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	92763553	92763554	+	IGR	INS	-	CG	CG	rs35609753		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92763553_92763554insCG								PCDH11X (885327 upstream) : NAP1L3 (162375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	97223060	97223061	+	IGR	INS	-	AC	AC	rs35360635		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97223060_97223061insAC								DIAPH2 (367464 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	97750933	97750933	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97750933delT								DIAPH2 (895337 upstream) : LOC442459 (965667 downstream)																																			---	---	---	---
TNMD	64102	broad.mit.edu	37	X	99843302	99843303	+	Intron	INS	-	AC	AC			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99843302_99843303insAC	uc004efy.3	+						TNMD_uc004efz.2_Intron	NM_022144	NP_071427			tenomodulin							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	99992841	99992844	+	IGR	DEL	CATT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99992841_99992844delCATT								SYTL4 (5710 upstream) : CSTF2 (82504 downstream)																																			---	---	---	---
ARL13A	392509	broad.mit.edu	37	X	100222591	100222594	+	5'Flank	DEL	AAAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100222591_100222594delAAAA	uc004ego.2	+						ARL13A_uc011mrf.1_5'Flank|ARL13A_uc010nng.2_5'Flank	NM_001012990	NP_001013008			ADP-ribosylation factor-like 13 isoform a								GTP binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	102620915	102620916	+	IGR	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102620915_102620916insT								WBP5 (7520 upstream) : NGFRAP1 (10352 downstream)																																			---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	104514980	104514981	+	Intron	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104514980_104514981delCA	uc004elz.1	+							NM_017416	NP_059112			interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	106662565	106662566	+	IGR	DEL	AA	-	-	rs67252049		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106662565_106662566delAA								CXorf41 (175093 upstream) : PRPS1 (209088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	108611757	108611757	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108611757delT								IRS4 (632150 upstream) : GUCY2F (4379 downstream)																																			---	---	---	---
GUCY2F	2986	broad.mit.edu	37	X	108631266	108631267	+	Intron	INS	-	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108631266_108631267insG	uc004eod.3	-						GUCY2F_uc011msq.1_Intron	NM_001522	NP_001513			guanylate cyclase 2F precursor						intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8																		---	---	---	---
ALG13	79868	broad.mit.edu	37	X	110927546	110927547	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110927546_110927547insT	uc011msy.1	+						ALG13_uc004epi.1_Intron|ALG13_uc011msw.1_Intron|ALG13_uc011msx.1_Intron|ALG13_uc011msz.1_Intron|ALG13_uc011mta.1_Intron|ALG13_uc011mtb.1_Intron					SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);						dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1																		---	---	---	---
TRPC5	7224	broad.mit.edu	37	X	111214003	111214004	+	Intron	INS	-	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111214003_111214004insT	uc004epl.1	-						TRPC5_uc004epm.1_Intron	NM_012471	NP_036603			transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1																		---	---	---	---
ZCCHC16	340595	broad.mit.edu	37	X	111405017	111405036	+	Intron	DEL	CTTCCTTCCTTCCTTCCTTC	-	-	rs36225922		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111405017_111405036delCTTCCTTCCTTCCTTCCTTC	uc004epo.1	+							NM_001004308	NP_001004308			zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	113504875	113504876	+	IGR	DEL	AT	-	-	rs111998413		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113504875_113504876delAT								None (None upstream) : HTR2C (313675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	114635304	114635305	+	IGR	DEL	TC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114635304_114635305delTC								LUZP4 (93185 upstream) : PLS3 (159901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	114781529	114781530	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114781529_114781530insA	uc004eqc.1	-											Homo sapiens cDNA FLJ45456 fis, clone BRSTN2009917.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	115134686	115134687	+	IGR	INS	-	T	T	rs66683327		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115134686_115134687insT								PLS3 (249696 upstream) : AGTR2 (167271 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	115237393	115237394	+	IGR	INS	-	AC	AC	rs148563163		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115237393_115237394insAC								PLS3 (352403 upstream) : AGTR2 (64564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	115739675	115739675	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115739675delG								CXorf61 (145538 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	116312696	116312697	+	IGR	INS	-	TG	TG			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:116312696_116312697insTG								CXorf61 (718559 upstream) : KLHL13 (719080 downstream)																																			---	---	---	---
IL13RA1	3597	broad.mit.edu	37	X	117865541	117865541	+	Intron	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117865541delA	uc004eqs.2	+						IL13RA1_uc004eqr.1_Intron|IL13RA1_uc004eqt.1_Intron	NM_001560	NP_001551			interleukin 13 receptor, alpha 1 precursor							interleukin-13 receptor complex	cytokine receptor activity				0																		---	---	---	---
NKRF	55922	broad.mit.edu	37	X	118727889	118727890	+	5'Flank	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118727889_118727890insA	uc004erq.2	-						NKRF_uc004err.2_Intron	NM_017544	NP_060014			transcription factor NRF						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	118913001	118913008	+	IGR	DEL	GGAGGGAA	-	-	rs66547601		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118913001_118913008delGGAGGGAA								ANKRD58 (18837 upstream) : RPL39 (7461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	120805890	120805891	+	IGR	INS	-	CT	CT	rs139717230		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120805890_120805891insCT								GLUD2 (622096 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	121280941	121280941	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:121280941delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	123411338	123411339	+	IGR	DEL	AA	-	-	rs146700933		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123411338_123411339delAA								STAG2 (174835 upstream) : SH2D1A (68809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	125433970	125433970	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125433970delG								DCAF12L2 (134036 upstream) : DCAF12L1 (249398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	126101522	126101522	+	IGR	DEL	G	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:126101522delG								CXorf64 (145756 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	127140298	127140299	+	IGR	DEL	CA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127140298_127140299delCA								None (None upstream) : ACTRT1 (44644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128130095	128130095	+	IGR	DEL	C	-	-	rs12687591	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128130095delC								ACTRT1 (943713 upstream) : SMARCA1 (450385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128539917	128539917	+	IGR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128539917delA								None (None upstream) : SMARCA1 (40563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	131402491	131402491	+	Intron	DEL	T	-	-	rs112173666		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131402491delT	uc004ewr.1	+											Homo sapiens cDNA FLJ38120 fis, clone D3OST3000195.																														---	---	---	---
HS6ST2	90161	broad.mit.edu	37	X	131796006	131796007	+	Intron	INS	-	A	A	rs76793899		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131796006_131796007insA	uc011mve.1	-						HS6ST2_uc011mvb.1_Intron|HS6ST2_uc011mvc.1_Intron|HS6ST2_uc011mvd.1_Intron|HS6ST2_uc011mva.1_Intron	NM_147175	NP_671704			heparan sulfate 6-O-sulfotransferase 2 isoform							integral to membrane	sulfotransferase activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	132558150	132558151	+	IGR	INS	-	T	T	rs144998519		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132558150_132558151insT								GPC4 (8945 upstream) : GPC3 (111625 downstream)																																			---	---	---	---
GPC3	2719	broad.mit.edu	37	X	132818911	132818911	+	Intron	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132818911delT	uc004exe.1	-						GPC3_uc004exd.1_Intron|GPC3_uc010nrn.1_Intron|GPC3_uc011mvh.1_Intron|GPC3_uc010nro.1_Intron	NM_004484	NP_004475			glypican 3 isoform 2 precursor							extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)							T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	X	133179645	133179646	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133179645_133179646insA								GPC3 (59979 upstream) : MIR363 (123762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	133799102	133799103	+	IGR	DEL	GT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133799102_133799103delGT								PLAC1 (6589 upstream) : FAM122B (104494 downstream)																																			---	---	---	---
CXorf48	54967	broad.mit.edu	37	X	134293851	134293852	+	Intron	DEL	AC	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134293851_134293852delAC	uc004eyk.1	-						CXorf48_uc004eyl.1_Intron	NM_001031705	NP_001026875			hypothetical protein LOC54967 isoform 1												0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	135199772	135199773	+	IGR	INS	-	A	A	rs147842246		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135199772_135199773insA								SLC9A6 (70346 upstream) : FHL1 (29088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	135879738	135879739	+	IGR	DEL	AT	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135879738_135879739delAT								ARHGEF6 (16235 upstream) : RBMX (71614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	137332585	137332586	+	IGR	INS	-	AAGGAAGA	AAGGAAGA	rs72462101		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137332585_137332586insAAGGAAGA								ZIC3 (678328 upstream) : LOC158696 (364306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	140316388	140316389	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140316388_140316389insA								LDOC1 (45078 upstream) : SPANXC (19208 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142079772	142079773	+	IGR	INS	-	T	T	rs72409960		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142079772_142079773insT								MAGEC2 (786696 upstream) : SPANXN4 (33931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142203668	142203668	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142203668delT								SPANXN4 (81603 upstream) : SPANXN3 (392897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142619682	142619682	+	IGR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142619682delC								SPANXN3 (14375 upstream) : SLITRK4 (96263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	143377361	143377361	+	IGR	DEL	T	-	-	rs71865063		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:143377361delT								UBE2NL (409006 upstream) : SPANXN1 (951746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	143904232	143904233	+	IGR	DEL	AC	-	-	rs111974257		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:143904232_143904233delAC								UBE2NL (935877 upstream) : SPANXN1 (424874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	144082693	144082694	+	IGR	DEL	AT	-	-	rs34541225	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144082693_144082694delAT								None (None upstream) : SPANXN1 (246413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	145340302	145340302	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145340302delT								MIR891A (230912 upstream) : CXorf51 (551000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	145558931	145558934	+	IGR	DEL	ACAA	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145558931_145558934delACAA								MIR891A (449541 upstream) : CXorf51 (332368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146381303	146381303	+	IGR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146381303delT								MIR514-3 (15057 upstream) : ASFMR1 (609646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	147461133	147461133	+	IGR	DEL	C	-	-	rs11333470		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147461133delC								FMR1NB (352953 upstream) : AFF2 (121006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	148408664	148408665	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148408664_148408665insA								AFF2 (326472 upstream) : IDS (151632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	148412500	148412501	+	IGR	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148412500_148412501insA								AFF2 (330308 upstream) : IDS (147796 downstream)																																			---	---	---	---
HMGB3	3149	broad.mit.edu	37	X	150157785	150157785	+	3'UTR	DEL	T	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150157785delT	uc004fep.2	+	5					HMGB3_uc004feq.2_3'UTR|HMGB3_uc004fer.2_3'UTR	NM_005342	NP_005333			high-mobility group box 3						DNA recombination|multicellular organismal development	chromosome|nucleus	DNA bending activity|double-stranded DNA binding				0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
ZNF275	10838	broad.mit.edu	37	X	152615293	152615293	+	3'UTR	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152615293delC	uc004fhg.1	+	5					ZNF275_uc011mym.1_3'UTR|ZNF275_uc011myn.1_3'UTR					SubName: Full=cDNA FLJ16723 fis, clone UTERU3004418, highly similar to Zinc finger protein 275; SubName: Full=Putative uncharacterized protein ZNF275;							intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
BGN	633	broad.mit.edu	37	X	152774514	152774517	+	3'UTR	DEL	TCTT	-	-	rs71690980		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152774514_152774517delTCTT	uc004fhr.1	+	8					BGN_uc004fhq.1_Intron	NM_001711	NP_001702			biglycan preproprotein							proteinaceous extracellular matrix|transport vesicle	extracellular matrix structural constituent			breast(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
GAB3	139716	broad.mit.edu	37	X	153921063	153921064	+	Intron	INS	-	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153921063_153921064insA	uc004fmj.1	-						GAB3_uc004fmk.1_Intron|GAB3_uc010nve.1_Intron|GAB3_uc004fml.1_Intron	NM_080612	NP_542179			Gab3 protein isoform 2											ovary(1)	1	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)																	---	---	---	---
F8	2157	broad.mit.edu	37	X	154196965	154196965	+	Intron	DEL	C	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154196965delC	uc004fmt.2	-							NM_000132	NP_000123			coagulation factor VIII isoform a precursor						acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)													---	---	---	---
BRCC3	79184	broad.mit.edu	37	X	154351000	154351000	+	3'UTR	DEL	A	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154351000delA	uc004fna.2	+	12					BRCC3_uc004fnb.2_3'UTR	NM_024332	NP_077308			BRCA1/BRCA2-containing complex, subunit 3						double-strand break repair|G2/M transition DNA damage checkpoint|histone H2A K63-linked deubiquitination|positive regulation of DNA repair|response to X-ray	BRCA1-A complex|BRISC complex|nuclear ubiquitin ligase complex	enzyme regulator activity|metal ion binding|metallopeptidase activity|polyubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(3)|ovary(1)|large_intestine(1)|breast(1)	6	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10071231	10071232	+	IGR	DEL	AG	-	-			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10071231_10071232delAG								TTTY22 (420377 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59027302	59027306	+	IGR	DEL	AAAAC	-	-	rs146705120		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59027302_59027306delAAAAC								None (None upstream) : None (None downstream)																																			---	---	---	---
PRAMEF10	343071	broad.mit.edu	37	1	12954476	12954476	+	Silent	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12954476G>T	uc001auo.2	-	3	880	c.807C>A	c.(805-807)CCC>CCA	p.P269P		NM_001039361	NP_001034450	O60809	PRA10_HUMAN	PRAME family member 10	269											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PTAFR	5724	broad.mit.edu	37	1	28477068	28477068	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28477068C>A	uc001bpl.2	-	2	592	c.465G>T	c.(463-465)CTG>CTT	p.L155L	PTAFR_uc001bpm.3_Silent_p.L155L|PTAFR_uc009vte.2_Silent_p.L155L	NM_000952	NP_000943	P25105	PTAFR_HUMAN	platelet-activating factor receptor	155	Helical; Name=4; (Potential).				chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
C8A	731	broad.mit.edu	37	1	57373737	57373737	+	Missense_Mutation	SNP	G	T	T	rs143908758	byFrequency	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57373737G>T	uc001cyo.2	+	9	1463	c.1331G>T	c.(1330-1332)CGT>CTT	p.R444L		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	444	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
MTF2	22823	broad.mit.edu	37	1	93594899	93594899	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93594899C>T	uc009wdj.2	+	11	1346	c.1054C>T	c.(1054-1056)CCT>TCT	p.P352S	MTF2_uc010oth.1_Missense_Mutation_p.P250S|MTF2_uc009wdk.2_Intron|MTF2_uc001dpi.3_Missense_Mutation_p.P79S|MTF2_uc010oti.1_Missense_Mutation_p.P250S|MTF2_uc001dpj.3_Missense_Mutation_p.P250S|MTF2_uc001dpl.3_Missense_Mutation_p.P250S|MTF2_uc001dpm.3_Missense_Mutation_p.P21S	NM_007358	NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription	352						nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)														---	---	---	---
KCNA3	3738	broad.mit.edu	37	1	111216794	111216794	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111216794C>T	uc001dzv.1	-	1	862	c.638G>A	c.(637-639)CGC>CAC	p.R213H		NM_002232	NP_002223	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related	213						voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(4)|pancreas(1)	5		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
WNT2B	7482	broad.mit.edu	37	1	113058764	113058764	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113058764A>G	uc001ecb.2	+	3	921	c.406A>G	c.(406-408)AGC>GGC	p.S136G	WNT2B_uc001eca.2_Missense_Mutation_p.S117G|WNT2B_uc009wgg.2_Missense_Mutation_p.S44G	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	136					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
PTGFRN	5738	broad.mit.edu	37	1	117491914	117491914	+	Silent	SNP	C	T	T	rs140719535		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117491914C>T	uc001egv.1	+	4	1070	c.933C>T	c.(931-933)CCC>CCT	p.P311P		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	311	Ig-like C2-type 3.|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)														---	---	---	---
PTGFRN	5738	broad.mit.edu	37	1	117503905	117503905	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117503905C>A	uc001egv.1	+	5	1391	c.1254C>A	c.(1252-1254)CCC>CCA	p.P418P		NM_020440	NP_065173	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor negative regulator	418	Extracellular (Potential).|Ig-like C2-type 4.					endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	protein binding			liver(1)	1	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)														---	---	---	---
WDR3	10885	broad.mit.edu	37	1	118494648	118494648	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118494648G>T	uc010oxe.1	+	17	1919	c.1853G>T	c.(1852-1854)TGG>TTG	p.W618L	WDR3_uc001ehi.2_Intron	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN	WD repeat-containing protein 3	618	WD 11.					nuclear membrane|nucleolus				upper_aerodigestive_tract(1)	1	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)														---	---	---	---
PIAS3	10401	broad.mit.edu	37	1	145584516	145584516	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145584516C>T	uc001eoc.1	+	12	1574	c.1483C>T	c.(1483-1485)CTA>TTA	p.L495L	NBPF10_uc001emp.3_Intron|PIAS3_uc001eod.1_Silent_p.L164L	NM_006099	NP_006090	Q9Y6X2	PIAS3_HUMAN	protein inhibitor of activated STAT, 3	495					positive regulation of protein sumoylation|protein sumoylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck	enzyme binding|nucleic acid binding|protein C-terminus binding|zinc ion binding			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)																	---	---	---	---
OTUD7B	56957	broad.mit.edu	37	1	149921651	149921651	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149921651T>C	uc001etn.2	-	9	1360	c.1004A>G	c.(1003-1005)TAT>TGT	p.Y335C		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	335	Catalytic.|OTU.|TRAF-binding.				negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)															---	---	---	---
UBAP2L	9898	broad.mit.edu	37	1	154239042	154239042	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154239042C>A	uc001fep.3	+	25	3135	c.2968C>A	c.(2968-2970)CAG>AAG	p.Q990K	UBAP2L_uc010pel.1_Missense_Mutation_p.Q1000K|UBAP2L_uc001feq.2_Missense_Mutation_p.Q186K|UBAP2L_uc001fer.2_Missense_Mutation_p.Q186K	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	990					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
SELP	6403	broad.mit.edu	37	1	169565287	169565287	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169565287C>A	uc001ggi.3	-	12	2042	c.1977G>T	c.(1975-1977)CCG>CCT	p.P659P	SELP_uc001ggh.2_Silent_p.P494P|SELP_uc009wvr.2_Silent_p.P659P	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	659	Extracellular (Potential).|Sushi 8.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)													---	---	---	---
CACNA1S	779	broad.mit.edu	37	1	201013512	201013512	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201013512C>A	uc001gvv.2	-	39	4968	c.4741G>T	c.(4741-4743)GAG>TAG	p.E1581*		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1581	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
CR1L	1379	broad.mit.edu	37	1	207890844	207890844	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207890844G>T	uc001hga.3	+	11	1571	c.1450G>T	c.(1450-1452)GGG>TGG	p.G484W	CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	484	Sushi 8.					cytoplasm|extracellular region|membrane					0																		---	---	---	---
HHIPL2	79802	broad.mit.edu	37	1	222717015	222717015	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222717015G>T	uc001hnh.1	-	2	896	c.838C>A	c.(838-840)CAC>AAC	p.H280N		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	280					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)														---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15651347	15651347	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15651347C>A	uc002rcc.1	-	10	900	c.874G>T	c.(874-876)GGG>TGG	p.G292W	NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	292										ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48848413	48848413	+	Silent	SNP	A	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48848413A>T	uc010yol.1	+	4	2390	c.2343A>T	c.(2341-2343)ACA>ACT	p.T781T	STON1-GTF2A1L_uc002rwp.1_Silent_p.T781T|GTF2A1L_uc002rws.1_Silent_p.T77T|GTF2A1L_uc010yom.1_Silent_p.T43T|GTF2A1L_uc002rwt.2_Silent_p.T77T	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	781					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---
ERLEC1	27248	broad.mit.edu	37	2	54045099	54045099	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54045099C>A	uc002rxl.2	+	14	1725	c.1445C>A	c.(1444-1446)CCC>CAC	p.P482H	ASB3_uc002rxi.3_Intron|ERLEC1_uc002rxm.2_Missense_Mutation_p.P456H|ERLEC1_uc002rxn.2_Missense_Mutation_p.P428H	NM_015701	NP_056516	Q96DZ1	ERLEC_HUMAN	erlectin isoform 1	482					ER-associated protein catabolic process	endoplasmic reticulum lumen	glycoprotein binding|protein binding			ovary(2)	2																		---	---	---	---
LOXL3	84695	broad.mit.edu	37	2	74761303	74761303	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74761303C>A	uc002smp.1	-	12	2072	c.2000G>T	c.(1999-2001)TGG>TTG	p.W667L	LOXL3_uc002smo.1_Missense_Mutation_p.W306L|LOXL3_uc010ffm.1_Missense_Mutation_p.W611L|LOXL3_uc002smq.1_Missense_Mutation_p.W522L|LOXL3_uc010ffn.1_Missense_Mutation_p.W522L	NM_032603	NP_115992	P58215	LOXL3_HUMAN	lysyl oxidase-like 3 precursor	667	Lysyl-oxidase like.					extracellular space|membrane	copper ion binding|protein-lysine 6-oxidase activity|scavenger receptor activity				0																		---	---	---	---
TSGA10	80705	broad.mit.edu	37	2	99725896	99725896	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99725896G>A	uc002szg.3	-	4	635	c.7C>T	c.(7-9)CGA>TGA	p.R3*	TSGA10_uc002szh.3_Nonsense_Mutation_p.R3*|TSGA10_uc002szi.3_Nonsense_Mutation_p.R3*|TSGA10_uc010fin.1_Nonsense_Mutation_p.R3*|TSGA10_uc010yvn.1_Nonsense_Mutation_p.R3*	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10	3					spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
NPAS2	4862	broad.mit.edu	37	2	101584858	101584858	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101584858C>A	uc002tap.1	+	11	1309	c.1023C>A	c.(1021-1023)CCC>CCA	p.P341P	NPAS2_uc010yvt.1_Silent_p.P406P	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	341	PAC.				central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
IL18RAP	8807	broad.mit.edu	37	2	103059744	103059744	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103059744C>A	uc002tbx.2	+	8	1365	c.881C>A	c.(880-882)TCT>TAT	p.S294Y	IL18RAP_uc010fiz.2_Missense_Mutation_p.S152Y	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	294	Ig-like C2-type 2.|Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5																		---	---	---	---
POTEE	445582	broad.mit.edu	37	2	131976213	131976213	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131976213G>A	uc002tsn.2	+	1	290	c.238G>A	c.(238-240)GTG>ATG	p.V80M	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Translation_Start_Site|POTEE_uc002tsl.2_Translation_Start_Site	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	80							ATP binding				0																		---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141707814	141707814	+	Silent	SNP	A	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141707814A>G	uc002tvj.1	-	20	4098	c.3126T>C	c.(3124-3126)TGT>TGC	p.C1042C	LRP1B_uc010fnl.1_Silent_p.C224C	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1042	Extracellular (Potential).|LDL-receptor class A 7.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
SCN9A	6335	broad.mit.edu	37	2	167133781	167133781	+	Silent	SNP	T	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167133781T>A	uc010fpl.2	-	16	2894	c.2553A>T	c.(2551-2553)TCA>TCT	p.S851S	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	862	II.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)													---	---	---	---
TTN	7273	broad.mit.edu	37	2	179424814	179424814	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179424814G>T	uc010zfg.1	-	275	78565	c.78341C>A	c.(78340-78342)CCG>CAG	p.P26114Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P19809Q|TTN_uc010zfi.1_Missense_Mutation_p.P19742Q|TTN_uc010zfj.1_Missense_Mutation_p.P19617Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27041							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ITGA4	3676	broad.mit.edu	37	2	182360534	182360534	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182360534C>T	uc002unu.2	+	14	2173	c.1410C>T	c.(1408-1410)GAC>GAT	p.D470D	ITGA4_uc010frj.1_5'Flank	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	470	FG-GAP 7.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)													---	---	---	---
PMS1	5378	broad.mit.edu	37	2	190660534	190660534	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190660534G>A	uc002urh.3	+	3	701	c.172G>A	c.(172-174)GGG>AGG	p.G58R	PMS1_uc010zga.1_Missense_Mutation_p.G58R|PMS1_uc010zgb.1_Intron|PMS1_uc002urk.3_Missense_Mutation_p.G58R|PMS1_uc002uri.3_Missense_Mutation_p.G58R|PMS1_uc010zgc.1_5'UTR|PMS1_uc010zgd.1_Intron|PMS1_uc002urj.2_RNA|PMS1_uc010fry.1_Missense_Mutation_p.G58R|PMS1_uc010frz.2_Missense_Mutation_p.G58R|PMS1_uc010zfz.1_Missense_Mutation_p.G58R	NM_000534	NP_000525	P54277	PMS1_HUMAN	postmeiotic segregation 1 isoform a	58					mismatch repair|reciprocal meiotic recombination	MutLalpha complex	ATP binding|ATPase activity|mismatched DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)					Mis|N			colorectal|endometrial|ovarian		Direct_reversal_of_damage|MMR					---	---	---	---
CLEC3B	7123	broad.mit.edu	37	3	45077035	45077035	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45077035G>T	uc003cok.3	+	3	324	c.228G>T	c.(226-228)AAG>AAT	p.K76N	CLEC3B_uc003col.2_Missense_Mutation_p.K34N	NM_003278	NP_003269	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	76					skeletal system development	extracellular space	protein binding|sugar binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
TLR9	54106	broad.mit.edu	37	3	52255554	52255554	+	Silent	SNP	C	A	A	rs140284375		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52255554C>A	uc003dda.1	-	2	3412	c.2778G>T	c.(2776-2778)TCG>TCT	p.S926S	TLR9_uc003ddb.2_Silent_p.S1023S	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	926	TIR.|Cytoplasmic (Potential).				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)													---	---	---	---
CD96	10225	broad.mit.edu	37	3	111264125	111264125	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111264125G>A	uc003dxw.2	+	2	464	c.294G>A	c.(292-294)GGG>GGA	p.G98G	CD96_uc003dxv.2_Silent_p.G98G|CD96_uc003dxx.2_Silent_p.G98G|CD96_uc010hpy.1_Silent_p.G98G	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	98	Extracellular (Potential).|Ig-like V-type 1.				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3														Opitz_Trigonocephaly_syndrome				---	---	---	---
CCDC80	151887	broad.mit.edu	37	3	112356885	112356885	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112356885C>T	uc003dzf.2	-	2	2086	c.1868G>A	c.(1867-1869)CGA>CAA	p.R623Q	CCDC80_uc011bhv.1_Missense_Mutation_p.R623Q|CCDC80_uc003dzg.2_Missense_Mutation_p.R623Q|CCDC80_uc003dzh.1_Missense_Mutation_p.R623Q	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	623										ovary(2)	2																		---	---	---	---
RAB7A	7879	broad.mit.edu	37	3	128532230	128532230	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128532230C>A	uc003eks.1	+	6	821	c.589C>A	c.(589-591)CGG>AGG	p.R197R	RAB7A_uc010hsv.1_Silent_p.R150R|RAB7A_uc003ekt.2_Intron	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family	197					endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)														---	---	---	---
PLS1	5357	broad.mit.edu	37	3	142416830	142416830	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142416830A>G	uc010huv.2	+	12	1451	c.1292A>G	c.(1291-1293)TAT>TGT	p.Y431C	PLS1_uc003euz.2_Missense_Mutation_p.Y431C|PLS1_uc003eva.2_Missense_Mutation_p.Y431C	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	431	CH 3.|Actin-binding 2.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1																		---	---	---	---
MED12L	116931	broad.mit.edu	37	3	151100435	151100435	+	Intron	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151100435G>T	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron|MED12L_uc003eyy.1_Intron	NM_053002	NP_443728			mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
PSMD2	5708	broad.mit.edu	37	3	184019833	184019833	+	Silent	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184019833T>C	uc003fnn.1	+	5	711	c.678T>C	c.(676-678)TAT>TAC	p.Y226Y	PSMD2_uc011brj.1_Silent_p.Y67Y|PSMD2_uc011brk.1_Silent_p.Y96Y	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2	226				Y -> S (in Ref. 3; AAA87705).	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)													---	---	---	---
PIGZ	80235	broad.mit.edu	37	3	196675340	196675340	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196675340G>A	uc003fxh.2	-	3	575	c.428C>T	c.(427-429)GCC>GTC	p.A143V		NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	143	Helical; (Potential).				GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)														---	---	---	---
CSN1S1	1446	broad.mit.edu	37	4	70810618	70810618	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70810618C>G	uc003hep.1	+	15	502	c.453C>G	c.(451-453)TAC>TAG	p.Y151*	CSN1S1_uc003heq.1_Nonsense_Mutation_p.Y142*|CSN1S1_uc003her.1_Nonsense_Mutation_p.Y143*	NM_001890	NP_001881	P47710	CASA1_HUMAN	casein alpha s1 isoform 1	151						extracellular region	protein binding|transporter activity				0																		---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87724935	87724935	+	Silent	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87724935G>T	uc003hpz.2	+	43	7059	c.6579G>T	c.(6577-6579)ACG>ACT	p.T2193T	PTPN13_uc003hpy.2_Silent_p.T2198T|PTPN13_uc003hqa.2_Silent_p.T2174T|PTPN13_uc003hqb.2_Silent_p.T2002T|PTPN13_uc003hqc.1_Silent_p.T559T	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	2193						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
TIGD2	166815	broad.mit.edu	37	4	90034294	90034294	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90034294A>G	uc003hsk.2	+	1	327	c.169A>G	c.(169-171)AAC>GAC	p.N57D	FAM13A_uc003hsh.1_5'Flank	NM_145715	NP_663761	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	57					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)														---	---	---	---
GRIA2	2891	broad.mit.edu	37	4	158142292	158142292	+	Intron	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158142292C>A	uc003ipm.3	+						GRIA2_uc011cit.1_Intron|GRIA2_uc003ipl.3_Intron|GRIA2_uc003ipk.3_Intron|GRIA2_uc010iqh.1_5'Flank	NM_001083619	NP_001077088			glutamate receptor, ionotropic, AMPA 2 isoform 2						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)													---	---	---	---
UFSP2	55325	broad.mit.edu	37	4	186329110	186329110	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186329110C>T	uc003ixo.2	-	9	1218	c.1101G>A	c.(1099-1101)ACG>ACA	p.T367T	UFSP2_uc003ixn.2_Silent_p.T242T|UFSP2_uc003ixq.2_Silent_p.T257T|UFSP2_uc003ixp.2_RNA	NM_018359	NP_060829	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	367						endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)														---	---	---	---
ADAMTS16	170690	broad.mit.edu	37	5	5239829	5239829	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5239829C>A	uc003jdl.2	+	16	2452	c.2314C>A	c.(2314-2316)CGG>AGG	p.R772R	ADAMTS16_uc003jdk.1_Silent_p.R772R	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	772	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---
GPR98	84059	broad.mit.edu	37	5	90074406	90074406	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90074406C>T	uc003kju.2	+	63	12925	c.12829C>T	c.(12829-12831)CGA>TGA	p.R4277*	GPR98_uc003kjt.2_Nonsense_Mutation_p.R1983*|GPR98_uc003kjw.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	4277	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137292190	137292190	+	Intron	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137292190T>C	uc003lbz.2	-						FAM13B_uc003lcb.2_Missense_Mutation_p.M377V|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687			hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
BRD8	10902	broad.mit.edu	37	5	137476527	137476527	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137476527C>A	uc003lcf.1	-	26	3537	c.3482G>T	c.(3481-3483)CGG>CTG	p.R1161L	BRD8_uc003lcc.1_Intron|NME5_uc003lce.2_5'Flank	NM_139199	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 2	1161	Bromo 2.				cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
ETF1	2107	broad.mit.edu	37	5	137844018	137844018	+	Silent	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137844018T>C	uc003ldc.3	-	11	1455	c.1290A>G	c.(1288-1290)GAA>GAG	p.E430E	ETF1_uc011cyv.1_Silent_p.E416E|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Silent_p.E397E	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	430					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
NDST1	3340	broad.mit.edu	37	5	149932803	149932803	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149932803G>T	uc003lsk.3	+	15	3060	c.2558G>T	c.(2557-2559)CGG>CTG	p.R853L	NDST1_uc011dcj.1_Missense_Mutation_p.R796L	NM_001543	NP_001534	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan	853	Heparan sulfate N-sulfotransferase 1.|Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process|inflammatory response	Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			breast(1)|skin(1)	2		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
STK10	6793	broad.mit.edu	37	5	171520568	171520568	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171520568C>A	uc003mbo.1	-	9	1702	c.1402G>T	c.(1402-1404)GGC>TGC	p.G468C		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	468							ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
STK10	6793	broad.mit.edu	37	5	171523475	171523475	+	Silent	SNP	G	A	A	rs139075094		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171523475G>A	uc003mbo.1	-	8	1260	c.960C>T	c.(958-960)GAC>GAT	p.D320D		NM_005990	NP_005981	O94804	STK10_HUMAN	serine/threonine kinase 10	320							ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
CDYL	9425	broad.mit.edu	37	6	4892004	4892004	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4892004C>T	uc003mwi.2	+	4	375	c.244C>T	c.(244-246)CGG>TGG	p.R82W	CDYL_uc003mwj.2_Missense_Mutation_p.R28W|CDYL_uc003mwk.2_Intron|CDYL_uc011dhx.1_5'UTR|CDYL_uc011dhy.1_5'UTR	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform	82	Chromo.				regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)														---	---	---	---
EDN1	1906	broad.mit.edu	37	6	12294222	12294222	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12294222G>T	uc003nae.3	+	3	616	c.282G>T	c.(280-282)TTG>TTT	p.L94F	EDN1_uc003nad.2_Missense_Mutation_p.L94F|EDN1_uc003naf.3_Missense_Mutation_p.L93F	NM_001955	NP_001946	P05305	EDN1_HUMAN	endothelin 1 precursor	94					artery smooth muscle contraction|calcium-mediated signaling|leukocyte activation|negative regulation of blood coagulation|negative regulation of cellular protein metabolic process|negative regulation of nitric-oxide synthase biosynthetic process|negative regulation of transcription from RNA polymerase II promoter|nitric oxide transport|peptide hormone secretion|phosphatidylinositol 3-kinase cascade|positive regulation of cardiac muscle hypertrophy|positive regulation of cell size|positive regulation of endothelial cell migration|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of JUN kinase activity|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of sarcomere organization|positive regulation of smooth muscle cell proliferation|prostaglandin biosynthetic process|protein kinase C deactivation|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	cytoplasm|extracellular space	cytokine activity|endothelin A receptor binding|endothelin B receptor binding|hormone activity			skin(1)	1	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)																---	---	---	---
HIST1H2AD	3013	broad.mit.edu	37	6	26199399	26199399	+	Nonsense_Mutation	SNP	G	A	A	rs140533379		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26199399G>A	uc003ngw.2	-	1	73	c.73C>T	c.(73-75)CAG>TAG	p.Q25*	HIST1H3D_uc003ngv.2_5'UTR|HIST1H2BF_uc003ngx.2_5'Flank	NM_021065	NP_066409	P20671	H2A1D_HUMAN	histone cluster 1, H2ad	25					nucleosome assembly	nucleosome|nucleus	DNA binding				0		all_hematologic(11;0.196)																---	---	---	---
ZNF187	7741	broad.mit.edu	37	6	28244298	28244298	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28244298G>T	uc011dld.1	+	5	1132	c.862G>T	c.(862-864)GGG>TGG	p.G288W	ZNF187_uc011dlc.1_Missense_Mutation_p.G289W|ZNF187_uc003nku.3_Missense_Mutation_p.G154W|ZNF187_uc003nkw.3_Missense_Mutation_p.G135W|ZNF187_uc011dle.1_Missense_Mutation_p.G135W|ZNF187_uc011dlf.1_Missense_Mutation_p.G80W|ZNF187_uc011dlg.1_Missense_Mutation_p.G135W	NM_001111039	NP_001104509	Q16670	ZN187_HUMAN	zinc finger protein 187 isoform b	288	C2H2-type 2.				viral reproduction	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42236873	42236873	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42236873G>A	uc003osd.2	-	5	1019	c.456C>T	c.(454-456)AAC>AAT	p.N152N	TRERF1_uc011duq.1_Silent_p.N152N|TRERF1_uc003osb.2_5'UTR|TRERF1_uc003osc.2_5'UTR|TRERF1_uc003ose.2_Silent_p.N152N	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	152					cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
TPBG	7162	broad.mit.edu	37	6	83075655	83075655	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83075655C>T	uc003pjn.3	+	3	1913	c.977C>T	c.(976-978)CCG>CTG	p.P326L	TPBG_uc010kbj.2_Missense_Mutation_p.P326L|TPBG_uc003pjo.2_Missense_Mutation_p.P326L	NM_006670	NP_006661	Q13641	TPBG_HUMAN	trophoblast glycoprotein precursor	326	Extracellular (Potential).|LRRCT.				cell adhesion	integral to plasma membrane				central_nervous_system(1)	1		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)														---	---	---	---
FUCA2	2519	broad.mit.edu	37	6	143823550	143823550	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143823550C>A	uc003qjm.2	-	4	997	c.905G>T	c.(904-906)TGG>TTG	p.W302L	FUCA2_uc003qjn.2_Missense_Mutation_p.W56L	NM_032020	NP_114409	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma precursor	302					fucose metabolic process	extracellular region	alpha-L-fucosidase activity|cation binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)														---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144757103	144757103	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144757103C>A	uc003qkt.2	+	9	980	c.888C>A	c.(886-888)CCC>CCA	p.P296P	UTRN_uc010khq.1_Silent_p.P296P	NM_007124	NP_009055	P46939	UTRO_HUMAN	utrophin	296	Interaction with SYNM.|Spectrin 1.				muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
NPY	4852	broad.mit.edu	37	7	24325011	24325011	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24325011C>T	uc003sww.1	+	2	238	c.152C>T	c.(151-153)GCG>GTG	p.A51V		NM_000905	NP_000896	P01303	NPY_HUMAN	neuropeptide Y precursor	51					adult feeding behavior|calcium ion transport|cell proliferation|cellular component movement|central nervous system neuron development|cerebral cortex development|digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|neuron projection development|neuropeptide signaling pathway|positive regulation of appetite|synaptic transmission	cell|extracellular space	calcium channel regulator activity|G-protein coupled receptor activity|neuropeptide hormone activity				0																		---	---	---	---
BUD31	8896	broad.mit.edu	37	7	99015162	99015162	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99015162G>C	uc003uqf.2	+	5	529	c.328G>C	c.(328-330)GAC>CAC	p.D110H	BUD31_uc011kiu.1_Missense_Mutation_p.D110H|BUD31_uc011kiv.1_Missense_Mutation_p.D110H|BUD31_uc003uqg.3_Missense_Mutation_p.D110H	NM_003910	NP_003901	P41223	BUD31_HUMAN	G10 protein	110					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_cancers(62;1.76e-08)|all_epithelial(64;1.63e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
ZAN	7455	broad.mit.edu	37	7	100349868	100349868	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100349868C>A	uc003uwj.2	+	14	2305	c.2140C>A	c.(2140-2142)CCA>ACA	p.P714T	ZAN_uc003uwk.2_Missense_Mutation_p.P714T|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	714	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)															---	---	---	---
RBM28	55131	broad.mit.edu	37	7	127978360	127978360	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127978360T>C	uc003vmp.2	-	5	600	c.485A>G	c.(484-486)AAA>AGA	p.K162R	RBM28_uc003vmo.2_5'Flank|RBM28_uc011koj.1_Intron|RBM28_uc011kok.1_Missense_Mutation_p.K109R	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	162	RRM 2.				mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
RBM33	155435	broad.mit.edu	37	7	155534608	155534608	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155534608G>A	uc010lqk.1	+	13	2513	c.2145G>A	c.(2143-2145)CCG>CCA	p.P715P	RBM33_uc011kvv.1_Silent_p.P524P	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	715							nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)														---	---	---	---
RP1L1	94137	broad.mit.edu	37	8	10464964	10464964	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10464964G>T	uc003wtc.2	-	4	6873	c.6644C>A	c.(6643-6645)CCG>CAG	p.P2215Q		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2215					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)														---	---	---	---
NEIL2	252969	broad.mit.edu	37	8	11643642	11643642	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11643642C>T	uc003wug.2	+	5	1534	c.859C>T	c.(859-861)CAG>TAG	p.Q287*	NEIL2_uc003wue.2_Nonsense_Mutation_p.Q287*|NEIL2_uc003wuf.2_Nonsense_Mutation_p.Q226*|NEIL2_uc011kxd.1_Nonsense_Mutation_p.Q171*	NM_145043	NP_659480	Q969S2	NEIL2_HUMAN	nei like 2 isoform a	287	FPG-type.				base-excision repair|nucleotide-excision repair	nucleus	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|hydrolase activity, hydrolyzing N-glycosyl compounds|zinc ion binding				0	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)									BER_DNA_glycosylases					---	---	---	---
FDFT1	2222	broad.mit.edu	37	8	11687745	11687745	+	Intron	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11687745C>T	uc003wui.2	+						FDFT1_uc003wuh.2_Intron|FDFT1_uc010lsa.1_Intron|FDFT1_uc011kxe.1_Intron|FDFT1_uc011kxf.1_Intron|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Intron|FDFT1_uc010lsb.2_Intron|FDFT1_uc011kxh.1_Intron|FDFT1_uc011kxi.1_Intron|FDFT1_uc011kxj.1_Intron|FDFT1_uc003wuk.2_Intron|FDFT1_uc011kxk.1_Intron	NM_004462	NP_004453			squalene synthase						cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)														---	---	---	---
FDFT1	2222	broad.mit.edu	37	8	11687749	11687749	+	Intron	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11687749C>T	uc003wui.2	+						FDFT1_uc003wuh.2_Intron|FDFT1_uc010lsa.1_Intron|FDFT1_uc011kxe.1_Intron|FDFT1_uc011kxf.1_Intron|FDFT1_uc011kxg.1_Intron|FDFT1_uc003wuj.2_Intron|FDFT1_uc010lsb.2_Intron|FDFT1_uc011kxh.1_Intron|FDFT1_uc011kxi.1_Intron|FDFT1_uc011kxj.1_Intron|FDFT1_uc003wuk.2_Intron|FDFT1_uc011kxk.1_Intron	NM_004462	NP_004453			squalene synthase						cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)														---	---	---	---
FDFT1	2222	broad.mit.edu	37	8	11687890	11687890	+	Silent	SNP	C	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11687890C>G	uc003wui.2	+	6	992	c.840C>G	c.(838-840)CTC>CTG	p.L280L	FDFT1_uc003wuh.2_Silent_p.L216L|FDFT1_uc010lsa.1_Silent_p.L195L|FDFT1_uc011kxe.1_Silent_p.L216L|FDFT1_uc011kxf.1_Silent_p.L237L|FDFT1_uc011kxg.1_Silent_p.L113L|FDFT1_uc003wuj.2_Silent_p.L273L|FDFT1_uc010lsb.2_Silent_p.L216L|FDFT1_uc011kxh.1_Silent_p.L216L|FDFT1_uc011kxi.1_Intron|FDFT1_uc011kxj.1_Silent_p.L216L|FDFT1_uc003wuk.2_Silent_p.L339L|FDFT1_uc011kxk.1_Silent_p.L195L	NM_004462	NP_004453	P37268	FDFT_HUMAN	squalene synthase	280					cholesterol biosynthetic process|isoprenoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	farnesyl-diphosphate farnesyltransferase activity|oxidoreductase activity|protein binding|squalene synthase activity				0	all_epithelial(15;0.234)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.18)														---	---	---	---
MSR1	4481	broad.mit.edu	37	8	15998502	15998502	+	Intron	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15998502C>A	uc003wwz.2	-						MSR1_uc010lsu.2_Intron|MSR1_uc003wxa.2_Intron|MSR1_uc003wxb.2_3'UTR|MSR1_uc011kxz.1_3'UTR	NM_138715	NP_619729			macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)														---	---	---	---
TNFRSF10A	8797	broad.mit.edu	37	8	23049343	23049343	+	Nonsense_Mutation	SNP	G	T	T	rs145301145		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23049343G>T	uc003xda.2	-	10	1336	c.1271C>A	c.(1270-1272)TCG>TAG	p.S424*		NM_003844	NP_003835	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily,	424	Cytoplasmic (Potential).|Death.				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors		caspase activator activity|death receptor activity|TRAIL binding|transcription factor binding			central_nervous_system(3)|ovary(2)|skin(1)	6		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)														---	---	---	---
BRF2	55290	broad.mit.edu	37	8	37702081	37702081	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37702081G>A	uc003xkk.2	-	4	1297	c.1187C>T	c.(1186-1188)CCT>CTT	p.P396L		NM_018310	NP_060780	Q9HAW0	BRF2_HUMAN	RNA polymerase III transcription initiation	396					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)															---	---	---	---
ZNF704	619279	broad.mit.edu	37	8	81553643	81553643	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81553643G>A	uc003yby.1	-	9	1429	c.1197C>T	c.(1195-1197)ACC>ACT	p.T399T		NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	399						intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)															---	---	---	---
CTHRC1	115908	broad.mit.edu	37	8	104388057	104388057	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104388057C>A	uc003ylk.2	+	2	341	c.242C>A	c.(241-243)CCA>CAA	p.P81Q	CTHRC1_uc011lhq.1_Missense_Mutation_p.P81Q	NM_138455	NP_612464	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	81	Collagen-like.					collagen				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)															---	---	---	---
DCAF13	25879	broad.mit.edu	37	8	104452417	104452417	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104452417C>T	uc003yln.2	+	9	1737	c.1460C>T	c.(1459-1461)TCT>TTT	p.S487F	DCAF13_uc003ylm.1_Missense_Mutation_p.S220F|DCAF13_uc003ylo.2_Missense_Mutation_p.S198F	NM_015420	NP_056235	Q9NV06	DCA13_HUMAN	WD repeats and SOF1 domain containing	335	WD 7.				rRNA processing	CUL4 RING ubiquitin ligase complex|nucleolus|ribonucleoprotein complex				breast(1)	1																		---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113697904	113697904	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113697904G>T	uc003ynu.2	-	15	2372	c.2213C>A	c.(2212-2214)CCA>CAA	p.P738Q	CSMD3_uc003yns.2_Missense_Mutation_p.P10Q|CSMD3_uc003ynt.2_Missense_Mutation_p.P698Q|CSMD3_uc011lhx.1_Missense_Mutation_p.P634Q	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	738	Extracellular (Potential).|CUB 4.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
DENND3	22898	broad.mit.edu	37	8	142202558	142202558	+	Intron	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142202558C>A	uc003yvy.2	+						DENND3_uc010mep.2_Intron|DENND3_uc003ywa.1_Intron|DENND3_uc003ywb.2_Intron	NM_014957	NP_055772			DENN/MADD domain containing 3											ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
IFNB1	3456	broad.mit.edu	37	9	21077680	21077680	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21077680C>T	uc003zok.2	-	1	264	c.189G>A	c.(187-189)GAG>GAA	p.E63E		NM_002176	NP_002167	P01574	IFNB_HUMAN	interferon, beta 1, fibroblast precursor	63					activation of caspase activity|B cell proliferation|blood coagulation|cellular response to exogenous dsRNA|defense response to virus|induction of apoptosis|natural killer cell activation|negative regulation of cell proliferation|negative regulation of T cell differentiation|negative regulation of T-helper 2 cell cytokine production|negative regulation of viral genome replication|negative regulation of viral transcription|negative regulation of virion penetration into host cell|positive regulation of innate immune response|positive regulation of transcription from RNA polymerase II promoter|regulation of MHC class I biosynthetic process|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding|transcription corepressor activity			ovary(1)|breast(1)|kidney(1)	3				GBM - Glioblastoma multiforme(5;7.45e-142)|Lung(24;2.42e-17)|LUSC - Lung squamous cell carcinoma(38;7.17e-11)	Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)													---	---	---	---
TEK	7010	broad.mit.edu	37	9	27158095	27158095	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27158095C>T	uc003zqi.3	+	2	761	c.319C>T	c.(319-321)CGA>TGA	p.R107*	TEK_uc010mjc.1_Intron|TEK_uc011lnn.1_Nonsense_Mutation_p.R107*|TEK_uc011lno.1_Nonsense_Mutation_p.R107*|TEK_uc011lnp.1_Intron|TEK_uc003zqj.1_Nonsense_Mutation_p.R84*	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	107	Extracellular (Potential).|Ig-like C2-type 1.				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)														---	---	---	---
DCAF12	25853	broad.mit.edu	37	9	34089583	34089583	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34089583G>A	uc003ztt.2	-	8	1372	c.1030C>T	c.(1030-1032)CGG>TGG	p.R344W		NM_015397	NP_056212	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	344	WD 4.					centrosome|CUL4 RING ubiquitin ligase complex					0																		---	---	---	---
NR4A3	8013	broad.mit.edu	37	9	102590441	102590441	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102590441C>A	uc004baf.1	+	3	846	c.117C>A	c.(115-117)ACC>ACA	p.T39T	NR4A3_uc004bae.2_Silent_p.T39T|NR4A3_uc004bag.1_Silent_p.T39T|NR4A3_uc004bai.2_Silent_p.T50T	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	39					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)						T	EWSR1	extraskeletal myxoid chondrosarcoma								---	---	---	---
FCN1	2219	broad.mit.edu	37	9	137805455	137805455	+	Silent	SNP	G	A	A	rs144127766		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137805455G>A	uc004cfi.2	-	5	404	c.312C>T	c.(310-312)GAC>GAT	p.D104D		NM_002003	NP_001994	O00602	FCN1_HUMAN	ficolin 1 precursor	104					opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|receptor binding|sugar binding			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)														---	---	---	---
AKR1C1	1645	broad.mit.edu	37	10	5008103	5008103	+	Intron	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5008103C>A	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron|AKR1C3_uc001ihr.2_Intron|AKR1C1_uc009xhx.2_Intron|AKR1C1_uc001ihq.2_Intron	NM_001353	NP_001344			aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)													---	---	---	---
ZNF248	57209	broad.mit.edu	37	10	38121178	38121178	+	Missense_Mutation	SNP	G	T	T	rs137877519		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38121178G>T	uc001izd.1	-	6	1604	c.1105C>A	c.(1105-1107)CAG>AAG	p.Q369K	ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Missense_Mutation_p.Q369K	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	369					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87407072	87407072	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87407072T>C	uc001kdl.1	-	13	2181	c.2080A>G	c.(2080-2082)AAG>GAG	p.K694E	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.K265E|uc001kdm.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	694	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98744051	98744051	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98744051C>A	uc001kmv.2	+	1	3011	c.2904C>A	c.(2902-2904)CCC>CCA	p.P968P		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	968										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98797490	98797490	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98797490C>A	uc001kmw.2	-	22	2583	c.2331G>T	c.(2329-2331)CCG>CCT	p.P777P	SLIT1_uc009xvh.1_Silent_p.P787P	NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	777	LRR 17.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)												OREG0020406	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
LOXL4	84171	broad.mit.edu	37	10	100015439	100015439	+	Missense_Mutation	SNP	G	A	A	rs149982668		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100015439G>A	uc001kpa.1	-	10	1637	c.1486C>T	c.(1486-1488)CGC>TGC	p.R496C		NM_032211	NP_115587	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4 precursor	496	SRCR 4.					extracellular space|membrane	copper ion binding|protein binding|scavenger receptor activity			ovary(3)|breast(1)|skin(1)	5		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100481463	100481463	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100481463C>A	uc001kpn.1	-	5	967	c.907G>T	c.(907-909)GGC>TGC	p.G303C	HPSE2_uc009xwc.1_Missense_Mutation_p.G293C|HPSE2_uc001kpo.1_Missense_Mutation_p.G235C|HPSE2_uc009xwd.1_Missense_Mutation_p.G181C	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	303					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
CNNM2	54805	broad.mit.edu	37	10	104679833	104679833	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104679833C>T	uc001kwm.2	+	1	1720	c.1596C>T	c.(1594-1596)GAC>GAT	p.D532D	CNNM2_uc001kwn.2_Silent_p.D532D|CNNM2_uc001kwl.2_Silent_p.D532D	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	532	CBS 2.				ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)														---	---	---	---
SLK	9748	broad.mit.edu	37	10	105750529	105750529	+	Silent	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105750529T>C	uc001kxo.1	+	2	281	c.247T>C	c.(247-249)TTA>CTA	p.L83L	SLK_uc001kxp.1_Silent_p.L83L	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	83	Protein kinase.				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)														---	---	---	---
BTBD16	118663	broad.mit.edu	37	10	124089067	124089067	+	Silent	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124089067T>C	uc001lgc.1	+	11	1235	c.984T>C	c.(982-984)CGT>CGC	p.R328R	BTBD16_uc001lgd.1_Silent_p.R327R	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	328										skin(1)	1		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)																---	---	---	---
PPP2R2D	55844	broad.mit.edu	37	10	133761176	133761176	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133761176G>A	uc001lks.2	+	6	1107	c.864G>A	c.(862-864)ATG>ATA	p.M288I	PPP2R2D_uc001lkr.2_Missense_Mutation_p.M94I|PPP2R2D_uc001lkt.2_Missense_Mutation_p.M94I|PPP2R2D_uc009yay.2_Missense_Mutation_p.M156I	NM_018461	NP_060931	Q66LE6	2ABD_HUMAN	protein phosphatase 2, regulatory subunit B,	321	WD 5.			M -> T (in Ref. 1; BAF85754).	cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			skin(1)	1		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)														---	---	---	---
MYOD1	4654	broad.mit.edu	37	11	17741344	17741344	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17741344G>A	uc001mni.2	+	1	235	c.15G>A	c.(13-15)TCG>TCA	p.S5S		NM_002478	NP_002469	P15172	MYOD1_HUMAN	myogenic differentiation 1	5					muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity			breast(2)|ovary(1)	3																		---	---	---	---
CD44	960	broad.mit.edu	37	11	35243229	35243229	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35243229G>A	uc001mvu.2	+	17	2408	c.1974G>A	c.(1972-1974)TTG>TTA	p.L658L	CD44_uc001mvv.2_Silent_p.L615L|CD44_uc001mvw.2_Silent_p.L409L|CD44_uc001mvx.2_Silent_p.L277L|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Silent_p.L345L|CD44_uc010rer.1_Silent_p.L256L|CD44_uc009ykh.2_RNA	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	658	Helical; (Potential).				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)													---	---	---	---
OR8K1	390157	broad.mit.edu	37	11	56114140	56114140	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56114140C>A	uc010rjg.1	+	1	626	c.626C>A	c.(625-627)TCA>TAA	p.S209*		NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)														HNSCC(65;0.19)			---	---	---	---
OR9G4	283189	broad.mit.edu	37	11	56511249	56511249	+	Silent	SNP	G	T	T	rs148280565		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56511249G>T	uc010rjo.1	-	1	39	c.39C>A	c.(37-39)TCC>TCA	p.S13S		NM_001005284	NP_001005284	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G,	13	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3																		---	---	---	---
NPAS4	266743	broad.mit.edu	37	11	66191575	66191575	+	Missense_Mutation	SNP	C	A	A	rs147569362		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66191575C>A	uc001ohx.1	+	7	1390	c.1214C>A	c.(1213-1215)CCT>CAT	p.P405H	NPAS4_uc010rpc.1_Missense_Mutation_p.P195H	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	405					transcription, DNA-dependent		DNA binding|signal transducer activity				0																		---	---	---	---
C2CD3	26005	broad.mit.edu	37	11	73789208	73789208	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73789208C>T	uc001ouu.2	-	23	4782	c.4555G>A	c.(4555-4557)GAC>AAC	p.D1519N	C2CD3_uc001out.2_RNA	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1519						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)																	---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117403086	117403086	+	Intron	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117403086C>A	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744			Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
ETS1	2113	broad.mit.edu	37	11	128359211	128359211	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128359211C>A	uc010sbs.1	-	3	693	c.377G>T	c.(376-378)TGG>TTG	p.W126L	ETS1_uc001qej.2_Missense_Mutation_p.W170L|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Missense_Mutation_p.W126L	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	126	PNT.				cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)														---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2706664	2706664	+	Splice_Site	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2706664T>C	uc009zdu.1	+	22	3226	c.2913_splice	c.e22+2	p.K971_splice	CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Splice_Site_p.K951_splice|CACNA1C_uc001qkc.2_Splice_Site_p.K951_splice|CACNA1C_uc001qke.2_Splice_Site_p.K951_splice|CACNA1C_uc001qkf.2_Splice_Site_p.K951_splice|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Splice_Site_p.K971_splice|CACNA1C_uc001qkn.2_Splice_Site_p.K951_splice|CACNA1C_uc001qko.2_Splice_Site_p.K971_splice|CACNA1C_uc001qkp.2_Splice_Site_p.K951_splice|CACNA1C_uc001qkr.2_Splice_Site_p.K951_splice|CACNA1C_uc001qku.2_Splice_Site_p.K951_splice|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Splice_Site_p.K486_splice|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
VWF	7450	broad.mit.edu	37	12	6122735	6122735	+	Silent	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6122735G>A	uc001qnn.1	-	32	5782	c.5532C>T	c.(5530-5532)GGC>GGT	p.G1844G	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1844	VWFA 3; main binding site for collagens type I and III.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
SCNN1A	6337	broad.mit.edu	37	12	6457212	6457212	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6457212G>T	uc001qnx.2	-	13	2126	c.1837C>A	c.(1837-1839)CCT>ACT	p.P613T	SCNN1A_uc001qnv.2_Missense_Mutation_p.P313T|SCNN1A_uc001qnw.2_Missense_Mutation_p.P672T|SCNN1A_uc010sfb.1_Missense_Mutation_p.P636T	NM_001038	NP_001029	P37088	SCNNA_HUMAN	sodium channel, nonvoltage-gated 1 alpha isoform	613	Cytoplasmic (By similarity).				excretion|response to stimulus|sensory perception of taste	apical plasma membrane	WW domain binding				0					Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
MMP19	4327	broad.mit.edu	37	12	56232293	56232293	+	Intron	SNP	T	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56232293T>G	uc001sib.2	-						MMP19_uc001sia.2_Missense_Mutation_p.S10R|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_Missense_Mutation_p.E249A	NM_002429	NP_002420			matrix metalloproteinase 19 isoform rasi-1						angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1																		---	---	---	---
TIMELESS	8914	broad.mit.edu	37	12	56814608	56814608	+	Missense_Mutation	SNP	C	A	A	rs150692151	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56814608C>A	uc001slf.2	-	25	3266	c.3098G>T	c.(3097-3099)CGG>CTG	p.R1033L		NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog	1033					cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8																		---	---	---	---
MBD6	114785	broad.mit.edu	37	12	57919268	57919268	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57919268C>A	uc001soj.1	+	6	741	c.517C>A	c.(517-519)CAG>AAG	p.Q173K	MBD6_uc001sok.1_Missense_Mutation_p.Q40K|MBD6_uc001sol.1_5'Flank	NM_052897	NP_443129	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	173	Pro-rich.					chromosome|nucleus	chromatin binding|DNA binding			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
RBM26	64062	broad.mit.edu	37	13	79911427	79911427	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79911427C>A	uc001vkz.2	-	19	2563	c.2549G>T	c.(2548-2550)CGA>CTA	p.R850L	RBM26_uc001vky.2_Missense_Mutation_p.R821L|RBM26_uc001vla.2_Missense_Mutation_p.R824L|RBM26_uc010tia.1_Missense_Mutation_p.R205L|RBM26_uc001vkx.2_Missense_Mutation_p.R560L	NM_022118	NP_071401	Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	848					mRNA processing		nucleotide binding|protein binding|RNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)														---	---	---	---
SCFD1	23256	broad.mit.edu	37	14	31191756	31191756	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31191756C>T	uc001wqm.1	+	23	1851	c.1827C>T	c.(1825-1827)GAC>GAT	p.D609D	SCFD1_uc001wqn.1_Silent_p.D542D|SCFD1_uc010tpg.1_Silent_p.D550D|SCFD1_uc010tph.1_Silent_p.D424D|SCFD1_uc010amf.1_Silent_p.D424D|SCFD1_uc010tpi.1_Silent_p.D517D|SCFD1_uc010ame.1_Missense_Mutation_p.T531I	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a	609					post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)														---	---	---	---
PAX9	5083	broad.mit.edu	37	14	37132484	37132484	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37132484C>A	uc001wty.3	+	3	1104	c.387C>A	c.(385-387)AAC>AAA	p.N129K	PAX9_uc010amq.2_5'Flank	NM_006194	NP_006185	P55771	PAX9_HUMAN	paired box 9	129	Paired.				multicellular organismal development|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)														---	---	---	---
HHIPL1	84439	broad.mit.edu	37	14	100135215	100135215	+	Intron	SNP	G	A	A	rs138192019	byFrequency	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100135215G>A	uc010avs.2	+						HHIPL1_uc001ygl.1_Missense_Mutation_p.V593M	NM_001127258	NP_001120730			HHIP-like protein 1 isoform a						carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)																---	---	---	---
RYR3	6263	broad.mit.edu	37	15	34078188	34078188	+	Intron	SNP	C	T	T	rs73383308	by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34078188C>T	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
C15orf55	256646	broad.mit.edu	37	15	34647250	34647250	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34647250T>G	uc001zif.2	+	6	1462	c.1307T>G	c.(1306-1308)CTG>CGG	p.L436R	C15orf55_uc010ucc.1_Missense_Mutation_p.L464R|C15orf55_uc010ucd.1_Missense_Mutation_p.L454R	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	436						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)				T	BRD3|BRD4	lethal midline carcinoma								---	---	---	---
SLC28A2	9153	broad.mit.edu	37	15	45560396	45560396	+	Intron	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45560396C>T	uc001zva.2	+							NM_004212	NP_004203			solute carrier family 28 (sodium-coupled						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)														---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84566718	84566718	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84566718G>T	uc002bjz.3	+	14	1800	c.1576G>T	c.(1576-1578)GAA>TAA	p.E526*	ADAMTSL3_uc010bmt.1_Nonsense_Mutation_p.E526*|ADAMTSL3_uc010bmu.1_Nonsense_Mutation_p.E526*	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	526	TSP type-1 3.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87066060	87066060	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87066060G>T	uc002blz.1	+	18	2517	c.2437G>T	c.(2437-2439)GGG>TGG	p.G813W		NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	813					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93557996	93557996	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93557996G>T	uc002bsp.2	+	37	5338	c.4763G>T	c.(4762-4764)CGG>CTG	p.R1588L	CHD2_uc002bso.1_Missense_Mutation_p.R1588L	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1588					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
ALDH1A3	220	broad.mit.edu	37	15	101447332	101447332	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101447332G>T	uc002bwn.3	+	11	1344	c.1240G>T	c.(1240-1242)GGG>TGG	p.G414W	ALDH1A3_uc010bpb.2_Missense_Mutation_p.G307W|uc002bwo.1_Intron	NM_000693	NP_000684	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1A3	414					retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)													---	---	---	---
RRN3	54700	broad.mit.edu	37	16	15186424	15186424	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15186424G>T	uc002dde.2	-	2	205	c.137C>A	c.(136-138)CCA>CAA	p.P46Q	PDXDC1_uc002ddc.2_Intron|RRN3_uc010uzq.1_Missense_Mutation_p.P46Q|RRN3_uc002ddf.1_Missense_Mutation_p.P46Q|uc010bve.1_5'Flank	NM_018427	NP_060897	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor	46					regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm				ovary(1)	1																		---	---	---	---
IL21R	50615	broad.mit.edu	37	16	27456494	27456494	+	Intron	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27456494C>T	uc002doq.1	+						IL21R_uc002dor.1_Intron|IL21R_uc002dos.1_Intron	NM_181078	NP_851564			interleukin 21 receptor precursor						natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4								T	BCL6	NHL								---	---	---	---
SALL1	6299	broad.mit.edu	37	16	51175484	51175484	+	Missense_Mutation	SNP	C	T	T	rs140165636		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175484C>T	uc010vgs.1	-	2	680	c.649G>A	c.(649-651)GGC>AGC	p.G217S	SALL1_uc010vgr.1_Missense_Mutation_p.G120S|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	217					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)															---	---	---	---
CES1	1066	broad.mit.edu	37	16	55855413	55855413	+	Missense_Mutation	SNP	C	A	A	rs60054861	byFrequency;by1000genomes	TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55855413C>A	uc002eim.2	-	5	665	c.557G>T	c.(556-558)CGG>CTG	p.R186L	CES1_uc002eil.2_Missense_Mutation_p.R187L|CES1_uc002ein.2_Missense_Mutation_p.R186L	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	186				R -> G (in Ref. 18; CAA37147).	response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)													---	---	---	---
SF3B3	23450	broad.mit.edu	37	16	70602310	70602310	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70602310A>T	uc002ezf.2	+	22	3288	c.3077A>T	c.(3076-3078)GAT>GTT	p.D1026V		NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3	1026					protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	74425446	74425446	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74425446C>T	uc010vmt.1	+	6	618	c.617C>T	c.(616-618)CCC>CTC	p.P206L						RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
TM4SF5	9032	broad.mit.edu	37	17	4675218	4675218	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4675218A>T	uc002fyw.1	+	1	32	c.1A>T	c.(1-3)ATG>TTG	p.M1L		NM_003963	NP_003954	O14894	T4S5_HUMAN	transmembrane 4 superfamily member 5	1	Cytoplasmic (Potential).					integral to plasma membrane				ovary(1)	1																		---	---	---	---
C17orf74	201243	broad.mit.edu	37	17	7329853	7329853	+	Silent	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7329853G>T	uc002ggw.2	+	3	616	c.543G>T	c.(541-543)CCG>CCT	p.P181P	FGF11_uc010vtw.1_Intron	NM_175734	NP_783861	Q0P670	CQ074_HUMAN	hypothetical protein LOC201243	181						integral to membrane					0		Prostate(122;0.157)																---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578208	7578208	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578208T>C	uc002gim.2	-	6	835	c.641A>G	c.(640-642)CAT>CGT	p.H214R	TP53_uc002gig.1_Missense_Mutation_p.H214R|TP53_uc002gih.2_Missense_Mutation_p.H214R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H82R|TP53_uc010cng.1_Missense_Mutation_p.H82R|TP53_uc002gii.1_Missense_Mutation_p.H82R|TP53_uc010cnh.1_Missense_Mutation_p.H214R|TP53_uc010cni.1_Missense_Mutation_p.H214R|TP53_uc002gij.2_Missense_Mutation_p.H214R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H121R|TP53_uc002gio.2_Missense_Mutation_p.H82R|TP53_uc010vug.1_Missense_Mutation_p.H175R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	214	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> Y (in sporadic cancers; somatic mutation).|H -> D (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> P (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H214R(45)|p.0?(7)|p.H214Y(4)|p.H214Q(4)|p.H214D(3)|p.H214fs*5(2)|p.H214fs*33(2)|p.D208fs*1(1)|p.K164_P219del(1)|p.H214H(1)|p.H214fs*7(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.T211_S215delTFRHS(1)|p.H214_S215insX(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
CRYBA1	1411	broad.mit.edu	37	17	27579206	27579206	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27579206C>A	uc002hdw.2	+	4	347	c.340C>A	c.(340-342)CGC>AGC	p.R114S		NM_005208	NP_005199	P05813	CRBA1_HUMAN	crystallin, beta A3	114	Beta/gamma crystallin 'Greek key' 2.				visual perception	soluble fraction	structural constituent of eye lens				0			BRCA - Breast invasive adenocarcinoma(11;3.3e-05)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)													OREG0024293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
UBTF	7343	broad.mit.edu	37	17	42290195	42290195	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42290195G>A	uc002igb.2	-	6	719	c.652C>T	c.(652-654)CGG>TGG	p.R218W	UBTF_uc002igc.2_Missense_Mutation_p.R218W|UBTF_uc010czs.2_Missense_Mutation_p.R218W|UBTF_uc002igd.2_Missense_Mutation_p.R218W|UBTF_uc010czt.2_Missense_Mutation_p.R218W|UBTF_uc002ige.2_Missense_Mutation_p.R218W	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	218	HMG box 2.				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
ERN1	2081	broad.mit.edu	37	17	62142586	62142586	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62142586C>A	uc002jdz.2	-	9	1017	c.904G>T	c.(904-906)GAG>TAG	p.E302*		NM_001433	NP_001424	O75460	ERN1_HUMAN	endoplasmic reticulum to nucleus signalling 1	302	Lumenal (Potential).				activation of signaling protein activity involved in unfolded protein response|apoptosis|cell cycle arrest|induction of apoptosis|mRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to endoplasmic reticulum membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(4)|lung(2)|stomach(1)|ovary(1)|kidney(1)	9																		---	---	---	---
CACNG5	27091	broad.mit.edu	37	17	64881015	64881015	+	Intron	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64881015G>A	uc010wqi.1	+						CACNG5_uc002jfr.2_Silent_p.S269S|CACNG5_uc010wqj.1_Intron	NM_145811	NP_665810			voltage-dependent calcium channel gamma-5						regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|postsynaptic density|postsynaptic membrane	voltage-gated calcium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(6;1.61e-08)															---	---	---	---
ZNF750	79755	broad.mit.edu	37	17	80788230	80788230	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80788230C>A	uc002kga.2	-	3	2271	c.1960G>T	c.(1960-1962)GGG>TGG	p.G654W	TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	NM_024702	NP_078978	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	654						intracellular	zinc ion binding			central_nervous_system(1)	1	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)															---	---	---	---
ARRDC5	645432	broad.mit.edu	37	19	4891082	4891082	+	Silent	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4891082G>T	uc002mbm.2	-	3	1005	c.1005C>A	c.(1003-1005)CCC>CCA	p.P335P		NM_001080523	NP_001073992	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	335					signal transduction						0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)														---	---	---	---
GIPC1	10755	broad.mit.edu	37	19	14591250	14591250	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14591250C>A	uc002myt.2	-	6	792	c.522G>T	c.(520-522)GTG>GTT	p.V174V	GIPC1_uc002myu.2_Silent_p.V174V|GIPC1_uc002myv.2_Silent_p.V77V|GIPC1_uc002myw.2_Silent_p.V77V|GIPC1_uc002myx.2_Silent_p.V174V|GIPC1_uc002myy.2_Silent_p.V77V	NM_005716	NP_005707	O14908	GIPC1_HUMAN	regulator of G-protein signalling 19 interacting	174	PDZ.				endothelial cell migration|G-protein coupled receptor protein signaling pathway|glutamate secretion|negative regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|protein targeting|regulation of protein stability|regulation of synaptic plasticity|synaptic transmission	cell cortex|dendritic shaft|dendritic spine|membrane fraction|soluble fraction|synaptic vesicle|vesicle membrane	actin binding|myosin binding|protein homodimerization activity|receptor binding				0																OREG0025316	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SIGLEC7	27036	broad.mit.edu	37	19	51645712	51645712	+	Missense_Mutation	SNP	C	T	T	rs140841032		TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51645712C>T	uc002pvv.1	+	1	155	c.86C>T	c.(85-87)ACG>ATG	p.T29M	SIGLEC7_uc002pvw.1_Missense_Mutation_p.T29M|SIGLEC7_uc010eoq.1_RNA|SIGLEC7_uc010eor.1_Missense_Mutation_p.T29M	NM_014385	NP_055200	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7 isoform 1	29	Extracellular (Potential).				cell adhesion	integral to plasma membrane	receptor activity|sugar binding			large_intestine(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)														---	---	---	---
ACSS1	84532	broad.mit.edu	37	20	24989990	24989990	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24989990C>A	uc002wub.2	-	13	2684	c.1806G>T	c.(1804-1806)GCG>GCT	p.A602A	ACSS1_uc002wuc.2_Silent_p.A600A|ACSS1_uc010gdc.2_Silent_p.A397A|ACSS1_uc002wud.1_RNA|ACSS1_uc002wua.2_Silent_p.A519A	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	602					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
PYGB	5834	broad.mit.edu	37	20	25252030	25252030	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25252030G>A	uc002wup.2	+	4	545	c.436G>A	c.(436-438)GAC>AAC	p.D146N		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	146					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)													---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42169439	42169439	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42169439G>A	uc010zwh.1	+	21	2358	c.2312G>A	c.(2311-2313)CGC>CAC	p.R771H	L3MBTL_uc002xkl.2_Missense_Mutation_p.R703H|L3MBTL_uc002xkm.2_Missense_Mutation_p.R703H|L3MBTL_uc010ggl.2_Missense_Mutation_p.R708H|L3MBTL_uc002xkn.1_Missense_Mutation_p.R462H|L3MBTL_uc002xko.2_Missense_Mutation_p.R355H|L3MBTL_uc002xkp.2_Missense_Mutation_p.R91H|SGK2_uc002xkq.1_5'UTR	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	703	SAM.				chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
ADARB1	104	broad.mit.edu	37	21	46596225	46596225	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46596225C>T	uc002zgy.2	+	4	1044	c.609C>T	c.(607-609)AGC>AGT	p.S203S	ADARB1_uc002zgr.2_Silent_p.S203S|ADARB1_uc002zgs.2_RNA|ADARB1_uc002zgw.2_Silent_p.S203S|ADARB1_uc002zgv.2_RNA|ADARB1_uc002zgt.2_Silent_p.S203S|ADARB1_uc010gpx.2_Intron|ADARB1_uc002zgq.2_RNA|ADARB1_uc002zgu.2_RNA|ADARB1_uc011afo.1_Silent_p.S252S	NM_015833	NP_056648	P78563	RED1_HUMAN	RNA-specific adenosine deaminase B1 isoform 2	203					adenosine to inosine editing|mRNA modification|mRNA processing|RNA processing	nucleoplasm|nucleus	double-stranded RNA adenosine deaminase activity|double-stranded RNA adenosine deaminase activity|double-stranded RNA binding|double-stranded RNA binding|metal ion binding|mRNA binding|RNA binding			skin(1)	1				Colorectal(79;0.115)														---	---	---	---
NIPSNAP1	8508	broad.mit.edu	37	22	29954921	29954921	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29954921C>A	uc003afx.3	-	9	801	c.728G>T	c.(727-729)CGG>CTG	p.R243L	NIPSNAP1_uc011akp.1_Missense_Mutation_p.R223L	NM_003634	NP_003625	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1	243										skin(1)	1																		---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40681756	40681756	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40681756C>A	uc011aor.1	+	12	3901	c.3690C>A	c.(3688-3690)CCC>CCA	p.P1230P	TNRC6B_uc003aym.2_Silent_p.P426P|TNRC6B_uc003ayn.3_Silent_p.P1120P|TNRC6B_uc003ayo.2_Silent_p.P977P	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	1230					gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
SBF1	6305	broad.mit.edu	37	22	50893258	50893258	+	Silent	SNP	C	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50893258C>T	uc003blh.2	-	35	4992	c.4797G>A	c.(4795-4797)GCG>GCA	p.A1599A	SBF1_uc003ble.2_Silent_p.A75A|SBF1_uc003blf.2_Silent_p.A75A|SBF1_uc011arx.1_Silent_p.A1237A	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1573	Myotubularin phosphatase.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
CHKB	1120	broad.mit.edu	37	22	51018236	51018236	+	Silent	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51018236C>A	uc003bms.2	-	9	1169	c.951G>T	c.(949-951)CTG>CTT	p.L317L	CPT1B_uc003bmk.3_5'Flank|CPT1B_uc003bml.2_5'Flank|CPT1B_uc003bmm.2_5'Flank|CPT1B_uc003bmo.2_5'Flank|CPT1B_uc011asa.1_5'Flank|CPT1B_uc003bmn.2_5'Flank|CPT1B_uc011asb.1_5'Flank|CHKB-CPT1B_uc003bmp.2_5'Flank|CHKB-CPT1B_uc003bmt.1_Silent_p.L108L|CHKB-CPT1B_uc003bmu.2_Silent_p.L196L|CHKB_uc003bmv.2_Silent_p.L317L	NM_005198	NP_005189	Q9Y259	CHKB_HUMAN	choline kinase beta	317					phosphatidylethanolamine biosynthetic process		ATP binding|choline kinase activity|ethanolamine kinase activity				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)													---	---	---	---
BHLHB9	80823	broad.mit.edu	37	X	102005104	102005104	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102005104G>T	uc010nog.2	+	4	1752	c.1181G>T	c.(1180-1182)GGG>GTG	p.G394V	BHLHB9_uc011mrq.1_Missense_Mutation_p.G394V|BHLHB9_uc011mrr.1_Missense_Mutation_p.G394V|BHLHB9_uc011mrs.1_Missense_Mutation_p.G394V|BHLHB9_uc011mrt.1_Missense_Mutation_p.G394V|BHLHB9_uc004ejo.2_Missense_Mutation_p.G394V|BHLHB9_uc011mru.1_Missense_Mutation_p.G394V|BHLHB9_uc011mrv.1_Missense_Mutation_p.G394V	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	394						cytoplasm|nucleus	binding			ovary(2)	2																		---	---	---	---
IRS4	8471	broad.mit.edu	37	X	107976577	107976577	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107976577G>T	uc004eoc.2	-	1	3031	c.2998C>A	c.(2998-3000)CTT>ATT	p.L1000I		NM_003604	NP_003595	O14654	IRS4_HUMAN	insulin receptor substrate 4	1000						plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity			ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10																		---	---	---	---
MAGEC1	9947	broad.mit.edu	37	X	140996328	140996328	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140996328A>C	uc004fbt.2	+	4	3424	c.3138A>C	c.(3136-3138)AAA>AAC	p.K1046N	MAGEC1_uc010nsl.1_Missense_Mutation_p.K113N	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1046	MAGE.						protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)														HNSCC(15;0.026)			---	---	---	---
FMR1	2332	broad.mit.edu	37	X	147013963	147013963	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147013963C>A	uc010nst.2	+	8	839	c.650C>A	c.(649-651)TCG>TAG	p.S217*	FMR1_uc011mwz.1_Nonsense_Mutation_p.S217*|FMR1_uc004fcj.2_Nonsense_Mutation_p.S217*|FMR1_uc004fck.3_Nonsense_Mutation_p.S217*|FMR1_uc004fcl.3_Nonsense_Mutation_p.S78*|FMR1_uc011mxa.1_5'UTR	NM_002024	NP_002015	Q06787	FMR1_HUMAN	fragile X mental retardation 1	217					mRNA transport|negative regulation of translational initiation	cytoplasm|mRNA cap binding complex|nucleolus|nucleoplasm|soluble fraction	mRNA binding|protein binding			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													Fragile_X_syndrome				---	---	---	---
PLXNA3	55558	broad.mit.edu	37	X	153698807	153698807	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4255-01A-01D-1126-08	TCGA-BR-4255-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153698807A>C	uc004flm.2	+	30	5182	c.5009A>C	c.(5008-5010)GAT>GCT	p.D1670A		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	1670	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)																	---	---	---	---
