Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TTC22	55001	broad.mit.edu	37	1	55266546	55266546	+	Silent	SNP	C	T	T	rs35670637		TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55266546C>T	uc009vzt.1	-	1	396	c.291G>A	c.(289-291)CCG>CCA	p.P97P	TTC22_uc001cxz.3_Silent_p.P97P	NM_001114108	NP_001107580	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22 isoform 1	97	TPR 1.						binding				0						TGAGGTTGCCCGGGTGCTCGT	0.687													3	16	---	---	---	---	capture	Silent	SNP	55266546	55266546	TTC22	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16571	9
SPAG17	200162	broad.mit.edu	37	1	118624163	118624163	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118624163C>G	uc001ehk.2	-	14	1933	c.1865G>C	c.(1864-1866)GGG>GCG	p.G622A		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	622						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		ACACATCATCCCAGAAGGTTT	0.428													28	195	---	---	---	---	capture	Missense_Mutation	SNP	118624163	118624163	SPAG17	1	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	14871	9
ADAM30	11085	broad.mit.edu	37	1	120438344	120438344	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120438344C>G	uc001eij.2	-	1	770	c.616G>C	c.(616-618)GAA>CAA	p.E206Q		NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein	206	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		AGGATCAATTCCAAGTACTTT	0.403													16	117	---	---	---	---	capture	Missense_Mutation	SNP	120438344	120438344	ADAM30	1	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	248	9
GPR52	9293	broad.mit.edu	37	1	174417320	174417320	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:174417320G>A	uc001gka.1	+	1	109	c.71G>A	c.(70-72)CGT>CAT	p.R24H	RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjx.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron	NM_005684	NP_005675	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	24	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1						GTGTCCGAGCGTCACTCCTGC	0.483													5	75	---	---	---	---	capture	Missense_Mutation	SNP	174417320	174417320	GPR52	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6631	9
HMCN1	83872	broad.mit.edu	37	1	186056355	186056355	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186056355G>A	uc001grq.1	+	59	9282	c.9053G>A	c.(9052-9054)CGA>CAA	p.R3018Q		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3018	Ig-like C2-type 28.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ACAGGTGGTCGAACTCTACAG	0.383													15	107	---	---	---	---	capture	Missense_Mutation	SNP	186056355	186056355	HMCN1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7145	9
COG2	22796	broad.mit.edu	37	1	230807312	230807312	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:230807312G>C	uc001htw.2	+	8	976	c.825G>C	c.(823-825)ATG>ATC	p.M275I	COG2_uc001htx.2_Missense_Mutation_p.M275I|COG2_uc010pwc.1_Missense_Mutation_p.M148I	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform	275					Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TTCAGGTCATGTATAATAAAC	0.393													28	159	---	---	---	---	capture	Missense_Mutation	SNP	230807312	230807312	COG2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	3623	9
PCNXL2	80003	broad.mit.edu	37	1	233394169	233394169	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233394169T>C	uc001hvl.2	-	5	1674	c.1439A>G	c.(1438-1440)AAG>AGG	p.K480R	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	480						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ACTGTGATCCTTGATGGCATT	0.542													3	54	---	---	---	---	capture	Missense_Mutation	SNP	233394169	233394169	PCNXL2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11495	9
OR56A4	120793	broad.mit.edu	37	11	6023660	6023660	+	Missense_Mutation	SNP	G	A	A	rs116778909	by1000genomes	TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6023660G>A	uc010qzv.1	-	1	719	c.719C>T	c.(718-720)TCC>TTC	p.S240F		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	188	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGAGTTTGGACACAGACAG	0.443													11	67	---	---	---	---	capture	Missense_Mutation	SNP	6023660	6023660	OR56A4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11039	9
NAT10	55226	broad.mit.edu	37	11	34129864	34129864	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:34129864A>C	uc001mvk.2	+	2	336	c.92A>C	c.(91-93)GAT>GCT	p.D31A	NAT10_uc010ren.1_Intron	NM_024662	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 isoform a	31						nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GTAGTTGGGGATCGAGGAAAA	0.423													18	179	---	---	---	---	capture	Missense_Mutation	SNP	34129864	34129864	NAT10	11	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	10082	9
SPRYD5	84767	broad.mit.edu	37	11	55653246	55653246	+	Silent	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55653246G>A	uc010rip.1	+	2	434	c.342G>A	c.(340-342)CCG>CCA	p.P114P	SPRYD5_uc010riq.1_5'Flank	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	114	B box-type.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TCTGTTTGCCGTGCTCCAACT	0.507													6	55	---	---	---	---	capture	Silent	SNP	55653246	55653246	SPRYD5	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	15003	9
OR8K3	219473	broad.mit.edu	37	11	56086106	56086106	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56086106T>G	uc010rjf.1	+	1	324	c.324T>G	c.(322-324)ATT>ATG	p.I108M		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					TTGTGTTCATTGGTAGTGAAC	0.378													14	152	---	---	---	---	capture	Missense_Mutation	SNP	56086106	56086106	OR8K3	11	T	G	G	G	1	0	0	0	0	1	0	0	0	809	63	4	4	11148	9
TPCN2	219931	broad.mit.edu	37	11	68854047	68854047	+	Missense_Mutation	SNP	A	G	G	rs150476703		TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:68854047A>G	uc001oos.2	+	23	2176	c.2060A>G	c.(2059-2061)AAC>AGC	p.N687S	TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_RNA	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	687	Helical; Name=S6 of repeat II; (Potential).				cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATCTGGGTCAACCTGTTTCTG	0.532													12	82	---	---	---	---	capture	Missense_Mutation	SNP	68854047	68854047	TPCN2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	16279	9
SLCO1A2	6579	broad.mit.edu	37	12	21457447	21457447	+	Missense_Mutation	SNP	C	T	T	rs148616059	byFrequency	TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21457447C>T	uc001rer.2	-	5	754	c.503G>A	c.(502-504)CGT>CAT	p.R168H	SLCO1A2_uc001res.2_Missense_Mutation_p.R168H|SLCO1A2_uc010siq.1_Missense_Mutation_p.R36H|SLCO1A2_uc010sio.1_Missense_Mutation_p.R36H|SLCO1A2_uc010sip.1_Missense_Mutation_p.R36H|SLCO1A2_uc001ret.2_Missense_Mutation_p.R166H|SLCO1A2_uc001reu.2_Missense_Mutation_p.R148H	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	168	Helical; Name=4; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						ACCCATTCCACGTACAATATT	0.348													15	123	---	---	---	---	capture	Missense_Mutation	SNP	21457447	21457447	SLCO1A2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14614	9
DDX11	1663	broad.mit.edu	37	12	31255360	31255360	+	Splice_Site	SNP	G	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31255360G>T	uc001rjt.1	+	23	2523	c.2272_splice	c.e23-1	p.A758_splice	DDX11_uc001rjr.1_Splice_Site_p.A758_splice|DDX11_uc001rjs.1_Splice_Site_p.A708_splice|DDX11_uc001rju.1_Splice_Site_p.A430_splice|DDX11_uc001rjv.1_Splice_Site_p.A758_splice|DDX11_uc001rjw.1_Splice_Site_p.A732_splice|DDX11_uc009zjn.1_Splice_Site|DDX11_uc009zjo.1_5'Flank	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					TTCTCCTACAGGCCTGTGGCC	0.577										Multiple Myeloma(12;0.14)			14	118	---	---	---	---	capture	Splice_Site	SNP	31255360	31255360	DDX11	12	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	4301	9
NUP107	57122	broad.mit.edu	37	12	69124921	69124921	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:69124921T>C	uc001suf.2	+	21	1881	c.1766T>C	c.(1765-1767)ATA>ACA	p.I589T	NUP107_uc001sug.2_Intron|NUP107_uc010stj.1_Missense_Mutation_p.I560T	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	589					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			ACAAATCTTATAGCATTTTAT	0.303													8	72	---	---	---	---	capture	Missense_Mutation	SNP	69124921	69124921	NUP107	12	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	10660	9
TRHDE	29953	broad.mit.edu	37	12	73014949	73014949	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:73014949T>A	uc001sxa.2	+	14	2426	c.2396T>A	c.(2395-2397)TTT>TAT	p.F799Y		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	799	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						AAAAATAATTTTAATGGATCT	0.323													16	111	---	---	---	---	capture	Missense_Mutation	SNP	73014949	73014949	TRHDE	12	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	16362	9
GPR109B	8843	broad.mit.edu	37	12	123200283	123200283	+	Silent	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123200283G>A	uc001ucy.3	-	1	1157	c.1002C>T	c.(1000-1002)GAC>GAT	p.D334D	GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B	334	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	TTTTGTTGGGGTCCCCTGTGA	0.542													9	75	---	---	---	---	capture	Silent	SNP	123200283	123200283	GPR109B	12	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	6560	9
FLT3	2322	broad.mit.edu	37	13	28592705	28592705	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28592705C>T	uc001urw.2	-	20	2522	c.2440G>A	c.(2440-2442)GCC>ACC	p.A814T	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	814	Protein kinase.|Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	ACGTTCCTGGCGGCCAGGTCT	0.453			Mis|O		AML|ALL								14	112	---	---	---	---	capture	Missense_Mutation	SNP	28592705	28592705	FLT3	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5886	9
YLPM1	56252	broad.mit.edu	37	14	75264755	75264755	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75264755G>A	uc001xqj.3	+	5	2879	c.2755G>A	c.(2755-2757)GTA>ATA	p.V919I	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	724					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GGAAGGGCCCGTAGAGCCCTC	0.483													5	29	---	---	---	---	capture	Missense_Mutation	SNP	75264755	75264755	YLPM1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17367	9
SETD3	84193	broad.mit.edu	37	14	99866491	99866491	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:99866491G>A	uc001ygc.2	-	12	1453	c.1283C>T	c.(1282-1284)ACA>ATA	p.T428I		NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a	428					peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				ttcaagaaatgtccaaagttt	0.303													12	72	---	---	---	---	capture	Missense_Mutation	SNP	99866491	99866491	SETD3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14025	9
HDC	3067	broad.mit.edu	37	15	50534686	50534686	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50534686C>A	uc001zxz.2	-	12	1866	c.1760G>T	c.(1759-1761)TGC>TTC	p.C587F	HDC_uc001zxy.2_Missense_Mutation_p.C330F|HDC_uc010uff.1_Missense_Mutation_p.C554F	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	587					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	CACACTGTTGCAACTGAGGGA	0.542													33	265	---	---	---	---	capture	Missense_Mutation	SNP	50534686	50534686	HDC	15	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	6942	9
C17orf68	80169	broad.mit.edu	37	17	8136310	8136310	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8136310C>T	uc002gkq.3	-	11	1918	c.1859G>A	c.(1858-1860)TGT>TAT	p.C620Y	C17orf68_uc010cnv.2_RNA	NM_025099	NP_079375	Q2NKJ3	CTC1_HUMAN	alpha accessory factor 132	620					positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding				0						AAGTTGCAGACAACCTTTATG	0.438													16	210	---	---	---	---	capture	Missense_Mutation	SNP	8136310	8136310	C17orf68	17	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	1861	9
NUFIP2	57532	broad.mit.edu	37	17	27613998	27613998	+	Silent	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27613998T>C	uc002hdy.3	-	2	1103	c.1014A>G	c.(1012-1014)AAA>AAG	p.K338K	NUFIP2_uc002hdx.3_Intron	NM_020772	NP_065823	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein	338						nucleus|polysomal ribosome	protein binding|RNA binding			skin(2)|ovary(1)|breast(1)	4			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			CTGGGGGTGGTTTAAATAGGG	0.413													32	222	---	---	---	---	capture	Silent	SNP	27613998	27613998	NUFIP2	17	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	10656	9
NF1	4763	broad.mit.edu	37	17	29556163	29556163	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29556163C>T	uc002hgg.2	+	21	2863	c.2530C>T	c.(2530-2532)CTT>TTT	p.L844F	NF1_uc002hgh.2_Missense_Mutation_p.L844F|NF1_uc010csn.1_Missense_Mutation_p.L704F|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	844			L -> F (in NF1).|L -> P (in NF1).|L -> R (in NF1; sporadic).		actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GACTGGCTTCCTTTGTGCCCT	0.517			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			14	62	---	---	---	---	capture	Missense_Mutation	SNP	29556163	29556163	NF1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10263	9
GAS2L2	246176	broad.mit.edu	37	17	34073181	34073181	+	Silent	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:34073181G>A	uc002hjv.1	-	6	1363	c.1335C>T	c.(1333-1335)GCC>GCT	p.A445A		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	445					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTTTGGTGGTGGCCTCAATGG	0.612													25	175	---	---	---	---	capture	Silent	SNP	34073181	34073181	GAS2L2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	6187	9
KRT28	162605	broad.mit.edu	37	17	38953242	38953242	+	Missense_Mutation	SNP	C	T	T	rs146193469	byFrequency	TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38953242C>T	uc002hvh.1	-	5	970	c.904G>A	c.(904-906)GCC>ACC	p.A302T		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	302	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				TGGCTCCGGGCGAAAGTGGCT	0.662													13	77	---	---	---	---	capture	Missense_Mutation	SNP	38953242	38953242	KRT28	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8385	9
MTMR4	9110	broad.mit.edu	37	17	56581411	56581411	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56581411C>A	uc002iwj.2	-	14	1766	c.1656G>T	c.(1654-1656)ATG>ATT	p.M552I		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	552	Myotubularin phosphatase.					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCAGACTCACCATGTCTGAGC	0.483													18	92	---	---	---	---	capture	Missense_Mutation	SNP	56581411	56581411	MTMR4	17	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	9856	9
MTMR4	9110	broad.mit.edu	37	17	56585838	56585838	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56585838C>T	uc002iwj.2	-	7	652	c.542G>A	c.(541-543)AGC>AAC	p.S181N		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	181	Myotubularin phosphatase.					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTTGTAGTTGCTGTTGATGTG	0.527													10	73	---	---	---	---	capture	Missense_Mutation	SNP	56585838	56585838	MTMR4	17	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	9856	9
GH1	2688	broad.mit.edu	37	17	61995152	61995152	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61995152C>T	uc002jdj.2	-	4	486	c.424G>A	c.(424-426)GAC>AAC	p.D142N	GH1_uc002jdi.2_Missense_Mutation_p.D127N|GH1_uc002jdk.2_Missense_Mutation_p.D102N|GH1_uc002jdl.2_Intron|GH1_uc002jdm.2_Intron|GH1_uc002jdn.2_Intron	NM_000515	NP_000506	P01241	SOMA_HUMAN	growth hormone 1 isoform 1	142					glucose transport|growth hormone receptor signaling pathway|JAK-STAT cascade|positive regulation of activation of JAK2 kinase activity|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of MAP kinase activity|positive regulation of multicellular organism growth|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|response to estradiol stimulus	extracellular space	growth factor activity|growth hormone receptor binding|hormone activity|metal ion binding|prolactin receptor binding				0						TCCTCTAGGTCCTTTAGGAGG	0.587													13	118	---	---	---	---	capture	Missense_Mutation	SNP	61995152	61995152	GH1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6306	9
ICAM2	3384	broad.mit.edu	37	17	62080238	62080238	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62080238C>A	uc002jdu.3	-	4	929	c.697G>T	c.(697-699)GTG>TTG	p.V233L	C17orf72_uc002jdt.3_3'UTR|C17orf72_uc010wpu.1_3'UTR|C17orf72_uc010wpv.1_3'UTR|C17orf72_uc010wpw.1_3'UTR|ICAM2_uc002jdw.3_Missense_Mutation_p.V233L|ICAM2_uc010ded.2_Missense_Mutation_p.V233L|ICAM2_uc002jdx.3_Missense_Mutation_p.V233L|ICAM2_uc002jdv.3_Missense_Mutation_p.V233L	NM_000873	NP_000864	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor	233	Helical; (Potential).				cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1						GACAGCAACACCGACACCACC	0.612													3	46	---	---	---	---	capture	Missense_Mutation	SNP	62080238	62080238	ICAM2	17	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	7405	9
FADS6	283985	broad.mit.edu	37	17	72878745	72878745	+	Silent	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72878745C>T	uc002jmd.1	-	3	465	c.453G>A	c.(451-453)ACG>ACA	p.T151T	FADS6_uc010wrn.1_Missense_Mutation_p.R68H	NM_178128	NP_835229	Q8N9I5	FADS6_HUMAN	fatty acid desaturase domain family, member 6	157					fatty acid biosynthetic process	integral to membrane	oxidoreductase activity				0	all_lung(278;0.172)|Lung NSC(278;0.207)					GCAGCCTCCACGTGCTGGAGT	0.602													4	12	---	---	---	---	capture	Silent	SNP	72878745	72878745	FADS6	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5322	9
SLC26A11	284129	broad.mit.edu	37	17	78195495	78195495	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78195495C>T	uc002jyb.1	+	3	405	c.136C>T	c.(136-138)CAG>TAG	p.Q46*	SGSH_uc002jxz.3_5'Flank|SGSH_uc002jya.3_5'Flank|SGSH_uc002jxy.2_5'Flank|SGSH_uc010wue.1_5'Flank|SLC26A11_uc002jyc.1_Nonsense_Mutation_p.Q46*|SLC26A11_uc002jyd.1_Nonsense_Mutation_p.Q46*|SLC26A11_uc010dhv.1_Nonsense_Mutation_p.Q46*	NM_173626	NP_775897	Q86WA9	S2611_HUMAN	solute carrier family 26, member 11	46	Extracellular (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTACTCCCTGCAGTGGCTGAA	0.687													6	20	---	---	---	---	capture	Nonsense_Mutation	SNP	78195495	78195495	SLC26A11	17	C	T	T	T	1	0	0	0	0	0	1	0	0	325	25	5	2	14408	9
REXO1	57455	broad.mit.edu	37	19	1828079	1828079	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1828079G>A	uc002lua.3	-	2	804	c.709C>T	c.(709-711)CTC>TTC	p.L237F	REXO1_uc010dsr.1_Missense_Mutation_p.L191F	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	237						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGTTGGAGAGAGGGTCATAC	0.701													4	48	---	---	---	---	capture	Missense_Mutation	SNP	1828079	1828079	REXO1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	13136	9
ANO8	57719	broad.mit.edu	37	19	17436028	17436028	+	Silent	SNP	G	A	A	rs144454643		TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17436028G>A	uc002ngf.2	-	17	2988	c.2829C>T	c.(2827-2829)TCC>TCT	p.S943S	ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8	943	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(3)	3						AGGCCTTCTCGGAGGAGGTGG	0.692													11	79	---	---	---	---	capture	Silent	SNP	17436028	17436028	ANO8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	697	9
CEACAM21	90273	broad.mit.edu	37	19	42083911	42083911	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42083911G>A	uc002ore.3	+	2	520	c.424G>A	c.(424-426)GAG>AAG	p.E142K	CEACAM21_uc002orc.1_RNA|CEACAM21_uc002ord.1_RNA|CEACAM21_uc002orf.2_RNA|CEACAM21_uc002org.3_Missense_Mutation_p.E142K	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion	142	Extracellular (Potential).					integral to membrane				ovary(1)	1						CCGTGTATACGGTGAGTGATT	0.522													7	71	---	---	---	---	capture	Missense_Mutation	SNP	42083911	42083911	CEACAM21	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3161	9
NTF4	4909	broad.mit.edu	37	19	49564974	49564974	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49564974A>C	uc002pmf.3	-	2	422	c.281T>G	c.(280-282)CTG>CGG	p.L94R	CGB7_uc010yah.1_Intron	NM_006179	NP_006170	P34130	NTF4_HUMAN	neurotrophin 5 preproprotein	94					adult locomotory behavior|epidermis development|ganglion mother cell fate determination|long-term memory|sensory organ boundary specification	endoplasmic reticulum lumen|extracellular region	growth factor activity				0		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GCACACAGCCAGCTCACCCCG	0.692													5	20	---	---	---	---	capture	Missense_Mutation	SNP	49564974	49564974	NTF4	19	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	10604	9
KLK6	5653	broad.mit.edu	37	19	51466671	51466671	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51466671C>T	uc002pui.2	-	5	592	c.332G>A	c.(331-333)CGC>CAC	p.R111H	KLK6_uc010eoj.2_Intron|KLK6_uc002puh.2_Missense_Mutation_p.R120H|KLK6_uc002puj.2_Missense_Mutation_p.R4H|KLK6_uc010ycn.1_Missense_Mutation_p.R4H|KLK6_uc002pul.2_Missense_Mutation_p.R111H|KLK6_uc002pum.2_Missense_Mutation_p.R4H	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A	111	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GCGTGCCAGGCGCAACAGCAT	0.617													11	48	---	---	---	---	capture	Missense_Mutation	SNP	51466671	51466671	KLK6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8328	9
ZSCAN22	342945	broad.mit.edu	37	19	58850588	58850588	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58850588C>T	uc002qsc.2	+	3	1519	c.1372C>T	c.(1372-1374)CAC>TAC	p.H458Y	ZSCAN22_uc010yhz.1_3'UTR	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	458	C2H2-type 7.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CCAGAGGATCCACACGGGAGA	0.542													11	116	---	---	---	---	capture	Missense_Mutation	SNP	58850588	58850588	ZSCAN22	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	18110	9
C2orf16	84226	broad.mit.edu	37	2	27801373	27801373	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27801373T>C	uc002rkz.3	+	1	1985	c.1934T>C	c.(1933-1935)GTA>GCA	p.V645A		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	645										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					GAACTGATAGTACCTGCAGAA	0.403													15	92	---	---	---	---	capture	Missense_Mutation	SNP	27801373	27801373	C2orf16	2	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	2137	9
SLC9A4	389015	broad.mit.edu	37	2	103149074	103149074	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103149074C>T	uc002tbz.3	+	12	2781	c.2324C>T	c.(2323-2325)TCG>TTG	p.S775L		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	775	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3						GAGGTTCGGTCGAGGTGGACA	0.517													6	55	---	---	---	---	capture	Missense_Mutation	SNP	103149074	103149074	SLC9A4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14608	9
LRP2	4036	broad.mit.edu	37	2	169985569	169985569	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:169985569C>T	uc002ues.2	-	78	13967	c.13754G>A	c.(13753-13755)CGA>CAA	p.R4585Q		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	4585	Cytoplasmic (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding	p.R4585*(1)		ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTTAGATTTTCGTTTGAAGAG	0.313													13	139	---	---	---	---	capture	Missense_Mutation	SNP	169985569	169985569	LRP2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8872	9
TTN	7273	broad.mit.edu	37	2	179463526	179463526	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179463526C>T	uc010zfg.1	-	240	49431	c.49207G>A	c.(49207-49209)GTG>ATG	p.V16403M	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V10098M|TTN_uc010zfi.1_Missense_Mutation_p.V10031M|TTN_uc010zfj.1_Missense_Mutation_p.V9906M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17330							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTGGACCCACGCCAGCAGCA	0.428													41	210	---	---	---	---	capture	Missense_Mutation	SNP	179463526	179463526	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	9
PID1	55022	broad.mit.edu	37	2	229890703	229890703	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:229890703T>C	uc002vpr.3	-	3	436	c.398A>G	c.(397-399)AAT>AGT	p.N133S	PID1_uc002vps.3_Missense_Mutation_p.N131S|PID1_uc002vpt.3_Missense_Mutation_p.N100S|PID1_uc002vpu.3_Missense_Mutation_p.N51S	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	133	PID.					cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		CAGGAGGGCATTGGCCGGAAA	0.557													6	63	---	---	---	---	capture	Missense_Mutation	SNP	229890703	229890703	PID1	2	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11785	9
COL6A3	1293	broad.mit.edu	37	2	238285526	238285526	+	Missense_Mutation	SNP	C	T	T	rs140437593	byFrequency	TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238285526C>T	uc002vwl.2	-	7	3244	c.2959G>A	c.(2959-2961)GTG>ATG	p.V987M	COL6A3_uc002vwo.2_Missense_Mutation_p.V781M|COL6A3_uc010znj.1_Missense_Mutation_p.V380M|COL6A3_uc002vwq.2_Missense_Mutation_p.V781M|COL6A3_uc002vwr.2_Missense_Mutation_p.V580M|COL6A3_uc010znk.1_Missense_Mutation_p.V787M	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	987	Nonhelical region.|VWFA 5.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGAGACAGCACGATCTGCTCT	0.512													33	223	---	---	---	---	capture	Missense_Mutation	SNP	238285526	238285526	COL6A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3666	9
SLC35C2	51006	broad.mit.edu	37	20	44979115	44979115	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44979115A>G	uc002xro.2	-	10	1557	c.1016T>C	c.(1015-1017)CTG>CCG	p.L339P	SLC35C2_uc002xrp.2_Missense_Mutation_p.L318P|SLC35C2_uc002xrq.2_Missense_Mutation_p.L339P|SLC35C2_uc002xrr.2_Missense_Mutation_p.L339P|SLC35C2_uc010zxn.1_Missense_Mutation_p.L204P|SLC35C2_uc010zxo.1_Missense_Mutation_p.L225P|SLC35C2_uc010zxp.1_Missense_Mutation_p.L368P	NM_173179	NP_775271	Q9NQQ7	S35C2_HUMAN	solute carrier family 35, member C2 isoform a	339					transport	integral to membrane				ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CAGCAGCTCCAGGTCGGGGCT	0.617													8	68	---	---	---	---	capture	Missense_Mutation	SNP	44979115	44979115	SLC35C2	20	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	14472	9
PTGIS	5740	broad.mit.edu	37	20	48129691	48129691	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48129691G>A	uc002xut.2	-	8	1186	c.1132C>T	c.(1132-1134)CGA>TGA	p.R378*	PTGIS_uc010zyi.1_Nonsense_Mutation_p.R239*	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase	378					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)	TCACCACGTCGCAGGTTGAAT	0.612													14	163	---	---	---	---	capture	Nonsense_Mutation	SNP	48129691	48129691	PTGIS	20	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	12647	9
PKDREJ	10343	broad.mit.edu	37	22	46657006	46657006	+	Silent	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:46657006G>A	uc003bhh.2	-	1	2214	c.2214C>T	c.(2212-2214)ATC>ATT	p.I738I		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	738	Extracellular (Potential).|REJ.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		AAGACTGATCGATGAGGTGTT	0.408													24	140	---	---	---	---	capture	Silent	SNP	46657006	46657006	PKDREJ	22	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	11873	9
CACNA1D	776	broad.mit.edu	37	3	53769408	53769408	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53769408G>A	uc003dgv.3	+	20	2792	c.2629G>A	c.(2629-2631)GTA>ATA	p.V877I	CACNA1D_uc003dgu.3_Missense_Mutation_p.V897I|CACNA1D_uc003dgy.3_Missense_Mutation_p.V877I|CACNA1D_uc003dgw.3_Missense_Mutation_p.V544I|CACNA1D_uc003dgx.1_Missense_Mutation_p.V25I	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	877	Cytoplasmic (Potential).|III.				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CAGGATCCGCGTAGGCTGCCA	0.587													23	152	---	---	---	---	capture	Missense_Mutation	SNP	53769408	53769408	CACNA1D	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2517	9
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			5	67	---	---	---	---	capture	Missense_Mutation	SNP	178936091	178936091	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	11816	9
CSN2	1447	broad.mit.edu	37	4	70823297	70823297	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70823297G>T	uc003hes.3	-	5	383	c.370C>A	c.(370-372)CCC>ACC	p.P124T	CSN2_uc003het.3_Missense_Mutation_p.P123T	NM_001891	NP_001882	P05814	CASB_HUMAN	casein beta precursor	124					calcium ion transport	extracellular region	calcium ion binding|enzyme inhibitor activity|transporter activity				0						TCAAAAAAGGGTATCGTTGGA	0.483													10	94	---	---	---	---	capture	Missense_Mutation	SNP	70823297	70823297	CSN2	4	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	3913	9
KIAA1109	84162	broad.mit.edu	37	4	123200986	123200986	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123200986G>T	uc003ieh.2	+	49	8693	c.8648G>T	c.(8647-8649)GGG>GTG	p.G2883V	KIAA1109_uc003iel.1_Missense_Mutation_p.G818V	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2883					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						GCCCAAAGAGGGCTGAAGACA	0.433													17	95	---	---	---	---	capture	Missense_Mutation	SNP	123200986	123200986	KIAA1109	4	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	8130	9
ADAMTS16	170690	broad.mit.edu	37	5	5262847	5262847	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5262847C>T	uc003jdl.2	+	18	2878	c.2740C>T	c.(2740-2742)CGA>TGA	p.R914*	ADAMTS16_uc003jdk.1_Nonsense_Mutation_p.R914*	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	914	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TCCCAAGACACGACCTGTCAC	0.512													9	77	---	---	---	---	capture	Nonsense_Mutation	SNP	5262847	5262847	ADAMTS16	5	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	261	9
PCDHB15	56121	broad.mit.edu	37	5	140627258	140627258	+	Silent	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140627258G>A	uc003lje.2	+	1	2112	c.2112G>A	c.(2110-2112)TCG>TCA	p.S704S		NM_018935	NP_061758	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15 precursor	704	Helical; (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)|breast(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCTCTTCTCGGTGTTCCTGT	0.682													37	283	---	---	---	---	capture	Silent	SNP	140627258	140627258	PCDHB15	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11443	9
KCTD16	57528	broad.mit.edu	37	5	143586570	143586570	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:143586570A>T	uc003lnm.1	+	3	922	c.293A>T	c.(292-294)GAT>GTT	p.D98V	KCTD16_uc003lnn.1_Missense_Mutation_p.D98V	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	98	BTB.					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GTCCTGCCTGATCACTTTCCA	0.478													14	50	---	---	---	---	capture	Missense_Mutation	SNP	143586570	143586570	KCTD16	5	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	8025	9
OR12D2	26529	broad.mit.edu	37	6	29364556	29364556	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29364556T>C	uc003nmf.3	+	1	141	c.80T>C	c.(79-81)GTG>GCG	p.V27A		NM_013936	NP_039224	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D,	27	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTTCTCTTCGTGGTTTTCCTC	0.438													27	202	---	---	---	---	capture	Missense_Mutation	SNP	29364556	29364556	OR12D2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	10835	9
UBD	10537	broad.mit.edu	37	6	29523710	29523710	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29523710C>T	uc003nmo.2	-	2	669	c.445G>A	c.(445-447)GGC>AGC	p.G149S	GABBR1_uc003nmp.3_3'UTR	NM_006398	NP_006389	O15205	UBD_HUMAN	ubiquitin D	149	Ubiquitin 2.				aggresome assembly|myeloid dendritic cell differentiation|negative regulation of mitotic prometaphase|positive regulation of apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein ubiquitination|response to interferon-gamma|response to tumor necrosis factor|ubiquitin-dependent protein catabolic process	aggresome|cytoplasm|nucleus	proteasome binding				0						TTTCTGATGCCGTAATCTGCC	0.473													10	98	---	---	---	---	capture	Missense_Mutation	SNP	29523710	29523710	UBD	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16725	9
COL12A1	1303	broad.mit.edu	37	6	75840567	75840567	+	Splice_Site	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:75840567C>T	uc003phs.2	-	36	6233	c.6067_splice	c.e36+1	p.L2023_splice	COL12A1_uc003pht.2_Splice_Site_p.L859_splice	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTCTGCCTCACGCGTTCGGCC	0.562													5	63	---	---	---	---	capture	Splice_Site	SNP	75840567	75840567	COL12A1	6	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	3634	9
THEMIS	387357	broad.mit.edu	37	6	128134889	128134889	+	Silent	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:128134889G>A	uc003qbi.2	-	5	1216	c.897C>T	c.(895-897)AGC>AGT	p.S299S	THEMIS_uc010kfa.2_Silent_p.S202S|THEMIS_uc011ebt.1_Silent_p.S299S|THEMIS_uc010kfb.2_Silent_p.S264S	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	299	CABIT 2.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						GCTGTAAAATGCTTTGGGGCA	0.393													26	173	---	---	---	---	capture	Silent	SNP	128134889	128134889	THEMIS	6	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	15745	9
SEMA3E	9723	broad.mit.edu	37	7	83016344	83016344	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:83016344G>A	uc003uhy.1	-	15	2156	c.1690C>T	c.(1690-1692)CGA>TGA	p.R564*		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	564					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTTCCATGTCGAACATCTTGT	0.363													6	47	---	---	---	---	capture	Nonsense_Mutation	SNP	83016344	83016344	SEMA3E	7	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	13921	9
COL1A2	1278	broad.mit.edu	37	7	94052404	94052404	+	Missense_Mutation	SNP	G	A	A	rs72658196		TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94052404G>A	uc003ung.1	+	40	3010	c.2539G>A	c.(2539-2541)GGT>AGT	p.G847S	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	847			Missing (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTGAGAAGGGTCCCTCTGG	0.502										HNSCC(75;0.22)			13	130	---	---	---	---	capture	Missense_Mutation	SNP	94052404	94052404	COL1A2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	3643	9
TRIM4	89122	broad.mit.edu	37	7	99516919	99516919	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99516919G>T	uc003usd.2	-	1	236	c.106C>A	c.(106-108)CTG>ATG	p.L36M	TRIM4_uc003use.2_Missense_Mutation_p.L36M|TRIM4_uc011kjc.1_Translation_Start_Site|TRIM4_uc003usf.2_Missense_Mutation_p.L36M	NM_033017	NP_148977	Q9C037	TRIM4_HUMAN	tripartite motif protein TRIM4 isoform alpha	36	RING-type.				protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				TTGCGGTGCAGGCAGCCGCGG	0.701													2	0	---	---	---	---	capture	Missense_Mutation	SNP	99516919	99516919	TRIM4	7	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	16397	9
OR2A12	346525	broad.mit.edu	37	7	143792582	143792582	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143792582C>A	uc011kty.1	+	1	382	c.382C>A	c.(382-384)CCC>ACC	p.P128T		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					AATCTGTCACCCCTTGCAATA	0.433													30	219	---	---	---	---	capture	Missense_Mutation	SNP	143792582	143792582	OR2A12	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	10879	9
PTK2B	2185	broad.mit.edu	37	8	27301729	27301729	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27301729C>T	uc003xfn.1	+	28	2963	c.2155C>T	c.(2155-2157)CGA>TGA	p.R719*	PTK2B_uc003xfo.1_Nonsense_Mutation_p.R719*|PTK2B_uc003xfp.1_Nonsense_Mutation_p.R719*|PTK2B_uc003xfq.1_Nonsense_Mutation_p.R719*|PTK2B_uc003xfr.1_Nonsense_Mutation_p.R465*	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	719	Pro-rich.				apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)		CCAGCCCAGCCGACCTAAGTA	0.542													4	60	---	---	---	---	capture	Nonsense_Mutation	SNP	27301729	27301729	PTK2B	8	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	12658	9
FAM164A	51101	broad.mit.edu	37	8	79590915	79590915	+	Splice_Site	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:79590915G>A	uc003ybd.2	+	3	312	c.210_splice	c.e3+1	p.R70_splice		NM_016010	NP_057094	Q96GY0	F164A_HUMAN	hypothetical protein LOC51101											ovary(1)	1						CAAACCGAGGGTAACTATATA	0.333													21	132	---	---	---	---	capture	Splice_Site	SNP	79590915	79590915	FAM164A	8	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	5431	9
RAD54B	25788	broad.mit.edu	37	8	95403893	95403893	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:95403893T>A	uc003ygk.2	-	10	1851	c.1753A>T	c.(1753-1755)ATA>TTA	p.I585L	RAD54B_uc010may.1_Missense_Mutation_p.I392L|RAD54B_uc003ygl.1_RNA	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			AGAGCTCCTATACATATTAGA	0.408								Direct_reversal_of_damage|Homologous_recombination					30	240	---	---	---	---	capture	Missense_Mutation	SNP	95403893	95403893	RAD54B	8	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	12887	9
PLEC	5339	broad.mit.edu	37	8	144990758	144990758	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144990758C>T	uc003zaf.1	-	32	13812	c.13642G>A	c.(13642-13644)GCC>ACC	p.A4548T	PLEC_uc003zab.1_Missense_Mutation_p.A4411T|PLEC_uc003zac.1_Missense_Mutation_p.A4415T|PLEC_uc003zad.2_Missense_Mutation_p.A4411T|PLEC_uc003zae.1_Missense_Mutation_p.A4379T|PLEC_uc003zag.1_Missense_Mutation_p.A4389T|PLEC_uc003zah.2_Missense_Mutation_p.A4397T|PLEC_uc003zaj.2_Missense_Mutation_p.A4438T	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4548	Plectin 32.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CGCTGCAGGGCCTCGTCCAGG	0.682													10	96	---	---	---	---	capture	Missense_Mutation	SNP	144990758	144990758	PLEC	8	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11955	9
RMI1	80010	broad.mit.edu	37	9	86616796	86616796	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86616796C>A	uc004anq.3	+	3	1303	c.895C>A	c.(895-897)CCA>ACA	p.P299T	RMI1_uc004anr.3_Missense_Mutation_p.P299T|RMI1_uc004anp.3_Missense_Mutation_p.P299T|RMI1_uc004ans.3_Missense_Mutation_p.P299T	NM_024945	NP_079221	Q9H9A7	RMI1_HUMAN	RMI1, RecQ mediated genome instability 1,	299					DNA replication	nucleus					0						AAAAGAGGAACCATCAAACCT	0.398													10	92	---	---	---	---	capture	Missense_Mutation	SNP	86616796	86616796	RMI1	9	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	13287	9
LHX3	8022	broad.mit.edu	37	9	139092527	139092527	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139092527C>A	uc004cha.2	-	2	249	c.152G>T	c.(151-153)TGG>TTG	p.W51L	LHX3_uc004cgz.2_Missense_Mutation_p.W56L	NM_178138	NP_835258	Q9UBR4	LHX3_HUMAN	LIM homeobox protein 3 isoform a	51	LIM zinc-binding 1.				inner ear development|organ morphogenesis|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;8.43e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.26e-07)		CTTGCTGTGCCAGTGGCGGTC	0.607													11	34	---	---	---	---	capture	Missense_Mutation	SNP	139092527	139092527	LHX3	9	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	8692	9
ARSE	415	broad.mit.edu	37	X	2867744	2867744	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2867744C>G	uc004crc.3	-	6	705	c.455G>C	c.(454-456)TGT>TCT	p.C152S	ARSE_uc011mhi.1_Missense_Mutation_p.C98S|ARSE_uc011mhh.1_Missense_Mutation_p.C177S	NM_000047	NP_000038	P51690	ARSE_HUMAN	arylsulfatase E precursor	152					skeletal system development	Golgi stack	arylsulfatase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCTGACTCACAGTTGAGACC	0.483													5	44	---	---	---	---	capture	Missense_Mutation	SNP	2867744	2867744	ARSE	23	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	983	9
MXRA5	25878	broad.mit.edu	37	X	3235366	3235366	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3235366C>T	uc004crg.3	-	6	6513	c.6356G>A	c.(6355-6357)CGC>CAC	p.R2119H		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2119	Ig-like C2-type 5.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCACTCATAGCGCCCGCTGTC	0.662													8	33	---	---	---	---	capture	Missense_Mutation	SNP	3235366	3235366	MXRA5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9913	9
MAGEB1	4112	broad.mit.edu	37	X	30269233	30269233	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30269233T>C	uc004dcc.2	+	4	943	c.623T>C	c.(622-624)ATC>ACC	p.I208T	MAGEB1_uc004dcd.2_Missense_Mutation_p.I208T|MAGEB1_uc004dce.2_Missense_Mutation_p.I208T	NM_002363	NP_002354	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	208	MAGE.										0						CTGGGTGTGATCTTCTTAAAG	0.488													6	26	---	---	---	---	capture	Missense_Mutation	SNP	30269233	30269233	MAGEB1	23	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	9086	9
FAM47A	158724	broad.mit.edu	37	X	34148878	34148878	+	Silent	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34148878C>T	uc004ddg.2	-	1	1551	c.1518G>A	c.(1516-1518)TCG>TCA	p.S506S		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	506			Missing.							ovary(4)|central_nervous_system(1)	5						TGGGAGGCTCCGAGCGGAGAC	0.652													16	62	---	---	---	---	capture	Silent	SNP	34148878	34148878	FAM47A	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5517	9
PHF16	9767	broad.mit.edu	37	X	46884151	46884151	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:46884151G>A	uc004dgx.2	+	5	361	c.310G>A	c.(310-312)GTT>ATT	p.V104I	PHF16_uc004dgy.2_Missense_Mutation_p.V104I	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	104					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						GGTAAAGGACGTTCTGTTTAT	0.448													10	64	---	---	---	---	capture	Missense_Mutation	SNP	46884151	46884151	PHF16	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11730	9
RBM10	8241	broad.mit.edu	37	X	47041361	47041361	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47041361G>A	uc004dhf.2	+	16	2084	c.1705G>A	c.(1705-1707)GTC>ATC	p.V569I	RBM10_uc004dhg.2_Missense_Mutation_p.V491I|RBM10_uc004dhh.2_Missense_Mutation_p.V568I|RBM10_uc010nhq.2_Missense_Mutation_p.V492I|RBM10_uc004dhi.2_Missense_Mutation_p.V634I	NM_005676	NP_005667	P98175	RBM10_HUMAN	RNA binding motif protein 10 isoform 1	569	Tyr-rich.				mRNA processing|RNA splicing	chromatin remodeling complex	nucleotide binding|RNA binding|zinc ion binding			ovary(1)|large_intestine(1)|prostate(1)|breast(1)|pancreas(1)	5						TGTTCCCGACGTCTCTACCTA	0.577													13	52	---	---	---	---	capture	Missense_Mutation	SNP	47041361	47041361	RBM10	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13006	9
ARL13A	392509	broad.mit.edu	37	X	100240808	100240808	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100240808G>A	uc004ego.2	+	4	399	c.283G>A	c.(283-285)GTC>ATC	p.V95I	ARL13A_uc011mrf.1_Missense_Mutation_p.V95I|ARL13A_uc010nng.2_Missense_Mutation_p.V95I	NM_001012990	NP_001013008	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13 isoform a	95							GTP binding			ovary(1)	1						GCTTGTTTTCGTCCTGGATTC	0.468													17	70	---	---	---	---	capture	Missense_Mutation	SNP	100240808	100240808	ARL13A	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	921	9
HNRNPH2	3188	broad.mit.edu	37	X	100667805	100667805	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100667805G>A	uc004ehm.2	+	2	999	c.829G>A	c.(829-831)GGA>AGA	p.G277R	HNRNPH2_uc004ehn.2_Missense_Mutation_p.G277R	NM_019597	NP_062543	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2	277	2 X 16 AA Gly-rich approximate repeats.				nuclear mRNA splicing, via spliceosome	actin cytoskeleton|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding				0						TCATAGATACGGAGATGGTGG	0.428													10	132	---	---	---	---	capture	Missense_Mutation	SNP	100667805	100667805	HNRNPH2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7192	9
SLC6A14	11254	broad.mit.edu	37	X	115586616	115586616	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:115586616C>T	uc004eqi.2	+	12	1702	c.1598C>T	c.(1597-1599)ACG>ATG	p.T533M		NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	533	Helical; Name=11; (Potential).				cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	TTTGTAATTACGCCTATCCTT	0.348													19	109	---	---	---	---	capture	Missense_Mutation	SNP	115586616	115586616	SLC6A14	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14569	9
RHOXF1	158800	broad.mit.edu	37	X	119249400	119249400	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119249400T>A	uc004esk.1	-	1	448	c.373A>T	c.(373-375)ACT>TCT	p.T125S	uc004esi.1_Intron	NM_139282	NP_644811	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	125	Homeobox.				gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GGGTATTGAGTGTGTCGGAAA	0.577													15	99	---	---	---	---	capture	Missense_Mutation	SNP	119249400	119249400	RHOXF1	23	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	13239	9
IRAK1	3654	broad.mit.edu	37	X	153283486	153283486	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153283486C>T	uc004fjs.1	-	7	959	c.880G>A	c.(880-882)GGC>AGC	p.G294S	IRAK1_uc004fjr.1_Missense_Mutation_p.G294S|IRAK1_uc004fjt.1_Missense_Mutation_p.G294S|IRAK1_uc010nur.2_Intron|IRAK1_uc004fju.2_Missense_Mutation_p.G320S	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	294	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGGGAGCCGTTGGGCAGG	0.612													10	80	---	---	---	---	capture	Missense_Mutation	SNP	153283486	153283486	IRAK1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7744	9
GPR126	57211	broad.mit.edu	37	6	142736934	142736934	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0119-01	TCGA-06-0119-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:142736934delA	uc010khc.2	+	20	3082	c.2671delA	c.(2671-2673)AAAfs	p.K891fs	GPR126_uc010khd.2_Frame_Shift_Del_p.K863fs|GPR126_uc010khe.2_Frame_Shift_Del_p.K891fs|GPR126_uc010khf.2_Frame_Shift_Del_p.K863fs	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	891	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		ATTTTTTAGGAAATTGCGAAG	0.398													17	87	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	142736934	142736934	GPR126	6	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	6574	9
