Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MTOR	2475	broad.mit.edu	37	1	11174395	11174395	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:11174395A>T	uc001asd.2	-	53	7401	c.7280T>A	c.(7279-7281)CTG>CAG	p.L2427Q	MTOR_uc001asc.2_Missense_Mutation_p.L632Q	NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	2427	PI3K/PI4K.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CCTCCAGTTCAGCAAGGGGTC	0.388													27	64	---	---	---	---	capture	Missense_Mutation	SNP	11174395	11174395	MTOR	1	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	9864	10
UBR4	23352	broad.mit.edu	37	1	19492180	19492180	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19492180C>T	uc001bbi.2	-	30	4185	c.4181G>A	c.(4180-4182)CGT>CAT	p.R1394H	UBR4_uc001bbm.1_Missense_Mutation_p.R605H	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1394			R -> H (in a breast cancer sample; somatic mutation).		interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding	p.R1394H(2)		kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CATAGCTTTACGAGCCTGGCT	0.433													22	33	---	---	---	---	capture	Missense_Mutation	SNP	19492180	19492180	UBR4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16786	10
EYA3	2140	broad.mit.edu	37	1	28362074	28362074	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28362074C>T	uc001bpi.1	-	6	507	c.342G>A	c.(340-342)ACG>ACA	p.T114T	EYA3_uc010ofs.1_Silent_p.T61T|EYA3_uc010oft.1_Silent_p.T114T|EYA3_uc001bpj.2_Silent_p.T114T|EYA3_uc001bpk.1_RNA|EYA3_uc010ofu.1_RNA	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3	114					anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		GTAGTCCATACGTTTGGGTTG	0.428													66	130	---	---	---	---	capture	Silent	SNP	28362074	28362074	EYA3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	5285	10
ZSCAN20	7579	broad.mit.edu	37	1	33960310	33960310	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:33960310C>T	uc001bxj.3	+	8	2533	c.2366C>T	c.(2365-2367)ACG>ATG	p.T789M	ZSCAN20_uc009vui.2_Missense_Mutation_p.T788M	NM_145238	NP_660281	P17040	ZSC20_HUMAN	zinc finger protein 31	789					viral reproduction	mitochondrion|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AGAATTCACACGGGGGAAAAG	0.438													57	90	---	---	---	---	capture	Missense_Mutation	SNP	33960310	33960310	ZSCAN20	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18108	10
EPHA10	284656	broad.mit.edu	37	1	38227491	38227491	+	Missense_Mutation	SNP	C	T	T	rs146430998		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38227491C>T	uc009vvi.2	-	3	522	c.436G>A	c.(436-438)GGC>AGC	p.G146S	EPHA10_uc001cbw.3_Missense_Mutation_p.G146S	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	146	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGCCGGCTGCCGCCTAGGCGG	0.662													19	36	---	---	---	---	capture	Missense_Mutation	SNP	38227491	38227491	EPHA10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5121	10
SGIP1	84251	broad.mit.edu	37	1	67194966	67194966	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:67194966G>A	uc001dcr.2	+	20	1979	c.1762G>A	c.(1762-1764)GGA>AGA	p.G588R	SGIP1_uc010opd.1_Missense_Mutation_p.G188R|SGIP1_uc001dcs.2_Missense_Mutation_p.G188R|SGIP1_uc001dct.2_Missense_Mutation_p.G190R|SGIP1_uc009wat.2_Missense_Mutation_p.G382R|SGIP1_uc001dcu.2_Missense_Mutation_p.G93R	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	588					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TAAGATTACCGGAGAAATGGT	0.423													40	59	---	---	---	---	capture	Missense_Mutation	SNP	67194966	67194966	SGIP1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14099	10
SPAG17	200162	broad.mit.edu	37	1	118548038	118548038	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118548038T>G	uc001ehk.2	-	32	4843	c.4775A>C	c.(4774-4776)CAG>CCG	p.Q1592P		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1592						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GCACTTTACCTGAAAAGTGTT	0.448													26	69	---	---	---	---	capture	Missense_Mutation	SNP	118548038	118548038	SPAG17	1	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	14871	10
APH1A	51107	broad.mit.edu	37	1	150239482	150239482	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150239482G>A	uc001ety.1	-	5	924	c.602C>T	c.(601-603)TCG>TTG	p.S201L	APH1A_uc010pbx.1_Missense_Mutation_p.S131L|APH1A_uc001etz.1_Missense_Mutation_p.S201L|APH1A_uc001eua.1_Missense_Mutation_p.S201L|APH1A_uc010pby.1_Missense_Mutation_p.S144L|APH1A_uc001eub.1_Missense_Mutation_p.S85L|APH1A_uc010pbz.1_Missense_Mutation_p.S85L	NM_001077628	NP_001071096	Q96BI3	APH1A_HUMAN	anterior pharynx defective 1 homolog A isoform	201	Helical; Name=6; (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to plasma membrane	protein binding			ovary(1)|lung(1)	2	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CACCAGTCCCGATGTCAGTAG	0.507													36	74	---	---	---	---	capture	Missense_Mutation	SNP	150239482	150239482	APH1A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	764	10
FLG2	388698	broad.mit.edu	37	1	152325713	152325713	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152325713G>A	uc001ezw.3	-	3	4622	c.4549C>T	c.(4549-4551)CAT>TAT	p.H1517Y	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1517							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCTGAATGTGTGTGCGAG	0.498													127	224	---	---	---	---	capture	Missense_Mutation	SNP	152325713	152325713	FLG2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	5868	10
PPOX	5498	broad.mit.edu	37	1	161138221	161138221	+	Splice_Site	SNP	G	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161138221G>T	uc001fyj.2	+	6	762	c.472_splice	c.e6-1	p.V158_splice	PPOX_uc001fyn.2_Intron|PPOX_uc001fyg.2_Splice_Site_p.V158_splice|PPOX_uc001fyl.2_Splice_Site_p.V124_splice|PPOX_uc001fym.2_Intron|PPOX_uc001fyk.2_Splice_Site|PPOX_uc001fyh.2_Splice_Site|PPOX_uc010pkg.1_Translation_Start_Site|PPOX_uc009wuc.1_Splice_Site|PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Translation_Start_Site	NM_001122764	NP_001116236	P50336	PPOX_HUMAN	protoporphyrinogen oxidase						heme biosynthetic process	intrinsic to mitochondrial inner membrane|mitochondrial intermembrane space	flavin adenine dinucleotide binding|oxygen-dependent protoporphyrinogen oxidase activity			ovary(1)	1	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCACCCTTAAGGTGGCGTCTC	0.522									Porphyria_Variegata				56	110	---	---	---	---	capture	Splice_Site	SNP	161138221	161138221	PPOX	1	G	T	T	T	1	0	0	0	0	0	0	1	0	455	35	5	4	12249	10
HMCN1	83872	broad.mit.edu	37	1	186092143	186092143	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186092143C>T	uc001grq.1	+	81	12519	c.12290C>T	c.(12289-12291)ACG>ATG	p.T4097M		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4097	Ig-like C2-type 40.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAGCCCATCACGTTATCCTGT	0.433													33	69	---	---	---	---	capture	Missense_Mutation	SNP	186092143	186092143	HMCN1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7145	10
RYR2	6262	broad.mit.edu	37	1	237811774	237811774	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237811774C>T	uc001hyl.1	+	49	7493	c.7373C>T	c.(7372-7374)GCG>GTG	p.A2458V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2458	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GACATGTCTGCGGGGTTTTGC	0.458													10	9	---	---	---	---	capture	Missense_Mutation	SNP	237811774	237811774	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13661	10
GPR123	84435	broad.mit.edu	37	10	134886514	134886514	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:134886514C>T	uc001llw.2	+	3	548	c.548C>T	c.(547-549)TCC>TTC	p.S183F				Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;	Error:Variant_position_missing_in_Q86SQ6_after_alignment						integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		ATTTTTACCTCCGTCTTGCAA	0.562													4	3	---	---	---	---	capture	Missense_Mutation	SNP	134886514	134886514	GPR123	10	C	T	T	T	1	0	0	0	0	1	0	0	0	378	30	2	2	6571	10
LRDD	55367	broad.mit.edu	37	11	800589	800589	+	Silent	SNP	G	A	A	rs151136652		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:800589G>A	uc001lro.1	-	12	2137	c.1995C>T	c.(1993-1995)GGC>GGT	p.G665G	SLC25A22_uc009yci.2_5'Flank|SLC25A22_uc001lrj.2_5'Flank|LRDD_uc009yck.1_RNA|LRDD_uc001lrk.1_Silent_p.G665G|LRDD_uc001lrl.1_Silent_p.G508G|LRDD_uc001lrm.1_Silent_p.G352G|LRDD_uc001lrn.1_Silent_p.G508G|LRDD_uc001lrp.1_Silent_p.G327G	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	665					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGAACTCTTCGCCCTCGAACA	0.682													14	18	---	---	---	---	capture	Silent	SNP	800589	800589	LRDD	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8852	10
OR56A4	120793	broad.mit.edu	37	11	6023920	6023920	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6023920G>A	uc010qzv.1	-	1	459	c.459C>T	c.(457-459)TTC>TTT	p.F153F		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	101	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACATCTGGAGGAAGCAGGCTG	0.532													25	59	---	---	---	---	capture	Silent	SNP	6023920	6023920	OR56A4	11	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	11039	10
TRIM3	10612	broad.mit.edu	37	11	6470286	6470286	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6470286C>T	uc001mdh.2	-	13	2594	c.2207G>A	c.(2206-2208)TGC>TAC	p.C736Y	TRIM3_uc001mdi.2_Missense_Mutation_p.C736Y|TRIM3_uc010raj.1_Missense_Mutation_p.C617Y|TRIM3_uc009yfd.2_Missense_Mutation_p.C736Y	NM_006458	NP_006449	O75382	TRIM3_HUMAN	tripartite motif-containing 3	736	NHL 6.				nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding	p.C736Y(1)		central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCTTTAAAGCAGTGGTTGCC	0.562													16	34	---	---	---	---	capture	Missense_Mutation	SNP	6470286	6470286	TRIM3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	16387	10
ANO5	203859	broad.mit.edu	37	11	22291917	22291917	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22291917G>T	uc001mqi.2	+	18	2275	c.1958G>T	c.(1957-1959)AGT>ATT	p.S653I	ANO5_uc001mqj.2_Missense_Mutation_p.S652I	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	653	Extracellular (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						AAGCTGTATAGTCGATGGGAG	0.398													48	72	---	---	---	---	capture	Missense_Mutation	SNP	22291917	22291917	ANO5	11	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	694	10
GAS2	2620	broad.mit.edu	37	11	22747846	22747846	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22747846G>A	uc009yie.2	+	4	582	c.276G>A	c.(274-276)CCG>CCA	p.P92P	GAS2_uc001mqm.2_Silent_p.P92P|GAS2_uc001mqn.2_RNA|GAS2_uc001mqo.2_Silent_p.P92P	NM_001143830	NP_001137302	O43903	GAS2_HUMAN	growth arrest-specific 2	92	CH.				cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2						AGAATCTACCGTTGAAGAAGA	0.393													68	75	---	---	---	---	capture	Silent	SNP	22747846	22747846	GAS2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	6185	10
RAG1	5896	broad.mit.edu	37	11	36596452	36596452	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:36596452C>T	uc001mwu.3	+	2	1722	c.1598C>T	c.(1597-1599)ACT>ATT	p.T533I	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	533					histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				TCTTCCAGCACTGATGTTGGC	0.493									Familial_Hemophagocytic_Lymphohistiocytosis				36	68	---	---	---	---	capture	Missense_Mutation	SNP	36596452	36596452	RAG1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	12898	10
OR4X1	390113	broad.mit.edu	37	11	48286015	48286015	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48286015C>T	uc010rht.1	+	1	603	c.603C>T	c.(601-603)GGC>GGT	p.G201G		NM_001004726	NP_001004726	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X,	201	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3						TCACCAATGGCGGCTCCATCT	0.557													25	27	---	---	---	---	capture	Silent	SNP	48286015	48286015	OR4X1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10988	10
FADS3	3995	broad.mit.edu	37	11	61647583	61647583	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61647583C>T	uc001nsm.2	-	2	407	c.254G>A	c.(253-255)CGC>CAC	p.R85H	FADS3_uc001nsn.2_5'UTR	NM_021727	NP_068373	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	85	Cytochrome b5 heme-binding.|Cytoplasmic (Potential).				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	heme binding|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water			ovary(1)|pancreas(1)	2						TAGGAACTTGCGCACAAAATT	0.428													3	31	---	---	---	---	capture	Missense_Mutation	SNP	61647583	61647583	FADS3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5321	10
THRSP	7069	broad.mit.edu	37	11	77775138	77775138	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77775138G>C	uc001oyx.2	+	1	232	c.211G>C	c.(211-213)GAC>CAC	p.D71H		NM_003251	NP_003242	Q92748	THRSP_HUMAN	thyroid hormone-responsive protein	71					lipid biosynthetic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus				breast(1)	1	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			TGTGGATGTGGACCATGGGCT	0.642													43	79	---	---	---	---	capture	Missense_Mutation	SNP	77775138	77775138	THRSP	11	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	15761	10
PRCP	5547	broad.mit.edu	37	11	82571019	82571019	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82571019C>T	uc001ozs.2	-	2	422	c.309G>A	c.(307-309)ACG>ACA	p.T103T	PRCP_uc001ozr.2_Silent_p.T124T	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	103					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						CTGCACATACCGTGTTATTAC	0.274													14	34	---	---	---	---	capture	Silent	SNP	82571019	82571019	PRCP	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12345	10
NFRKB	4798	broad.mit.edu	37	11	129751720	129751720	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:129751720G>C	uc001qfi.2	-	12	1421	c.1220C>G	c.(1219-1221)TCA>TGA	p.S407*	NFRKB_uc001qfg.2_Nonsense_Mutation_p.S432*|NFRKB_uc001qfh.2_Nonsense_Mutation_p.S430*|NFRKB_uc010sbw.1_Nonsense_Mutation_p.S419*	NM_001143835	NP_001137307	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	407					DNA recombination|DNA repair|inflammatory response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Ino80 complex	DNA binding|protease binding			ovary(3)	3	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GGCTGGCGATGACTGCCAATC	0.557											OREG0021512	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	37	---	---	---	---	capture	Nonsense_Mutation	SNP	129751720	129751720	NFRKB	11	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	10291	10
ESPL1	9700	broad.mit.edu	37	12	53684176	53684176	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53684176G>A	uc001sck.2	+	24	5378	c.5287G>A	c.(5287-5289)GCA>ACA	p.A1763T	ESPL1_uc001scj.2_Missense_Mutation_p.A1438T	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	1763					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						CATCCAGAAGGCACAGAAAGA	0.557													27	50	---	---	---	---	capture	Missense_Mutation	SNP	53684176	53684176	ESPL1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5208	10
LRP1	4035	broad.mit.edu	37	12	57598195	57598195	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57598195C>T	uc001snd.2	+	71	11420	c.10954C>T	c.(10954-10956)CGG>TGG	p.R3652W		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3652	Extracellular (Potential).|LDL-receptor class A 29.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGCACCAGTGCGGACCTGCCC	0.622													18	43	---	---	---	---	capture	Missense_Mutation	SNP	57598195	57598195	LRP1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	8867	10
ANO4	121601	broad.mit.edu	37	12	101336194	101336194	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101336194C>T	uc010svm.1	+	5	909	c.337C>T	c.(337-339)CGA>TGA	p.R113*	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Nonsense_Mutation_p.R78*|ANO4_uc001thx.2_Nonsense_Mutation_p.R113*	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	113	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						ACTTTACTTTCGAGATGGAAA	0.388										HNSCC(74;0.22)			42	95	---	---	---	---	capture	Nonsense_Mutation	SNP	101336194	101336194	ANO4	12	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	693	10
GCN1L1	10985	broad.mit.edu	37	12	120599821	120599821	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120599821C>T	uc001txo.2	-	21	2218	c.2205G>A	c.(2203-2205)CCG>CCA	p.P735P		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	735					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGACCCGGTCCGGCGACAGGA	0.617													17	38	---	---	---	---	capture	Silent	SNP	120599821	120599821	GCN1L1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6239	10
POTEG	404785	broad.mit.edu	37	14	19553823	19553823	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19553823G>A	uc001vuz.1	+	1	459	c.407G>A	c.(406-408)CGT>CAT	p.R136H	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	136								p.R136H(1)		ovary(1)	1						TACCACGTCCGTCGAGAAGAT	0.577													27	222	---	---	---	---	capture	Missense_Mutation	SNP	19553823	19553823	POTEG	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12167	10
FOXA1	3169	broad.mit.edu	37	14	38061527	38061527	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38061527G>A	uc001wuf.2	-	2	774	c.462C>T	c.(460-462)GGC>GGT	p.G154G	FOXA1_uc010tpz.1_Silent_p.G121G	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	154					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		cgccgccgccgcccgcgcggc	0.567													16	51	---	---	---	---	capture	Silent	SNP	38061527	38061527	FOXA1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5933	10
MDGA2	161357	broad.mit.edu	37	14	47426709	47426709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:47426709G>A	uc001wwj.3	-	9	1946	c.1750C>T	c.(1750-1752)CGG>TGG	p.R584W	MDGA2_uc001wwi.3_Missense_Mutation_p.R355W|MDGA2_uc010ani.2_Missense_Mutation_p.R144W	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	584	Ig-like 6.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TGACCCGTCCGTAATAATTTA	0.443													29	61	---	---	---	---	capture	Missense_Mutation	SNP	47426709	47426709	MDGA2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	9320	10
KIAA1409	57578	broad.mit.edu	37	14	94173118	94173118	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94173118G>C	uc001ybv.1	+	48	7394	c.7311G>C	c.(7309-7311)AGG>AGC	p.R2437S	KIAA1409_uc001ybs.1_Missense_Mutation_p.R2415S	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2592						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ACAGCCTAAGGACGCTGCCGG	0.567													16	64	---	---	---	---	capture	Missense_Mutation	SNP	94173118	94173118	KIAA1409	14	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	8152	10
KIAA1409	57578	broad.mit.edu	37	14	94173139	94173139	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94173139G>C	uc001ybv.1	+	48	7415	c.7332G>C	c.(7330-7332)CAG>CAC	p.Q2444H	KIAA1409_uc001ybs.1_Missense_Mutation_p.Q2422H	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2599						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		GCTCGGGCCAGAGCAGTGCTG	0.577													18	58	---	---	---	---	capture	Missense_Mutation	SNP	94173139	94173139	KIAA1409	14	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	8152	10
BAHD1	22893	broad.mit.edu	37	15	40751616	40751616	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40751616T>C	uc001zlu.2	+	2	1024	c.953T>C	c.(952-954)ATG>ACG	p.M318T	BAHD1_uc001zlt.2_Missense_Mutation_p.M318T|BAHD1_uc010bbp.1_Missense_Mutation_p.M318T|BAHD1_uc001zlv.2_Missense_Mutation_p.M318T	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	318	Pro-rich.				heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CCCCTGCTGATGGGTGGACAG	0.652													29	59	---	---	---	---	capture	Missense_Mutation	SNP	40751616	40751616	BAHD1	15	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	1286	10
CYP19A1	1588	broad.mit.edu	37	15	51507426	51507426	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:51507426G>A	uc001zyz.3	-	9	1113	c.862C>T	c.(862-864)CGT>TGT	p.R288C	CYP19A1_uc001zza.3_Missense_Mutation_p.R288C|CYP19A1_uc001zzb.2_Missense_Mutation_p.R288C	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19	288					estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	AGGTCACCACGTTTCTGAACA	0.403													24	52	---	---	---	---	capture	Missense_Mutation	SNP	51507426	51507426	CYP19A1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4108	10
CILP	8483	broad.mit.edu	37	15	65490345	65490345	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65490345C>T	uc002aon.2	-	9	2460	c.2279G>A	c.(2278-2280)CGG>CAG	p.R760Q		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	760					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						CCTCTCACTCCGGTAGGCCCT	0.547													70	112	---	---	---	---	capture	Missense_Mutation	SNP	65490345	65490345	CILP	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3394	10
BTBD12	84464	broad.mit.edu	37	16	3642834	3642834	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3642834G>A	uc002cvp.2	-	11	2820	c.2193C>T	c.(2191-2193)GAC>GAT	p.D731D		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	731	BTB.|Interaction with PLK1 and TERF2-TERF2IP.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						TCAGAACCCCGTCCTCTACAG	0.567								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				11	21	---	---	---	---	capture	Silent	SNP	3642834	3642834	BTBD12	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1528	10
ANKRD11	29123	broad.mit.edu	37	16	89351279	89351279	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89351279C>T	uc002fmx.1	-	9	2132	c.1671G>A	c.(1669-1671)CCG>CCA	p.P557P	ANKRD11_uc002fmy.1_Silent_p.P557P|ANKRD11_uc002fnc.1_Silent_p.P557P|ANKRD11_uc002fnb.1_Silent_p.P514P	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	557	Ser-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTGACCAAGCCGGGGAAGAAA	0.562													3	72	---	---	---	---	capture	Silent	SNP	89351279	89351279	ANKRD11	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	636	10
SLC13A5	284111	broad.mit.edu	37	17	6604344	6604344	+	Missense_Mutation	SNP	T	G	G	rs77405963		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:6604344T>G	uc002gdj.2	-	6	906	c.818A>C	c.(817-819)CAG>CCG	p.Q273P	SLC13A5_uc010vtf.1_Missense_Mutation_p.Q273P|SLC13A5_uc010clq.2_Missense_Mutation_p.Q230P|SLC13A5_uc002gdk.2_Missense_Mutation_p.Q256P|SLC13A5_uc002gdl.1_Missense_Mutation_p.Q255P	NM_177550	NP_808218	Q86YT5	S13A5_HUMAN	solute carrier family 13, member 5 isoform a	273						integral to membrane	citrate transmembrane transporter activity				0						GTAAACAAACTGGAGCCACAG	0.473													5	34	---	---	---	---	capture	Missense_Mutation	SNP	6604344	6604344	SLC13A5	17	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	14288	10
COX10	1352	broad.mit.edu	37	17	14110273	14110273	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:14110273C>T	uc002gof.3	+	7	1279	c.1075C>T	c.(1075-1077)CGC>TGC	p.R359C	COX10_uc010vvs.1_Missense_Mutation_p.R142C|COX10_uc010vvt.1_Missense_Mutation_p.R167C	NM_001303	NP_001294	Q12887	COX10_HUMAN	heme A:farnesyltransferase precursor	359					heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		CGTGGCGCTGCGCCACTGCCT	0.657													31	76	---	---	---	---	capture	Missense_Mutation	SNP	14110273	14110273	COX10	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3727	10
SYNRG	11276	broad.mit.edu	37	17	35928904	35928904	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35928904C>G	uc002hoa.2	-	11	1553	c.1470G>C	c.(1468-1470)CAG>CAC	p.Q490H	SYNRG_uc010wde.1_Missense_Mutation_p.Q412H|SYNRG_uc010wdf.1_Missense_Mutation_p.Q412H|SYNRG_uc002hoc.2_Missense_Mutation_p.Q411H|SYNRG_uc002hoe.2_Missense_Mutation_p.Q412H|SYNRG_uc002hod.2_Missense_Mutation_p.Q412H|SYNRG_uc010wdg.1_Missense_Mutation_p.Q329H|SYNRG_uc002hob.2_Missense_Mutation_p.Q490H|SYNRG_uc002hof.2_Missense_Mutation_p.Q202H|SYNRG_uc010cvd.1_Missense_Mutation_p.Q290H|SYNRG_uc002hog.1_Missense_Mutation_p.Q624H	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	490					endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						TGTTTCCATGCTGGGAGTTAC	0.363													32	76	---	---	---	---	capture	Missense_Mutation	SNP	35928904	35928904	SYNRG	17	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	15348	10
KRT34	3885	broad.mit.edu	37	17	39535345	39535345	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39535345G>A	uc002hwm.2	-	6	1098	c.1086C>T	c.(1084-1086)AAC>AAT	p.N362N		NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34	362	Rod.|Coil 2.				epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				GAGACTCCACGTTGGTGATCA	0.617													45	86	---	---	---	---	capture	Silent	SNP	39535345	39535345	KRT34	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8391	10
ARMC7	79637	broad.mit.edu	37	17	73125017	73125017	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73125017C>T	uc002jmw.1	+	3	783	c.481C>T	c.(481-483)CAG>TAG	p.Q161*	ARMC7_uc010wru.1_3'UTR|ARMC7_uc010dga.1_RNA	NM_024585	NP_078861	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	161							binding			pancreas(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			GAACCTGGCACAGATCTTCCT	0.706													13	20	---	---	---	---	capture	Nonsense_Mutation	SNP	73125017	73125017	ARMC7	17	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	949	10
ANKRD12	23253	broad.mit.edu	37	18	9280962	9280962	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:9280962A>C	uc002knv.2	+	13	6284	c.6027A>C	c.(6025-6027)CAA>CAC	p.Q2009H	ANKRD12_uc002knw.2_Missense_Mutation_p.Q1986H|ANKRD12_uc002knx.2_Missense_Mutation_p.Q1986H	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	2009						nucleus				ovary(2)|central_nervous_system(1)	3						TGAGGCAACAACATGAAGCTG	0.363													31	60	---	---	---	---	capture	Missense_Mutation	SNP	9280962	9280962	ANKRD12	18	A	C	C	C	1	0	0	0	0	1	0	0	0	24	2	4	4	637	10
GALR1	2587	broad.mit.edu	37	18	74962646	74962646	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74962646G>A	uc002lms.3	+	1	639	c.142G>A	c.(142-144)GTG>ATG	p.V48M		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	48	Helical; Name=1; (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		CGCGCTGGGTGTGCTGGGCAA	0.682													9	30	---	---	---	---	capture	Missense_Mutation	SNP	74962646	74962646	GALR1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	6167	10
OR7G2	390882	broad.mit.edu	37	19	9213120	9213120	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9213120G>C	uc010xkk.1	-	1	863	c.863C>G	c.(862-864)TCA>TGA	p.S288*		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	267	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTTCCTAGGTGAGTCAGTAAC	0.463													23	80	---	---	---	---	capture	Nonsense_Mutation	SNP	9213120	9213120	OR7G2	19	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	11127	10
C19orf44	84167	broad.mit.edu	37	19	16612069	16612069	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:16612069C>T	uc002neh.1	+	2	539	c.466C>T	c.(466-468)CGT>TGT	p.R156C	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Missense_Mutation_p.R156C|C19orf44_uc002neg.2_Missense_Mutation_p.R156C|C19orf44_uc010eai.1_RNA	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	156											0						GAATCAAGCCCGTGAACTTCC	0.498													24	91	---	---	---	---	capture	Missense_Mutation	SNP	16612069	16612069	C19orf44	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1910	10
KLHL26	55295	broad.mit.edu	37	19	18779533	18779533	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18779533C>T	uc002njz.1	+	3	1353	c.1326C>T	c.(1324-1326)TAC>TAT	p.Y442Y		NM_018316	NP_060786	Q53HC5	KLH26_HUMAN	kelch-like 26	442	Kelch 3.									ovary(1)	1						AGTGGGGCTACGCCTGCTCGC	0.701													7	26	---	---	---	---	capture	Silent	SNP	18779533	18779533	KLHL26	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8301	10
APLP1	333	broad.mit.edu	37	19	36363501	36363501	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36363501C>T	uc002oce.2	+	7	1105	c.967C>T	c.(967-969)CGC>TGC	p.R323C	APLP1_uc010xsz.1_Missense_Mutation_p.R284C|APLP1_uc002ocf.2_Missense_Mutation_p.R323C|APLP1_uc002ocg.2_Missense_Mutation_p.R226C|APLP1_uc010xta.1_Missense_Mutation_p.R317C	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2	323	Heparin-binding (By similarity).|Extracellular (Potential).				apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCGTAGGATGCGCCAGATTAA	0.537													28	103	---	---	---	---	capture	Missense_Mutation	SNP	36363501	36363501	APLP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	771	10
PSG8	440533	broad.mit.edu	37	19	43269670	43269670	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43269670C>A	uc002ouo.2	-	1	162	c.64G>T	c.(64-66)GCA>TCA	p.A22S	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG8_uc002oui.2_5'UTR|PSG8_uc002ouh.2_Missense_Mutation_p.A22S|PSG8_uc010ein.2_Missense_Mutation_p.V22L|PSG8_uc002ouj.3_Intron|PSG8_uc002ouk.3_Intron|PSG8_uc002oul.3_Intron|PSG8_uc002oum.3_Intron|PSG1_uc002oun.2_Intron|PSG8_uc002oup.3_Intron	NM_182707	NP_874366	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8 isoform	22						extracellular region					0		Prostate(69;0.00899)				CTCTCCTCACCTGTGAGCAGG	0.552													12	100	---	---	---	---	capture	Missense_Mutation	SNP	43269670	43269670	PSG8	19	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	12556	10
ZNF229	7772	broad.mit.edu	37	19	44933156	44933156	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44933156G>A	uc002oze.1	-	6	2234	c.1800C>T	c.(1798-1800)TAC>TAT	p.Y600Y	ZNF229_uc010ejk.1_Silent_p.Y254Y|ZNF229_uc010ejl.1_Silent_p.Y594Y	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	600	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				CGTCACACACGTAGGGCCTCT	0.542													27	87	---	---	---	---	capture	Silent	SNP	44933156	44933156	ZNF229	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17662	10
SPIB	6689	broad.mit.edu	37	19	50926144	50926144	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50926144G>A	uc002psd.2	+	4	214	c.189G>A	c.(187-189)CCG>CCA	p.P63P	SPIB_uc002pse.2_Silent_p.P63P|SPIB_uc010ycc.1_Intron	NM_003121	NP_003112	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	63					regulation of transcription from RNA polymerase II promoter	cytoplasm|microtubule cytoskeleton|nucleus	sequence-specific DNA binding			lung(1)|kidney(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CCTTCGACCCGGCAGCAGCCG	0.662													18	66	---	---	---	---	capture	Silent	SNP	50926144	50926144	SPIB	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14942	10
SIGLEC9	27180	broad.mit.edu	37	19	51630497	51630497	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51630497G>A	uc002pvu.2	+	4	1026	c.959G>A	c.(958-960)TGC>TAC	p.C320Y	SIGLEC9_uc010yct.1_Missense_Mutation_p.C320Y	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	320	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GAATTCACCTGCAGAGCTCAG	0.622													24	52	---	---	---	---	capture	Missense_Mutation	SNP	51630497	51630497	SIGLEC9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	14208	10
ZNF417	147687	broad.mit.edu	37	19	58423432	58423432	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58423432C>T	uc002qqq.2	-	2	358	c.159G>A	c.(157-159)TCG>TCA	p.S53S	ZNF417_uc010yhm.1_Silent_p.S10S|ZNF417_uc002qqr.2_Silent_p.S52S	NM_152475	NP_689688	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	53	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		ACTTACCCAGCGAGGATATGA	0.498													12	61	---	---	---	---	capture	Silent	SNP	58423432	58423432	ZNF417	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	17774	10
PRKD3	23683	broad.mit.edu	37	2	37516578	37516578	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37516578G>C	uc002rqd.2	-	4	1193	c.638C>G	c.(637-639)TCA>TGA	p.S213*	PRKD3_uc002rqf.1_Nonsense_Mutation_p.S213*	NM_005813	NP_005804	O94806	KPCD3_HUMAN	protein kinase D3	213					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)				AGATACATTTGACAGACGTCT	0.413													32	57	---	---	---	---	capture	Nonsense_Mutation	SNP	37516578	37516578	PRKD3	2	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	12416	10
PCDP1	200373	broad.mit.edu	37	2	120369295	120369295	+	Missense_Mutation	SNP	C	T	T	rs149304410		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:120369295C>T	uc002tmb.2	+	14	1522	c.430C>T	c.(430-432)CGG>TGG	p.R144W	PCDP1_uc010yyq.1_Missense_Mutation_p.R274W	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	430						cilium	calmodulin binding				0	Colorectal(110;0.196)					TAGCCATAAACGGGTTGTTCG	0.333													21	35	---	---	---	---	capture	Missense_Mutation	SNP	120369295	120369295	PCDP1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	11475	10
LRP1B	53353	broad.mit.edu	37	2	141072506	141072506	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:141072506A>G	uc002tvj.1	-	83	13775	c.12803T>C	c.(12802-12804)CTA>CCA	p.L4268P		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4268	Extracellular (Potential).|EGF-like 11.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATATTTACCTAGAACTGATGG	0.353										TSP Lung(27;0.18)			28	47	---	---	---	---	capture	Missense_Mutation	SNP	141072506	141072506	LRP1B	2	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	8871	10
COBLL1	22837	broad.mit.edu	37	2	165578701	165578701	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:165578701G>A	uc010zcw.1	-	9	1202	c.1078C>T	c.(1078-1080)CGG>TGG	p.R360W	COBLL1_uc002ucp.2_Missense_Mutation_p.R294W|COBLL1_uc002ucq.2_Missense_Mutation_p.R294W|COBLL1_uc010zcx.1_Missense_Mutation_p.R340W|COBLL1_uc002ucs.1_RNA|COBLL1_uc002uco.2_Missense_Mutation_p.R63W	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	332	KKRRAP 1.									ovary(2)|pancreas(1)	3						AGTGGAGCCCGCCTCTTCTTG	0.522													40	59	---	---	---	---	capture	Missense_Mutation	SNP	165578701	165578701	COBLL1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	3619	10
SCN1A	6323	broad.mit.edu	37	2	166850847	166850847	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166850847T>C	uc010zcz.1	-	25	4646	c.4628A>G	c.(4627-4629)AAC>AGC	p.N1543S		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1554	Helical; Name=S1 of repeat IV; (By similarity).|IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TGTGACCATGTTAAGACAGAT	0.378													23	52	---	---	---	---	capture	Missense_Mutation	SNP	166850847	166850847	SCN1A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	13807	10
TTN	7273	broad.mit.edu	37	2	179476875	179476875	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179476875G>C	uc010zfg.1	-	216	42783	c.42559C>G	c.(42559-42561)CCC>GCC	p.P14187A	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P7882A|TTN_uc010zfi.1_Missense_Mutation_p.P7815A|TTN_uc010zfj.1_Missense_Mutation_p.P7690A	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15114							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGGCGTAGGGTGGTCCAGGA	0.418													10	17	---	---	---	---	capture	Missense_Mutation	SNP	179476875	179476875	TTN	2	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	16617	10
TTN	7273	broad.mit.edu	37	2	179597777	179597777	+	Silent	SNP	G	A	A	rs72648936		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179597777G>A	uc010zfg.1	-	52	12618	c.12394C>T	c.(12394-12396)CTG>TTG	p.L4132L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.L793L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5059							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCAGTCCAGTCTGCAGGTA	0.468													13	28	---	---	---	---	capture	Silent	SNP	179597777	179597777	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	16617	10
TTN	7273	broad.mit.edu	37	2	179599243	179599243	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179599243G>A	uc010zfg.1	-	49	11800	c.11576C>T	c.(11575-11577)CCA>CTA	p.P3859L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.P520L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	4786							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTTCAAATGGTCCAGTGCC	0.393													41	92	---	---	---	---	capture	Missense_Mutation	SNP	179599243	179599243	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	16617	10
IHH	3549	broad.mit.edu	37	2	219920562	219920562	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219920562G>A	uc002vjo.1	-	3	603	c.603C>T	c.(601-603)GGC>GGT	p.G201G		NM_002181	NP_002172	Q14623	IHH_HUMAN	Indian hedgehog homolog precursor	201					cell-cell signaling|intein-mediated protein splicing|proteolysis	extracellular space|plasma membrane	cholesterol binding|patched binding|peptidase activity			breast(1)	1		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAAGCAGCCGCCCGTCTTGG	0.672													10	18	---	---	---	---	capture	Silent	SNP	219920562	219920562	IHH	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7531	10
ACCN4	55515	broad.mit.edu	37	2	220396799	220396799	+	Silent	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220396799G>C	uc002vma.2	+	3	1199	c.1185G>C	c.(1183-1185)GGG>GGC	p.G395G	ACCN4_uc010fwi.1_Silent_p.G395G|ACCN4_uc010fwj.1_Silent_p.G395G|ACCN4_uc002vly.1_Silent_p.G395G|ACCN4_uc002vlz.2_Silent_p.G395G|ACCN4_uc002vmb.2_Silent_p.G49G	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN	amiloride-sensitive cation channel 4 isoform 2	395	Extracellular (Potential).					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)		ACCAGCTGGGGTTCGGGGTGT	0.617													43	93	---	---	---	---	capture	Silent	SNP	220396799	220396799	ACCN4	2	G	C	C	C	1	0	0	0	0	0	0	0	1	561	44	4	4	131	10
GIGYF2	26058	broad.mit.edu	37	2	233710565	233710565	+	Silent	SNP	T	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233710565T>C	uc002vti.3	+	28	3766	c.3429T>C	c.(3427-3429)CTT>CTC	p.L1143L	GIGYF2_uc002vtj.3_Silent_p.L1164L|GIGYF2_uc002vtk.3_Silent_p.L1143L|GIGYF2_uc002vth.3_Silent_p.L1137L|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc002vtq.3_Silent_p.L476L	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	1143					cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AACAGATGCTTCATGCCCTTA	0.249													3	64	---	---	---	---	capture	Silent	SNP	233710565	233710565	GIGYF2	2	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	6317	10
UGT1A6	54578	broad.mit.edu	37	2	234602272	234602272	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234602272C>T	uc002vuv.3	+	1	761	c.622C>T	c.(622-624)CGA>TGA	p.R208*	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Nonsense_Mutation_p.R208*	NM_001072	NP_001063	P19224	UD16_HUMAN	UDP glycosyltransferase 1 family, polypeptide A6	208					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity				0		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)		TTTTTCCCAACGAGTGGCCAA	0.448													78	123	---	---	---	---	capture	Nonsense_Mutation	SNP	234602272	234602272	UGT1A6	2	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	16831	10
XKR7	343702	broad.mit.edu	37	20	30584453	30584453	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30584453C>T	uc002wxe.2	+	3	1107	c.933C>T	c.(931-933)GCC>GCT	p.A311A		NM_001011718	NP_001011718	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related	311						integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TCAGCATTGCCGCCCGCGGCC	0.637													26	84	---	---	---	---	capture	Silent	SNP	30584453	30584453	XKR7	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	17317	10
KIAA1755	85449	broad.mit.edu	37	20	36869819	36869819	+	Silent	SNP	G	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36869819G>C	uc002xhy.1	-	3	986	c.714C>G	c.(712-714)GGC>GGG	p.G238G	KIAA1755_uc002xhz.1_Silent_p.G238G	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	238										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				CATATGTCCTGCCCTTACCCT	0.582													46	98	---	---	---	---	capture	Silent	SNP	36869819	36869819	KIAA1755	20	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	8179	10
TOX2	84969	broad.mit.edu	37	20	42695486	42695486	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42695486C>G	uc002xlf.3	+	7	1436	c.1419C>G	c.(1417-1419)ATC>ATG	p.I473M	TOX2_uc010ggo.2_Missense_Mutation_p.I491M|TOX2_uc002xle.3_Missense_Mutation_p.I449M|TOX2_uc010ggp.2_Missense_Mutation_p.I449M|TOX2_uc002xlg.2_Missense_Mutation_p.I290M|TOX2_uc010zwk.1_Missense_Mutation_p.I369M	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	473					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			AGTGTGGCATCAGCACCTGCA	0.647													4	160	---	---	---	---	capture	Missense_Mutation	SNP	42695486	42695486	TOX2	20	C	G	G	G	1	0	0	0	0	1	0	0	0	369	29	4	4	16261	10
ZSWIM3	140831	broad.mit.edu	37	20	44506781	44506781	+	Silent	SNP	C	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44506781C>G	uc002xqd.2	+	2	1787	c.1584C>G	c.(1582-1584)GGC>GGG	p.G528G	ZSWIM3_uc010zxg.1_Silent_p.G522G	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	528							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				ACATGGCTGGCTCTTCAGTGG	0.547													15	36	---	---	---	---	capture	Silent	SNP	44506781	44506781	ZSWIM3	20	C	G	G	G	1	0	0	0	0	0	0	0	1	353	28	4	4	18118	10
TSHZ2	128553	broad.mit.edu	37	20	51871857	51871857	+	Silent	SNP	C	T	T	rs143642849		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:51871857C>T	uc002xwo.2	+	2	2816	c.1860C>T	c.(1858-1860)CAC>CAT	p.H620H		NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	620					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			AAAGTCCCCACGAAGAGGCCT	0.517													24	100	---	---	---	---	capture	Silent	SNP	51871857	51871857	TSHZ2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16507	10
TIMP3	7078	broad.mit.edu	37	22	33255261	33255261	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:33255261A>C	uc003anb.2	+	5	1719	c.533A>C	c.(532-534)CAG>CCG	p.Q178P	SYN3_uc003amx.2_Intron|SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_000362	NP_000353	P35625	TIMP3_HUMAN	tissue inhibitor of metalloproteinase 3	178	Mediates interaction with EFEMP1.				negative regulation of membrane protein ectodomain proteolysis|visual perception		metal ion binding|metalloendopeptidase inhibitor activity|protein binding			lung(1)	1						CCTGGCTACCAGTCCAAACAC	0.557													17	24	---	---	---	---	capture	Missense_Mutation	SNP	33255261	33255261	TIMP3	22	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	15804	10
NHP2L1	4809	broad.mit.edu	37	22	42071074	42071074	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42071074G>A	uc003bat.2	-	3	444	c.250C>T	c.(250-252)CGC>TGC	p.R84C	NHP2L1_uc003bau.2_Missense_Mutation_p.R84C|NHP2L1_uc003bav.2_Missense_Mutation_p.R84C|NHP2L1_uc003baw.2_Missense_Mutation_p.R84C	NM_005008	NP_004999	P55769	NH2L1_HUMAN	NHP2 non-histone chromosome protein 2-like 1	84					nuclear mRNA splicing, via spliceosome|ribosome biogenesis	box C/D snoRNP complex|nucleoplasm|spliceosomal complex	protein binding|RNA binding				0						TGCTTGGAGCGCACAAACACG	0.577													4	108	---	---	---	---	capture	Missense_Mutation	SNP	42071074	42071074	NHP2L1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10317	10
OR5K3	403277	broad.mit.edu	37	3	98109856	98109856	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98109856C>T	uc011bgw.1	+	1	347	c.347C>T	c.(346-348)GCG>GTG	p.A116V		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTTCTTCTGGCGGCAATGGCC	0.453													66	134	---	---	---	---	capture	Missense_Mutation	SNP	98109856	98109856	OR5K3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11072	10
RTP1	132112	broad.mit.edu	37	3	186917654	186917654	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186917654G>A	uc003frg.2	+	2	618	c.588G>A	c.(586-588)GAG>GAA	p.E196E		NM_153708	NP_714919	P59025	RTP1_HUMAN	receptor transporting protein 1	196	Cytoplasmic (Potential).				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding			ovary(2)|breast(1)	3	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CCTGCCAGGAGGGCATCGTGC	0.692													12	33	---	---	---	---	capture	Silent	SNP	186917654	186917654	RTP1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	13625	10
ADAMTS16	170690	broad.mit.edu	37	5	5262831	5262831	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:5262831C>A	uc003jdl.2	+	18	2862	c.2724C>A	c.(2722-2724)TTC>TTA	p.F908L	ADAMTS16_uc003jdk.1_Missense_Mutation_p.F908L	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	908	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ATATGTCCTTCTGCAATCCCA	0.498													37	49	---	---	---	---	capture	Missense_Mutation	SNP	5262831	5262831	ADAMTS16	5	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	261	10
HCN1	348980	broad.mit.edu	37	5	45462085	45462085	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45462085C>G	uc003jok.2	-	3	899	c.874G>C	c.(874-876)GCC>CCC	p.A292P		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	292	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ACTGCACTGGCGAGATCATAT	0.378													6	26	---	---	---	---	capture	Missense_Mutation	SNP	45462085	45462085	HCN1	5	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	6922	10
PCDHB4	56131	broad.mit.edu	37	5	140502131	140502131	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140502131A>T	uc003lip.1	+	1	551	c.551A>T	c.(550-552)CAT>CTT	p.H184L		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	184	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCGAAATCATAGTGAGGGC	0.478													4	52	---	---	---	---	capture	Missense_Mutation	SNP	140502131	140502131	PCDHB4	5	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	11447	10
EZR	7430	broad.mit.edu	37	6	159206603	159206603	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159206603C>A	uc003qrt.3	-	4	420	c.205G>T	c.(205-207)GAG>TAG	p.E69*	EZR_uc011efs.1_Nonsense_Mutation_p.E37*|EZR_uc003qru.3_Nonsense_Mutation_p.E69*	NM_003379	NP_003370	P15311	EZRI_HUMAN	ezrin	69	FERM.				actin filament bundle assembly|axon guidance|cytoskeletal anchoring at plasma membrane|leukocyte cell-cell adhesion|membrane to membrane docking|regulation of cell shape	actin filament|apical plasma membrane|basolateral plasma membrane|cortical cytoskeleton|cytosol|extrinsic to membrane|filopodium|microvillus membrane|nucleolus|ruffle membrane	actin filament binding|cell adhesion molecule binding			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		TTCCTGACCTCCTGGGCAGAC	0.537													15	23	---	---	---	---	capture	Nonsense_Mutation	SNP	159206603	159206603	EZR	6	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	5289	10
VOPP1	81552	broad.mit.edu	37	7	55588786	55588786	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55588786C>T	uc003tqs.2	-	2	275	c.92G>A	c.(91-93)GGA>GAA	p.G31E	VOPP1_uc003tqq.2_Missense_Mutation_p.G22E|VOPP1_uc010kzh.2_Missense_Mutation_p.G28E|VOPP1_uc010kzi.2_Missense_Mutation_p.G14E|VOPP1_uc011kcr.1_5'UTR	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN	EGFR-coamplified and overexpressed protein	31	Extracellular (Potential).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0						TGGATAGAGTCCTTCGAAATA	0.408													8	209	---	---	---	---	capture	Missense_Mutation	SNP	55588786	55588786	VOPP1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	17066	10
PCLO	27445	broad.mit.edu	37	7	82390725	82390725	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82390725A>G	uc003uhx.2	-	23	15381	c.15092T>C	c.(15091-15093)CTC>CCC	p.L5031P		NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4954	C2 2.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TCTGCATTGGAGAATTTCAAC	0.308													14	15	---	---	---	---	capture	Missense_Mutation	SNP	82390725	82390725	PCLO	7	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	11486	10
PCLO	27445	broad.mit.edu	37	7	82586181	82586181	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82586181G>A	uc003uhx.2	-	5	4377	c.4088C>T	c.(4087-4089)ACG>ATG	p.T1363M	PCLO_uc003uhv.2_Missense_Mutation_p.T1363M	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1294					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AGAATATCCCGTGTCGCTCAG	0.428													23	54	---	---	---	---	capture	Missense_Mutation	SNP	82586181	82586181	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11486	10
TFEC	22797	broad.mit.edu	37	7	115614228	115614228	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:115614228C>T	uc003vhj.1	-	3	447	c.263G>A	c.(262-264)AGA>AAA	p.R88K	TFEC_uc003vhk.1_Intron|TFEC_uc003vhl.3_Intron|TFEC_uc011kmw.1_Missense_Mutation_p.R178K	NM_012252	NP_036384	O14948	TFEC_HUMAN	transcription factor EC isoform a	88	Necessary for transcriptional transactivation.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			ACTTACTGTTCTTTGCATTAG	0.358													20	46	---	---	---	---	capture	Missense_Mutation	SNP	115614228	115614228	TFEC	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	15687	10
CNTNAP2	26047	broad.mit.edu	37	7	147259316	147259316	+	Silent	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147259316C>T	uc003weu.1	+	12	2380	c.1864C>T	c.(1864-1866)CTG>TTG	p.L622L		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	622	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGCGGACCTCTGGGGCCTCT	0.408										HNSCC(39;0.1)			25	77	---	---	---	---	capture	Silent	SNP	147259316	147259316	CNTNAP2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	3612	10
DEFB135	613209	broad.mit.edu	37	8	11842018	11842018	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11842018C>G	uc003wuw.1	+	2	153	c.153C>G	c.(151-153)AAC>AAG	p.N51K		NM_001033017	NP_001028189	Q30KP9	DB135_HUMAN	beta-defensin 135 precursor	51					defense response to bacterium	extracellular region					0						GTCTAAAAAACGAACAATATC	0.383													41	103	---	---	---	---	capture	Missense_Mutation	SNP	11842018	11842018	DEFB135	8	C	G	G	G	1	0	0	0	0	1	0	0	0	246	19	4	4	4377	10
SLCO5A1	81796	broad.mit.edu	37	8	70667821	70667821	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70667821A>T	uc003xyl.2	-	4	1803	c.1096T>A	c.(1096-1098)TTT>ATT	p.F366I	SLCO5A1_uc010lzb.2_Missense_Mutation_p.F366I|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Missense_Mutation_p.F366I|SLCO5A1_uc010lzc.2_Missense_Mutation_p.F366I	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	366	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GGGAAAGTAAACATTGGGAAT	0.353													22	29	---	---	---	---	capture	Missense_Mutation	SNP	70667821	70667821	SLCO5A1	8	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	14623	10
KCNB2	9312	broad.mit.edu	37	8	73848476	73848476	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73848476G>A	uc003xzb.2	+	3	1474	c.886G>A	c.(886-888)GTG>ATG	p.V296M		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	296					regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			GTTCCAAAACGTGAGGCGCGT	0.527													27	18	---	---	---	---	capture	Missense_Mutation	SNP	73848476	73848476	KCNB2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7935	10
COL22A1	169044	broad.mit.edu	37	8	139890128	139890128	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:139890128C>T	uc003yvd.2	-	3	970	c.523G>A	c.(523-525)GTG>ATG	p.V175M		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	175	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCCACGCCCACGGCAAAGATG	0.667										HNSCC(7;0.00092)			7	16	---	---	---	---	capture	Missense_Mutation	SNP	139890128	139890128	COL22A1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3646	10
PRPS2	5634	broad.mit.edu	37	X	12817486	12817486	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12817486G>A	uc004cvb.2	+	2	407	c.283G>A	c.(283-285)GCC>ACC	p.A95T	PRPS2_uc004cva.2_Missense_Mutation_p.A95T|PRPS2_uc010nec.2_Missense_Mutation_p.A28T	NM_002765	NP_002756	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	95					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0						TTTCCCATACGCCCGACAAGA	0.468													39	79	---	---	---	---	capture	Missense_Mutation	SNP	12817486	12817486	PRPS2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12476	10
PPP1R3F	89801	broad.mit.edu	37	X	49142412	49142412	+	Silent	SNP	C	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49142412C>G	uc004dnh.1	+	4	1276	c.1260C>G	c.(1258-1260)TCC>TCG	p.S420S	PPP1R3F_uc011mnd.1_Silent_p.S91S|PPP1R3F_uc004dni.2_Silent_p.S74S|PPP1R3F_uc004dnj.1_Silent_p.S74S	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory (inhibitor)	420	Extracellular (Potential).					integral to membrane				ovary(2)|skin(1)	3	Ovarian(276;0.236)					TTCCCCCCTCCTCCCCTCTCT	0.662													9	17	---	---	---	---	capture	Silent	SNP	49142412	49142412	PPP1R3F	23	C	G	G	G	1	0	0	0	0	0	0	0	1	301	24	4	4	12276	10
AWAT2	158835	broad.mit.edu	37	X	69262197	69262197	+	Silent	SNP	G	A	A			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69262197G>A	uc004dxt.1	-	6	693	c.687C>T	c.(685-687)GAC>GAT	p.D229D		NM_001002254	NP_001002254	Q6E213	AWAT2_HUMAN	wax synthase 2	229						endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity				0						GATCATAGAGGTCCGTCTCCC	0.502													19	35	---	---	---	---	capture	Silent	SNP	69262197	69262197	AWAT2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	1225	10
KLHL4	56062	broad.mit.edu	37	X	86873003	86873003	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:86873003C>T	uc004efb.2	+	4	978	c.796C>T	c.(796-798)CAG>TAG	p.Q266*	KLHL4_uc004efa.2_Nonsense_Mutation_p.Q266*	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	266						cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						GCAGCTGACTCAGGTCATTGA	0.418													32	46	---	---	---	---	capture	Nonsense_Mutation	SNP	86873003	86873003	KLHL4	23	C	T	T	T	1	0	0	0	0	0	1	0	0	377	29	5	2	8311	10
MCART6	401612	broad.mit.edu	37	X	103349047	103349047	+	Silent	SNP	C	T	T	rs138837474		TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103349047C>T	uc004elu.2	-	2	1075	c.894G>A	c.(892-894)TCG>TCA	p.S298S		NM_001012755	NP_001012773	Q5H9E4	MCAR6_HUMAN	mitochondrial carrier triple repeat 6	298	Solcar 3.				transport	integral to membrane|mitochondrial inner membrane					0						TCCTGGAGTGCGACTTCCTCT	0.502													23	58	---	---	---	---	capture	Silent	SNP	103349047	103349047	MCART6	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9284	10
KLHL13	90293	broad.mit.edu	37	X	117033178	117033178	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117033178A>T	uc004eql.2	-	7	1723	c.1661T>A	c.(1660-1662)GTC>GAC	p.V554D	KLHL13_uc004eqk.2_Missense_Mutation_p.V503D|KLHL13_uc011mtn.1_Missense_Mutation_p.V394D|KLHL13_uc011mto.1_Missense_Mutation_p.V548D|KLHL13_uc011mtp.1_Missense_Mutation_p.V556D|KLHL13_uc004eqm.2_Missense_Mutation_p.V503D|KLHL13_uc011mtq.1_Missense_Mutation_p.V538D	NM_033495	NP_277030	Q9P2N7	KLH13_HUMAN	kelch-like 13	554	Kelch 5.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex				kidney(1)|skin(1)	2						ACAGCTTAGGACATCATCATA	0.463													123	224	---	---	---	---	capture	Missense_Mutation	SNP	117033178	117033178	KLHL13	23	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	8289	10
THOC2	57187	broad.mit.edu	37	X	122820484	122820484	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122820484A>G	uc004etu.2	-	8	714	c.682T>C	c.(682-684)TTT>CTT	p.F228L	THOC2_uc011muh.1_Missense_Mutation_p.F149L|THOC2_uc011mui.1_Missense_Mutation_p.F113L	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	228					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						AAAGATATAAAGAAGTCATCG	0.368													43	82	---	---	---	---	capture	Missense_Mutation	SNP	122820484	122820484	THOC2	23	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	15750	10
OR5B17	219965	broad.mit.edu	37	11	58125932	58125932	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58125932delT	uc010rke.1	-	1	611	c.611delA	c.(610-612)AATfs	p.N204fs		NM_001005489	NP_001005489	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B,	204	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AAAAAAGACATTAAAACTTGA	0.368													16	41	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	58125932	58125932	OR5B17	11	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	11053	10
PAPD7	11044	broad.mit.edu	37	5	6737716	6737717	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:6737716_6737717delTG	uc003jdx.1	+	2	189_190	c.60_61delTG	c.(58-63)ACTGTGfs	p.T20fs	PAPD7_uc011cmn.1_Frame_Shift_Del_p.T11fs	NM_006999	NP_008930	Q5XG87	PAPD7_HUMAN	DNA polymerase sigma	20_21					cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1						GGATCGAAACTGTGGTGAAAGA	0.436													22	29	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	6737716	6737717	PAPD7	5	TG	-	-	-	1	0	1	0	1	0	0	0	0	704	55	5	5	11330	10
NIPBL	25836	broad.mit.edu	37	5	37051937	37051937	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0122-01	TCGA-06-0122-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:37051937delG	uc003jkl.3	+	41	7510	c.7011delG	c.(7009-7011)AAGfs	p.K2337fs	NIPBL_uc003jkk.3_Frame_Shift_Del_p.K2337fs|NIPBL_uc003jkn.2_Frame_Shift_Del_p.K30fs	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2337	HEAT 5.				brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TGCGGAACAAGGCTGATCAGC	0.318													10	48	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	37051937	37051937	NIPBL	5	G	-	-	-	1	0	1	0	1	0	0	0	0	451	35	5	5	10335	10
