Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ATAD3B	83858	broad.mit.edu	37	1	1430871	1430871	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1430871G>A	uc001afv.2	+	16	1722	c.1621G>A	c.(1621-1623)GCA>ACA	p.A541T	ATAD3B_uc001afx.2_Missense_Mutation_p.A495T|ATAD3B_uc001afy.2_Missense_Mutation_p.A94T	NM_031921	NP_114127	Q5T9A4	ATD3B_HUMAN	AAA-ATPase  TOB3	541							ATP binding|nucleoside-triphosphatase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CTAGGCCACGGCATATGCCTC	0.632													4	141	---	---	---	---	capture	Missense_Mutation	SNP	1430871	1430871	ATAD3B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1065	1
TPM3	7170	broad.mit.edu	37	1	154148652	154148652	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154148652G>A	uc001fec.1	-	3	431	c.316C>T	c.(316-318)CGC>TGC	p.R106C	TPM3_uc010pei.1_Intron|TPM3_uc001fdy.1_Missense_Mutation_p.R69C|TPM3_uc001fdz.1_Missense_Mutation_p.R69C|TPM3_uc001fea.1_Missense_Mutation_p.R69C|TPM3_uc001feb.1_Missense_Mutation_p.R69C|TPM3_uc010pej.1_Intron|TPM3_uc009wor.2_Intron|TPM3_uc001fed.1_Missense_Mutation_p.R69C	NM_152263	NP_689476	P06753	TPM3_HUMAN	tropomyosin 3 isoform 1	105	By similarity.				cellular component movement|muscle filament sliding|regulation of muscle contraction	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding		TPM3/ALK(33)	haematopoietic_and_lymphoid_tissue(22)|soft_tissue(11)|skin(1)	34	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					GTGGCCAGGCGCTCCTGAGCA	0.527			T	NTRK1|ALK	papillary thyroid|ALCL								123	137	---	---	---	---	capture	Missense_Mutation	SNP	154148652	154148652	TPM3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16290	1
NR1I3	9970	broad.mit.edu	37	1	161206281	161206281	+	Silent	SNP	C	T	T	rs140012276	byFrequency	TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161206281C>T	uc001fzx.2	-	2	278	c.75G>A	c.(73-75)GCG>GCA	p.A25A	TOMM40L_uc009wuf.1_Intron|NR1I3_uc001fzf.2_Silent_p.A25A|NR1I3_uc001fzg.2_Intron|NR1I3_uc001fzh.2_Intron|NR1I3_uc001fzi.2_Intron|NR1I3_uc001fzj.2_Intron|NR1I3_uc001fzk.2_Intron|NR1I3_uc001fzl.2_Intron|NR1I3_uc001fzm.2_Intron|NR1I3_uc001fzn.2_5'UTR|NR1I3_uc009wug.2_Intron|NR1I3_uc001fzp.2_Silent_p.A25A|NR1I3_uc001fzo.2_Intron|NR1I3_uc001fzq.2_Silent_p.A25A|NR1I3_uc001fzr.2_Silent_p.A25A|NR1I3_uc001fzs.2_Intron|NR1I3_uc001fzt.2_Intron|NR1I3_uc001fzu.2_Intron|NR1I3_uc001fzv.2_Intron|NR1I3_uc001fzw.2_Silent_p.A25A|NR1I3_uc001fzy.2_Silent_p.A25A|NR1I3_uc001fzz.2_Silent_p.A25A|NR1I3_uc001gaa.2_Silent_p.A25A|NR1I3_uc001gab.2_Silent_p.A25A|NR1I3_uc001gac.2_Intron|NR1I3_uc010pkm.1_Intron|NR1I3_uc010pkn.1_Silent_p.A25A	NM_001077480	NP_001070948	Q14994	NR1I3_HUMAN	constitutive androstane receptor isoform 2	25	NR C4-type.|Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	androgen receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(1)|skin(1)	2	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CACAAGTCAGCGCATTAAAGT	0.532													30	83	---	---	---	---	capture	Silent	SNP	161206281	161206281	NR1I3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10528	1
AGT	183	broad.mit.edu	37	1	230846235	230846235	+	Missense_Mutation	SNP	T	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:230846235T>A	uc001hty.3	-	2	870	c.362A>T	c.(361-363)CAC>CTC	p.H121L	AGT_uc009xfe.2_Missense_Mutation_p.H121L|AGT_uc009xff.2_Missense_Mutation_p.H93L	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein	121					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	TAGCTCACTGTGCATGCCATA	0.582													7	244	---	---	---	---	capture	Missense_Mutation	SNP	230846235	230846235	AGT	1	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	399	1
TACC2	10579	broad.mit.edu	37	10	123810032	123810032	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:123810032C>T	uc001lfv.2	+	3	473	c.113C>T	c.(112-114)ACG>ATG	p.T38M	TACC2_uc001lfw.2_Missense_Mutation_p.T38M|TACC2_uc009xzx.2_Missense_Mutation_p.T38M|TACC2_uc010qtv.1_Missense_Mutation_p.T38M	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	38						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CAGCAGGACACGCCCGGAAGC	0.577													36	4	---	---	---	---	capture	Missense_Mutation	SNP	123810032	123810032	TACC2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15390	1
JAKMIP3	282973	broad.mit.edu	37	10	133967449	133967449	+	Silent	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:133967449C>T	uc001lkx.3	+	18	2169	c.2169C>T	c.(2167-2169)GAC>GAT	p.D723D	JAKMIP3_uc009yba.1_Silent_p.D160D	NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GCTACCTGGACGAGGAGCTGG	0.632													64	15	---	---	---	---	capture	Silent	SNP	133967449	133967449	JAKMIP3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7865	1
NAALAD2	10003	broad.mit.edu	37	11	89868837	89868837	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:89868837C>T	uc001pdf.3	+	2	302	c.193C>T	c.(193-195)CGT>TGT	p.R65C	NAALAD2_uc009yvx.2_Missense_Mutation_p.R65C|NAALAD2_uc009yvy.2_Missense_Mutation_p.R65C|NAALAD2_uc001pdd.2_Missense_Mutation_p.R65C|NAALAD2_uc001pde.2_Missense_Mutation_p.R65C	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	65	Extracellular (Potential).				proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ATCATTTCTTCGGTAAGTTTA	0.348													35	33	---	---	---	---	capture	Missense_Mutation	SNP	89868837	89868837	NAALAD2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10038	1
FAT3	120114	broad.mit.edu	37	11	92570936	92570936	+	Silent	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:92570936G>A	uc001pdj.3	+	16	10349	c.10332G>A	c.(10330-10332)CCG>CCA	p.P3444P	FAT3_uc001pdi.3_5'Flank	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3444	Extracellular (Potential).|Cadherin 31.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAACAGCCCGGTGTTTACAC	0.468										TCGA Ovarian(4;0.039)			41	62	---	---	---	---	capture	Silent	SNP	92570936	92570936	FAT3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5637	1
PANX3	116337	broad.mit.edu	37	11	124489539	124489539	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124489539G>A	uc001qah.2	+	4	887	c.887G>A	c.(886-888)CGG>CAG	p.R296Q		NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN	pannexin 3	296	Cytoplasmic (Potential).				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		CGGCTATGTCGGTGGGACAAA	0.438													89	123	---	---	---	---	capture	Missense_Mutation	SNP	124489539	124489539	PANX3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11326	1
SLC2A14	144195	broad.mit.edu	37	12	7980269	7980269	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7980269C>T	uc001qtk.2	-	12	1548	c.755G>A	c.(754-756)CGG>CAG	p.R252Q	SLC2A14_uc001qtl.2_Missense_Mutation_p.R229Q|SLC2A14_uc001qtm.2_Missense_Mutation_p.R229Q|SLC2A14_uc010sgg.1_Missense_Mutation_p.R143Q|SLC2A14_uc001qtn.2_Missense_Mutation_p.R252Q|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Missense_Mutation_p.R267Q	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	252	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		GCCCCACAACCGCTGGAGGAC	0.502													30	33	---	---	---	---	capture	Missense_Mutation	SNP	7980269	7980269	SLC2A14	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14435	1
SLC2A3	6515	broad.mit.edu	37	12	8082458	8082458	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8082458C>T	uc001qtr.2	-	6	945	c.683G>A	c.(682-684)CGG>CAG	p.R228Q	SLC2A3_uc001qts.2_3'UTR	NM_006931	NP_008862	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose	228	Cytoplasmic (Potential).				carbohydrate metabolic process|water-soluble vitamin metabolic process	integral to membrane|plasma membrane	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			ovary(3)|pancreas(1)	4				Kidney(36;0.0866)		GCCCCACAACCGCTGGAGGAC	0.493													24	187	---	---	---	---	capture	Missense_Mutation	SNP	8082458	8082458	SLC2A3	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14437	1
MTERFD3	80298	broad.mit.edu	37	12	107371855	107371855	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107371855A>G	uc001tme.1	-	2	2457	c.638T>C	c.(637-639)TTA>TCA	p.L213S	MTERFD3_uc001tmf.1_Missense_Mutation_p.L213S|MTERFD3_uc001tmg.1_Missense_Mutation_p.L213S|MTERFD3_uc001tmh.1_Missense_Mutation_p.L213S	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein	213					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						GTTTTGGCTTAACAATTTTAG	0.383													50	70	---	---	---	---	capture	Missense_Mutation	SNP	107371855	107371855	MTERFD3	12	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	9831	1
BTBD11	121551	broad.mit.edu	37	12	108012011	108012011	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108012011G>A	uc001tmk.1	+	10	2829	c.2308G>A	c.(2308-2310)GAG>AAG	p.E770K	BTBD11_uc009zut.1_Intron|BTBD11_uc001tmj.2_Missense_Mutation_p.E770K|BTBD11_uc001tml.1_Missense_Mutation_p.E307K	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	770						integral to membrane	DNA binding			skin(2)|ovary(1)	3						GATTCTGGCCGAGGGGACTGA	0.607													34	59	---	---	---	---	capture	Missense_Mutation	SNP	108012011	108012011	BTBD11	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1527	1
MYH6	4624	broad.mit.edu	37	14	23858709	23858709	+	Silent	SNP	G	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23858709G>T	uc001wjv.2	-	28	3938	c.3871C>A	c.(3871-3873)CGG>AGG	p.R1291R	uc010tnn.1_5'Flank|MIR208A_hsa-mir-208a|MI0000251_5'Flank	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1291	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCTAGCTGCCGGGCCAACTCT	0.582													85	96	---	---	---	---	capture	Silent	SNP	23858709	23858709	MYH6	14	G	T	T	T	1	0	0	0	0	0	0	0	1	506	39	4	4	9948	1
AKAP6	9472	broad.mit.edu	37	14	33290999	33290999	+	Missense_Mutation	SNP	A	G	G			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:33290999A>G	uc001wrq.2	+	13	4150	c.3980A>G	c.(3979-3981)GAC>GGC	p.D1327G		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1327					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CTCAGTAAAGACTCTTCATTT	0.418													48	73	---	---	---	---	capture	Missense_Mutation	SNP	33290999	33290999	AKAP6	14	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	455	1
EML1	2009	broad.mit.edu	37	14	100363606	100363606	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:100363606G>A	uc001ygs.2	+	7	871	c.802G>A	c.(802-804)GCT>ACT	p.A268T	EML1_uc010avt.1_Missense_Mutation_p.A255T|EML1_uc010tww.1_Missense_Mutation_p.A256T|EML1_uc001ygq.2_Missense_Mutation_p.A287T|EML1_uc001ygr.2_Missense_Mutation_p.A287T	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	268						cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				GAGGCATTACGCTGGCCACAA	0.383													47	40	---	---	---	---	capture	Missense_Mutation	SNP	100363606	100363606	EML1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5051	1
WDR72	256764	broad.mit.edu	37	15	53998200	53998200	+	Silent	SNP	A	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53998200A>T	uc002acj.2	-	10	1068	c.1026T>A	c.(1024-1026)TCT>TCA	p.S342S	WDR72_uc010bfi.1_Silent_p.S342S	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	342	WD 4.									lung(1)|skin(1)	2				all cancers(107;0.0511)		AGACTTCTCCAGAGAAAAGTA	0.403													52	8	---	---	---	---	capture	Silent	SNP	53998200	53998200	WDR72	15	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	17203	1
GNPTG	84572	broad.mit.edu	37	16	1412529	1412529	+	Silent	SNP	C	T	T	rs146171435	byFrequency	TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1412529C>T	uc002clm.2	+	8	638	c.603C>T	c.(601-603)ACC>ACT	p.T201T		NM_032520	NP_115909	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphotransferase, gamma	201						extracellular region|Golgi apparatus	protein binding			central_nervous_system(1)	1		Hepatocellular(780;0.0893)				AGCTGATCACCCCCCAGGTAA	0.667													51	45	---	---	---	---	capture	Silent	SNP	1412529	1412529	GNPTG	16	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	6482	1
MAPK8IP3	23162	broad.mit.edu	37	16	1815961	1815961	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1815961C>T	uc002cmk.2	+	21	2564	c.2444C>T	c.(2443-2445)GCG>GTG	p.A815V	MAPK8IP3_uc002cml.2_Missense_Mutation_p.A809V|MAPK8IP3_uc010uvl.1_Missense_Mutation_p.A816V	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	815					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						CTCTCCCCAGCGGCCAGCGAC	0.687													11	11	---	---	---	---	capture	Missense_Mutation	SNP	1815961	1815961	MAPK8IP3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9199	1
SPATA22	84690	broad.mit.edu	37	17	3366028	3366028	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3366028G>A	uc002fvm.2	-	4	443	c.206C>T	c.(205-207)GCT>GTT	p.A69V	SPATA22_uc010vrg.1_Missense_Mutation_p.A53V|SPATA22_uc010vrf.1_Missense_Mutation_p.A69V|SPATA22_uc002fvn.2_Missense_Mutation_p.A69V|SPATA22_uc002fvo.2_Missense_Mutation_p.A69V|SPATA22_uc002fvp.2_Missense_Mutation_p.A69V|SPATA22_uc010ckf.2_Missense_Mutation_p.A26V	NM_032598	NP_115987	Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	69											0						CATTACAGGAGCCAACTCTGG	0.348													64	115	---	---	---	---	capture	Missense_Mutation	SNP	3366028	3366028	SPATA22	17	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	14900	1
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	A	A	rs28934574		TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577094G>A	uc002gim.2	-	8	1038	c.844C>T	c.(844-846)CGG>TGG	p.R282W	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R282W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R150W|TP53_uc010cng.1_Missense_Mutation_p.R150W|TP53_uc002gii.1_Missense_Mutation_p.R150W|TP53_uc010cnh.1_Missense_Mutation_p.R282W|TP53_uc010cni.1_Missense_Mutation_p.R282W|TP53_uc002gij.2_Missense_Mutation_p.R282W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	282	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R282W(367)|p.R282G(27)|p.R282Q(20)|p.R282P(14)|p.R282R(8)|p.0?(7)|p.R282L(3)|p.D281fs*63(2)|p.?(2)|p.R282fs*24(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.R280fs*62(1)|p.R282_E287delRRTEEE(1)|p.G279fs*59(1)|p.S269fs*21(1)|p.C275_R283delCACPGRDRR(1)|p.D281_R282insXX(1)|p.L265_K305del41(1)|p.R282H(1)|p.R283_T284>T(1)|p.V272_K292del21(1)|p.R282fs*63(1)|p.C275fs*20(1)|p.D281_R282delDR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCTGTGCGCCGGTCTCTCCCA	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			44	60	---	---	---	---	capture	Missense_Mutation	SNP	7577094	7577094	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16264	1
TP53	7157	broad.mit.edu	37	17	7578396	7578396	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578396G>T	uc002gim.2	-	5	728	c.534C>A	c.(532-534)CAC>CAA	p.H178Q	TP53_uc002gig.1_Missense_Mutation_p.H178Q|TP53_uc002gih.2_Missense_Mutation_p.H178Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H46Q|TP53_uc010cng.1_Missense_Mutation_p.H46Q|TP53_uc002gii.1_Missense_Mutation_p.H46Q|TP53_uc010cnh.1_Missense_Mutation_p.H178Q|TP53_uc010cni.1_Missense_Mutation_p.H178Q|TP53_uc002gij.2_Missense_Mutation_p.H178Q|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.H85Q|TP53_uc002gio.2_Missense_Mutation_p.H46Q|TP53_uc010vug.1_Missense_Mutation_p.H139Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	178	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> L (in a sporadic cancer; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> HPHP (in a Burkitt lymphoma).|H -> D (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H178fs*69(13)|p.P177_C182delPHHERC(8)|p.H179Y(8)|p.H178Y(8)|p.0?(7)|p.H178P(6)|p.H178fs*3(5)|p.H178Q(5)|p.H178D(4)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.H178N(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.H178H(2)|p.K164_P219del(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.R175_H178>X(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.H178_H179>QY(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.H178del(1)|p.R174_E180>K(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H178L(1)|p.R174fs*3(1)|p.E171fs*61(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGCGCTCATGGTGGGGGCAGC	0.642		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			44	72	---	---	---	---	capture	Missense_Mutation	SNP	7578396	7578396	TP53	17	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	16264	1
HOXB1	3211	broad.mit.edu	37	17	46607715	46607715	+	Missense_Mutation	SNP	C	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46607715C>A	uc002ink.1	-	1	558	c.552G>T	c.(550-552)AAG>AAT	p.K184N		NM_002144	NP_002135	P14653	HXB1_HUMAN	homeobox B1	184	Antp-type hexapeptide.					nucleus	protein domain specific binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTCTCTTAACCTTCATCCAGT	0.592													36	44	---	---	---	---	capture	Missense_Mutation	SNP	46607715	46607715	HOXB1	17	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	7224	1
FUT5	2527	broad.mit.edu	37	19	5867712	5867712	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5867712G>T	uc002mdo.3	-	2	113	c.25C>A	c.(25-27)CCA>ACA	p.P9T	FUT5_uc010duo.2_Missense_Mutation_p.P9T	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	9	Cytoplasmic (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						AGCCACTGTGGCTTGGCTGGG	0.607													5	38	---	---	---	---	capture	Missense_Mutation	SNP	5867712	5867712	FUT5	19	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	6049	1
ILF3	3609	broad.mit.edu	37	19	10789305	10789305	+	Silent	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10789305C>T	uc002mpn.2	+	6	893	c.576C>T	c.(574-576)AAC>AAT	p.N192N	ILF3_uc002mpm.2_Silent_p.N192N|ILF3_uc002mpl.2_Silent_p.N192N|ILF3_uc002mpk.2_Silent_p.N192N|ILF3_uc010xli.1_Intron|ILF3_uc002mpo.2_Silent_p.N192N|ILF3_uc002mpp.2_Silent_p.N13N	NM_012218	NP_036350	Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3 isoform a	192	DZF.				M phase|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleolus|ribonucleoprotein complex	DNA binding|double-stranded RNA binding|protein binding|protein binding			ovary(3)	3			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			TATCAGTCAACGACCCCCCGG	0.502													76	112	---	---	---	---	capture	Silent	SNP	10789305	10789305	ILF3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7635	1
PODNL1	79883	broad.mit.edu	37	19	14046616	14046616	+	Missense_Mutation	SNP	G	A	A	rs142083249		TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14046616G>A	uc002mxr.2	-	5	707	c.433C>T	c.(433-435)CGG>TGG	p.R145W	PODNL1_uc010xni.1_Missense_Mutation_p.R63W|PODNL1_uc010xnj.1_Missense_Mutation_p.R143W|PODNL1_uc002mxs.2_Intron	NM_024825	NP_079101	Q6PEZ8	PONL1_HUMAN	podocan-like 1 isoform 1	145	LRR 3.|Leu-rich.					proteinaceous extracellular matrix				central_nervous_system(1)	1			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			CGGAGGGACCGGGGCAGAAAC	0.657													15	25	---	---	---	---	capture	Missense_Mutation	SNP	14046616	14046616	PODNL1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	12082	1
NLRP5	126206	broad.mit.edu	37	19	56538455	56538455	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56538455G>A	uc002qmj.2	+	7	856	c.856G>A	c.(856-858)GGA>AGA	p.G286R	NLRP5_uc002qmi.2_Missense_Mutation_p.G267R	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	286	NACHT.|ATP (Potential).					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GGTTCTGCACGGAAAGTCAGG	0.547													10	4	---	---	---	---	capture	Missense_Mutation	SNP	56538455	56538455	NLRP5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10387	1
ZNF583	147949	broad.mit.edu	37	19	56934399	56934399	+	Missense_Mutation	SNP	T	G	G			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56934399T>G	uc010ygl.1	+	5	537	c.372T>G	c.(370-372)AGT>AGG	p.S124R	ZNF583_uc002qnc.2_Missense_Mutation_p.S124R|ZNF583_uc010ygm.1_Missense_Mutation_p.S124R	NM_001159860	NP_001153332	Q96ND8	ZN583_HUMAN	zinc finger protein 583	124					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		ACTGTCAAAGTGAGGACTGGT	0.383													72	69	---	---	---	---	capture	Missense_Mutation	SNP	56934399	56934399	ZNF583	19	T	G	G	G	1	0	0	0	0	1	0	0	0	764	59	4	4	17893	1
C2orf63	130162	broad.mit.edu	37	2	55439915	55439915	+	Silent	SNP	C	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:55439915C>A	uc002ryi.2	-	5	739	c.393G>T	c.(391-393)TCG>TCT	p.S131S	C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Silent_p.S9S	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	131							binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			ATTGAATCTTCGAGGAATTAC	0.338													50	54	---	---	---	---	capture	Silent	SNP	55439915	55439915	C2orf63	2	C	A	A	A	1	0	0	0	0	0	0	0	1	392	31	4	4	2162	1
ALMS1	7840	broad.mit.edu	37	2	73680365	73680365	+	Silent	SNP	A	G	G			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73680365A>G	uc002sje.1	+	10	6825	c.6714A>G	c.(6712-6714)GAA>GAG	p.E2238E	ALMS1_uc002sjf.1_Silent_p.E2194E|ALMS1_uc002sjg.2_Silent_p.E1624E|ALMS1_uc002sjh.1_Silent_p.E1624E	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2236					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						ATAAACCAGAATCTGCAGGTT	0.363													3	118	---	---	---	---	capture	Silent	SNP	73680365	73680365	ALMS1	2	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	535	1
PLCL1	5334	broad.mit.edu	37	2	198950756	198950756	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198950756G>A	uc010fsp.2	+	2	2806	c.2515G>A	c.(2515-2517)GTA>ATA	p.V839I	PLCL1_uc002uuv.3_Missense_Mutation_p.V760I	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	839					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	CATGGAGCACGTAACCCTTTT	0.453													71	70	---	---	---	---	capture	Missense_Mutation	SNP	198950756	198950756	PLCL1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11942	1
SLC11A1	6556	broad.mit.edu	37	2	219255987	219255987	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219255987G>A	uc002vhv.2	+	10	1361	c.1021G>A	c.(1021-1023)GTG>ATG	p.V341M	SLC11A1_uc010fvp.1_Missense_Mutation_p.V341M|SLC11A1_uc010fvq.1_Missense_Mutation_p.V274M|SLC11A1_uc010zkc.1_Missense_Mutation_p.V274M|SLC11A1_uc002vhu.1_Missense_Mutation_p.V136M|SLC11A1_uc002vhw.2_Missense_Mutation_p.V223M|SLC11A1_uc010fvr.2_Missense_Mutation_p.V136M	NM_000578	NP_000569	P49279	NRAM1_HUMAN	natural resistance-associated macrophage protein	341	Extracellular (Potential).				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAACGCCACCGTGGCCGTGGA	0.627													59	66	---	---	---	---	capture	Missense_Mutation	SNP	219255987	219255987	SLC11A1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14273	1
OBSL1	23363	broad.mit.edu	37	2	220422920	220422920	+	Missense_Mutation	SNP	T	C	C			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220422920T>C	uc010fwk.2	-	10	3545	c.3488A>G	c.(3487-3489)AAT>AGT	p.N1163S	OBSL1_uc002vmh.1_Missense_Mutation_p.N154S|OBSL1_uc010zli.1_Intron|OBSL1_uc010fwl.1_Missense_Mutation_p.N638S	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	1163	Ig-like 9.				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CAGGATGACATTGAAGGTGAT	0.657													13	24	---	---	---	---	capture	Missense_Mutation	SNP	220422920	220422920	OBSL1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	10718	1
TSHZ2	128553	broad.mit.edu	37	20	51872260	51872260	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51872260C>T	uc002xwo.2	+	2	3219	c.2263C>T	c.(2263-2265)CGC>TGC	p.R755C		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	755					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			CGTGTCCAGGCGCTACCTGTT	0.512													63	96	---	---	---	---	capture	Missense_Mutation	SNP	51872260	51872260	TSHZ2	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16507	1
FAM83F	113828	broad.mit.edu	37	22	40417570	40417570	+	Silent	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40417570C>T	uc003ayk.1	+	4	1150	c.1056C>T	c.(1054-1056)GGC>GGT	p.G352G		NM_138435	NP_612444	Q8NEG4	FA83F_HUMAN	hypothetical protein LOC113828	352										breast(1)	1						GGGAGGCGGGCGGCAACCCGG	0.687													38	31	---	---	---	---	capture	Silent	SNP	40417570	40417570	FAM83F	22	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5584	1
PKDREJ	10343	broad.mit.edu	37	22	46656782	46656782	+	Missense_Mutation	SNP	C	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46656782C>A	uc003bhh.2	-	1	2438	c.2438G>T	c.(2437-2439)AGT>ATT	p.S813I		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	813	Extracellular (Potential).|REJ.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		ATTAGACAAACTCATTAGTAT	0.348													45	102	---	---	---	---	capture	Missense_Mutation	SNP	46656782	46656782	PKDREJ	22	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	11873	1
CLEC3B	7123	broad.mit.edu	37	3	45077083	45077083	+	Silent	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45077083C>T	uc003cok.3	+	3	372	c.276C>T	c.(274-276)CAC>CAT	p.H92H	CLEC3B_uc003col.2_Silent_p.H50H	NM_003278	NP_003269	P05452	TETN_HUMAN	C-type lectin domain family 3, member B	92	C-type lectin.				skeletal system development	extracellular space	protein binding|sugar binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00863)|KIRC - Kidney renal clear cell carcinoma(197;0.0475)|Kidney(197;0.0595)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGACCTTCCACGAGGCCAGCG	0.627													42	51	---	---	---	---	capture	Silent	SNP	45077083	45077083	CLEC3B	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3476	1
NPRL2	10641	broad.mit.edu	37	3	50387203	50387203	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50387203G>A	uc003daj.1	-	3	635	c.232C>T	c.(232-234)CGC>TGC	p.R78C	NPRL2_uc003dai.1_5'UTR|CYB561D2_uc003dak.2_5'Flank|CYB561D2_uc003dal.2_5'Flank|CYB561D2_uc003dam.2_5'Flank	NM_006545	NP_006536	Q8WTW4	NPRL2_HUMAN	tumor suppressor candidate 4	78	Interaction with PDPK1.				negative regulation of kinase activity		protein binding|protein kinase activity			lung(1)	1						AGAGCATTGCGGCTGTACTTC	0.547													96	249	---	---	---	---	capture	Missense_Mutation	SNP	50387203	50387203	NPRL2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10504	1
DZIP1L	199221	broad.mit.edu	37	3	137796433	137796433	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137796433C>T	uc003erq.2	-	11	1693	c.1330G>A	c.(1330-1332)GCT>ACT	p.A444T	DZIP1L_uc003err.1_Missense_Mutation_p.A444T	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	444						intracellular	zinc ion binding			ovary(1)|pancreas(1)	2						CGCCTCAGAGCTGCCAGCACC	0.537													116	124	---	---	---	---	capture	Missense_Mutation	SNP	137796433	137796433	DZIP1L	3	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	4819	1
ANAPC4	29945	broad.mit.edu	37	4	25396471	25396471	+	Missense_Mutation	SNP	G	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25396471G>T	uc003gro.2	+	14	1134	c.1005G>T	c.(1003-1005)CAG>CAT	p.Q335H	ANAPC4_uc003grp.2_Missense_Mutation_p.Q220H|ANAPC4_uc010iet.1_Missense_Mutation_p.Q115H|ANAPC4_uc010ieu.1_Intron	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN	anaphase-promoting complex subunit 4	335					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)				AGCTTGGCCAGTCTATAGAGT	0.313													54	91	---	---	---	---	capture	Missense_Mutation	SNP	25396471	25396471	ANAPC4	4	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	601	1
UGT2B28	54490	broad.mit.edu	37	4	70156391	70156391	+	Missense_Mutation	SNP	T	C	C			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70156391T>C	uc003hej.2	+	5	1174	c.1172T>C	c.(1171-1173)GTA>GCA	p.V391A	UGT2B28_uc010ihr.2_Intron	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	391					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	ATCCCTATGGTAGGCATTCCA	0.448													37	361	---	---	---	---	capture	Missense_Mutation	SNP	70156391	70156391	UGT2B28	4	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	16842	1
DNAH5	1767	broad.mit.edu	37	5	13727709	13727709	+	Silent	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13727709C>T	uc003jfd.2	-	70	11982	c.11940G>A	c.(11938-11940)GAG>GAA	p.E3980E	DNAH5_uc003jfc.2_Silent_p.E148E	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3980					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GAAGAGGTTCCTCCTCCGGGT	0.413									Kartagener_syndrome				36	55	---	---	---	---	capture	Silent	SNP	13727709	13727709	DNAH5	5	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	4561	1
PIK3R1	5295	broad.mit.edu	37	5	67589138	67589138	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589138G>A	uc003jva.2	+	10	1686	c.1126G>A	c.(1126-1128)GGA>AGA	p.G376R	PIK3R1_uc003jvb.2_Missense_Mutation_p.G376R|PIK3R1_uc003jvc.2_Missense_Mutation_p.G76R|PIK3R1_uc003jvd.2_Missense_Mutation_p.G106R|PIK3R1_uc003jve.2_Missense_Mutation_p.G55R|PIK3R1_uc011crb.1_Missense_Mutation_p.G46R	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	376	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.G376R(3)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CAGGAAAGGGGGAAATAACAA	0.308			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			22	60	---	---	---	---	capture	Missense_Mutation	SNP	67589138	67589138	PIK3R1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11821	1
MTX3	345778	broad.mit.edu	37	5	79284349	79284349	+	Missense_Mutation	SNP	A	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79284349A>T	uc010jag.2	-	5	467	c.440T>A	c.(439-441)CTG>CAG	p.L147Q	MTX3_uc010jah.2_Missense_Mutation_p.L147Q|MTX3_uc003kge.3_Missense_Mutation_p.L86Q|MTX3_uc003kgf.1_5'Flank	NM_001010891	NP_001010891	Q5HYI7	MTX3_HUMAN	metaxin 3	147					protein targeting to mitochondrion	mitochondrial outer membrane					0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		AATCCTATTCAGTGCTCCCTT	0.463													25	28	---	---	---	---	capture	Missense_Mutation	SNP	79284349	79284349	MTX3	5	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	9879	1
HRH2	3274	broad.mit.edu	37	5	175110351	175110351	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:175110351G>A	uc003mdd.2	+	1	1888	c.115G>A	c.(115-117)GTC>ATC	p.V39I	HRH2_uc003mdc.3_Missense_Mutation_p.V39I	NM_022304	NP_071640	P25021	HRH2_HUMAN	histamine receptor H2 isoform 2	39	Helical; Name=1; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|immune response	integral to plasma membrane	histamine receptor activity			ovary(1)	1	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Nizatidine(DB00585)|Ranitidine(DB00863)	CAATGTGGTCGTCTGTCTGGC	0.582													168	225	---	---	---	---	capture	Missense_Mutation	SNP	175110351	175110351	HRH2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7281	1
KIAA0319	9856	broad.mit.edu	37	6	24556864	24556864	+	Missense_Mutation	SNP	C	T	T	rs137950263		TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24556864C>T	uc011djo.1	-	18	3065	c.2828G>A	c.(2827-2829)CGT>CAT	p.R943H	KIAA0319_uc011djp.1_Missense_Mutation_p.R898H|KIAA0319_uc003neh.1_Missense_Mutation_p.R943H|KIAA0319_uc011djq.1_Missense_Mutation_p.R934H|KIAA0319_uc011djr.1_Missense_Mutation_p.R943H|KIAA0319_uc010jpt.1_Missense_Mutation_p.R354H	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	943	Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						CCAGATATAACGCTGTATAAG	0.488													28	60	---	---	---	---	capture	Missense_Mutation	SNP	24556864	24556864	KIAA0319	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8090	1
SLC39A7	7922	broad.mit.edu	37	6	33170112	33170112	+	Missense_Mutation	SNP	T	C	C			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33170112T>C	uc003odf.2	+	5	824	c.707T>C	c.(706-708)TTT>TCT	p.F236S	RXRB_uc003odb.2_5'Flank|RXRB_uc003odc.2_5'Flank|RXRB_uc003odd.2_5'Flank|RXRB_uc011dqr.1_5'Flank|RXRB_uc011dqs.1_5'Flank|RXRB_uc011dqt.1_5'Flank|RXRB_uc011dqu.1_5'Flank|SLC39A7_uc003odg.2_Missense_Mutation_p.F236S|SLC39A7_uc011dqv.1_Missense_Mutation_p.F111S|SLC39A7_uc003odh.2_5'UTR|HSD17B8_uc003odi.1_5'Flank	NM_001077516	NP_001070984	Q92504	S39A7_HUMAN	solute carrier family 39, member 7	236						endoplasmic reticulum membrane|integral to membrane|membrane fraction	protein binding|zinc ion transmembrane transporter activity			large_intestine(1)	1						GTGGAGAAATTTGTGAGACAT	0.507													106	120	---	---	---	---	capture	Missense_Mutation	SNP	33170112	33170112	SLC39A7	6	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	14515	1
EPHA7	2045	broad.mit.edu	37	6	94120845	94120845	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:94120845C>T	uc003poe.2	-	3	447	c.206G>A	c.(205-207)CGA>CAA	p.R69Q	EPHA7_uc003pof.2_Missense_Mutation_p.R69Q|EPHA7_uc011eac.1_Missense_Mutation_p.R69Q|EPHA7_uc003pog.3_Missense_Mutation_p.R69Q	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor	69	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity	p.R69Q(1)		lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTGGTATGTTCGTATCGGGGT	0.393													82	102	---	---	---	---	capture	Missense_Mutation	SNP	94120845	94120845	EPHA7	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5127	1
SHPRH	257218	broad.mit.edu	37	6	146269445	146269445	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146269445C>T	uc003qlf.2	-	5	1423	c.1024G>A	c.(1024-1026)GAG>AAG	p.E342K	SHPRH_uc003qld.2_Missense_Mutation_p.E342K|SHPRH_uc003qle.2_Missense_Mutation_p.E342K|SHPRH_uc003qlg.1_5'UTR|SHPRH_uc003qlj.1_Missense_Mutation_p.E231K|SHPRH_uc003qlk.1_Missense_Mutation_p.E342K	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	342	Helicase ATP-binding; first part.				DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TTCAGACCCTCAGATGTAACA	0.308													44	13	---	---	---	---	capture	Missense_Mutation	SNP	146269445	146269445	SHPRH	6	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	14184	1
ELMO1	9844	broad.mit.edu	37	7	37251095	37251095	+	Missense_Mutation	SNP	G	C	C			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37251095G>C	uc003tfk.1	-	13	1289	c.982C>G	c.(982-984)CGA>GGA	p.R328G	ELMO1_uc011kbc.1_Missense_Mutation_p.R232G|ELMO1_uc010kxg.1_Missense_Mutation_p.R328G	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	328	ELMO.				actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						GCAATTCTTCGAAGTTCAAAT	0.428													41	65	---	---	---	---	capture	Missense_Mutation	SNP	37251095	37251095	ELMO1	7	G	C	C	C	1	0	0	0	0	1	0	0	0	480	37	4	4	5020	1
EGFR	1956	broad.mit.edu	37	7	55233109	55233109	+	Missense_Mutation	SNP	G	A	A	rs150899403		TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233109G>A	uc003tqk.2	+	15	2105	c.1859G>A	c.(1858-1860)TGC>TAC	p.C620Y	EGFR_uc003tqi.2_Missense_Mutation_p.C620Y|EGFR_uc003tqj.2_Missense_Mutation_p.C620Y|EGFR_uc010kzg.1_Missense_Mutation_p.C575Y|EGFR_uc011kco.1_Missense_Mutation_p.C567Y|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	620	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.C620Y(1)|p.C620W(1)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCACCTGTGCCATCCAAAC	0.542		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			293	342	---	---	---	---	capture	Missense_Mutation	SNP	55233109	55233109	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	1
ZNF680	340252	broad.mit.edu	37	7	64004766	64004766	+	Silent	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:64004766C>T	uc003tta.2	-	2	248	c.75G>A	c.(73-75)GAG>GAA	p.E25E	ZNF680_uc010kzr.2_5'UTR|ZNF680_uc003ttb.2_Silent_p.E25E	NM_178558	NP_848653	Q8NEM1	ZN680_HUMAN	zinc finger protein 680 isoform 1	25	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.118)|all_lung(88;0.243)				ATTGCCACTCCTCCAGAGAGA	0.343													8	399	---	---	---	---	capture	Silent	SNP	64004766	64004766	ZNF680	7	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	17965	1
AUTS2	26053	broad.mit.edu	37	7	70255710	70255710	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70255710G>A	uc003tvw.3	+	19	4251	c.3508G>A	c.(3508-3510)GTG>ATG	p.V1170M	AUTS2_uc003tvx.3_Missense_Mutation_p.V1146M|AUTS2_uc011keg.1_Missense_Mutation_p.V622M	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	1170	His-rich.									ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GCTCCACTCCGTGCACCCCGC	0.697													28	67	---	---	---	---	capture	Missense_Mutation	SNP	70255710	70255710	AUTS2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1215	1
MUC17	140453	broad.mit.edu	37	7	100677039	100677039	+	Missense_Mutation	SNP	C	T	T			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100677039C>T	uc003uxp.1	+	3	2395	c.2342C>T	c.(2341-2343)TCT>TTT	p.S781F	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	781	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|11.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					ATCACCACTTCTACTGAAGCC	0.458													243	635	---	---	---	---	capture	Missense_Mutation	SNP	100677039	100677039	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	9884	1
SLC26A3	1811	broad.mit.edu	37	7	107431527	107431527	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107431527G>A	uc003ver.2	-	5	747	c.536C>T	c.(535-537)GCG>GTG	p.A179V	SLC26A3_uc003ves.2_Missense_Mutation_p.A144V	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	179	Helical; (Potential).				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						GACTGATGCCGCCGCCGCCAC	0.483													4	111	---	---	---	---	capture	Missense_Mutation	SNP	107431527	107431527	SLC26A3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14410	1
POTEA	340441	broad.mit.edu	37	8	43147808	43147808	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:43147808G>A	uc003xpz.1	+	1	224	c.181G>A	c.(181-183)GTC>ATC	p.V61I	POTEA_uc003xqa.1_Missense_Mutation_p.V61I	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	61										ovary(1)	1						AAGGTATCACGTCCGTCGAGA	0.602													80	105	---	---	---	---	capture	Missense_Mutation	SNP	43147808	43147808	POTEA	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12163	1
UBR5	51366	broad.mit.edu	37	8	103282370	103282370	+	Missense_Mutation	SNP	C	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:103282370C>A	uc003ykr.1	-	50	7160	c.7127G>T	c.(7126-7128)AGA>ATA	p.R2376I	UBR5_uc003yks.1_Missense_Mutation_p.R2376I|UBR5_uc003ykq.2_5'Flank	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	2376					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGAGGCTGGTCTAAAGGGCCT	0.438													5	205	---	---	---	---	capture	Missense_Mutation	SNP	103282370	103282370	UBR5	8	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	16787	1
KIAA0020	9933	broad.mit.edu	37	9	2811564	2811564	+	Missense_Mutation	SNP	G	A	A			TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2811564G>A	uc003zhp.1	-	15	1528	c.1432C>T	c.(1432-1434)CGC>TGC	p.R478C	KIAA0020_uc010mhc.1_Missense_Mutation_p.R477C|KIAA0020_uc003zhq.1_Missense_Mutation_p.R477C	NM_014878	NP_055693	Q15397	K0020_HUMAN	KIAA0020 protein	478	PUM-HD.					endoplasmic reticulum|nucleolus	RNA binding			ovary(1)	1				GBM - Glioblastoma multiforme(50;0.0319)		TCCCGTCTGCGGACCTCTGTA	0.433													16	179	---	---	---	---	capture	Missense_Mutation	SNP	2811564	2811564	KIAA0020	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8074	1
KIF27	55582	broad.mit.edu	37	9	86482718	86482718	+	Missense_Mutation	SNP	G	A	A	rs3199677	by1000genomes	TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86482718G>A	uc004ana.2	-	13	2959	c.2815C>T	c.(2815-2817)CGC>TGC	p.R939C	KIF27_uc010mpw.2_Missense_Mutation_p.R873C|KIF27_uc010mpx.2_Intron	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27	939	Potential.				cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						AATTCTTGGCGTTGGTTCAGA	0.373													45	95	---	---	---	---	capture	Missense_Mutation	SNP	86482718	86482718	KIF27	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8218	1
KLHL13	90293	broad.mit.edu	37	X	117035907	117035907	+	Missense_Mutation	SNP	T	C	C	rs148032932		TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117035907T>C	uc004eql.2	-	6	1431	c.1369A>G	c.(1369-1371)ACA>GCA	p.T457A	KLHL13_uc004eqk.2_Missense_Mutation_p.T406A|KLHL13_uc011mtn.1_Missense_Mutation_p.T297A|KLHL13_uc011mto.1_Missense_Mutation_p.T451A|KLHL13_uc011mtp.1_Missense_Mutation_p.T459A|KLHL13_uc004eqm.2_Missense_Mutation_p.T406A|KLHL13_uc011mtq.1_Missense_Mutation_p.T441A	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	457	Kelch 3.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						CATTCTACTGTGGCTGTTAAA	0.323													6	46	---	---	---	---	capture	Missense_Mutation	SNP	117035907	117035907	KLHL13	23	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	8289	1
AASS	10157	broad.mit.edu	37	7	121717919	121717920	+	Frame_Shift_Ins	INS	-	G	G	rs147476318	by1000genomes	TCGA-02-0003-01	TCGA-02-0003-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:121717919_121717920insG	uc003vka.2	-	22	2730_2731	c.2634_2635insC	c.(2632-2637)ACCGCCfs	p.T878fs	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Frame_Shift_Ins_p.T878fs|AASS_uc011knw.1_Frame_Shift_Ins_p.T366fs	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	878_879	Saccharopine dehydrogenase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)	GCTGCCATGGCGGTGGGTAACC	0.460													12	688	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	121717919	121717920	AASS	7	-	G	G	G	1	0	1	1	0	0	0	0	0	351	27	5	5	24	1
