Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
RNF207	388591	broad.mit.edu	37	1	6271141	6271141	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6271141C>T	uc001amg.2	+	12	1246	c.1072C>T	c.(1072-1074)CCA>TCA	p.P358S	RNF207_uc010nzp.1_RNA	NM_207396	NP_997279	Q6ZRF8	RN207_HUMAN	ring finger protein 207	358						intracellular	zinc ion binding				0	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GCTGCTGGGGCCACGTCGGGT	0.667													3	19	---	---	---	---	capture	Missense_Mutation	SNP	6271141	6271141	RNF207	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13366	17
CAMTA1	23261	broad.mit.edu	37	1	7723936	7723936	+	Silent	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7723936C>T	uc001aoi.2	+	9	1536	c.1329C>T	c.(1327-1329)GCC>GCT	p.A443A		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	443					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ACAAGTTCGCCTTTCCCACCA	0.652													9	100	---	---	---	---	capture	Silent	SNP	7723936	7723936	CAMTA1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	2589	17
CAMTA1	23261	broad.mit.edu	37	1	7723997	7723997	+	Silent	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7723997C>T	uc001aoi.2	+	9	1597	c.1390C>T	c.(1390-1392)CTG>TTG	p.L464L		NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	464					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GTCCGAAGAGCTGGTCCTCTC	0.597													21	120	---	---	---	---	capture	Silent	SNP	7723997	7723997	CAMTA1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	2589	17
FHL3	2275	broad.mit.edu	37	1	38463709	38463709	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38463709G>A	uc001ccj.2	-	4	514	c.427C>T	c.(427-429)CCC>TCC	p.P143S	FHL3_uc001cck.2_Missense_Mutation_p.P143S|FHL3_uc001ccl.2_Missense_Mutation_p.P143S|FHL3_uc001ccm.2_Missense_Mutation_p.P35S|FHL3_uc009vvl.1_Missense_Mutation_p.P143S	NM_004468	NP_004459	Q13643	FHL3_HUMAN	four and a half LIM domains 3	143	LIM zinc-binding 2.				muscle organ development		zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCCTTGTCGGGCACAAAAGAA	0.622													6	164	---	---	---	---	capture	Missense_Mutation	SNP	38463709	38463709	FHL3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5826	17
PSMA5	5686	broad.mit.edu	37	1	109964523	109964523	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109964523C>T	uc001dxn.2	-	2	140	c.55G>A	c.(55-57)GGA>AGA	p.G19R	PSMA5_uc010ovj.1_Intron	NM_002790	NP_002781	P28066	PSA5_HUMAN	proteasome alpha 5 subunit	19					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity				0		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		AATAATCTTCCTTCGGGAGAA	0.348													14	74	---	---	---	---	capture	Missense_Mutation	SNP	109964523	109964523	PSMA5	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	12565	17
SPAG17	200162	broad.mit.edu	37	1	118640437	118640437	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:118640437T>C	uc001ehk.2	-	7	935	c.867A>G	c.(865-867)ATA>ATG	p.I289M		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	289	Potential.					cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TAAGCTCTTTTATGGCATTTT	0.333													12	87	---	---	---	---	capture	Missense_Mutation	SNP	118640437	118640437	SPAG17	1	T	C	C	C	1	0	0	0	0	1	0	0	0	784	61	3	3	14871	17
NBPF10	100132406	broad.mit.edu	37	1	145325997	145325997	+	Silent	SNP	A	G	G			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145325997A>G	uc001end.3	+	32	4130	c.4095A>G	c.(4093-4095)CAA>CAG	p.Q1365Q	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1290											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AAGTCTTGCAAGACTCACTGG	0.468													3	160	---	---	---	---	capture	Silent	SNP	145325997	145325997	NBPF10	1	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	10100	17
FCRLA	84824	broad.mit.edu	37	1	161682911	161682911	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:161682911C>T	uc001gbe.2	+	6	1132	c.890C>T	c.(889-891)CCA>CTA	p.P297L	FCRLA_uc001gbd.2_Missense_Mutation_p.P291L|FCRLA_uc001gbf.2_Missense_Mutation_p.P202L|FCRLA_uc001gbg.2_Missense_Mutation_p.P151L|FCRLA_uc009wuo.2_Missense_Mutation_p.P157L|FCRLA_uc009wup.2_Missense_Mutation_p.P107L|FCRLA_uc009wuq.2_Missense_Mutation_p.P56L	NM_032738	NP_116127	Q7L513	FCRLA_HUMAN	Fc receptor-like and mucin-like 1	274	Pro-rich.				cell differentiation	cytoplasm|extracellular region					0	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			ACATTGAATCCAGCTCCTCAG	0.582													20	201	---	---	---	---	capture	Missense_Mutation	SNP	161682911	161682911	FCRLA	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5746	17
CACNA1S	779	broad.mit.edu	37	1	201012596	201012596	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201012596C>T	uc001gvv.2	-	40	5088	c.4861G>A	c.(4861-4863)GTC>ATC	p.V1621I		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	1621	Cytoplasmic (Potential).				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TTGGCCATGACGGGGGGCAGG	0.567											OREG0014067	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	106	---	---	---	---	capture	Missense_Mutation	SNP	201012596	201012596	CACNA1S	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2523	17
ABCG4	64137	broad.mit.edu	37	11	119031668	119031668	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119031668C>T	uc001pvs.2	+	15	2129	c.1793C>T	c.(1792-1794)CCG>CTG	p.P598L	ABCG4_uc009zar.2_Missense_Mutation_p.P598L	NM_022169	NP_071452	Q9H172	ABCG4_HUMAN	ATP-binding cassette, subfamily G, member 4	598	Extracellular (Potential).|ABC transmembrane type-2.				cholesterol efflux	integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GAACGCTGCCCGTTCCGGGAG	0.567													7	43	---	---	---	---	capture	Missense_Mutation	SNP	119031668	119031668	ABCG4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	70	17
TSPAN9	10867	broad.mit.edu	37	12	3387673	3387673	+	Silent	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3387673G>A	uc001qlp.2	+	4	297	c.150G>A	c.(148-150)TCG>TCA	p.S50S		NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9	50	Extracellular (Potential).					integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			GCTTCCCTTCGTTGTCTGCAG	0.597													14	222	---	---	---	---	capture	Silent	SNP	3387673	3387673	TSPAN9	12	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16537	17
OR9K2	441639	broad.mit.edu	37	12	55524385	55524385	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55524385G>A	uc010spe.1	+	1	833	c.833G>A	c.(832-834)GGT>GAT	p.G278D		NM_001005243	NP_001005243	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K,	278	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2						GTGCTGTATGGTGCTGTCTTT	0.443													40	273	---	---	---	---	capture	Missense_Mutation	SNP	55524385	55524385	OR9K2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	11158	17
APOF	319	broad.mit.edu	37	12	56755194	56755194	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56755194C>T	uc001sle.1	-	2	850	c.796G>A	c.(796-798)GCA>ACA	p.A266T		NM_001638	NP_001629	Q13790	APOF_HUMAN	apolipoprotein F precursor	266					cholesterol metabolic process	high-density lipoprotein particle|low-density lipoprotein particle	cholesterol binding|lipid transporter activity|receptor binding				0						GAGATGTTTGCGTCTTTCTGA	0.493													6	157	---	---	---	---	capture	Missense_Mutation	SNP	56755194	56755194	APOF	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	796	17
FOXN4	121643	broad.mit.edu	37	12	109719238	109719238	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109719238G>A	uc001toe.3	-	9	1373	c.1268C>T	c.(1267-1269)CCG>CTG	p.P423L	FOXN4_uc009zvg.2_Missense_Mutation_p.P220L|FOXN4_uc001tof.3_Missense_Mutation_p.P243L	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	423					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2						CATGATGCTCGGGTCGAGGGC	0.627													15	114	---	---	---	---	capture	Missense_Mutation	SNP	109719238	109719238	FOXN4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5966	17
SERPINA12	145264	broad.mit.edu	37	14	94953819	94953819	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94953819C>T	uc001ydj.2	-	6	1862	c.1066G>A	c.(1066-1068)GCT>ACT	p.A356T		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	356					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		TTCAGCTCAGCCTTGTGCACA	0.597													17	78	---	---	---	---	capture	Missense_Mutation	SNP	94953819	94953819	SERPINA12	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13982	17
PEPD	5184	broad.mit.edu	37	19	33892682	33892682	+	Silent	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33892682G>A	uc002nur.3	-	12	1047	c.912C>T	c.(910-912)GCC>GCT	p.A304A	PEPD_uc010xrr.1_Silent_p.A263A|PEPD_uc010xrs.1_Silent_p.A240A	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1	304					cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					CCTCATAGACGGCCTTCTGGT	0.627													3	28	---	---	---	---	capture	Silent	SNP	33892682	33892682	PEPD	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11631	17
NLRP12	91662	broad.mit.edu	37	19	54313742	54313742	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54313742C>T	uc002qch.3	-	3	1391	c.1171G>A	c.(1171-1173)GTG>ATG	p.V391M	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.V391M|NLRP12_uc002qcj.3_Missense_Mutation_p.V391M|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.V391M	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	391	NACHT.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TTGTCCCTCACGTAATTGAAG	0.562													38	301	---	---	---	---	capture	Missense_Mutation	SNP	54313742	54313742	NLRP12	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10381	17
YIPF4	84272	broad.mit.edu	37	2	32530586	32530586	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32530586G>A	uc002rok.2	+	6	893	c.626G>A	c.(625-627)AGT>AAT	p.S209N		NM_032312	NP_115688	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	209	Helical; (Potential).					endoplasmic reticulum|integral to membrane	protein binding				0	Acute lymphoblastic leukemia(172;0.155)					GCTGCCTACAGTGCTGCTTCA	0.323													15	130	---	---	---	---	capture	Missense_Mutation	SNP	32530586	32530586	YIPF4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	17361	17
RAB11FIP5	26056	broad.mit.edu	37	2	73315741	73315741	+	Silent	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:73315741C>T	uc002siu.3	-	3	1246	c.1005G>A	c.(1003-1005)TCG>TCA	p.S335S	RAB11FIP5_uc002sit.3_Silent_p.S257S	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	335					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						TGACACAGAGCGAAGAGCGGG	0.622													11	50	---	---	---	---	capture	Silent	SNP	73315741	73315741	RAB11FIP5	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12792	17
LCT	3938	broad.mit.edu	37	2	136566075	136566075	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136566075G>A	uc002tuu.1	-	8	3853	c.3842C>T	c.(3841-3843)CCG>CTG	p.P1281L		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1281	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		CTCCGTGTTCGGATTGGTCAG	0.493													5	345	---	---	---	---	capture	Missense_Mutation	SNP	136566075	136566075	LCT	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8613	17
MBD5	55777	broad.mit.edu	37	2	149248058	149248058	+	Silent	SNP	C	T	T			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:149248058C>T	uc002twm.3	+	12	5146	c.4158C>T	c.(4156-4158)GGC>GGT	p.G1386G	MBD5_uc010zbs.1_Intron|MBD5_uc010fns.2_Silent_p.G1386G|MBD5_uc002two.2_Silent_p.G644G|MBD5_uc002twp.2_Silent_p.G436G	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1386	PWWP.					chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TCAATGTTGGCGACTTGGTCT	0.448													16	92	---	---	---	---	capture	Silent	SNP	149248058	149248058	MBD5	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9260	17
SCN3A	6328	broad.mit.edu	37	2	166019113	166019113	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166019113T>A	uc002ucx.2	-	8	1412	c.920A>T	c.(919-921)AAT>ATT	p.N307I	SCN3A_uc002ucy.2_Missense_Mutation_p.N307I|SCN3A_uc002ucz.2_Missense_Mutation_p.N307I|SCN3A_uc002uda.1_Missense_Mutation_p.N176I|SCN3A_uc002udb.1_Missense_Mutation_p.N176I	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	307						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	CATTGTTACATTAACAAATGT	0.363													12	129	---	---	---	---	capture	Missense_Mutation	SNP	166019113	166019113	SCN3A	2	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	13811	17
SCN9A	6335	broad.mit.edu	37	2	167055670	167055670	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:167055670C>A	uc010fpl.2	-	27	5787	c.5446G>T	c.(5446-5448)GAT>TAT	p.D1816Y	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1827						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	ATGGGCAGATCCATGGCAATG	0.463													26	180	---	---	---	---	capture	Missense_Mutation	SNP	167055670	167055670	SCN9A	2	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	13818	17
ZSWIM2	151112	broad.mit.edu	37	2	187693302	187693302	+	Silent	SNP	T	C	C			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:187693302T>C	uc002upu.1	-	9	1351	c.1311A>G	c.(1309-1311)AGA>AGG	p.R437R		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	437					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AAATTCCAAGTCTATTTTGTT	0.328													3	121	---	---	---	---	capture	Silent	SNP	187693302	187693302	ZSWIM2	2	T	C	C	C	1	0	0	0	0	0	0	0	1	751	58	3	3	18117	17
ANO7	50636	broad.mit.edu	37	2	242151595	242151595	+	Missense_Mutation	SNP	G	A	A	rs111600763	byFrequency;by1000genomes	TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:242151595G>A	uc002wax.2	+	16	1913	c.1810G>A	c.(1810-1812)GTC>ATC	p.V604I		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	604	Helical; (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						CTCCTCACCCGTCTACATTGC	0.562													11	136	---	---	---	---	capture	Missense_Mutation	SNP	242151595	242151595	ANO7	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	696	17
SLC5A4	6527	broad.mit.edu	37	22	32627012	32627012	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32627012C>G	uc003ami.2	-	10	1074	c.1072G>C	c.(1072-1074)GAT>CAT	p.D358H		NM_014227	NP_055042	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (low affinity glucose	358	Extracellular (Potential).				carbohydrate transport|sodium ion transport	integral to membrane	symporter activity				0						CAGCCAACATCAACGCCACAG	0.522													3	80	---	---	---	---	capture	Missense_Mutation	SNP	32627012	32627012	SLC5A4	22	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	14559	17
CHL1	10752	broad.mit.edu	37	3	383663	383663	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:383663G>A	uc003bou.2	+	7	848	c.577G>A	c.(577-579)GTG>ATG	p.V193M	CHL1_uc003bot.2_Missense_Mutation_p.V193M|CHL1_uc003bow.1_Missense_Mutation_p.V193M|CHL1_uc011asi.1_Missense_Mutation_p.V193M	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	193	Ig-like C2-type 2.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTTCGCAAACGTGGAAGAAAA	0.383													11	61	---	---	---	---	capture	Missense_Mutation	SNP	383663	383663	CHL1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3314	17
SPOCK3	50859	broad.mit.edu	37	4	167656159	167656159	+	Silent	SNP	A	G	G			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:167656159A>G	uc003iri.1	-	12	1365	c.1224T>C	c.(1222-1224)ATT>ATC	p.I408I	SPOCK3_uc011cjp.1_Silent_p.I365I|SPOCK3_uc011cjq.1_Silent_p.I417I|SPOCK3_uc011cjr.1_Silent_p.I288I|SPOCK3_uc003irj.1_Silent_p.I405I|SPOCK3_uc011cjs.1_Silent_p.I357I|SPOCK3_uc011cjt.1_Silent_p.I316I|SPOCK3_uc011cju.1_Silent_p.I301I|SPOCK3_uc011cjv.1_Silent_p.I310I	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	408	Asp-rich.				signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		catcattcataatatcgtctt	0.070													12	66	---	---	---	---	capture	Silent	SNP	167656159	167656159	SPOCK3	4	A	G	G	G	1	0	0	0	0	0	0	0	1	164	13	3	3	14973	17
FSTL4	23105	broad.mit.edu	37	5	132556518	132556518	+	Silent	SNP	G	A	A	rs141735817	byFrequency	TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:132556518G>A	uc003kyn.1	-	12	1598	c.1380C>T	c.(1378-1380)GAC>GAT	p.D460D	FSTL4_uc003kym.1_Silent_p.D109D	NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor	460						extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGATGATACCGTCGTCGGAGA	0.547													4	177	---	---	---	---	capture	Silent	SNP	132556518	132556518	FSTL4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6021	17
PCDHA9	9752	broad.mit.edu	37	5	140229589	140229589	+	Silent	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140229589G>A	uc003lhu.2	+	1	2233	c.1509G>A	c.(1507-1509)TCG>TCA	p.S503S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Silent_p.S503S	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	503	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGAGCGCTCGCTGTCGAGCT	0.672													13	101	---	---	---	---	capture	Silent	SNP	140229589	140229589	PCDHA9	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11434	17
LAMB1	3912	broad.mit.edu	37	7	107591684	107591684	+	Silent	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107591684G>A	uc003vew.2	-	24	3713	c.3378C>T	c.(3376-3378)GAC>GAT	p.D1126D	LAMB1_uc003vev.2_Silent_p.D1150D	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1126	Laminin EGF-like 12.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGCACTCCACGTCGGGGTCTC	0.572													17	92	---	---	---	---	capture	Silent	SNP	107591684	107591684	LAMB1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8530	17
SGK223	157285	broad.mit.edu	37	8	8175745	8175745	+	Silent	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:8175745G>A	uc003wsh.3	-	5	4140	c.4140C>T	c.(4138-4140)TGC>TGT	p.C1380C		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	1380							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GGTACTGGCAGCAAAGCCAGT	0.642													3	89	---	---	---	---	capture	Silent	SNP	8175745	8175745	SGK223	8	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	14103	17
PIP5K1B	8395	broad.mit.edu	37	9	71555697	71555697	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71555697A>C	uc004agu.2	+	14	1798	c.1493A>C	c.(1492-1494)TAT>TCT	p.Y498S	PIP5K1B_uc011lrq.1_Missense_Mutation_p.Y498S|PIP5K1B_uc004agv.2_RNA	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	498						endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		CCTACACTCTATTCAAACAGG	0.443													28	176	---	---	---	---	capture	Missense_Mutation	SNP	71555697	71555697	PIP5K1B	9	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	11843	17
SUSD1	64420	broad.mit.edu	37	9	114840947	114840947	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114840947T>C	uc004bfu.2	-	12	1665	c.1624A>G	c.(1624-1626)AAT>GAT	p.N542D	SUSD1_uc010mui.2_Missense_Mutation_p.N542D|SUSD1_uc010muj.2_Missense_Mutation_p.N542D	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor	542	Extracellular (Potential).					integral to membrane	calcium ion binding				0						CTACTGATATTAAAGGTCATT	0.488													27	135	---	---	---	---	capture	Missense_Mutation	SNP	114840947	114840947	SUSD1	9	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	15295	17
CXorf59	286464	broad.mit.edu	37	X	36103467	36103467	+	Silent	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:36103467G>A	uc004ddk.1	+	5	639	c.453G>A	c.(451-453)TCG>TCA	p.S151S		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	151						integral to membrane				central_nervous_system(1)	1						CATCAACCTCGCCACCCCAAA	0.333													17	85	---	---	---	---	capture	Silent	SNP	36103467	36103467	CXorf59	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4075	17
DCAF12L2	340578	broad.mit.edu	37	X	125299499	125299499	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125299499G>A	uc004euk.1	-	1	436	c.409C>T	c.(409-411)CGG>TGG	p.R137W		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	137										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						TCCTTGTCCCGCATGAGGGGG	0.642													4	74	---	---	---	---	capture	Missense_Mutation	SNP	125299499	125299499	DCAF12L2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	4224	17
OR13H1	347468	broad.mit.edu	37	X	130678349	130678349	+	Missense_Mutation	SNP	C	T	T	rs149527425	byFrequency	TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:130678349C>T	uc011muw.1	+	1	302	c.302C>T	c.(301-303)ACG>ATG	p.T101M	IGSF1_uc004ewf.2_Intron	NM_001004486	NP_001004486	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Acute lymphoblastic leukemia(192;0.000636)					TTGGCTCAAACGAGTGTCTCC	0.517													22	65	---	---	---	---	capture	Missense_Mutation	SNP	130678349	130678349	OR13H1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10847	17
ZBTB20	26137	broad.mit.edu	37	3	114069362	114069362	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0132-01	TCGA-06-0132-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:114069362delG	uc003ebi.2	-	4	1743	c.1563delC	c.(1561-1563)CCCfs	p.P521fs	ZBTB20_uc003ebj.2_Frame_Shift_Del_p.P448fs|ZBTB20_uc010hqp.2_Frame_Shift_Del_p.P448fs|ZBTB20_uc003ebk.2_Frame_Shift_Del_p.P448fs|ZBTB20_uc003ebl.2_Frame_Shift_Del_p.P448fs|ZBTB20_uc003ebm.2_Frame_Shift_Del_p.P448fs|ZBTB20_uc003ebn.2_Frame_Shift_Del_p.P448fs|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	521					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GGAAAGGCTTGGGGCCACTGC	0.627													16	132	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	114069362	114069362	ZBTB20	3	G	-	-	-	1	0	1	0	1	0	0	0	0	600	47	5	5	17409	17
