Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PAFAH2	5051	broad.mit.edu	37	1	26314754	26314754	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26314754C>G	uc001bld.3	-	4	489	c.309G>C	c.(307-309)TTG>TTC	p.L103F	PAFAH2_uc001ble.3_Missense_Mutation_p.L103F	NM_000437	NP_000428	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2	103					lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding			ovary(2)	2		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		AGAAGATGATCAAGGGGTATC	0.517													89	149	---	---	---	---	capture	Missense_Mutation	SNP	26314754	26314754	PAFAH2	1	C	G	G	G	1	0	0	0	0	1	0	0	0	376	29	4	4	11291	12
PAFAH2	5051	broad.mit.edu	37	1	26315958	26315958	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:26315958C>T	uc001bld.3	-	3	405	c.225G>A	c.(223-225)TTG>TTA	p.L75L	PAFAH2_uc001ble.3_Silent_p.L75L	NM_000437	NP_000428	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2	75					lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding			ovary(2)	2		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		GGTTGAACAGCAAGCCCCCGC	0.592													24	56	---	---	---	---	capture	Silent	SNP	26315958	26315958	PAFAH2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	324	25	2	2	11291	12
HEATR1	55127	broad.mit.edu	37	1	236720633	236720633	+	Silent	SNP	C	T	T	rs138638506	byFrequency	TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236720633C>T	uc001hyd.1	-	37	5342	c.5217G>A	c.(5215-5217)TCG>TCA	p.S1739S	HEATR1_uc009xgh.1_Silent_p.S901S	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	1739					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTGTCAGCAACGATGGCATCA	0.498													20	41	---	---	---	---	capture	Silent	SNP	236720633	236720633	HEATR1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6954	12
RYR2	6262	broad.mit.edu	37	1	237540686	237540686	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237540686G>A	uc001hyl.1	+	8	647	c.527G>A	c.(526-528)CGA>CAA	p.R176Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	176	Cytoplasmic (By similarity).|MIR 2.		R -> Q (in ARVD2 and CPVT1).		cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAAAAGTACGAGTTGGAGAT	0.438													21	28	---	---	---	---	capture	Missense_Mutation	SNP	237540686	237540686	RYR2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13661	12
CHAT	1103	broad.mit.edu	37	10	50835688	50835688	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50835688G>A	uc001jhz.2	+	7	1121	c.968G>A	c.(967-969)CGT>CAT	p.R323H	CHAT_uc001jhv.1_Missense_Mutation_p.R205H|CHAT_uc001jhx.1_Missense_Mutation_p.R205H|CHAT_uc001jhy.1_Missense_Mutation_p.R205H|CHAT_uc001jia.2_Missense_Mutation_p.R205H|CHAT_uc010qgs.1_Missense_Mutation_p.R205H	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	323					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity	p.R323H(1)		central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	AATTTCCGCCGTCTCAGTGAG	0.512													130	28	---	---	---	---	capture	Missense_Mutation	SNP	50835688	50835688	CHAT	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3279	12
TYSND1	219743	broad.mit.edu	37	10	71905207	71905207	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:71905207G>A	uc001jqr.2	-	1	1290	c.1136C>T	c.(1135-1137)GCC>GTC	p.A379V	TYSND1_uc001jqq.2_Intron|TYSND1_uc001jqs.2_Missense_Mutation_p.A379V|TYSND1_uc001jqt.2_Intron	NM_173555	NP_775826	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1 isoform a	379	Serine protease.				proteolysis	peroxisome	serine-type endopeptidase activity			large_intestine(1)	1						CAGGACCCTGGCTGCTTCCCG	0.647													7	1	---	---	---	---	capture	Missense_Mutation	SNP	71905207	71905207	TYSND1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16699	12
KIAA0913	23053	broad.mit.edu	37	10	75560906	75560906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75560906C>T	uc009xrl.2	+	25	5295	c.5263C>T	c.(5263-5265)CCG>TCG	p.P1755S	KIAA0913_uc001jve.2_Missense_Mutation_p.P1760S|KIAA0913_uc001jvf.2_Missense_Mutation_p.P1573S|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.P1182S|KIAA0913_uc010qkr.1_Missense_Mutation_p.P1170S|KIAA0913_uc001jvj.2_Missense_Mutation_p.P1147L|KIAA0913_uc009xrn.1_3'UTR	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	1755							zinc ion binding			breast(1)	1	Prostate(51;0.0112)					CCTGCGTGCCCCGGCCTTCCA	0.622													2	2	---	---	---	---	capture	Missense_Mutation	SNP	75560906	75560906	KIAA0913	10	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8122	12
CNNM2	54805	broad.mit.edu	37	10	104678301	104678301	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104678301C>G	uc001kwm.2	+	1	188	c.64C>G	c.(64-66)CTG>GTG	p.L22V	CNNM2_uc001kwn.2_Missense_Mutation_p.L22V|CNNM2_uc001kwl.2_Missense_Mutation_p.L22V	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	22					ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		AGCCGCCGCACTGCCCACTTG	0.587													4	2	---	---	---	---	capture	Missense_Mutation	SNP	104678301	104678301	CNNM2	10	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	3578	12
OR51F1	256892	broad.mit.edu	37	11	4790251	4790251	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4790251T>A	uc010qyl.1	-	1	897	c.897A>T	c.(895-897)AAA>AAT	p.K299N		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	299						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGCGGATTTGTTTTGTTTTTA	0.438													51	75	---	---	---	---	capture	Missense_Mutation	SNP	4790251	4790251	OR51F1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	777	60	4	4	11000	12
TEAD1	7003	broad.mit.edu	37	11	12901370	12901370	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:12901370C>T	uc001mkj.3	+	6	1066	c.401C>T	c.(400-402)ACC>ATC	p.T134I	TEAD1_uc001mkk.3_Missense_Mutation_p.T53I|TEAD1_uc009ygl.2_Missense_Mutation_p.T28I	NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1	149	Pro-rich.				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CCACGCCCGACCTTCCCAGGG	0.612													26	52	---	---	---	---	capture	Missense_Mutation	SNP	12901370	12901370	TEAD1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	15623	12
OR5W2	390148	broad.mit.edu	37	11	55681774	55681774	+	Silent	SNP	A	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681774A>G	uc010rir.1	-	1	285	c.285T>C	c.(283-285)TAT>TAC	p.Y95Y		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GAGCACAGCCATAGAAGGGTA	0.463													67	68	---	---	---	---	capture	Silent	SNP	55681774	55681774	OR5W2	11	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	11089	12
OR5M3	219482	broad.mit.edu	37	11	56237921	56237921	+	Missense_Mutation	SNP	C	T	T	rs142752109		TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56237921C>T	uc010rjk.1	-	1	53	c.53G>A	c.(52-54)CGT>CAT	p.R18H		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					CCATTCTCGACGGCTCGTTAG	0.398													5	98	---	---	---	---	capture	Missense_Mutation	SNP	56237921	56237921	OR5M3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11079	12
CD248	57124	broad.mit.edu	37	11	66084085	66084085	+	Silent	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66084085G>A	uc001ohm.1	-	1	431	c.414C>T	c.(412-414)GGC>GGT	p.G138G		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	138	C-type lectin.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	AGCGGTGCTCGCCACTTGCCT	0.706													14	17	---	---	---	---	capture	Silent	SNP	66084085	66084085	CD248	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2960	12
C1S	716	broad.mit.edu	37	12	7177424	7177424	+	Silent	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7177424G>A	uc001qsj.2	+	15	2255	c.1536G>A	c.(1534-1536)CCG>CCA	p.P512P	C1S_uc001qsk.2_Silent_p.P512P|C1S_uc001qsl.2_Silent_p.P512P|C1S_uc009zfr.2_Silent_p.P345P|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	512	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	TTATTCATCCGGGATGGAAGC	0.507													32	26	---	---	---	---	capture	Silent	SNP	7177424	7177424	C1S	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	1956	12
A2M	2	broad.mit.edu	37	12	9254170	9254170	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9254170T>C	uc001qvk.1	-	12	1480	c.1367A>G	c.(1366-1368)AAG>AGG	p.K456R	A2M_uc009zgk.1_Missense_Mutation_p.K306R	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	456					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	GACAAAGCTCTTGCTTGGGGA	0.507													39	25	---	---	---	---	capture	Missense_Mutation	SNP	9254170	9254170	A2M	12	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	4	12
KRT74	121391	broad.mit.edu	37	12	52964563	52964563	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52964563C>T	uc001sap.1	-	5	946	c.898G>A	c.(898-900)GAC>AAC	p.D300N		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	300	Rod.|Linker 12.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)		CGGTTGTTGTCCATGGACAGG	0.572													24	53	---	---	---	---	capture	Missense_Mutation	SNP	52964563	52964563	KRT74	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8407	12
FLT3	2322	broad.mit.edu	37	13	28644701	28644701	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28644701G>A	uc001urw.2	-	2	174	c.92C>T	c.(91-93)CCT>CTT	p.P31L	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.P31L	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	31	Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity	p.P31L(1)		haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	CTTGATCACAGGCAGATCTTG	0.299			Mis|O		AML|ALL								75	86	---	---	---	---	capture	Missense_Mutation	SNP	28644701	28644701	FLT3	13	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	5886	12
C14orf183	196913	broad.mit.edu	37	14	50550652	50550652	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50550652C>T	uc010tqk.1	-	5	692	c.692G>A	c.(691-693)CGC>CAC	p.R231H		NM_001014830	NP_001014830	Q8WXQ3	CN183_HUMAN	hypothetical protein LOC196913	231											0						CTCTTGGAGGCGAGGTGGGGC	0.662													7	9	---	---	---	---	capture	Missense_Mutation	SNP	50550652	50550652	C14orf183	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1752	12
GPR65	8477	broad.mit.edu	37	14	88478002	88478002	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88478002A>T	uc001xvv.2	+	2	1341	c.811A>T	c.(811-813)ATG>TTG	p.M271L		NM_003608	NP_003599	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	271	Extracellular (Potential).				actin cytoskeleton reorganization|activation of Rho GTPase activity|apoptosis|immune response|multicellular organismal development|positive regulation of cAMP biosynthetic process|positive regulation of stress fiber assembly|response to acidity	integral to plasma membrane	G-protein coupled receptor activity				0						AACTTACACAATGTATAGAAT	0.383													60	86	---	---	---	---	capture	Missense_Mutation	SNP	88478002	88478002	GPR65	14	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	6639	12
SERPINA1	5265	broad.mit.edu	37	14	94845837	94845837	+	Silent	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94845837G>A	uc001ycx.3	-	4	1290	c.1029C>T	c.(1027-1029)TCC>TCT	p.S343S	SERPINA1_uc001ycw.3_RNA|SERPINA1_uc010auw.2_Silent_p.S343S|SERPINA1_uc010aux.2_Silent_p.S343S|SERPINA1_uc001ycy.3_Silent_p.S343S|SERPINA1_uc010auy.2_Silent_p.S343S|SERPINA1_uc001ycz.3_Silent_p.S343S|SERPINA1_uc010auz.2_Silent_p.S343S|SERPINA1_uc010ava.2_Silent_p.S343S|SERPINA1_uc001ydb.3_Silent_p.S343S|SERPINA1_uc010avb.2_Silent_p.S343S|SERPINA1_uc001ydc.3_Silent_p.S343S|SERPINA1_uc001yda.1_Silent_p.S343S	NM_000295	NP_000286	P01009	A1AT_HUMAN	serine proteinase inhibitor, clade A, member 1	343					acute-phase response|platelet activation|platelet degranulation|regulation of proteolysis	extracellular space|platelet alpha granule lumen|proteinaceous extracellular matrix	protease binding|serine-type endopeptidase inhibitor activity			skin(1)	1		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)	Alpha-1-proteinase inhibitor(DB00058)	CTGTGACCCCGGAGAGGTCAG	0.542									Alpha-1-Antitrypsin_Deficiency				77	119	---	---	---	---	capture	Silent	SNP	94845837	94845837	SERPINA1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13979	12
TCL1B	9623	broad.mit.edu	37	14	96152931	96152931	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96152931C>T	uc001yez.2	+	1	169	c.127C>T	c.(127-129)CGT>TGT	p.R43C	TCL1B_uc001yew.2_Intron|TCL1B_uc001yex.2_Intron|TCL1B_uc010avj.2_Intron|TCL1B_uc001yfa.2_Missense_Mutation_p.R43C	NM_004918	NP_004909	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	43										ovary(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		CAATCCCTCGCGTAGGGAATG	0.672													28	22	---	---	---	---	capture	Missense_Mutation	SNP	96152931	96152931	TCL1B	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15590	12
AHNAK2	113146	broad.mit.edu	37	14	105420774	105420774	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105420774C>T	uc010axc.1	-	7	1134	c.1014G>A	c.(1012-1014)TCG>TCA	p.S338S	AHNAK2_uc001ypx.2_Silent_p.S238S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	338						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGTCCTGTCGATGAAGGGC	0.667													22	16	---	---	---	---	capture	Silent	SNP	105420774	105420774	AHNAK2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	415	12
GPR132	29933	broad.mit.edu	37	14	105517549	105517549	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105517549C>T	uc001yqd.2	-	4	1824	c.925G>A	c.(925-927)GTG>ATG	p.V309M	GPR132_uc001yqc.2_Missense_Mutation_p.V121M|GPR132_uc001yqe.2_Missense_Mutation_p.V300M	NM_013345	NP_037477	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	309	Helical; Name=7; (Potential).				response to stress	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		GTGGCCAGCACGTAGATAATG	0.577													35	55	---	---	---	---	capture	Missense_Mutation	SNP	105517549	105517549	GPR132	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6576	12
MYH11	4629	broad.mit.edu	37	16	15835524	15835524	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15835524C>T	uc002ddy.2	-	22	2762	c.2655G>A	c.(2653-2655)CTG>CTA	p.L885L	MYH11_uc002ddv.2_Silent_p.L892L|MYH11_uc002ddw.2_Silent_p.L885L|MYH11_uc002ddx.2_Silent_p.L892L|MYH11_uc010bvg.2_Silent_p.L717L	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	885	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						TCTCCTCGGTCAGCTGCACGC	0.637			T	CBFB	AML								68	101	---	---	---	---	capture	Silent	SNP	15835524	15835524	MYH11	16	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	9941	12
NDRG4	65009	broad.mit.edu	37	16	58538057	58538057	+	Splice_Site	SNP	G	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58538057G>C	uc002eno.2	+	3	234	c.128_splice	c.e3-1	p.H43_splice	NDRG4_uc002enk.2_Splice_Site_p.H75_splice|NDRG4_uc002enm.2_Splice_Site_p.H95_splice|NDRG4_uc010vif.1_Splice_Site_p.H75_splice|NDRG4_uc010cdk.2_Splice_Site_p.D61_splice|NDRG4_uc010vig.1_Splice_Site_p.H73_splice|NDRG4_uc010vih.1_Splice_Site|NDRG4_uc010vii.1_Splice_Site_p.H61_splice|NDRG4_uc002enp.2_Splice_Site_p.H43_splice|NDRG4_uc002enq.1_5'Flank	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1						TGTCTTTGCAGACAAACTATG	0.577													69	110	---	---	---	---	capture	Splice_Site	SNP	58538057	58538057	NDRG4	16	G	C	C	C	1	0	0	0	0	0	0	1	0	429	33	5	4	10161	12
CNOT1	23019	broad.mit.edu	37	16	58559906	58559906	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58559906C>T	uc002env.2	-	45	6883	c.6590G>A	c.(6589-6591)CGC>CAC	p.R2197H	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.R2192H|CNOT1_uc002ent.2_Missense_Mutation_p.R135H|CNOT1_uc010vik.1_Missense_Mutation_p.R1154H	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2197					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TAGGTTGCTGCGCAGATCAGA	0.413													4	151	---	---	---	---	capture	Missense_Mutation	SNP	58559906	58559906	CNOT1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3582	12
CDYL2	124359	broad.mit.edu	37	16	80646527	80646527	+	Missense_Mutation	SNP	G	A	A	rs145890469		TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:80646527G>A	uc002ffs.2	-	5	1319	c.1214C>T	c.(1213-1215)GCG>GTG	p.A405V		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	405						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1						GCTTACCAGCGCGACGCCCAG	0.622													35	47	---	---	---	---	capture	Missense_Mutation	SNP	80646527	80646527	CDYL2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3155	12
GNGT2	2793	broad.mit.edu	37	17	47284767	47284767	+	Silent	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47284767G>A	uc002ioo.1	-	3	325	c.18C>T	c.(16-18)AGC>AGT	p.S6S	ABI3_uc002ioq.1_5'Flank|ABI3_uc002iop.1_5'Flank	NM_031498	NP_113686	O14610	GBGT2_HUMAN	guanine nucleotide binding protein-gamma	6					G-protein coupled receptor protein signaling pathway|phototransduction|synaptic transmission	extracellular region|heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GGTCCTTCTCGCTGAGATCCT	0.537													157	211	---	---	---	---	capture	Silent	SNP	47284767	47284767	GNGT2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	6470	12
TNRC6C	57690	broad.mit.edu	37	17	76082938	76082938	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76082938C>T	uc002jud.2	+	14	4166	c.3566C>T	c.(3565-3567)GCG>GTG	p.A1189V	TNRC6C_uc002juf.2_Missense_Mutation_p.A1186V	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2	1189	Potential.				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TGCCAGGTTGCGCGCACAATC	0.592													4	197	---	---	---	---	capture	Missense_Mutation	SNP	76082938	76082938	TNRC6C	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16225	12
TCEB3B	51224	broad.mit.edu	37	18	44561319	44561319	+	Missense_Mutation	SNP	T	C	C	rs146911955	byFrequency	TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44561319T>C	uc002lcr.1	-	1	670	c.317A>G	c.(316-318)CAG>CGG	p.Q106R	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	106					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GGCCTTTTCCTGGTCCTGAAG	0.652													4	63	---	---	---	---	capture	Missense_Mutation	SNP	44561319	44561319	TCEB3B	18	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	15569	12
TCEB3B	51224	broad.mit.edu	37	18	44561321	44561321	+	Missense_Mutation	SNP	G	C	C	rs138936821	byFrequency	TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:44561321G>C	uc002lcr.1	-	1	668	c.315C>G	c.(313-315)GAC>GAG	p.D105E	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	105					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						CCTTTTCCTGGTCCTGAAGAG	0.662													3	58	---	---	---	---	capture	Missense_Mutation	SNP	44561321	44561321	TCEB3B	18	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	15569	12
NFATC1	4772	broad.mit.edu	37	18	77227543	77227543	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77227543C>T	uc010xfg.1	+	8	2506	c.2053C>T	c.(2053-2055)CGA>TGA	p.R685*	NFATC1_uc002lnc.1_Nonsense_Mutation_p.R685*|NFATC1_uc010xff.1_3'UTR|NFATC1_uc002lnd.2_Nonsense_Mutation_p.R685*|NFATC1_uc002lne.2_Nonsense_Mutation_p.R213*|NFATC1_uc010xfh.1_Nonsense_Mutation_p.R685*|NFATC1_uc010xfi.1_Nonsense_Mutation_p.R672*|NFATC1_uc010xfj.1_Nonsense_Mutation_p.R213*|NFATC1_uc002lnf.2_Nonsense_Mutation_p.R672*|NFATC1_uc002lng.2_Nonsense_Mutation_p.R672*|NFATC1_uc010xfk.1_Nonsense_Mutation_p.R672*	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	685					intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		GAAGAGAAAGCGAAGCCAGTA	0.522													9	43	---	---	---	---	capture	Nonsense_Mutation	SNP	77227543	77227543	NFATC1	18	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	10268	12
MUC16	94025	broad.mit.edu	37	19	9087317	9087317	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9087317A>G	uc002mkp.2	-	1	4702	c.4498T>C	c.(4498-4500)TCA>CCA	p.S1500P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1500	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTGACTTTGAAAGTTCATGA	0.428													147	284	---	---	---	---	capture	Missense_Mutation	SNP	9087317	9087317	MUC16	19	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	9883	12
ZNF653	115950	broad.mit.edu	37	19	11598332	11598332	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11598332C>T	uc002mrz.1	-	4	999	c.946G>A	c.(946-948)GGC>AGC	p.G316S		NM_138783	NP_620138	Q96CK0	ZN653_HUMAN	zinc finger protein 653	316					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACCTGTGAGCCGGGCACCATG	0.672													41	87	---	---	---	---	capture	Missense_Mutation	SNP	11598332	11598332	ZNF653	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17944	12
ZNF829	374899	broad.mit.edu	37	19	37383097	37383097	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37383097A>G	uc002ofa.1	-	6	958	c.596T>C	c.(595-597)GTT>GCT	p.V199A	ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	199	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGTCGAGTAACGAGTGAGCC	0.373													59	129	---	---	---	---	capture	Missense_Mutation	SNP	37383097	37383097	ZNF829	19	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	18058	12
MARK4	57787	broad.mit.edu	37	19	45781188	45781188	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45781188G>A	uc002pbb.1	+	9	799	c.794G>A	c.(793-795)CGG>CAG	p.R265Q	MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Missense_Mutation_p.R265Q|MARK4_uc002pbc.1_Missense_Mutation_p.R131Q			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;	265	Protein kinase.				microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CAGGAGCTGCGGGAGCGAGTA	0.468													50	117	---	---	---	---	capture	Missense_Mutation	SNP	45781188	45781188	MARK4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9228	12
SLC8A2	6543	broad.mit.edu	37	19	47960816	47960816	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47960816C>T	uc002pgx.2	-	3	989	c.711G>A	c.(709-711)CCG>CCA	p.P237P	SLC8A2_uc010xyq.1_5'UTR|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Silent_p.P237P	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor	237	Helical; (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CCACGCACACCGGGAAGAAGA	0.587													10	44	---	---	---	---	capture	Silent	SNP	47960816	47960816	SLC8A2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14599	12
SLC17A7	57030	broad.mit.edu	37	19	49933892	49933892	+	Missense_Mutation	SNP	C	T	T	rs150211751		TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49933892C>T	uc002pnp.2	-	12	1739	c.1567G>A	c.(1567-1569)GAA>AAA	p.E523K	SLC17A7_uc002pno.2_Missense_Mutation_p.E185K	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	523	Cytoplasmic (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		TCCTCCATTTCGCTGTCGTCA	0.662													29	80	---	---	---	---	capture	Missense_Mutation	SNP	49933892	49933892	SLC17A7	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14315	12
KLK14	43847	broad.mit.edu	37	19	51582885	51582885	+	Missense_Mutation	SNP	C	T	T	rs61998181	by1000genomes	TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51582885C>T	uc002pvs.1	-	5	554	c.335G>A	c.(334-336)CGT>CAT	p.R112H		NM_022046	NP_071329	Q9P0G3	KLK14_HUMAN	kallikrein 14 preproprotein	112	Peptidase S1.				epidermis morphogenesis|fertilization|negative regulation of G-protein coupled receptor protein signaling pathway|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis|seminal clot liquefaction	extracellular space	serine-type endopeptidase activity			skin(1)	1		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		CGTCACCTGACGAACCACGCG	0.657													7	30	---	---	---	---	capture	Missense_Mutation	SNP	51582885	51582885	KLK14	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8322	12
SIGLEC8	27181	broad.mit.edu	37	19	51958738	51958738	+	Nonsense_Mutation	SNP	G	A	A	rs141833256		TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51958738G>A	uc002pwt.2	-	4	1052	c.985C>T	c.(985-987)CGA>TGA	p.R329*	SIGLEC8_uc010yda.1_Nonsense_Mutation_p.R220*|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Nonsense_Mutation_p.R236*	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	329	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity	p.R329Q(1)		ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		TTCTGAGCTCGGCAGGTGAAT	0.637													26	54	---	---	---	---	capture	Nonsense_Mutation	SNP	51958738	51958738	SIGLEC8	19	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	14207	12
ZNF813	126017	broad.mit.edu	37	19	53994691	53994691	+	Missense_Mutation	SNP	G	A	A	rs140206311	by1000genomes	TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53994691G>A	uc002qbu.2	+	4	1333	c.1205G>A	c.(1204-1206)CGT>CAT	p.R402H	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	402	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		AAATGCCATCGTAGACTTCAT	0.408													65	157	---	---	---	---	capture	Missense_Mutation	SNP	53994691	53994691	ZNF813	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18051	12
ZNF274	10782	broad.mit.edu	37	19	58723898	58723898	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58723898C>T	uc002qrq.1	+	10	1810	c.1351C>T	c.(1351-1353)CGC>TGC	p.R451C	ZNF274_uc002qrr.1_Missense_Mutation_p.R419C|ZNF274_uc002qrs.1_Missense_Mutation_p.R346C|ZNF274_uc010eum.1_Missense_Mutation_p.R210C	NM_133502	NP_598009	Q96GC6	ZN274_HUMAN	zinc finger protein 274 isoform c	451					viral reproduction	centrosome|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		AAAACGATTGCGCAAACGTGA	0.428													45	129	---	---	---	---	capture	Missense_Mutation	SNP	58723898	58723898	ZNF274	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17689	12
EMILIN1	11117	broad.mit.edu	37	2	27306459	27306459	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27306459G>A	uc002rii.3	+	4	2448	c.2020G>A	c.(2020-2022)GAT>AAT	p.D674N	EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	674					cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAGGGCGCTGATCTGGCTGA	0.562													45	55	---	---	---	---	capture	Missense_Mutation	SNP	27306459	27306459	EMILIN1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	5048	12
COL3A1	1281	broad.mit.edu	37	2	189859003	189859003	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:189859003G>A	uc002uqj.1	+	18	1355	c.1238G>A	c.(1237-1239)CGG>CAG	p.R413Q	COL3A1_uc010frw.1_RNA	NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	413	Triple-helical region.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	ATGGGAGCCCGGGGTCCTCCA	0.488													38	68	---	---	---	---	capture	Missense_Mutation	SNP	189859003	189859003	COL3A1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3653	12
ECEL1	9427	broad.mit.edu	37	2	233347307	233347307	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233347307G>A	uc002vsv.2	-	11	1902	c.1697C>T	c.(1696-1698)CCC>CTC	p.P566L	ECEL1_uc010fya.1_Missense_Mutation_p.P564L|ECEL1_uc010fyb.1_Missense_Mutation_p.P273L	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	566	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CGCCTGTGGGGGGAGCAGCCA	0.617													72	89	---	---	---	---	capture	Missense_Mutation	SNP	233347307	233347307	ECEL1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	4846	12
DTD1	92675	broad.mit.edu	37	20	18576672	18576672	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:18576672C>T	uc002wrf.3	+	3	318	c.157C>T	c.(157-159)CGT>TGT	p.R53C		NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	53					D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2						TCTAAACCTGCGTGTATTTGA	0.493													23	101	---	---	---	---	capture	Missense_Mutation	SNP	18576672	18576672	DTD1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4741	12
XKR7	343702	broad.mit.edu	37	20	30585031	30585031	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30585031G>A	uc002wxe.2	+	3	1685	c.1511G>A	c.(1510-1512)CGG>CAG	p.R504Q		NM_001011718	NP_001011718	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related	504						integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TTCCAGGTGCGGCCTGGCTTG	0.677													43	88	---	---	---	---	capture	Missense_Mutation	SNP	30585031	30585031	XKR7	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17317	12
DNMT3B	1789	broad.mit.edu	37	20	31386409	31386409	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31386409G>A	uc002wyc.2	+	15	1955	c.1634G>A	c.(1633-1635)CGC>CAC	p.R545H	DNMT3B_uc010ztx.1_RNA|DNMT3B_uc010zty.1_RNA|DNMT3B_uc002wyd.2_Missense_Mutation_p.R525H|DNMT3B_uc002wye.2_Missense_Mutation_p.R525H|DNMT3B_uc010gee.2_RNA|DNMT3B_uc010gef.2_RNA|DNMT3B_uc010ztz.1_Missense_Mutation_p.R483H|DNMT3B_uc010zua.1_Missense_Mutation_p.R449H|DNMT3B_uc002wyf.2_Missense_Mutation_p.R537H|DNMT3B_uc002wyg.2_Missense_Mutation_p.R244H|DNMT3B_uc010geg.2_5'Flank|DNMT3B_uc010geh.2_5'Flank	NM_006892	NP_008823	Q9UBC3	DNM3B_HUMAN	DNA cytosine-5 methyltransferase 3 beta isoform	545	ADD.				negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5						TGGAACGTGCGCCTGCAGGCC	0.627													38	87	---	---	---	---	capture	Missense_Mutation	SNP	31386409	31386409	DNMT3B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4633	12
SFRS6	6431	broad.mit.edu	37	20	42089538	42089538	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42089538G>C	uc010zwg.1	+	6	1040	c.870G>C	c.(868-870)AAG>AAC	p.K290N	SFRS6_uc002xki.2_Missense_Mutation_p.K161N|SFRS6_uc002xkk.2_Intron	NM_006275	NP_006266	Q13247	SRSF6_HUMAN	arginine/serine-rich splicing factor 6	290	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GTGATATAAAGTCAAAATCCA	0.488													12	122	---	---	---	---	capture	Missense_Mutation	SNP	42089538	42089538	SFRS6	20	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	14074	12
NPBWR2	2832	broad.mit.edu	37	20	62737203	62737203	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62737203G>A	uc011abt.1	-	1	982	c.982C>T	c.(982-984)CGC>TGC	p.R328C		NM_005286	NP_005277	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	328	Cytoplasmic (Potential).					plasma membrane	opioid receptor activity|protein binding			large_intestine(1)	1	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					AATATGCTGCGGAAGTTCTTC	0.383													21	47	---	---	---	---	capture	Missense_Mutation	SNP	62737203	62737203	NPBWR2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10476	12
FBLN2	2199	broad.mit.edu	37	3	13679191	13679191	+	Silent	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13679191G>A	uc011avb.1	+	17	3452	c.3327G>A	c.(3325-3327)GCG>GCA	p.A1109A	FBLN2_uc011auz.1_Silent_p.A1135A|FBLN2_uc011ava.1_Silent_p.A1156A|FBLN2_uc011avc.1_Silent_p.A1156A	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	1109	Domain III.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			TTGGCCCCGCGCCAGCCTTCA	0.622													15	23	---	---	---	---	capture	Silent	SNP	13679191	13679191	FBLN2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5645	12
CTNNB1	1499	broad.mit.edu	37	3	41275669	41275669	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:41275669G>A	uc010hia.1	+	11	1720	c.1564G>A	c.(1564-1566)GCA>ACA	p.A522T	CTNNB1_uc003ckp.2_Missense_Mutation_p.A522T|CTNNB1_uc003ckq.2_Missense_Mutation_p.A522T|CTNNB1_uc003ckr.2_Missense_Mutation_p.A522T|CTNNB1_uc011azf.1_Missense_Mutation_p.A515T|CTNNB1_uc011azg.1_Missense_Mutation_p.A450T|CTNNB1_uc003cks.2_3'UTR|CTNNB1_uc003ckt.1_5'Flank	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	522	ARM 9.				adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	CCTTTGTCCCGCAAATCATGC	0.468		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				5	143	---	---	---	---	capture	Missense_Mutation	SNP	41275669	41275669	CTNNB1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3979	12
TGM4	7047	broad.mit.edu	37	3	44929232	44929232	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:44929232C>T	uc003coc.3	+	3	318	c.245C>T	c.(244-246)ACG>ATG	p.T82M	TGM4_uc003coa.2_Missense_Mutation_p.T82M|TGM4_uc003cob.2_Intron	NM_003241	NP_003232	P49221	TGM4_HUMAN	transglutaminase 4 (prostate)	82					peptide cross-linking|protein polyamination		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GACCCGAGGACGCCCTCAGAC	0.617													21	36	---	---	---	---	capture	Missense_Mutation	SNP	44929232	44929232	TGM4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15717	12
CACNA1D	776	broad.mit.edu	37	3	53756373	53756373	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53756373G>A	uc003dgv.3	+	12	1701	c.1538G>A	c.(1537-1539)CGC>CAC	p.R513H	CACNA1D_uc003dgu.3_Missense_Mutation_p.R533H|CACNA1D_uc003dgy.3_Missense_Mutation_p.R513H|CACNA1D_uc003dgw.3_Missense_Mutation_p.R180H	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	513	Cytoplasmic (Potential).|II.				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	CGATTCAATCGCAGAAGATGT	0.453													38	48	---	---	---	---	capture	Missense_Mutation	SNP	53756373	53756373	CACNA1D	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2517	12
PRR23B	389151	broad.mit.edu	37	3	138739098	138739098	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138739098C>T	uc003esy.1	-	1	671	c.406G>A	c.(406-408)GTC>ATC	p.V136I		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	136										breast(1)	1						AGCTCGACGACGACGTCCTCC	0.657													33	56	---	---	---	---	capture	Missense_Mutation	SNP	138739098	138739098	PRR23B	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12490	12
P2RY13	53829	broad.mit.edu	37	3	151045981	151045981	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151045981T>C	uc003eyv.2	-	2	884	c.863A>G	c.(862-864)GAC>GGC	p.D288G	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_176894	NP_795713	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	288	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(3)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			CAGTCTACAGTCAGTCTTATT	0.358													68	97	---	---	---	---	capture	Missense_Mutation	SNP	151045981	151045981	P2RY13	3	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	11254	12
MFI2	4241	broad.mit.edu	37	3	196736682	196736682	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196736682C>T	uc003fxk.3	-	11	1445	c.1332G>A	c.(1330-1332)CCG>CCA	p.P444P		NM_005929	NP_005920	P08582	TRFM_HUMAN	melanoma-associated antigen p97 isoform 1	444	Transferrin-like 2.				cellular iron ion homeostasis|iron ion transport	anchored to membrane|extracellular region|integral to plasma membrane	ferric iron binding|protein binding				0	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		TGCTGTCTTCCGCTGGGGAGA	0.632													23	42	---	---	---	---	capture	Silent	SNP	196736682	196736682	MFI2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9434	12
SMARCA5	8467	broad.mit.edu	37	4	144474296	144474296	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:144474296G>A	uc003ijg.2	+	24	3580	c.3118G>A	c.(3118-3120)GCA>ACA	p.A1040T		NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated	1040					CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)					AATGGATGGCGCACCTGATGG	0.333													4	120	---	---	---	---	capture	Missense_Mutation	SNP	144474296	144474296	SMARCA5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14663	12
GLRA3	8001	broad.mit.edu	37	4	175649758	175649758	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175649758G>A	uc003ity.1	-	4	862	c.359C>T	c.(358-360)CCC>CTC	p.P120L	GLRA3_uc003itz.1_Missense_Mutation_p.P120L	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a	120	Extracellular (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	CAACATGGAGGGGTCGAGGTC	0.418													77	108	---	---	---	---	capture	Missense_Mutation	SNP	175649758	175649758	GLRA3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	6392	12
PLEKHG4B	153478	broad.mit.edu	37	5	161944	161944	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161944G>A	uc003jak.2	+	10	1516	c.1466G>A	c.(1465-1467)CGT>CAT	p.R489H		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	489					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AACCCGCAACGTACAGAGGAA	0.592													25	45	---	---	---	---	capture	Missense_Mutation	SNP	161944	161944	PLEKHG4B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11975	12
UGT3A2	167127	broad.mit.edu	37	5	36035828	36035828	+	Missense_Mutation	SNP	C	T	T	rs138640717		TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36035828C>T	uc003jjz.1	-	7	1637	c.1544G>A	c.(1543-1545)CGT>CAT	p.R515H	UGT3A2_uc011cos.1_Missense_Mutation_p.R481H|UGT3A2_uc011cot.1_Missense_Mutation_p.R213H	NM_174914	NP_777574	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	515	Cytoplasmic (Potential).		R -> H (in a colorectal cancer sample; somatic mutation).			integral to membrane	glucuronosyltransferase activity	p.R515H(2)		ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCTGGCCCCACGCAGCCACCA	0.577													14	29	---	---	---	---	capture	Missense_Mutation	SNP	36035828	36035828	UGT3A2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16846	12
KCTD16	57528	broad.mit.edu	37	5	143853420	143853420	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:143853420C>T	uc003lnm.1	+	4	1659	c.1030C>T	c.(1030-1032)CGT>TGT	p.R344C	KCTD16_uc003lnn.1_Missense_Mutation_p.R344C	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	344						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GACTCTGGACCGTCCCATCAA	0.587													52	55	---	---	---	---	capture	Missense_Mutation	SNP	143853420	143853420	KCTD16	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8025	12
HIST1H2BL	8340	broad.mit.edu	37	6	27775524	27775524	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27775524C>T	uc003njl.2	-	1	186	c.161G>A	c.(160-162)GGC>GAC	p.G54D	HIST1H3H_uc003njm.2_5'Flank	NM_003519	NP_003510	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	54					nucleosome assembly	nucleosome|nucleus	DNA binding				0						AGAAGAGATGCCGGTGTCGGG	0.582													6	360	---	---	---	---	capture	Missense_Mutation	SNP	27775524	27775524	HIST1H2BL	6	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7076	12
DST	667	broad.mit.edu	37	6	56457035	56457035	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56457035G>C	uc003pdf.2	-	43	6519	c.6491C>G	c.(6490-6492)TCT>TGT	p.S2164C	DST_uc003pcz.3_Missense_Mutation_p.S1986C|DST_uc011dxj.1_Missense_Mutation_p.S2015C|DST_uc011dxk.1_Missense_Mutation_p.S2026C|DST_uc003pcy.3_Missense_Mutation_p.S1660C|DST_uc010kaa.1_RNA	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	4072	Spectrin 3.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AATAGGTTCAGATAAGTGTTT	0.433													16	26	---	---	---	---	capture	Missense_Mutation	SNP	56457035	56457035	DST	6	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	4738	12
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			720	236	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	12
FZD9	8326	broad.mit.edu	37	7	72849409	72849409	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72849409T>A	uc003tyb.2	+	1	1301	c.1072T>A	c.(1072-1074)TTC>ATC	p.F358I		NM_003508	NP_003499	O00144	FZD9_HUMAN	frizzled 9 precursor	358	Helical; Name=4; (Potential).				B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CGGCAGCTATTTCCACATGGC	0.652													29	56	---	---	---	---	capture	Missense_Mutation	SNP	72849409	72849409	FZD9	7	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	6079	12
SRPK2	6733	broad.mit.edu	37	7	104782492	104782492	+	Silent	SNP	T	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:104782492T>C	uc003vct.2	-	10	1660	c.1473A>G	c.(1471-1473)AGA>AGG	p.R491R	SRPK2_uc003vcu.2_Silent_p.R491R|SRPK2_uc003vcv.2_Silent_p.R502R|SRPK2_uc003vcw.1_Silent_p.R491R	NM_182691	NP_872633	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2	491	Protein kinase.				angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity	p.R491R(1)		central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						CTGAAACCGTTCTGCTTCTGT	0.512													49	163	---	---	---	---	capture	Silent	SNP	104782492	104782492	SRPK2	7	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	15052	12
ATP6V0A4	50617	broad.mit.edu	37	7	138441286	138441286	+	Splice_Site	SNP	C	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138441286C>G	uc003vuf.2	-	8	878	c.640_splice	c.e8-1	p.K214_splice	ATP6V0A4_uc003vug.2_Splice_Site_p.K214_splice|ATP6V0A4_uc003vuh.2_Splice_Site_p.K214_splice	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						TTTCTTCTTTCTGGAAAATCA	0.284													111	230	---	---	---	---	capture	Splice_Site	SNP	138441286	138441286	ATP6V0A4	7	C	G	G	G	1	0	0	0	0	0	0	1	0	416	32	5	4	1161	12
MKRN1	23608	broad.mit.edu	37	7	140156627	140156627	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:140156627A>T	uc003vvt.2	-	5	1036	c.811T>A	c.(811-813)TTT>ATT	p.F271I	MKRN1_uc003vvs.2_Missense_Mutation_p.F207I|MKRN1_uc011krd.1_Missense_Mutation_p.F5I|MKRN1_uc003vvv.3_Missense_Mutation_p.F271I|MKRN1_uc003vvu.3_Missense_Mutation_p.F207I	NM_013446	NP_038474	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1 isoform 1	271							ligase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.00956)					TGCACGGCAAATGAGAGCTCC	0.532													21	60	---	---	---	---	capture	Missense_Mutation	SNP	140156627	140156627	MKRN1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	9518	12
C8orf58	541565	broad.mit.edu	37	8	22458597	22458597	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22458597C>T	uc003xce.2	+	2	355	c.243C>T	c.(241-243)GCC>GCT	p.A81A	C8orf58_uc011kzl.1_Silent_p.A81A|C8orf58_uc003xcf.2_Silent_p.A81A	NM_001013842	NP_001013864	Q8NAV2	CH058_HUMAN	hypothetical protein LOC541565	81										skin(1)	1		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		GCCCCCTGGCCGCCTTACCGG	0.632													16	23	---	---	---	---	capture	Silent	SNP	22458597	22458597	C8orf58	8	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2410	12
DOCK5	80005	broad.mit.edu	37	8	25156484	25156484	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:25156484C>T	uc003xeg.2	+	8	768	c.631C>T	c.(631-633)CGG>TGG	p.R211W	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_5'UTR|DOCK5_uc003xef.2_Missense_Mutation_p.R211W	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	211						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CCTCGATTTGCGGGGCCAGTC	0.418													13	33	---	---	---	---	capture	Missense_Mutation	SNP	25156484	25156484	DOCK5	8	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4646	12
PPP1R16A	84988	broad.mit.edu	37	8	145726654	145726654	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145726654G>C	uc003zdd.2	+	10	2093	c.1180G>C	c.(1180-1182)GAG>CAG	p.E394Q	uc003zde.1_5'Flank|PPP1R16A_uc003zdf.2_Missense_Mutation_p.E394Q|GPT_uc011lli.1_5'Flank|GPT_uc011llj.1_5'Flank|GPT_uc003zdh.3_5'Flank	NM_032902	NP_116291	Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	394						plasma membrane	protein binding				0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GACAGGCGCAGAGCTCAGGCC	0.736													2	9	---	---	---	---	capture	Missense_Mutation	SNP	145726654	145726654	PPP1R16A	8	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	12266	12
PTCH1	5727	broad.mit.edu	37	9	98209358	98209358	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:98209358G>A	uc004avk.3	-	23	4368	c.4180C>T	c.(4180-4182)CGA>TGA	p.R1394*	PTCH1_uc010mrn.2_Nonsense_Mutation_p.R186*|PTCH1_uc010mro.2_Nonsense_Mutation_p.R1243*|PTCH1_uc010mrp.2_Nonsense_Mutation_p.R1243*|PTCH1_uc010mrq.2_Nonsense_Mutation_p.R1243*|PTCH1_uc004avl.3_Nonsense_Mutation_p.R1243*|PTCH1_uc010mrr.2_Nonsense_Mutation_p.R1328*|PTCH1_uc004avm.3_Nonsense_Mutation_p.R1393*	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	1394	Cytoplasmic (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	p.R1394*(1)		skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AGTCCCCCTCGGGGGTTCCGC	0.677									Basal_Cell_Nevus_syndrome				57	54	---	---	---	---	capture	Nonsense_Mutation	SNP	98209358	98209358	PTCH1	9	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	12625	12
ARSD	414	broad.mit.edu	37	X	2826829	2826829	+	Silent	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2826829C>T	uc004cqy.2	-	9	1429	c.1353G>A	c.(1351-1353)TCG>TCA	p.S451S	ARSD_uc004cqz.1_RNA	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	451						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACTCATGTGCCGAGCGTGCCT	0.527													28	28	---	---	---	---	capture	Silent	SNP	2826829	2826829	ARSD	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	982	12
MAGEB6	158809	broad.mit.edu	37	X	26212934	26212934	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:26212934T>A	uc004dbr.2	+	2	1120	c.971T>A	c.(970-972)ATC>AAC	p.I324N	MAGEB6_uc010ngc.1_Missense_Mutation_p.I104N	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	324	MAGE.									ovary(3)	3						CTGCATTCAATCTATGGGGAT	0.488													151	206	---	---	---	---	capture	Missense_Mutation	SNP	26212934	26212934	MAGEB6	23	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	9093	12
FAM47A	158724	broad.mit.edu	37	X	34150200	34150200	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:34150200C>T	uc004ddg.2	-	1	229	c.196G>A	c.(196-198)GAA>AAA	p.E66K		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	66										ovary(4)|central_nervous_system(1)	5						AGAGTATCTTCGGGAGACGGA	0.552													61	74	---	---	---	---	capture	Missense_Mutation	SNP	34150200	34150200	FAM47A	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5517	12
GPKOW	27238	broad.mit.edu	37	X	48976107	48976107	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48976107G>A	uc004dmr.2	-	4	524	c.517C>T	c.(517-519)CGG>TGG	p.R173W		NM_015698	NP_056513	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	173	G-patch.					nucleus	nucleic acid binding			ovary(2)	2						CCCATGCCCCGCAGCATGGCC	0.597													13	21	---	---	---	---	capture	Missense_Mutation	SNP	48976107	48976107	GPKOW	23	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	6547	12
TRO	7216	broad.mit.edu	37	X	54949888	54949888	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54949888G>A	uc004dtq.2	+	3	1030	c.923G>A	c.(922-924)AGG>AAG	p.R308K	TRO_uc011moj.1_Missense_Mutation_p.R251K|TRO_uc004dts.2_Missense_Mutation_p.R308K|TRO_uc004dtr.2_Missense_Mutation_p.R308K|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Intron|TRO_uc004dtw.2_Intron|TRO_uc004dtx.2_5'Flank	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	308					embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						GCTGCCAGCAGGGGCCCAAAT	0.552													4	5	---	---	---	---	capture	Missense_Mutation	SNP	54949888	54949888	TRO	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16457	12
KLHL4	56062	broad.mit.edu	37	X	86773199	86773199	+	Silent	SNP	A	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:86773199A>G	uc004efb.2	+	1	485	c.303A>G	c.(301-303)CAA>CAG	p.Q101Q	KLHL4_uc004efa.2_Silent_p.Q101Q	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1	101						cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						TACATTTTCAAGCAAATGAAG	0.438													3	113	---	---	---	---	capture	Silent	SNP	86773199	86773199	KLHL4	23	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	8311	12
ESX1	80712	broad.mit.edu	37	X	103499199	103499199	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103499199G>A	uc004ely.2	-	2	200	c.142C>T	c.(142-144)CGG>TGG	p.R48W		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	48					negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGTTTGGACCGTGTATTCTCC	0.587													178	247	---	---	---	---	capture	Missense_Mutation	SNP	103499199	103499199	ESX1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5218	12
MUM1L1	139221	broad.mit.edu	37	X	105451028	105451028	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105451028A>C	uc004emf.1	+	4	2252	c.1603A>C	c.(1603-1605)ATG>CTG	p.M535L	MUM1L1_uc004emg.1_Missense_Mutation_p.M535L	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	535										ovary(2)|pancreas(1)|skin(1)	4						GACCAAGAAAATGTCCTTCCA	0.453													15	18	---	---	---	---	capture	Missense_Mutation	SNP	105451028	105451028	MUM1L1	23	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	9896	12
KIAA1210	57481	broad.mit.edu	37	X	118219419	118219419	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118219419T>A	uc004era.3	-	12	4775	c.4775A>T	c.(4774-4776)CAC>CTC	p.H1592L		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1592										ovary(4)|skin(1)	5						CACAGAAATGTGGGCCTTGAA	0.463													12	169	---	---	---	---	capture	Missense_Mutation	SNP	118219419	118219419	KIAA1210	23	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	8136	12
BRS3	680	broad.mit.edu	37	X	135570275	135570275	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135570275T>G	uc004ezv.1	+	1	151	c.2T>G	c.(1-3)ATG>AGG	p.M1R		NM_001727	NP_001718	P32247	BRS3_HUMAN	bombesin-like receptor 3	1	Extracellular (Potential).				adult feeding behavior|glucose metabolic process|regulation of blood pressure	integral to membrane|plasma membrane	bombesin receptor activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCAGAAGAAATGGCTCAAAGG	0.378													29	56	---	---	---	---	capture	Missense_Mutation	SNP	135570275	135570275	BRS3	23	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	1510	12
PTEN	5728	broad.mit.edu	37	10	89720799	89720802	+	Frame_Shift_Del	DEL	TACT	-	-			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720799_89720802delTACT	uc001kfb.2	+	9	1981_1984	c.950_953delTACT	c.(949-954)GTACTTfs	p.V317fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	317_318	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L318fs*2(17)|p.V317fs*3(16)|p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.V317fs*6(2)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.W274_F341del(1)|p.V317_K322del(1)|p.L318F(1)|p.T318fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAATATCTAGTACTTACTTTAACA	0.333	V317fs*3(SKUT1_SOFT_TISSUE)|V317fs*3(EVSAT_BREAST)|V317fs*3(IGROV1_OVARY)|V317fs*3(ISHIKAWAHERAKLIO02ER_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			99	48	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89720799	89720802	PTEN	10	TACT	-	-	-	1	0	1	0	1	0	0	0	0	741	57	5	5	12633	12
SSR3	6747	broad.mit.edu	37	3	156271443	156271444	+	Splice_Site	INS	-	TTGTGCTTG	TTGTGCTTG			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:156271443_156271444insTTGTGCTTG	uc003fau.2	-	2	317	c.260_splice	c.e2+1	p.K87_splice	SSR3_uc011bop.1_Splice_Site_p.K87_splice	NM_007107	NP_009038	Q9UNL2	SSRG_HUMAN	signal sequence receptor gamma subunit						cotranslational protein targeting to membrane	integral to endoplasmic reticulum membrane|microsome|Sec61 translocon complex	protein binding|signal sequence binding				0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AACATACTTACTTGTGCTTGAG	0.312													25	98	---	---	---	---	capture_indel	Splice_Site	INS	156271443	156271444	SSR3	3	-	TTGTGCTTG	TTGTGCTTG	TTGTGCTTG	1	0	1	1	0	0	0	1	0	260	20	5	5	15084	12
KDR	3791	broad.mit.edu	37	4	55968556	55968556	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-0125-01	TCGA-06-0125-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55968556delC	uc003has.2	-	14	2409	c.2107delG	c.(2107-2109)GATfs	p.D703fs	KDR_uc003hat.1_Frame_Shift_Del_p.D703fs	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	703	Ig-like C2-type 7.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	GTCTCATTATCTTTAAACCAC	0.433			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			110	139	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	55968556	55968556	KDR	4	C	-	-	-	1	0	1	0	1	0	0	0	0	416	32	5	5	8061	12
