Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NKAIN1	79570	broad.mit.edu	37	1	31658176	31658176	+	Splice_Site	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31658176T>C	uc010ogd.1	-	3	199	c.193_splice	c.e3-1	p.Y65_splice	NKAIN1_uc001bsn.2_Splice_Site_p.Y21_splice|NKAIN1_uc010ogc.1_Intron	NM_024522	NP_078798	Q4KMZ8	NKAI1_HUMAN	Na+/K+ transporting ATPase interacting 1							integral to membrane|plasma membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|Breast(348;0.141)|all_neural(195;0.146)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0184)|READ - Rectum adenocarcinoma(331;0.148)		GGCTGCATACTGGGGAAAGCA	0.587													4	14	---	---	---	---	capture	Splice_Site	SNP	31658176	31658176	NKAIN1	1	T	C	C	C	1	0	0	0	0	0	0	1	0	715	55	5	3	10342	5
KCNA2	3737	broad.mit.edu	37	1	111146955	111146955	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:111146955C>A	uc001dzu.2	-	2	946	c.450G>T	c.(448-450)TGG>TGT	p.W150C	KCNA2_uc009wfv.1_Missense_Mutation_p.W150C|KCNA2_uc009wfw.2_Missense_Mutation_p.W150C	NM_004974	NP_004965	P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related	150						juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(1)	1		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)		CAAAGAGAAGCCACACTTGTC	0.473													21	57	---	---	---	---	capture	Missense_Mutation	SNP	111146955	111146955	KCNA2	1	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	7925	5
RYR2	6262	broad.mit.edu	37	1	237604722	237604722	+	Missense_Mutation	SNP	T	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237604722T>A	uc001hyl.1	+	13	1229	c.1109T>A	c.(1108-1110)CTA>CAA	p.L370Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	370	Cytoplasmic (By similarity).|MIR 5.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GACACAGGCCTATGGCTTACT	0.373													39	117	---	---	---	---	capture	Missense_Mutation	SNP	237604722	237604722	RYR2	1	T	A	A	A	1	0	0	0	0	1	0	0	0	689	53	4	4	13661	5
STAM	8027	broad.mit.edu	37	10	17735226	17735226	+	Silent	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:17735226A>G	uc001ipj.1	+	6	666	c.450A>G	c.(448-450)GCA>GCG	p.A150A	STAM_uc010qcf.1_Silent_p.A39A|STAM_uc009xjw.1_5'Flank	NM_003473	NP_003464	Q92783	STAM1_HUMAN	signal transducing adaptor molecule 1	150					cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	SH3/SH2 adaptor activity			large_intestine(1)|ovary(1)	2						GTTAGGCTGCAGAACAAGCAA	0.408													98	89	---	---	---	---	capture	Silent	SNP	17735226	17735226	STAM	10	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	15138	5
NEBL	10529	broad.mit.edu	37	10	21461321	21461321	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21461321T>C	uc001iqk.2	-	2	509	c.155A>G	c.(154-156)TAT>TGT	p.Y52C		NM_213569	NP_998734	O76041	NEBL_HUMAN	nebulette non-muscle isoform	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CGCATTACAATAGGGCTTCTT	0.438													38	45	---	---	---	---	capture	Missense_Mutation	SNP	21461321	21461321	NEBL	10	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	10210	5
SVIL	6840	broad.mit.edu	37	10	29839574	29839574	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:29839574C>T	uc001iut.1	-	6	1532	c.779G>A	c.(778-780)CGG>CAG	p.R260Q	SVIL_uc001iuu.1_Missense_Mutation_p.R260Q|SVIL_uc009xld.1_Missense_Mutation_p.R260Q	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	260					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				GGAGGGGCTCCGGGAGGCTGC	0.612													25	26	---	---	---	---	capture	Missense_Mutation	SNP	29839574	29839574	SVIL	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15309	5
KIAA1462	57608	broad.mit.edu	37	10	30315760	30315760	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:30315760G>A	uc001iux.2	-	2	3376	c.3317C>T	c.(3316-3318)GCG>GTG	p.A1106V	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.A968V|KIAA1462_uc009xle.1_Missense_Mutation_p.A1106V	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	1106										ovary(4)	4						GTTCTGTCCCGCTCTCCGGAT	0.637													71	66	---	---	---	---	capture	Missense_Mutation	SNP	30315760	30315760	KIAA1462	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8156	5
PTEN	5728	broad.mit.edu	37	10	89717672	89717672	+	Nonsense_Mutation	SNP	C	T	T	rs121909219		TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717672C>T	uc001kfb.2	+	8	1728	c.697C>T	c.(697-699)CGA>TGA	p.R233*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	233	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R233*(61)|p.R233fs*10(4)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R233fs*12(1)|p.R233fs*20(1)|p.R233fs*25(1)|p.R233fs*23(1)|p.R233R(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGACCCACACGACGGGAAGA	0.423	R233*(JHUEM1_ENDOMETRIUM)|R233*(SW1783_CENTRAL_NERVOUS_SYSTEM)|R233*(NCIH1155_LUNG)|R233*(SF295_CENTRAL_NERVOUS_SYSTEM)|R233*(HEC59_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			98	97	---	---	---	---	capture	Nonsense_Mutation	SNP	89717672	89717672	PTEN	10	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	12633	5
ANO3	63982	broad.mit.edu	37	11	26569054	26569054	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:26569054G>A	uc001mqt.3	+	12	1391	c.1246G>A	c.(1246-1248)GTT>ATT	p.V416I	ANO3_uc010rdr.1_Missense_Mutation_p.V400I|ANO3_uc010rds.1_Missense_Mutation_p.V255I|ANO3_uc010rdt.1_Missense_Mutation_p.V270I	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	416	Helical; (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TGGTTTGTGCGTTTTCTTCTA	0.373													92	262	---	---	---	---	capture	Missense_Mutation	SNP	26569054	26569054	ANO3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	692	5
OR5D13	390142	broad.mit.edu	37	11	55541619	55541619	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55541619C>T	uc010ril.1	+	1	706	c.706C>T	c.(706-708)CGC>TGC	p.R236C		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				TGCAAGTGGGCGCCAGAAAAC	0.408													53	135	---	---	---	---	capture	Missense_Mutation	SNP	55541619	55541619	OR5D13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11058	5
OR10V1	390201	broad.mit.edu	37	11	59481032	59481032	+	Missense_Mutation	SNP	G	A	A	rs144835634		TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59481032G>A	uc001nof.1	-	1	287	c.287C>T	c.(286-288)ACG>ATG	p.T96M		NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCCACATCCCGTGATGGAAAC	0.473													12	34	---	---	---	---	capture	Missense_Mutation	SNP	59481032	59481032	OR10V1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10824	5
CAPN1	823	broad.mit.edu	37	11	64953733	64953733	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64953733G>A	uc009yqd.1	+	6	794	c.683G>A	c.(682-684)CGC>CAC	p.R228H	CAPN1_uc001odf.1_Missense_Mutation_p.R228H|CAPN1_uc001odg.1_Missense_Mutation_p.R228H|CAPN1_uc010roa.1_5'UTR	NM_005186	NP_005177	P07384	CAN1_HUMAN	calpain 1, large subunit	228	Calpain catalytic.				positive regulation of cell proliferation|proteolysis	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		TACGAGTTGCGCAAGGCTCCC	0.637													6	16	---	---	---	---	capture	Missense_Mutation	SNP	64953733	64953733	CAPN1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2598	5
TMEM123	114908	broad.mit.edu	37	11	102272678	102272678	+	Silent	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102272678A>G	uc001pha.2	-	3	838	c.417T>C	c.(415-417)AGT>AGC	p.S139S	TMEM123_uc009yxc.2_Silent_p.S120S	NM_052932	NP_443164	Q8N131	PORIM_HUMAN	transmembrane protein 123 precursor	139	Thr-rich.|Extracellular (Potential).				oncosis	external side of plasma membrane|integral to membrane	receptor activity			breast(2)	2	all_cancers(8;0.00027)|all_epithelial(12;0.0021)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0314)|Lung(13;0.109)|all cancers(10;0.12)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0149)		ATGTCACTGAACTATTGTGGG	0.363													4	297	---	---	---	---	capture	Silent	SNP	102272678	102272678	TMEM123	11	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	15921	5
RAPGEF3	10411	broad.mit.edu	37	12	48143197	48143197	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48143197C>A	uc009zkp.2	-	9	1331	c.891G>T	c.(889-891)AAG>AAT	p.K297N	RAPGEF3_uc010sln.1_5'Flank|RAPGEF3_uc001rpy.2_5'Flank|RAPGEF3_uc009zkq.2_Missense_Mutation_p.K297N|RAPGEF3_uc001rpz.3_Missense_Mutation_p.K339N|RAPGEF3_uc001rqa.2_5'Flank|RAPGEF3_uc009zkr.2_RNA|RAPGEF3_uc009zks.2_Missense_Mutation_p.K351N|RAPGEF3_uc001rqb.3_Missense_Mutation_p.K339N	NM_001098532	NP_001092002	A8K2G5	A8K2G5_HUMAN	Rap guanine nucleotide exchange factor 3 isoform	297					regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex	cAMP-dependent protein kinase regulator activity|guanyl-nucleotide exchange factor activity			lung(2)|skin(1)|pancreas(1)	4	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		TGAAGTCCTGCTTGTCCACAC	0.562													20	123	---	---	---	---	capture	Missense_Mutation	SNP	48143197	48143197	RAPGEF3	12	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	12940	5
SRRM4	84530	broad.mit.edu	37	12	119588965	119588965	+	Missense_Mutation	SNP	C	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:119588965C>G	uc001txa.1	+	10	1512	c.1220C>G	c.(1219-1221)TCC>TGC	p.S407C		NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein	407	Ser-rich.				cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						TCGTCCCGATCCCCAAATCCC	0.572													20	72	---	---	---	---	capture	Missense_Mutation	SNP	119588965	119588965	SRRM4	12	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	15063	5
RIMBP2	23504	broad.mit.edu	37	12	130898833	130898833	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130898833C>T	uc001uil.2	-	14	2653	c.2489G>A	c.(2488-2490)CGC>CAC	p.R830H		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	830						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TGGAGAAAGGCGGTCTCGCCC	0.572													21	65	---	---	---	---	capture	Missense_Mutation	SNP	130898833	130898833	RIMBP2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13255	5
FGF14	2259	broad.mit.edu	37	13	102375254	102375254	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:102375254G>A	uc001vpe.2	-	5	671	c.671C>T	c.(670-672)ACG>ATG	p.T224M	FGF14_uc001vpf.2_Missense_Mutation_p.T229M|FGF14_uc001vpd.1_5'Flank	NM_004115	NP_004106	Q92915	FGF14_HUMAN	fibroblast growth factor 14 isoform 1A	224					cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTACTTGGCGTCACCCCAGG	0.473													28	90	---	---	---	---	capture	Missense_Mutation	SNP	102375254	102375254	FGF14	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5789	5
C14orf39	317761	broad.mit.edu	37	14	60951623	60951623	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:60951623C>T	uc001xez.3	-	3	192	c.82G>A	c.(82-84)GAA>AAA	p.E28K	C14orf39_uc010apo.2_5'UTR	NM_174978	NP_777638	Q08AQ4	Q08AQ4_HUMAN	hypothetical protein LOC317761	28										ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		ATCATCTCTTCTTTAGTACTT	0.264													33	76	---	---	---	---	capture	Missense_Mutation	SNP	60951623	60951623	C14orf39	14	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	1758	5
DLK1	8788	broad.mit.edu	37	14	101201218	101201218	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:101201218C>T	uc001yhs.3	+	5	1290	c.1137C>T	c.(1135-1137)GGC>GGT	p.G379G	DLK1_uc001yhu.3_Silent_p.G306G	NM_003836	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog precursor	379	Cytoplasmic (Potential).				multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)|breast(1)|skin(1)	4		Melanoma(154;0.155)				AGGAGGCCGGCGACGAGGAGA	0.552													27	124	---	---	---	---	capture	Silent	SNP	101201218	101201218	DLK1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4522	5
TDRD9	122402	broad.mit.edu	37	14	104508512	104508512	+	Missense_Mutation	SNP	A	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:104508512A>C	uc001yom.3	+	34	3992	c.3962A>C	c.(3961-3963)CAG>CCG	p.Q1321P	TDRD9_uc001yon.3_Missense_Mutation_p.Q868P	NM_153046	NP_694591	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	1321					cell differentiation|DNA methylation involved in gamete generation|fertilization|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	nucleus|piP-body	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ATTGCCCGTCAGAAGCTTTTA	0.478													19	55	---	---	---	---	capture	Missense_Mutation	SNP	104508512	104508512	TDRD9	14	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	15621	5
TGM5	9333	broad.mit.edu	37	15	43552356	43552356	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43552356C>T	uc001zrd.1	-	3	338	c.330G>A	c.(328-330)GCG>GCA	p.A110A	TGM5_uc001zre.1_Intron	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	110					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GACCCACGGCCGCCGTGGGAG	0.617													29	70	---	---	---	---	capture	Silent	SNP	43552356	43552356	TGM5	15	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15718	5
DET1	55070	broad.mit.edu	37	15	89056199	89056199	+	Nonsense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89056199G>A	uc002bmr.2	-	5	1788	c.1636C>T	c.(1636-1638)CGA>TGA	p.R546*	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Nonsense_Mutation_p.R557*	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	546						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CAGCAGTGTCGCATATGGAAG	0.498													4	65	---	---	---	---	capture	Nonsense_Mutation	SNP	89056199	89056199	DET1	15	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	4408	5
DET1	55070	broad.mit.edu	37	15	89073948	89073948	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89073948C>T	uc002bmr.2	-	2	1141	c.989G>A	c.(988-990)CGA>CAA	p.R330Q	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Missense_Mutation_p.R341Q	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	330						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TTTCCACATTCGCAGCTGCCG	0.493													7	26	---	---	---	---	capture	Missense_Mutation	SNP	89073948	89073948	DET1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	4408	5
ITGAX	3687	broad.mit.edu	37	16	31368588	31368588	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31368588C>T	uc002ebu.1	+	5	400	c.333C>T	c.(331-333)ACC>ACT	p.T111T	ITGAX_uc010cao.1_3'UTR|ITGAX_uc002ebt.2_Silent_p.T111T	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	111	FG-GAP 2.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GCGGCCCCACCGTGCACCACG	0.687													4	18	---	---	---	---	capture	Silent	SNP	31368588	31368588	ITGAX	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7812	5
CCDC135	84229	broad.mit.edu	37	16	57760043	57760043	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:57760043G>A	uc002emi.2	+	13	1911	c.1822G>A	c.(1822-1824)GTG>ATG	p.V608M	CCDC135_uc002emj.2_Missense_Mutation_p.V608M|CCDC135_uc002emk.2_Missense_Mutation_p.V543M	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135	608						cytoplasm				central_nervous_system(1)	1						GGCAGAGCGCGTGTTTCTGGT	0.627													11	40	---	---	---	---	capture	Missense_Mutation	SNP	57760043	57760043	CCDC135	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2743	5
DLG4	1742	broad.mit.edu	37	17	7121951	7121951	+	Missense_Mutation	SNP	C	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7121951C>G	uc002get.3	-	2	1228	c.27G>C	c.(25-27)AGG>AGC	p.R9S	DLG4_uc010cly.2_5'Flank|DLG4_uc010vto.1_Missense_Mutation_p.R9S|DLG4_uc002geu.2_5'Flank|ACADVL_uc010vtp.1_Intron|ACADVL_uc010vtq.1_5'Flank|ACADVL_uc002gev.2_5'Flank|ACADVL_uc002gew.2_5'Flank|ACADVL_uc002gex.2_5'Flank	NM_001365	NP_001356	P78352	DLG4_HUMAN	post-synaptic density protein 95 isoform 1	Error:Variant_position_missing_in_P78352_after_alignment					axon guidance|learning|protein complex assembly|protein localization to synapse|signal transduction|synaptic transmission	cell junction|cortical cytoskeleton|endocytic vesicle membrane|neuron spine|postsynaptic density|postsynaptic membrane|synaptosome	protein binding|protein C-terminus binding			ovary(1)|breast(1)	2						AGAGGGCTGACCTGGGAGCTA	0.592													3	5	---	---	---	---	capture	Missense_Mutation	SNP	7121951	7121951	DLG4	17	C	G	G	G	1	0	0	0	0	1	0	0	0	233	18	4	4	4515	5
C17orf102	400591	broad.mit.edu	37	17	32905952	32905952	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:32905952G>T	uc002hie.1	-	1	437	c.348C>A	c.(346-348)AAC>AAA	p.N116K	TMEM132E_uc002hif.2_5'Flank	NM_207454	NP_997337	A2RUQ5	CQ102_HUMAN	hypothetical protein LOC400591	116										ovary(1)	1						GAATAAATAGGTTTCCCACAG	0.607													5	308	---	---	---	---	capture	Missense_Mutation	SNP	32905952	32905952	C17orf102	17	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	1834	5
C17orf71	55181	broad.mit.edu	37	17	57292254	57292254	+	Missense_Mutation	SNP	T	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57292254T>G	uc002ixi.2	+	4	2909	c.2867T>G	c.(2866-2868)TTT>TGT	p.F956C		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	956					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					GTTTTGAGATTTCCTTATGCA	0.473													41	119	---	---	---	---	capture	Missense_Mutation	SNP	57292254	57292254	C17orf71	17	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	1863	5
CTAGE1	64693	broad.mit.edu	37	18	19995570	19995570	+	Missense_Mutation	SNP	T	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19995570T>A	uc002ktv.1	-	1	2309	c.2205A>T	c.(2203-2205)AGA>AGT	p.R735S		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	735	Pro-rich.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					AAAATGCAGGTCTTGGGGGAC	0.483													12	35	---	---	---	---	capture	Missense_Mutation	SNP	19995570	19995570	CTAGE1	18	T	A	A	A	1	0	0	0	0	1	0	0	0	751	58	4	4	3957	5
TCEB3B	51224	broad.mit.edu	37	18	44560403	44560403	+	Silent	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44560403T>C	uc002lcr.1	-	1	1586	c.1233A>G	c.(1231-1233)CAA>CAG	p.Q411Q	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	411					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						TTGCTTTCCTTTGTTTATCTC	0.502													48	169	---	---	---	---	capture	Silent	SNP	44560403	44560403	TCEB3B	18	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	15569	5
TNFRSF11A	8792	broad.mit.edu	37	18	60025550	60025550	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60025550C>T	uc002lin.2	+	5	535	c.497C>T	c.(496-498)ACG>ATG	p.T166M	TNFRSF11A_uc010dpv.2_Missense_Mutation_p.T166M	NM_003839	NP_003830	Q9Y6Q6	TNR11_HUMAN	tumor necrosis factor receptor superfamily,	166	TNFR-Cys 4.|Extracellular (Potential).				adaptive immune response|cell-cell signaling|circadian temperature homeostasis|monocyte chemotaxis|osteoclast differentiation|positive regulation of cell proliferation|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling|positive regulation of fever generation by positive regulation of prostaglandin secretion|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|response to interleukin-1|response to lipopolysaccharide	external side of plasma membrane|integral to membrane	metal ion binding|tumor necrosis factor receptor activity			breast(2)|lung(1)	3		Colorectal(73;0.188)				TTTTCCTCCACGGACAAATGC	0.448									Paget_Disease_of_Bone				54	152	---	---	---	---	capture	Missense_Mutation	SNP	60025550	60025550	TNFRSF11A	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16167	5
TJP3	27134	broad.mit.edu	37	19	3730053	3730053	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3730053C>T	uc010xhv.1	+	3	243	c.243C>T	c.(241-243)AAC>AAT	p.N81N	TJP3_uc010xhs.1_Silent_p.N62N|TJP3_uc010xht.1_Silent_p.N26N|TJP3_uc010xhu.1_Silent_p.N71N|TJP3_uc010xhw.1_Silent_p.N81N	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	62	PDZ 1.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		TCATGGTGAACGGGGTTTCCA	0.597													52	153	---	---	---	---	capture	Silent	SNP	3730053	3730053	TJP3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15816	5
MATK	4145	broad.mit.edu	37	19	3783147	3783147	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3783147G>A	uc002lyt.2	-	7	1053	c.653C>T	c.(652-654)TCG>TTG	p.S218L	MATK_uc002lyv.2_Missense_Mutation_p.S219L|MATK_uc002lyu.2_Missense_Mutation_p.S177L|MATK_uc010dtq.2_Missense_Mutation_p.S218L	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform	218					cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCTCGGCCGACTTGGTCCC	0.657													20	87	---	---	---	---	capture	Missense_Mutation	SNP	3783147	3783147	MATK	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9245	5
TMEM146	257062	broad.mit.edu	37	19	5757927	5757927	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5757927A>G	uc002mda.2	+	14	1413	c.1352A>G	c.(1351-1353)AAC>AGC	p.N451S	TMEM146_uc010duj.1_Missense_Mutation_p.N109S	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	451	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						TCAGATGGGAACACCAAGTAC	0.567													10	33	---	---	---	---	capture	Missense_Mutation	SNP	5757927	5757927	TMEM146	19	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	15944	5
NPHS1	4868	broad.mit.edu	37	19	36340038	36340038	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36340038C>T	uc002oby.2	-	8	852	c.852G>A	c.(850-852)CCG>CCA	p.P284P		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	284	Ig-like C2-type 3.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGTGGACACCGGCTGGCCAT	0.677													14	45	---	---	---	---	capture	Silent	SNP	36340038	36340038	NPHS1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10489	5
ZNF526	116115	broad.mit.edu	37	19	42730344	42730344	+	Missense_Mutation	SNP	C	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42730344C>G	uc002osz.1	+	3	1945	c.1789C>G	c.(1789-1791)CGA>GGA	p.R597G		NM_133444	NP_597701	Q8TF50	ZN526_HUMAN	zinc finger protein 526	597					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0704)				GGTCCATGCCCGAGCTCGGAC	0.612													17	52	---	---	---	---	capture	Missense_Mutation	SNP	42730344	42730344	ZNF526	19	C	G	G	G	1	0	0	0	0	1	0	0	0	295	23	4	4	17846	5
ZNF606	80095	broad.mit.edu	37	19	58490980	58490980	+	Missense_Mutation	SNP	G	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58490980G>C	uc002qqw.2	-	7	1686	c.1068C>G	c.(1066-1068)TTC>TTG	p.F356L	ZNF606_uc010yhp.1_Missense_Mutation_p.F266L	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	356					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TAAAGGATGAGAAATAAAAGA	0.333													47	165	---	---	---	---	capture	Missense_Mutation	SNP	58490980	58490980	ZNF606	19	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	17910	5
TPO	7173	broad.mit.edu	37	2	1488428	1488428	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1488428G>A	uc002qww.2	+	9	1490	c.1399G>A	c.(1399-1401)GTG>ATG	p.V467M	TPO_uc010ewj.2_RNA|TPO_uc002qwu.2_Missense_Mutation_p.V467M|TPO_uc002qwr.2_Missense_Mutation_p.V467M|TPO_uc002qwx.2_Missense_Mutation_p.V467M|TPO_uc010yio.1_Missense_Mutation_p.V294M|TPO_uc010yip.1_Missense_Mutation_p.V467M|TPO_uc002qwy.1_Translation_Start_Site|TPO_uc002qwz.2_RNA	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	467	Extracellular (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CCAGCAGTACGTGGGTCCCTA	0.587													19	57	---	---	---	---	capture	Missense_Mutation	SNP	1488428	1488428	TPO	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16293	5
EMILIN1	11117	broad.mit.edu	37	2	27303034	27303034	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27303034C>T	uc002rii.3	+	2	614	c.186C>T	c.(184-186)TAC>TAT	p.Y62Y	EMILIN1_uc010eyq.1_Silent_p.Y62Y	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	62	EMI.				cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGTGCCTACGTGGTGACCC	0.592													37	110	---	---	---	---	capture	Silent	SNP	27303034	27303034	EMILIN1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5048	5
PSME4	23198	broad.mit.edu	37	2	54094006	54094006	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:54094006G>A	uc002rxp.2	-	45	5331	c.5275C>T	c.(5275-5277)CGC>TGC	p.R1759C	PSME4_uc010yop.1_Missense_Mutation_p.R1649C|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.R1134C|PSME4_uc010fbv.1_Missense_Mutation_p.R903C|PSME4_uc010fbt.1_Missense_Mutation_p.R194C	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	1759					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CCAGCATGGCGTTTGACCAAC	0.418													18	46	---	---	---	---	capture	Missense_Mutation	SNP	54094006	54094006	PSME4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12604	5
IL1R2	7850	broad.mit.edu	37	2	102638708	102638708	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102638708C>T	uc002tbm.2	+	6	977	c.748C>T	c.(748-750)CTG>TTG	p.L250L	IL1R2_uc002tbn.2_Silent_p.L250L|IL1R2_uc002tbo.1_Silent_p.L250L	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	250	Extracellular (Potential).|Ig-like C2-type 3.				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	ATCAGCTTCTCTGGGTAAGGC	0.507													21	232	---	---	---	---	capture	Silent	SNP	102638708	102638708	IL1R2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	7582	5
SLC5A7	60482	broad.mit.edu	37	2	108609520	108609520	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108609520C>A	uc002tdv.2	+	4	661	c.385C>A	c.(385-387)CTC>ATC	p.L129I	SLC5A7_uc010ywm.1_5'UTR|SLC5A7_uc010fjj.2_Missense_Mutation_p.L129I|SLC5A7_uc010ywn.1_Missense_Mutation_p.L16I	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	129	Helical; (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity	p.L129L(1)		ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	CATGGGCGGACTCCTGTTTAT	0.453													8	151	---	---	---	---	capture	Missense_Mutation	SNP	108609520	108609520	SLC5A7	2	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	14562	5
STAM2	10254	broad.mit.edu	37	2	153003822	153003822	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:153003822C>T	uc002tyc.3	-	5	651	c.301G>A	c.(301-303)GCA>ACA	p.A101T	STAM2_uc010foa.1_Missense_Mutation_p.A101T|STAM2_uc002tyd.2_Missense_Mutation_p.A101T	NM_005843	NP_005834	O75886	STAM2_HUMAN	signal transducing adaptor molecule 2	101	VHS.				cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)		TTAGGATGTGCCTTTTAAGGA	0.299													30	99	---	---	---	---	capture	Missense_Mutation	SNP	153003822	153003822	STAM2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15139	5
NHEJ1	79840	broad.mit.edu	37	2	220012493	220012493	+	Silent	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220012493G>A	uc002vjp.3	-	4	561	c.415C>T	c.(415-417)CTG>TTG	p.L139L	NHEJ1_uc002vjq.3_RNA	NM_024782	NP_079058	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1	139					B cell differentiation|central nervous system development|DNA recombination|double-strand break repair via nonhomologous end joining|positive regulation of ligase activity|response to ionizing radiation|T cell differentiation	nonhomologous end joining complex|nucleus	DNA binding|identical protein binding			lung(1)	1		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		ATGCCCATCAGAGGACGAATC	0.433								Direct_reversal_of_damage|NHEJ					3	108	---	---	---	---	capture	Silent	SNP	220012493	220012493	NHEJ1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	10309	5
PLCB4	5332	broad.mit.edu	37	20	9417712	9417712	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:9417712G>A	uc002wnf.2	+	28	2777	c.2641G>A	c.(2641-2643)GCC>ACC	p.A881T	PLCB4_uc010gbw.1_Missense_Mutation_p.A881T|PLCB4_uc010gbx.2_Missense_Mutation_p.A893T|PLCB4_uc002wne.2_Missense_Mutation_p.A881T|PLCB4_uc002wnh.2_Missense_Mutation_p.A728T	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	881					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						GGCCAACACCGCCAAAGCAAA	0.512													3	44	---	---	---	---	capture	Missense_Mutation	SNP	9417712	9417712	PLCB4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11933	5
KIF16B	55614	broad.mit.edu	37	20	16506810	16506810	+	Missense_Mutation	SNP	G	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16506810G>C	uc002wpg.1	-	3	316	c.158C>G	c.(157-159)ACC>AGC	p.T53S	KIF16B_uc010gch.1_Missense_Mutation_p.T53S|KIF16B_uc010gci.1_Missense_Mutation_p.T53S|KIF16B_uc010gcj.1_Missense_Mutation_p.T53S	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	53	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						GAAGGTCTTGGTCCGTTCTCT	0.353													6	244	---	---	---	---	capture	Missense_Mutation	SNP	16506810	16506810	KIF16B	20	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	8200	5
SSTR4	6754	broad.mit.edu	37	20	23016581	23016581	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23016581C>T	uc002wsr.2	+	1	525	c.461C>T	c.(460-462)GCG>GTG	p.A154V		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	154	Cytoplasmic (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CCTCTGCGCGCGGCGACCTAC	0.662													17	58	---	---	---	---	capture	Missense_Mutation	SNP	23016581	23016581	SSTR4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15092	5
BPIL1	80341	broad.mit.edu	37	20	31606072	31606072	+	Missense_Mutation	SNP	C	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31606072C>G	uc002wyj.2	+	8	779	c.585C>G	c.(583-585)AAC>AAG	p.N195K		NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN	bactericidal/permeability-increasing	195						extracellular region	lipid binding			skin(2)|large_intestine(1)|ovary(1)	4						AAGGCCTCAACCCCGTGGGTC	0.473													23	92	---	---	---	---	capture	Missense_Mutation	SNP	31606072	31606072	BPIL1	20	C	G	G	G	1	0	0	0	0	1	0	0	0	233	18	4	4	1479	5
PPP1R16B	26051	broad.mit.edu	37	20	37534721	37534721	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37534721C>T	uc002xje.2	+	7	995	c.806C>T	c.(805-807)GCT>GTT	p.A269V	PPP1R16B_uc010ggc.2_Intron	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	269	ANK 4.				regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				CTGCATGCAGCTGCCTTCTGG	0.607													20	57	---	---	---	---	capture	Missense_Mutation	SNP	37534721	37534721	PPP1R16B	20	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	12267	5
MX2	4600	broad.mit.edu	37	21	42773954	42773954	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42773954A>G	uc002yzf.1	+	11	1576	c.1472A>G	c.(1471-1473)GAG>GGG	p.E491G	MX2_uc002yzg.1_Missense_Mutation_p.E214G|MX2_uc010gop.1_5'UTR	NM_002463	NP_002454	P20592	MX2_HUMAN	myxovirus resistance protein 2	491					response to virus|type I interferon-mediated signaling pathway	cytoplasm|nucleus	GTP binding|GTPase activity			ovary(2)	2		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CGAGGCAAGGAGCTTCTGGGA	0.433													32	144	---	---	---	---	capture	Missense_Mutation	SNP	42773954	42773954	MX2	21	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	9908	5
XYLB	9942	broad.mit.edu	37	3	38411555	38411555	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38411555A>G	uc003cic.2	+	9	764	c.655A>G	c.(655-657)ATG>GTG	p.M219V	XYLB_uc011ayp.1_Missense_Mutation_p.M82V|XYLB_uc003cid.1_Missense_Mutation_p.M141V	NM_005108	NP_005099	O75191	XYLB_HUMAN	xylulokinase	219					D-xylose metabolic process|generation of precursor metabolites and energy|xylulose catabolic process		ATP binding|xylulokinase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		AGGTTCTGGAATGAATTTGTT	0.443													73	346	---	---	---	---	capture	Missense_Mutation	SNP	38411555	38411555	XYLB	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	17343	5
CD96	10225	broad.mit.edu	37	3	111264248	111264248	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111264248C>T	uc003dxw.2	+	2	587	c.417C>T	c.(415-417)CAC>CAT	p.H139H	CD96_uc003dxv.2_Silent_p.H139H|CD96_uc003dxx.2_Silent_p.H139H|CD96_uc010hpy.1_Silent_p.H139H	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	139	Extracellular (Potential).				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						TTCAGACACACGGTAAGCATA	0.418									Opitz_Trigonocephaly_syndrome				19	53	---	---	---	---	capture	Silent	SNP	111264248	111264248	CD96	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3019	5
DOK7	285489	broad.mit.edu	37	4	3478126	3478126	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:3478126C>A	uc003ghd.2	+	4	459	c.389C>A	c.(388-390)ACC>AAC	p.T130N	DOK7_uc003ghe.2_5'UTR	NM_173660	NP_775931	Q18PE1	DOK7_HUMAN	downstream of tyrosine kinase 7 isoform 1	130	IRS-type PTB.				positive regulation of protein tyrosine kinase activity	cell junction|synapse	insulin receptor binding|protein kinase binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GGCCCGGCTACCCTGCACCTC	0.512													6	85	---	---	---	---	capture	Missense_Mutation	SNP	3478126	3478126	DOK7	4	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	4658	5
GABRA4	2557	broad.mit.edu	37	4	46967126	46967126	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46967126G>A	uc003gxg.2	-	8	1134	c.995C>T	c.(994-996)TCG>TTG	p.S332L		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	332	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GATAAGGGCCGAAAATACAAA	0.458													36	104	---	---	---	---	capture	Missense_Mutation	SNP	46967126	46967126	GABRA4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6105	5
NUP54	53371	broad.mit.edu	37	4	77065621	77065621	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77065621A>G	uc003hjs.2	-	2	201	c.73T>C	c.(73-75)TTT>CTT	p.F25L	NUP54_uc010ije.2_5'UTR|NUP54_uc011cbs.1_5'UTR|NUP54_uc011cbt.1_Missense_Mutation_p.F25L|NUP54_uc003hjt.2_5'UTR	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	25	Gly-rich.|2.|9 X 2 AA repeats of F-G.			AGGF -> GWV (in Ref. 1; AAF67488).	carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						AATCCTCCAAACCCACCTAAT	0.333													3	124	---	---	---	---	capture	Missense_Mutation	SNP	77065621	77065621	NUP54	4	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	10674	5
ARHGAP24	83478	broad.mit.edu	37	4	86916597	86916597	+	Missense_Mutation	SNP	C	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:86916597C>A	uc003hpk.2	+	9	2239	c.1790C>A	c.(1789-1791)CCG>CAG	p.P597Q	ARHGAP24_uc003hpl.2_Missense_Mutation_p.P502Q|ARHGAP24_uc010ikf.2_Missense_Mutation_p.P512Q|ARHGAP24_uc003hpm.2_Missense_Mutation_p.P504Q	NM_001025616	NP_001020787	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24 isoform 1	597					angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell projection|cytoskeleton|cytosol|focal adhesion	GTPase activator activity|protein binding				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		GATGGGCCCCCGCAGGACGAC	0.557													4	139	---	---	---	---	capture	Missense_Mutation	SNP	86916597	86916597	ARHGAP24	4	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	866	5
PDHA2	5161	broad.mit.edu	37	4	96761886	96761886	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:96761886C>T	uc003htr.3	+	1	648	c.585C>T	c.(583-585)GGC>GGT	p.G195G		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	195					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	ATGGGGATGGCGCTGCGAATC	0.473													36	75	---	---	---	---	capture	Silent	SNP	96761886	96761886	PDHA2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11568	5
ADH7	131	broad.mit.edu	37	4	100349053	100349053	+	Silent	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:100349053G>A	uc003huv.1	-	5	576	c.477C>T	c.(475-477)ACC>ACT	p.T159T		NM_000673	NP_000664	P40394	ADH7_HUMAN	class IV alcohol dehydrogenase, mu or sigma	159					ethanol oxidation|fatty acid omega-oxidation|response to bacterium|response to ethanol|xenobiotic metabolic process	cytosol|soluble fraction	alcohol dehydrogenase activity, zinc-dependent|aldehyde oxidase activity|ethanol binding|receptor antagonist activity|retinol binding|retinol dehydrogenase activity			lung(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)	NADH(DB00157)	CTGTGTACTCGGTAAATGTAC	0.458													49	185	---	---	---	---	capture	Silent	SNP	100349053	100349053	ADH7	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	313	5
DCHS2	54798	broad.mit.edu	37	4	155157377	155157377	+	Silent	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155157377T>C	uc003inw.2	-	25	7062	c.7062A>G	c.(7060-7062)GTA>GTG	p.V2354V		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	2354	Cadherin 21.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AACAGGGTGATACAATAGAAT	0.393													3	194	---	---	---	---	capture	Silent	SNP	155157377	155157377	DCHS2	4	T	C	C	C	1	0	0	0	0	0	0	0	1	626	49	3	3	4247	5
CCDC110	256309	broad.mit.edu	37	4	186381079	186381079	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:186381079T>C	uc003ixu.3	-	6	738	c.662A>G	c.(661-663)GAT>GGT	p.D221G	CCDC110_uc003ixv.3_Missense_Mutation_p.D184G|CCDC110_uc011ckt.1_Missense_Mutation_p.D221G	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	221						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TTTGGATTTATCCAGAATTAC	0.323													4	139	---	---	---	---	capture	Missense_Mutation	SNP	186381079	186381079	CCDC110	4	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	2721	5
WDR70	55100	broad.mit.edu	37	5	37480065	37480065	+	Nonsense_Mutation	SNP	T	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37480065T>G	uc003jkv.2	+	8	874	c.816T>G	c.(814-816)TAT>TAG	p.Y272*	WDR70_uc010iva.1_Nonsense_Mutation_p.Y272*	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70	272										ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAGACCAGTATATTGTGGACA	0.328													37	130	---	---	---	---	capture	Nonsense_Mutation	SNP	37480065	37480065	WDR70	5	T	G	G	G	1	0	0	0	0	0	1	0	0	634	49	5	4	17202	5
C5orf34	375444	broad.mit.edu	37	5	43509299	43509299	+	Missense_Mutation	SNP	T	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:43509299T>G	uc003jnz.1	-	3	460	c.143A>C	c.(142-144)GAA>GCA	p.E48A	C5orf34_uc011cpx.1_Intron	NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	48										breast(1)	1	Lung NSC(6;2.07e-05)					TTCTGGTTGTTCTAAAGGATG	0.328													3	168	---	---	---	---	capture	Missense_Mutation	SNP	43509299	43509299	C5orf34	5	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	2271	5
PCDHA10	56139	broad.mit.edu	37	5	140237634	140237634	+	Silent	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140237634G>A	uc003lhx.2	+	1	2001	c.2001G>A	c.(1999-2001)TCG>TCA	p.S667S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc011dad.1_Silent_p.S667S	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	667	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTTGTGTCGCTTGTGGAGG	0.667													8	17	---	---	---	---	capture	Silent	SNP	140237634	140237634	PCDHA10	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11423	5
ERGIC1	57222	broad.mit.edu	37	5	172336690	172336690	+	Missense_Mutation	SNP	A	G	G			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:172336690A>G	uc003mbw.3	+	4	370	c.176A>G	c.(175-177)GAT>GGT	p.D59G	ERGIC1_uc003mby.3_5'UTR|ERGIC1_uc011dfa.1_5'UTR|ERGIC1_uc003mbz.3_Missense_Mutation_p.D14G	NM_001031711	NP_001026881	Q969X5	ERGI1_HUMAN	endoplasmic reticulum-golgi intermediate	59	Lumenal (Potential).				ER to Golgi vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTCTATGTCGATGACCCAGAC	0.542													36	151	---	---	---	---	capture	Missense_Mutation	SNP	172336690	172336690	ERGIC1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	5178	5
KIF13A	63971	broad.mit.edu	37	6	17837205	17837205	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17837205C>T	uc003ncg.3	-	11	1164	c.1059G>A	c.(1057-1059)GTG>GTA	p.V353V	KIF13A_uc003ncf.2_Silent_p.V353V|KIF13A_uc003nch.3_Silent_p.V353V|KIF13A_uc003nci.3_Silent_p.V353V|KIF13A_uc003ncj.2_Silent_p.V29V	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	353					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CAGCATGGTTCACAATCCTTT	0.502													7	537	---	---	---	---	capture	Silent	SNP	17837205	17837205	KIF13A	6	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	8196	5
RFX6	222546	broad.mit.edu	37	6	117215161	117215161	+	Missense_Mutation	SNP	A	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117215161A>C	uc003pxm.2	+	5	641	c.578A>C	c.(577-579)TAT>TCT	p.Y193S		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	193	RFX-type winged-helix.				glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TATCATTACTATGGGATTGGC	0.413													38	129	---	---	---	---	capture	Missense_Mutation	SNP	117215161	117215161	RFX6	6	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	13162	5
SYNJ2	8871	broad.mit.edu	37	6	158483196	158483196	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158483196G>A	uc003qqx.1	+	8	1202	c.1127G>A	c.(1126-1128)CGT>CAT	p.R376H	SYNJ2_uc011efm.1_RNA|SYNJ2_uc003qqw.1_Missense_Mutation_p.R376H|SYNJ2_uc003qqy.1_Missense_Mutation_p.R89H|SYNJ2_uc011efn.1_Missense_Mutation_p.R304H|SYNJ2_uc010kjo.1_Missense_Mutation_p.R325H|SYNJ2_uc003qqz.1_5'UTR	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	376	SAC.						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GTCAGTCCACGGTGAGGCTCG	0.607													38	146	---	---	---	---	capture	Missense_Mutation	SNP	158483196	158483196	SYNJ2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15341	5
IGFBP1	3484	broad.mit.edu	37	7	45932660	45932660	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45932660C>T	uc003tnp.2	+	4	1043	c.750C>T	c.(748-750)AAC>AAT	p.N250N	IGFBP1_uc003tno.3_Silent_p.N248N|IGFBP1_uc010kyn.2_Silent_p.N207N	NM_000596	NP_000587	P08833	IBP1_HUMAN	insulin-like growth factor binding protein 1	250	Thyroglobulin type-1.					extracellular space	insulin-like growth factor binding			lung(1)	1						GAGACCCCAACTGCCAGATAT	0.433													5	150	---	---	---	---	capture	Silent	SNP	45932660	45932660	IGFBP1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	7503	5
CDHR3	222256	broad.mit.edu	37	7	105660972	105660972	+	Missense_Mutation	SNP	C	T	T	rs144905888	by1000genomes	TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:105660972C>T	uc003vdl.3	+	13	1915	c.1807C>T	c.(1807-1809)CGT>TGT	p.R603C	CDHR3_uc003vdk.2_Intron|CDHR3_uc003vdm.3_Missense_Mutation_p.R590C|CDHR3_uc011klt.1_Missense_Mutation_p.R515C|CDHR3_uc003vdn.2_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor	603	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						CAGATCTTTCCGTTATTCCAT	0.498													44	194	---	---	---	---	capture	Missense_Mutation	SNP	105660972	105660972	CDHR3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3091	5
PARP12	64761	broad.mit.edu	37	7	139726106	139726106	+	Silent	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139726106C>T	uc003vvl.1	-	11	2545	c.1671G>A	c.(1669-1671)GTG>GTA	p.V557V	PARP12_uc003vvk.1_Silent_p.V343V|PARP12_uc010lnf.1_RNA	NM_022750	NP_073587	Q9H0J9	PAR12_HUMAN	poly ADP-ribose polymerase 12	557	PARP catalytic.					nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)					GCCGCTCGTCCACGGCCTTCC	0.572													18	104	---	---	---	---	capture	Silent	SNP	139726106	139726106	PARP12	7	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	11360	5
CNTNAP2	26047	broad.mit.edu	37	7	146818164	146818164	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:146818164G>A	uc003weu.1	+	6	1364	c.848G>A	c.(847-849)CGC>CAC	p.R283H		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	283	Laminin G-like 1.|Extracellular (Potential).		R -> C.		behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GTCATTGAGCGCCAGGGGCGG	0.532										HNSCC(39;0.1)			24	112	---	---	---	---	capture	Missense_Mutation	SNP	146818164	146818164	CNTNAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3612	5
MLL3	58508	broad.mit.edu	37	7	151962124	151962124	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151962124T>C	uc003wla.2	-	8	1402	c.1183A>G	c.(1183-1185)AAA>GAA	p.K395E		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	395	PHD-type 2.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AAAACTTACTTGCAGTTCTGG	0.403			N		medulloblastoma								16	521	---	---	---	---	capture	Missense_Mutation	SNP	151962124	151962124	MLL3	7	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	9534	5
NEFM	4741	broad.mit.edu	37	8	24772112	24772112	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24772112C>T	uc003xed.3	+	1	839	c.806C>T	c.(805-807)GCG>GTG	p.A269V	NEFM_uc011lac.1_Missense_Mutation_p.A269V|NEFM_uc010lue.2_5'Flank|uc010luc.1_5'UTR	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	269	Rod.|Coil 2A.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		ATCTCGACGGCGCTGAAGGAA	0.592													19	49	---	---	---	---	capture	Missense_Mutation	SNP	24772112	24772112	NEFM	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10223	5
CA9	768	broad.mit.edu	37	9	35674152	35674152	+	Missense_Mutation	SNP	C	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35674152C>T	uc003zxo.3	+	1	238	c.196C>T	c.(196-198)CCC>TCC	p.P66S	C9orf100_uc003zxl.2_RNA|CA9_uc003zxn.1_RNA|CA9_uc003zxp.3_Missense_Mutation_p.P66S	NM_001216	NP_001207	Q16790	CAH9_HUMAN	carbonic anhydrase IX precursor	66	Extracellular.|Proteoglycan-like (PG).				one-carbon metabolic process	integral to membrane|microvillus membrane|nucleolus	carbonate dehydratase activity|zinc ion binding			ovary(4)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGAGGATCTGCCCAGTGAAGA	0.592													3	59	---	---	---	---	capture	Missense_Mutation	SNP	35674152	35674152	CA9	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2500	5
SPAG8	26206	broad.mit.edu	37	9	35810291	35810291	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35810291G>T	uc003zye.2	-	6	1331	c.1216C>A	c.(1216-1218)CAG>AAG	p.Q406K	SPAG8_uc003zyf.2_Missense_Mutation_p.Q323K|SPAG8_uc003zyg.2_Missense_Mutation_p.Q406K	NM_172312	NP_758516	Q99932	SPAG8_HUMAN	sperm associated antigen 8 isoform 2	406						acrosomal vesicle|membrane				ovary(1)	1	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			GGTTGCTCCTGGCGGTAGTCG	0.607													7	327	---	---	---	---	capture	Missense_Mutation	SNP	35810291	35810291	SPAG8	9	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	14876	5
MELK	9833	broad.mit.edu	37	9	36651764	36651764	+	Missense_Mutation	SNP	G	T	T			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:36651764G>T	uc003zzn.2	+	12	1081	c.943G>T	c.(943-945)GCT>TCT	p.A315S	MELK_uc011lpm.1_Missense_Mutation_p.A184S|MELK_uc011lpn.1_Missense_Mutation_p.A315S|MELK_uc011lpo.1_Missense_Mutation_p.A121S|MELK_uc010mll.2_Missense_Mutation_p.A283S|MELK_uc011lpp.1_Missense_Mutation_p.A267S|MELK_uc010mlm.2_Missense_Mutation_p.A244S|MELK_uc011lpq.1_Missense_Mutation_p.A121S|MELK_uc011lpr.1_Missense_Mutation_p.A244S|MELK_uc011lps.1_Missense_Mutation_p.A235S	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	315						cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TCACCTCACGGCTACCTATCT	0.403													247	227	---	---	---	---	capture	Missense_Mutation	SNP	36651764	36651764	MELK	9	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	9383	5
MAGEB18	286514	broad.mit.edu	37	X	26157158	26157158	+	Missense_Mutation	SNP	G	A	A			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26157158G>A	uc004dbq.1	+	2	243	c.56G>A	c.(55-57)CGT>CAT	p.R19H		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	19							protein binding			central_nervous_system(1)	1						CACCAGGCTCGTTGTGAGAAT	0.532													19	18	---	---	---	---	capture	Missense_Mutation	SNP	26157158	26157158	MAGEB18	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9089	5
CXorf48	54967	broad.mit.edu	37	X	134294392	134294392	+	Missense_Mutation	SNP	T	C	C			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134294392T>C	uc004eyk.1	-	3	1024	c.368A>G	c.(367-369)GAA>GGA	p.E123G	CXorf48_uc004eyl.1_Missense_Mutation_p.E123G	NM_001031705	NP_001026875	Q8WUE5	CX048_HUMAN	hypothetical protein LOC54967 isoform 1	123											0	Acute lymphoblastic leukemia(192;0.000127)					AATATTATCTTCATTTATAGA	0.308													21	7	---	---	---	---	capture	Missense_Mutation	SNP	134294392	134294392	CXorf48	23	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	4071	5
GGNBP2	79893	broad.mit.edu	37	17	34943625	34943625	+	Frame_Shift_Del	DEL	T	-	-			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34943625delT	uc002hnb.2	+	13	2089	c.1840delT	c.(1840-1842)TTGfs	p.L614fs		NM_024835	NP_079111	Q9H3C7	GGNB2_HUMAN	zinc finger protein 403	614					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasmic membrane-bounded vesicle				ovary(2)	2		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TACAGAAACGTTGTTTGGTCC	0.463													8	379	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	34943625	34943625	GGNBP2	17	T	-	-	-	1	0	1	0	1	0	0	0	0	777	60	5	5	6298	5
MALT1	10892	broad.mit.edu	37	18	56400716	56400716	+	Frame_Shift_Del	DEL	A	-	-			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56400716delA	uc002lhm.1	+	11	1568	c.1310delA	c.(1309-1311)GAAfs	p.E437fs	MALT1_uc002lhn.1_Frame_Shift_Del_p.E426fs	NM_006785	NP_006776	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma	437	Caspase-like.				activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4						TATAGGTCTGAAAATTGTCTG	0.348			T	BIRC3	MALT								9	233	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	56400716	56400716	MALT1	18	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	9116	5
NFIX	4784	broad.mit.edu	37	19	13192662	13192662	+	Frame_Shift_Del	DEL	C	-	-			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:13192662delC	uc010xmx.1	+	8	1324	c.1271delC	c.(1270-1272)ACCfs	p.T424fs	NFIX_uc002mwd.2_Frame_Shift_Del_p.T416fs|NFIX_uc002mwe.2_Frame_Shift_Del_p.T408fs|NFIX_uc002mwf.2_Frame_Shift_Del_p.T378fs|NFIX_uc002mwg.1_Frame_Shift_Del_p.T415fs			Q14938	NFIX_HUMAN	RecName: Full=Nuclear factor 1;	416					DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(19;8.2e-22)			GGCCAGGCCACCGGACAGGTG	0.612											OREG0025286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	19	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	13192662	13192662	NFIX	19	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	10281	5
ZNF667	63934	broad.mit.edu	37	19	56953854	56953859	+	In_Frame_Del	DEL	CTTCTC	-	-			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56953854_56953859delCTTCTC	uc002qnd.2	-	5	667_672	c.505_510delGAGAAG	c.(505-510)GAGAAGdel	p.EK169del	ZNF667_uc010etl.2_5'UTR|ZNF667_uc002qne.2_In_Frame_Del_p.EK169del|ZNF667_uc010etm.2_In_Frame_Del_p.EK112del	NM_022103	NP_071386	Q5HYK9	ZN667_HUMAN	zinc finger protein 667	169_170					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		ATTCAAAAGGCTTCTCTCCTGTATGA	0.374													7	219	---	---	---	---	capture_indel	In_Frame_Del	DEL	56953854	56953859	ZNF667	19	CTTCTC	-	-	-	1	0	1	0	1	0	0	0	0	363	28	5	5	17952	5
SH2D3C	10044	broad.mit.edu	37	9	130502108	130502108	+	Frame_Shift_Del	DEL	C	-	-			TCGA-02-2470-01	TCGA-02-2470-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130502108delC	uc004bsc.2	-	11	2402	c.2260delG	c.(2260-2262)GAGfs	p.E754fs	SH2D3C_uc010mxo.2_Frame_Shift_Del_p.E594fs|SH2D3C_uc004bry.2_Frame_Shift_Del_p.E596fs|SH2D3C_uc004brz.3_Frame_Shift_Del_p.E400fs|SH2D3C_uc011mak.1_Frame_Shift_Del_p.E400fs|SH2D3C_uc004bsa.2_Frame_Shift_Del_p.E597fs|SH2D3C_uc004bsb.2_Frame_Shift_Del_p.E686fs	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	754	Ras-GEF.				JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						GAGTCACACTCCAGCAGGGTG	0.657													3	5	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	130502108	130502108	SH2D3C	9	C	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	14127	5
