Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
WDR65	149465	broad.mit.edu	37	1	43651007	43651007	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43651007C>A	uc001cip.1	+	5	1070	c.949C>A	c.(949-951)CGT>AGT	p.R317S	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.R306S|WDR65_uc001ciq.1_Missense_Mutation_p.R317S	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	317										skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGATTTTTACCGTGAGAGCAG	0.473													3	55	---	---	---	---	capture	Missense_Mutation	SNP	43651007	43651007	WDR65	1	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	17197	19
OR4F6	390648	broad.mit.edu	37	15	102346736	102346736	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:102346736G>A	uc010utr.1	+	1	814	c.814G>A	c.(814-816)GCC>ACC	p.A272T		NM_001005326	NP_001005326	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F,	272	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TAAATTCCTTGCCATCTTTGA	0.378													9	115	---	---	---	---	capture	Missense_Mutation	SNP	102346736	102346736	OR4F6	15	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	10970	19
TANC2	26115	broad.mit.edu	37	17	61391934	61391934	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61391934G>A	uc002jal.3	+	8	1146	c.1123G>A	c.(1123-1125)GGC>AGC	p.G375S	TANC2_uc010wpe.1_Missense_Mutation_p.G285S	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	375							binding			ovary(2)	2						CATTGGATTCGGCAAAACTGC	0.507													4	103	---	---	---	---	capture	Missense_Mutation	SNP	61391934	61391934	TANC2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15433	19
EXOC7	23265	broad.mit.edu	37	17	74094004	74094004	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74094004C>A	uc002jqs.2	-	5	608	c.513G>T	c.(511-513)TTG>TTT	p.L171F	EXOC7_uc010dgv.1_Missense_Mutation_p.L118F|EXOC7_uc002jqq.2_Missense_Mutation_p.L171F|EXOC7_uc010wsw.1_Missense_Mutation_p.L171F|EXOC7_uc010wsx.1_Missense_Mutation_p.L171F|EXOC7_uc002jqr.2_Missense_Mutation_p.L171F|EXOC7_uc010wsv.1_Missense_Mutation_p.L130F|EXOC7_uc002jqu.2_Missense_Mutation_p.L171F	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4	171					exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			TGATCAGATCCAAGATGAGCA	0.602													9	108	---	---	---	---	capture	Missense_Mutation	SNP	74094004	74094004	EXOC7	17	C	A	A	A	1	0	0	0	0	1	0	0	0	272	21	4	4	5265	19
PCDHB3	56132	broad.mit.edu	37	5	140480851	140480851	+	Silent	SNP	G	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140480851G>A	uc003lio.2	+	1	618	c.618G>A	c.(616-618)CCG>CCA	p.P206P	uc003lin.2_Intron	NM_018937	NP_061760	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3 precursor	206	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGAGCAGCCGGAACTCAGCT	0.567													3	59	---	---	---	---	capture	Silent	SNP	140480851	140480851	PCDHB3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11446	19
DIAPH1	1729	broad.mit.edu	37	5	140960406	140960406	+	Silent	SNP	C	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140960406C>A	uc003llb.3	-	8	870	c.729G>T	c.(727-729)CTG>CTT	p.L243L	DIAPH1_uc003llc.3_Silent_p.L234L	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1	243	GBD/FH3.				regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTGACCAGCAGTAGGATTC	0.473													4	68	---	---	---	---	capture	Silent	SNP	140960406	140960406	DIAPH1	5	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	4476	19
PRSS55	203074	broad.mit.edu	37	8	10387101	10387101	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10387101C>T	uc003wta.2	+	2	254	c.239C>T	c.(238-240)CCG>CTG	p.P80L	uc010lru.2_Intron|PRSS55_uc003wtb.2_RNA	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	80	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						GGTGAGTTTCCGTGGCAGGTG	0.512													5	172	---	---	---	---	capture	Missense_Mutation	SNP	10387101	10387101	PRSS55	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12529	19
CYP7A1	1581	broad.mit.edu	37	8	59409488	59409488	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59409488G>A	uc003xtm.3	-	3	646	c.583C>T	c.(583-585)CGG>TGG	p.R195W		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	195					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TGTGTGTCCCGCCTTGTAAGA	0.453									Neonatal_Giant_Cell_Hepatitis				7	120	---	---	---	---	capture	Missense_Mutation	SNP	59409488	59409488	CYP7A1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	4156	19
PSAT1	29968	broad.mit.edu	37	9	80921319	80921319	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:80921319G>A	uc004ala.2	+	5	555	c.487G>A	c.(487-489)GAC>AAC	p.D163N	PSAT1_uc004alb.2_Missense_Mutation_p.D163N	NM_058179	NP_478059	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1 isoform 1	163					L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)	TGTGGAGTTTGACTTTATACC	0.463													10	312	---	---	---	---	capture	Missense_Mutation	SNP	80921319	80921319	PSAT1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	12539	19
PSAT1	29968	broad.mit.edu	37	9	80921343	80921343	+	Missense_Mutation	SNP	G	A	A	rs115263053	by1000genomes	TCGA-06-0139-01	TCGA-06-0139-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:80921343G>A	uc004ala.2	+	5	579	c.511G>A	c.(511-513)GCA>ACA	p.A171T	PSAT1_uc004alb.2_Missense_Mutation_p.A171T	NM_058179	NP_478059	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1 isoform 1	171					L-serine biosynthetic process|pyridoxine biosynthetic process		O-phospho-L-serine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)	TGTCAAGGGAGCAGTACTGGT	0.498													10	295	---	---	---	---	capture	Missense_Mutation	SNP	80921343	80921343	PSAT1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	12539	19
