Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
DNAJC16	23341	broad.mit.edu	37	1	15888817	15888817	+	Silent	SNP	A	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15888817A>C	uc001aws.2	+	9	1455	c.1335A>C	c.(1333-1335)TCA>TCC	p.S445S	DNAJC16_uc001awr.1_Silent_p.S445S|DNAJC16_uc001awt.2_Silent_p.S133S|DNAJC16_uc001awu.2_RNA	NM_015291	NP_056106	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16	445	Cytoplasmic (Potential).				cell redox homeostasis|protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			urinary_tract(1)|lung(1)|kidney(1)	3		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		AAGGGAAATCAGCGGTAAGCC	0.473													116	61	---	---	---	---	capture	Silent	SNP	15888817	15888817	DNAJC16	1	A	C	C	C	1	0	0	0	0	0	0	0	1	80	7	4	4	4591	25
DOCK7	85440	broad.mit.edu	37	1	62993826	62993826	+	Nonsense_Mutation	SNP	G	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:62993826G>C	uc001daq.2	-	31	3966	c.3932C>G	c.(3931-3933)TCA>TGA	p.S1311*	DOCK7_uc001dan.2_Nonsense_Mutation_p.S1172*|DOCK7_uc001dao.2_Nonsense_Mutation_p.S1172*|DOCK7_uc001dap.2_Nonsense_Mutation_p.S1280*|DOCK7_uc001dam.2_Nonsense_Mutation_p.S491*|DOCK7_uc010oov.1_Intron	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1311					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						TTTTACCGTTGACGTGAGGAG	0.423													20	153	---	---	---	---	capture	Nonsense_Mutation	SNP	62993826	62993826	DOCK7	1	G	C	C	C	1	0	0	0	0	0	1	0	0	585	45	5	4	4648	25
OR10J1	26476	broad.mit.edu	37	1	159410403	159410403	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159410403G>A	uc010piv.1	+	1	855	c.855G>A	c.(853-855)TCG>TCA	p.S285S	uc001fts.3_Intron	NM_012351	NP_036483	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J,	285	Helical; Name=7; (Potential).				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0429)					AGCTGATCTCGGTGACCTACA	0.517													148	68	---	---	---	---	capture	Silent	SNP	159410403	159410403	OR10J1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10814	25
ATP1A4	480	broad.mit.edu	37	1	160144388	160144388	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160144388C>A	uc001fve.3	+	15	2641	c.2162C>A	c.(2161-2163)ACA>AAA	p.T721K	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.T224K|ATP1A4_uc001fvh.2_5'Flank	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	721	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTGGCCGTGACAGGTGACGGG	0.542													12	60	---	---	---	---	capture	Missense_Mutation	SNP	160144388	160144388	ATP1A4	1	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	1122	25
SLC9A11	284525	broad.mit.edu	37	1	173505000	173505000	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173505000A>C	uc001giz.2	-	15	2167	c.1744T>G	c.(1744-1746)TGT>GGT	p.C582G	SLC9A11_uc009wwe.2_Missense_Mutation_p.C140G|SLC9A11_uc010pmq.1_Intron	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	582					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						TTTTCTATACAATATTCCAAG	0.264													43	113	---	---	---	---	capture	Missense_Mutation	SNP	173505000	173505000	SLC9A11	1	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	14603	25
AIDA	64853	broad.mit.edu	37	1	222860999	222860999	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222860999G>C	uc001hnn.2	-	5	496	c.291C>G	c.(289-291)ATC>ATG	p.I97M	AIDA_uc001hno.2_RNA|AIDA_uc010pus.1_Missense_Mutation_p.I73M	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	97					dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						TATTCTTTAGGACTAGAATAA	0.194													234	61	---	---	---	---	capture	Missense_Mutation	SNP	222860999	222860999	AIDA	1	G	C	C	C	1	0	0	0	0	1	0	0	0	525	41	4	4	423	25
KIAA1217	56243	broad.mit.edu	37	10	24762771	24762771	+	Silent	SNP	C	T	T	rs143282203	byFrequency	TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24762771C>T	uc001iru.3	+	6	1864	c.1461C>T	c.(1459-1461)CAC>CAT	p.H487H	KIAA1217_uc001irs.2_Silent_p.H407H|KIAA1217_uc001irt.3_Silent_p.H487H|KIAA1217_uc010qcy.1_Silent_p.H487H|KIAA1217_uc010qcz.1_Silent_p.H487H|KIAA1217_uc001irv.1_Silent_p.H337H|KIAA1217_uc010qda.1_RNA|KIAA1217_uc001irw.2_Silent_p.H205H|KIAA1217_uc001irz.2_Silent_p.H205H|KIAA1217_uc001irx.2_Silent_p.H205H|KIAA1217_uc001iry.2_Silent_p.H205H	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	487					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TAGACATGCACGCTCACTATA	0.557													8	75	---	---	---	---	capture	Silent	SNP	24762771	24762771	KIAA1217	10	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8138	25
KIAA1462	57608	broad.mit.edu	37	10	30315407	30315407	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:30315407G>C	uc001iux.2	-	2	3729	c.3670C>G	c.(3670-3672)CCA>GCA	p.P1224A	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Missense_Mutation_p.P1086A|KIAA1462_uc009xle.1_Missense_Mutation_p.P1224A	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	1224										ovary(4)	4						GCCACACTTGGGGTTCTTTCT	0.488													117	64	---	---	---	---	capture	Missense_Mutation	SNP	30315407	30315407	KIAA1462	10	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	8156	25
DOCK1	1793	broad.mit.edu	37	10	129231688	129231688	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:129231688G>T	uc001ljt.2	+	48	5057	c.4993G>T	c.(4993-4995)GAC>TAC	p.D1665Y	DOCK1_uc010qun.1_Missense_Mutation_p.D1686Y|DOCK1_uc009yaq.2_Missense_Mutation_p.D660Y	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1665					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	p.D1665Y(1)		central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ACCAGGCTCCGACGGGTGAGT	0.597													35	26	---	---	---	---	capture	Missense_Mutation	SNP	129231688	129231688	DOCK1	10	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	4640	25
NELL1	4745	broad.mit.edu	37	11	20949959	20949959	+	Missense_Mutation	SNP	C	T	T	rs150066751		TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20949959C>T	uc001mqe.2	+	9	1084	c.931C>T	c.(931-933)CCT>TCT	p.P311S	NELL1_uc001mqf.2_Missense_Mutation_p.P311S|NELL1_uc009yid.2_Missense_Mutation_p.P339S|NELL1_uc010rdo.1_Missense_Mutation_p.P254S|NELL1_uc010rdp.1_Missense_Mutation_p.P71S	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	311	VWFC 1.				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						GTCCTGTCCCCCTCTCAATTG	0.537													58	84	---	---	---	---	capture	Missense_Mutation	SNP	20949959	20949959	NELL1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10240	25
PACS1	55690	broad.mit.edu	37	11	65988123	65988123	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65988123G>A	uc001oha.1	+	9	1194	c.1060G>A	c.(1060-1062)GTG>ATG	p.V354M		NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	354	Potential.				interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						GCTGGAGCATGTGTCCCGCGA	0.517													17	57	---	---	---	---	capture	Missense_Mutation	SNP	65988123	65988123	PACS1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11276	25
PRMT8	56341	broad.mit.edu	37	12	3649947	3649947	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:3649947G>T	uc001qmf.2	+	2	618	c.251G>T	c.(250-252)GGG>GTG	p.G84V	PRMT8_uc009zed.2_Missense_Mutation_p.G75V|PRMT8_uc009zee.1_RNA	NM_019854	NP_062828	Q9NR22	ANM8_HUMAN	HMT1 hnRNP methyltransferase-like 4	84					regulation of protein binding	cytoplasm|plasma membrane	histone-arginine N-methyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein-arginine omega-N asymmetric methyltransferase activity|protein-arginine omega-N monomethyltransferase activity			ovary(3)|central_nervous_system(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			GCCCACTTTGGGATCCACGAG	0.532													120	195	---	---	---	---	capture	Missense_Mutation	SNP	3649947	3649947	PRMT8	12	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12438	25
TMEM132D	121256	broad.mit.edu	37	12	129694197	129694197	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129694197G>A	uc009zyl.1	-	5	1639	c.1311C>T	c.(1309-1311)ATC>ATT	p.I437I		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	437	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTGTGTTCAGGATTTCTGCCT	0.617													45	72	---	---	---	---	capture	Silent	SNP	129694197	129694197	TMEM132D	12	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	15931	25
MTUS2	23281	broad.mit.edu	37	13	29599308	29599308	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29599308T>C	uc001usl.3	+	1	561	c.503T>C	c.(502-504)GTT>GCT	p.V168A		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	158						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						CCCCGGCATGTTCCCAAGGAT	0.507													21	95	---	---	---	---	capture	Missense_Mutation	SNP	29599308	29599308	MTUS2	13	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	9876	25
SLITRK6	84189	broad.mit.edu	37	13	86370526	86370526	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:86370526T>G	uc001vll.1	-	2	577	c.118A>C	c.(118-120)AAA>CAA	p.K40Q	SLITRK6_uc010afe.1_5'Flank	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	40	LRRNT 1.|Extracellular (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GTGCCATCTTTTTCCTCACAA	0.388													43	60	---	---	---	---	capture	Missense_Mutation	SNP	86370526	86370526	SLITRK6	13	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	14639	25
FOXA1	3169	broad.mit.edu	37	14	38060897	38060897	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:38060897G>A	uc001wuf.2	-	2	1404	c.1092C>T	c.(1090-1092)CCC>CCT	p.P364P	FOXA1_uc010tpz.1_Silent_p.P331P	NM_004496	NP_004487	P55317	FOXA1_HUMAN	forkhead box A1	364					chromatin remodeling|embryo development|epithelial cell maturation involved in prostate gland development|epithelial tube branching involved in lung morphogenesis|epithelial-mesenchymal signaling involved in prostate gland development|glucose homeostasis|lung epithelial cell differentiation|negative regulation of survival gene product expression|neuron fate specification|pattern specification process|positive regulation of estrogen receptor signaling pathway|positive regulation of mitotic cell cycle|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|prostate gland epithelium morphogenesis|prostate gland stromal morphogenesis|response to estradiol stimulus|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|protein domain specific binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding				0	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CCAGCGCCCCGGGCCCGGAGC	0.697													4	9	---	---	---	---	capture	Silent	SNP	38060897	38060897	FOXA1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5933	25
SIPA1L1	26037	broad.mit.edu	37	14	72055586	72055586	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:72055586C>T	uc001xms.2	+	2	1345	c.997C>T	c.(997-999)CAC>TAC	p.H333Y	SIPA1L1_uc001xmt.2_Missense_Mutation_p.H333Y|SIPA1L1_uc001xmu.2_Missense_Mutation_p.H333Y|SIPA1L1_uc001xmv.2_Missense_Mutation_p.H333Y	NM_015556	NP_056371	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like	333					actin cytoskeleton reorganization|activation of Rap GTPase activity|regulation of dendritic spine morphogenesis	cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane|synaptosome	GTPase activator activity			ovary(3)|breast(1)	4				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GTGCTTTGCCCACTATGATGT	0.448													56	126	---	---	---	---	capture	Missense_Mutation	SNP	72055586	72055586	SIPA1L1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	14222	25
FAM181A	90050	broad.mit.edu	37	14	94394688	94394688	+	Silent	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94394688C>T	uc001ybz.1	+	3	550	c.243C>T	c.(241-243)AGC>AGT	p.S81S	C14orf86_uc001yby.2_5'Flank|FAM181A_uc010aus.1_Silent_p.S19S|FAM181A_uc001yca.1_Silent_p.S19S	NM_138344	NP_612353	Q8N9Y4	F181A_HUMAN	hypothetical protein LOC90050	81											0						TGGCGTCCAGCGACATCAAGG	0.587													31	51	---	---	---	---	capture	Silent	SNP	94394688	94394688	FAM181A	14	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	5460	25
SERPINA11	256394	broad.mit.edu	37	14	94914503	94914503	+	Silent	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94914503C>T	uc001ydd.1	-	2	669	c.609G>A	c.(607-609)ACG>ACA	p.T203T		NM_001080451	NP_001073920	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1	203					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)		GAACCATGAACGTGTCCTGGC	0.473													75	123	---	---	---	---	capture	Silent	SNP	94914503	94914503	SERPINA11	14	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13981	25
RYR3	6263	broad.mit.edu	37	15	34077951	34077951	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34077951G>T	uc001zhi.2	+	66	9427	c.9357G>T	c.(9355-9357)GAG>GAT	p.E3119D	RYR3_uc010bar.2_Missense_Mutation_p.E3119D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3119					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACCTGGCCGAGTCAGGGGCCC	0.567													32	159	---	---	---	---	capture	Missense_Mutation	SNP	34077951	34077951	RYR3	15	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	13662	25
TYRO3	7301	broad.mit.edu	37	15	41860451	41860451	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41860451G>A	uc001zof.1	+	8	1222	c.998G>A	c.(997-999)CGC>CAC	p.R333H		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	333	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CATGCCATCCGCACAGATTCA	0.562													40	59	---	---	---	---	capture	Missense_Mutation	SNP	41860451	41860451	TYRO3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16696	25
CCDC33	80125	broad.mit.edu	37	15	74554903	74554903	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74554903C>T	uc002axo.2	+	3	702	c.308C>T	c.(307-309)GCA>GTA	p.A103V		NM_025055	NP_079331	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33 isoform 1	306	C2.						protein binding			ovary(3)|skin(2)	5						GCTGAGGATGCAGGGCAAGAA	0.587													12	20	---	---	---	---	capture	Missense_Mutation	SNP	74554903	74554903	CCDC33	15	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	2780	25
BCL2A1	597	broad.mit.edu	37	15	80263133	80263133	+	Missense_Mutation	SNP	G	A	A	rs143571009		TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:80263133G>A	uc002bfc.3	-	1	511	c.329C>T	c.(328-330)CCG>CTG	p.P110L	BCL2A1_uc002bfd.3_Missense_Mutation_p.P110L	NM_004049	NP_004040	Q16548	B2LA1_HUMAN	BCL2-related protein A1 isoform 1	110					anti-apoptosis|apoptosis	cytoplasm	protein binding			pancreas(1)	1						ATCCACATCCGGGGCAATTTG	0.403													45	255	---	---	---	---	capture	Missense_Mutation	SNP	80263133	80263133	BCL2A1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1355	25
ALPK3	57538	broad.mit.edu	37	15	85400203	85400203	+	Missense_Mutation	SNP	C	A	A	rs142677464		TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85400203C>A	uc002ble.2	+	6	3007	c.2840C>A	c.(2839-2841)GCG>GAG	p.A947E		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	947					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCACCTACAGCGGGTCCTAGA	0.562													70	118	---	---	---	---	capture	Missense_Mutation	SNP	85400203	85400203	ALPK3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	546	25
PEX11A	8800	broad.mit.edu	37	15	90226684	90226684	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90226684C>T	uc002boi.2	-	3	763	c.668G>A	c.(667-669)GGA>GAA	p.G223E	PEX11A_uc010upy.1_RNA	NM_003847	NP_003838	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha	223	Helical; (Potential).				cellular lipid metabolic process|peroxisome fission|signal transduction	integral to peroxisomal membrane					0	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			ACCTCCAAGTCCAATGATGCC	0.483													205	353	---	---	---	---	capture	Missense_Mutation	SNP	90226684	90226684	PEX11A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	11640	25
ALG1	56052	broad.mit.edu	37	16	5128838	5128838	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5128838G>A	uc002cym.2	+	7	862	c.821G>A	c.(820-822)CGT>CAT	p.R274H	ALG1_uc002cyj.2_Missense_Mutation_p.R163H|ALG1_uc002cyn.2_Missense_Mutation_p.R274H|ALG1_uc010bue.2_Missense_Mutation_p.R163H|ALG1_uc010uxy.1_Missense_Mutation_p.R163H	NM_019109	NP_061982	Q9BT22	ALG1_HUMAN	beta-1,4-mannosyltransferase	274	Lumenal (Potential).				dolichol-linked oligosaccharide biosynthetic process|lipopolysaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	chitobiosyldiphosphodolichol beta-mannosyltransferase activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(90;0.0164)				ACGCGTCTCCGTGAGCGGCCA	0.652													31	29	---	---	---	---	capture	Missense_Mutation	SNP	5128838	5128838	ALG1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	510	25
TAX1BP3	30851	broad.mit.edu	37	17	3567085	3567085	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3567085C>T	uc002fwc.2	-	4	485	c.332G>A	c.(331-333)CGG>CAG	p.R111Q	P2RX5_uc002fwd.2_RNA|TAX1BP3_uc002fwe.1_3'UTR	NM_014604	NP_055419	O14907	TX1B3_HUMAN	Tax1 binding protein 3	111	PDZ.				activation of Cdc42 GTPase activity|negative regulation of protein localization at cell surface|negative regulation of Wnt receptor signaling pathway|Rho protein signal transduction|Wnt receptor signaling pathway	cytoplasm|nucleus	protein C-terminus binding				0				COAD - Colon adenocarcinoma(5;0.0761)		CAGCGACTGCCGCGTCACCAG	0.647													4	10	---	---	---	---	capture	Missense_Mutation	SNP	3567085	3567085	TAX1BP3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15483	25
ENO3	2027	broad.mit.edu	37	17	4860277	4860277	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:4860277G>A	uc002gab.3	+	12	1334	c.1240G>A	c.(1240-1242)GAG>AAG	p.E414K	ENO3_uc002gac.3_Missense_Mutation_p.E414K|ENO3_uc010vss.1_Missense_Mutation_p.E371K|ENO3_uc010vst.1_Missense_Mutation_p.E241K	NM_053013	NP_443739	P13929	ENOB_HUMAN	enolase 3	414					gluconeogenesis|glycolysis	phosphopyruvate hydratase complex	magnesium ion binding|phosphopyruvate hydratase activity			ovary(1)	1						TTCTAGGATCGAGGAGGCTCT	0.577											OREG0024110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	97	123	---	---	---	---	capture	Missense_Mutation	SNP	4860277	4860277	ENO3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5078	25
ALOX12B	242	broad.mit.edu	37	17	7984477	7984477	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7984477G>A	uc002gjy.1	-	3	642	c.381C>T	c.(379-381)CCC>CCT	p.P127P	uc010cnq.1_RNA	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	127	Lipoxygenase.				epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CCAGGAGGACGGGGAGCGAGT	0.617										Multiple Myeloma(8;0.094)			17	78	---	---	---	---	capture	Silent	SNP	7984477	7984477	ALOX12B	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	537	25
USH1G	124590	broad.mit.edu	37	17	72916074	72916074	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72916074G>A	uc002jme.1	-	2	1040	c.857C>T	c.(856-858)GCC>GTC	p.A286V	USH1G_uc010wro.1_Missense_Mutation_p.A183V	NM_173477	NP_775748	Q495M9	USH1G_HUMAN	Usher syndrome 1G protein	286					equilibrioception|photoreceptor cell maintenance|sensory perception of sound	actin cytoskeleton				skin(2)	2	all_lung(278;0.172)|Lung NSC(278;0.207)					CGCCAGCGTGGCACGGGAGAC	0.687													10	43	---	---	---	---	capture	Missense_Mutation	SNP	72916074	72916074	USH1G	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16917	25
FOXJ1	2302	broad.mit.edu	37	17	74136123	74136123	+	Silent	SNP	C	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74136123C>A	uc002jqw.2	-	1	444	c.354G>T	c.(352-354)CCG>CCT	p.P118P	FOXJ1_uc002jqx.2_Silent_p.P118P|uc002jqy.1_5'Flank	NM_001454	NP_001445	Q92949	FOXJ1_HUMAN	forkhead box J1	118					actin cytoskeleton organization|activation of Rho GTPase activity|central tolerance induction|cilium assembly|epithelial cell differentiation|establishment of apical/basal cell polarity|heart looping|humoral immune response|left/right pattern formation|leukocyte migration|lung development|negative regulation of B cell activation|negative regulation of germinal center formation|negative regulation of humoral immune response mediated by circulating immunoglobulin|negative regulation of interleukin-6 biosynthetic process|negative regulation of NF-kappaB transcription factor activity|negative regulation of T cell differentiation in thymus|negative regulation of T cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of central B cell tolerance induction|spermatogenesis	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			pancreas(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			GCTTCACGTGCGGATTGGTGG	0.667													6	29	---	---	---	---	capture	Silent	SNP	74136123	74136123	FOXJ1	17	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	5955	25
FAM59A	64762	broad.mit.edu	37	18	29890192	29890192	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29890192G>A	uc002kxl.2	-	3	413	c.357C>T	c.(355-357)CGC>CGT	p.R119R	FAM59A_uc002kxk.1_Silent_p.R119R	NM_022751	NP_073588	Q9H706	FA59A_HUMAN	family with sequence similarity 59, member A	119	CABIT.									ovary(1)|skin(1)	2						TGACGTACACGCGTTCAGGAA	0.413													99	171	---	---	---	---	capture	Silent	SNP	29890192	29890192	FAM59A	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5540	25
SERPINB5	5268	broad.mit.edu	37	18	61156656	61156656	+	Missense_Mutation	SNP	C	T	T	rs145559318		TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61156656C>T	uc002liz.3	+	4	525	c.383C>T	c.(382-384)ACG>ATG	p.T128M	SERPINB5_uc002liy.2_Missense_Mutation_p.T128M	NM_002639	NP_002630	P36952	SPB5_HUMAN	serine (or cysteine) proteinase inhibitor, clade	128					cellular component movement|regulation of proteolysis	cytoplasm|extracellular space	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1						TTGGAAGAAACGAAAGGTCAG	0.388													26	78	---	---	---	---	capture	Missense_Mutation	SNP	61156656	61156656	SERPINB5	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13997	25
MUC16	94025	broad.mit.edu	37	19	9067989	9067989	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9067989A>G	uc002mkp.2	-	3	19661	c.19457T>C	c.(19456-19458)TTG>TCG	p.L6486S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6488	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AAGAGTGGACAAATCTAATTG	0.488													58	109	---	---	---	---	capture	Missense_Mutation	SNP	9067989	9067989	MUC16	19	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	9883	25
SLC44A2	57153	broad.mit.edu	37	19	10742381	10742381	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10742381G>A	uc002mpf.2	+	8	721	c.582G>A	c.(580-582)GGG>GGA	p.G194G	SLC44A2_uc002mpe.3_Silent_p.G192G	NM_020428	NP_065161	Q8IWA5	CTL2_HUMAN	solute carrier family 44, member 2 isoform 1	194	Extracellular (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	choline transmembrane transporter activity|signal transducer activity			ovary(1)	1			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	ATGAGGATGGGCATGGCTCCC	0.602													4	88	---	---	---	---	capture	Silent	SNP	10742381	10742381	SLC44A2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	14528	25
PSG7	5676	broad.mit.edu	37	19	43429925	43429925	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43429925C>A	uc002ovl.3	-	6	1345	c.1243G>T	c.(1243-1245)GAC>TAC	p.D415Y	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Missense_Mutation_p.A328S|PSG7_uc002ous.1_RNA|PSG7_uc002out.1_Missense_Mutation_p.A141S|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.D328Y|PSG7_uc010xwl.1_Missense_Mutation_p.D293Y	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7	415					female pregnancy	extracellular region					0		Prostate(69;0.00682)				ATCCACTTACCAGAGACTCTG	0.483													150	229	---	---	---	---	capture	Missense_Mutation	SNP	43429925	43429925	PSG7	19	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	12555	25
CEACAM20	125931	broad.mit.edu	37	19	45029207	45029207	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45029207G>A	uc010ejn.1	-	2	139	c.123C>T	c.(121-123)GCC>GCT	p.A41A	CEACAM20_uc010ejo.1_Silent_p.A41A|CEACAM20_uc010ejp.1_Silent_p.A41A|CEACAM20_uc010ejq.1_Silent_p.A41A	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	41	Extracellular (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				CACTTTGGGTGGCATCAAGTG	0.562													4	174	---	---	---	---	capture	Silent	SNP	45029207	45029207	CEACAM20	19	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	3160	25
ZNF83	55769	broad.mit.edu	37	19	53116375	53116375	+	Silent	SNP	T	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53116375T>C	uc002pzu.3	-	2	2687	c.1443A>G	c.(1441-1443)GGA>GGG	p.G481G	ZNF83_uc002pzv.3_Silent_p.G481G|ZNF83_uc010eps.2_Silent_p.G453G|ZNF83_uc010ept.2_Silent_p.G481G|ZNF83_uc010epu.2_Silent_p.G481G|ZNF83_uc010epv.2_Silent_p.G481G|ZNF83_uc010epw.2_Silent_p.G481G|ZNF83_uc010epx.2_Silent_p.G453G|ZNF83_uc010epy.2_Silent_p.G481G|ZNF83_uc010epz.2_Silent_p.G453G	NM_018300	NP_060770	P51522	ZNF83_HUMAN	zinc finger protein 83 isoform a	481						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		AATGTTTCTCTCCAGTGTGGA	0.388													3	144	---	---	---	---	capture	Silent	SNP	53116375	53116375	ZNF83	19	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	18059	25
TMC4	147798	broad.mit.edu	37	19	54669199	54669199	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54669199T>G	uc010erf.2	-	6	1049	c.917A>C	c.(916-918)GAC>GCC	p.D306A	TMC4_uc002qdn.2_5'Flank|TMC4_uc002qdo.2_Missense_Mutation_p.D300A	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1	306	Extracellular (Potential).					integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CACGTGGACGTCCCCGCAGAG	0.632													10	17	---	---	---	---	capture	Missense_Mutation	SNP	54669199	54669199	TMC4	19	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	15872	25
NLRP9	338321	broad.mit.edu	37	19	56244390	56244390	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56244390G>A	uc002qly.2	-	2	835	c.807C>T	c.(805-807)TCC>TCT	p.S269S		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	269	NACHT.					cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TAAGGAGAGAGGATTCTGGAA	0.408													37	77	---	---	---	---	capture	Silent	SNP	56244390	56244390	NLRP9	19	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	10391	25
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													3	23	---	---	---	---	capture	Missense_Mutation	SNP	58385546	58385546	ZNF814	19	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	18052	25
FEZ2	9637	broad.mit.edu	37	2	36810520	36810520	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:36810520A>C	uc002rph.2	-	3	515	c.468T>G	c.(466-468)GAT>GAG	p.D156E	FEZ2_uc002rpe.2_5'Flank|FEZ2_uc002rpf.2_5'UTR|FEZ2_uc002rpg.2_Missense_Mutation_p.D156E|FEZ2_uc002rpi.2_Missense_Mutation_p.D11E|FEZ2_uc002rpj.2_Missense_Mutation_p.D156E	NM_005102	NP_005093	Q9UHY8	FEZ2_HUMAN	zygin 2 isoform 1	156					axon guidance|signal transduction		protein binding			ovary(1)	1		all_hematologic(82;0.21)				AGAGGGGTTCATCATTAACAC	0.438													36	94	---	---	---	---	capture	Missense_Mutation	SNP	36810520	36810520	FEZ2	2	A	C	C	C	1	0	0	0	0	1	0	0	0	102	8	4	4	5770	25
CD8A	925	broad.mit.edu	37	2	87013056	87013056	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:87013056G>A	uc002srt.2	-	6	1584	c.695C>T	c.(694-696)GCG>GTG	p.A232V	RMND5A_uc002srs.3_Intron|CD8A_uc002srv.2_Missense_Mutation_p.A232V|CD8A_uc010ytn.1_Missense_Mutation_p.A273V|CD8A_uc002sru.2_Missense_Mutation_p.A195V	NM_001768	NP_001759	P01732	CD8A_HUMAN	CD8 antigen alpha polypeptide isoform 1	232	Cytoplasmic (Potential).				antigen processing and presentation|regulation of immune response|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			ovary(1)	1						GACGTATCTCGCCGAAAGGCT	0.507													54	162	---	---	---	---	capture	Missense_Mutation	SNP	87013056	87013056	CD8A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3015	25
TRIM43	129868	broad.mit.edu	37	2	96262159	96262159	+	Missense_Mutation	SNP	A	T	T	rs149986492		TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96262159A>T	uc002suv.2	+	4	853	c.717A>T	c.(715-717)AAA>AAT	p.K239N		NM_138800	NP_620155	Q96BQ3	TRI43_HUMAN	tripartite motif-containing 43	239						intracellular	zinc ion binding			ovary(1)	1						TGTGTCATAAACCAGATGTGG	0.413													12	10	---	---	---	---	capture	Missense_Mutation	SNP	96262159	96262159	TRIM43	2	A	T	T	T	1	0	0	0	0	1	0	0	0	24	2	4	4	16401	25
GPR148	344561	broad.mit.edu	37	2	131486773	131486773	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131486773G>A	uc002trv.1	+	1	51	c.49G>A	c.(49-51)GCC>ACC	p.A17T		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	17	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1	Colorectal(110;0.1)					AGCTTGGCCGGCCCTGATCCA	0.612													35	98	---	---	---	---	capture	Missense_Mutation	SNP	131486773	131486773	GPR148	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	6587	25
PLCB1	23236	broad.mit.edu	37	20	8352082	8352082	+	Silent	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:8352082C>T	uc002wnb.2	+	3	234	c.231C>T	c.(229-231)CAC>CAT	p.H77H	PLCB1_uc010zrb.1_Translation_Start_Site|PLCB1_uc010gbv.1_Silent_p.H77H|PLCB1_uc002wmz.1_Silent_p.H77H|PLCB1_uc002wna.2_Silent_p.H77H	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	77					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						GTGGGAGACACGCCAAAGCTC	0.468													29	96	---	---	---	---	capture	Silent	SNP	8352082	8352082	PLCB1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11930	25
SSTR4	6754	broad.mit.edu	37	20	23016952	23016952	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23016952G>T	uc002wsr.2	+	1	896	c.832G>T	c.(832-834)GTG>TTG	p.V278L		NM_001052	NP_001043	P31391	SSR4_HUMAN	somatostatin receptor 4	278	Helical; Name=6; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity			ovary(1)	1	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TTTCTACGTGGTGCAGCTGCT	0.577													29	109	---	---	---	---	capture	Missense_Mutation	SNP	23016952	23016952	SSTR4	20	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	15092	25
PREX1	57580	broad.mit.edu	37	20	47244458	47244458	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47244458G>A	uc002xtw.1	-	38	4833	c.4810C>T	c.(4810-4812)CGG>TGG	p.R1604W	PREX1_uc002xtv.1_Missense_Mutation_p.R901W	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1604					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCGTGGCTCCGTGCCAAGATG	0.692													16	49	---	---	---	---	capture	Missense_Mutation	SNP	47244458	47244458	PREX1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	12372	25
KCNG1	3755	broad.mit.edu	37	20	49621144	49621144	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:49621144C>T	uc002xwa.3	-	3	1269	c.974G>A	c.(973-975)CGT>CAT	p.R325H		NM_002237	NP_002228	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G,	325						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|central_nervous_system(1)	2						GGGCTTGCGACGGCCTGCGGC	0.701													3	6	---	---	---	---	capture	Missense_Mutation	SNP	49621144	49621144	KCNG1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7949	25
SCARF2	91179	broad.mit.edu	37	22	20784714	20784714	+	Splice_Site	SNP	A	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20784714A>C	uc002zsj.1	-	6	1307	c.1202_splice	c.e6+1	p.H401_splice	SCARF2_uc002zsk.1_Splice_Site_p.H401_splice	NM_153334	NP_699165	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2 isoform 1						cell adhesion	integral to membrane	protein binding|receptor activity			breast(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGGCACTCACTGGGGCCCG	0.711													3	2	---	---	---	---	capture	Splice_Site	SNP	20784714	20784714	SCARF2	22	A	C	C	C	1	0	0	0	0	0	0	1	0	78	6	5	4	13776	25
CACNA1I	8911	broad.mit.edu	37	22	40078576	40078576	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40078576G>A	uc003ayc.2	+	35	5740	c.5740G>A	c.(5740-5742)GTC>ATC	p.V1914I	CACNA1I_uc003ayd.2_Missense_Mutation_p.V1879I|CACNA1I_uc003aye.2_Missense_Mutation_p.V1829I|CACNA1I_uc003ayf.2_Missense_Mutation_p.V1794I	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	1914	Cytoplasmic (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CTCTACGGCCGTCTCGCCGGA	0.592													41	21	---	---	---	---	capture	Missense_Mutation	SNP	40078576	40078576	CACNA1I	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2522	25
DLEC1	9940	broad.mit.edu	37	3	38104257	38104257	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38104257G>A	uc003cho.1	+	5	1080	c.1059G>A	c.(1057-1059)CCG>CCA	p.P353P	DLEC1_uc003chp.1_Silent_p.P353P|DLEC1_uc010hgv.1_Silent_p.P353P|DLEC1_uc010hgw.1_Silent_p.P52P|DLEC1_uc003chq.1_RNA	NM_007335	NP_031361	Q9Y238	DLEC1_HUMAN	deleted in lung and esophageal cancer 1 isoform	353					negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AGCCAGCACCGATAGGAGAAT	0.463													24	74	---	---	---	---	capture	Silent	SNP	38104257	38104257	DLEC1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	4510	25
ULK4	54986	broad.mit.edu	37	3	41953077	41953077	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:41953077T>G	uc003ckv.3	-	10	1172	c.971A>C	c.(970-972)AAA>ACA	p.K324T	ULK4_uc003ckw.2_Missense_Mutation_p.K324T|ULK4_uc003ckx.1_Missense_Mutation_p.K324T	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	324							ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CTTGTGCCCTTTTGCTTGTCT	0.413													38	106	---	---	---	---	capture	Missense_Mutation	SNP	41953077	41953077	ULK4	3	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	16860	25
LRBA	987	broad.mit.edu	37	4	151788860	151788860	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:151788860C>T	uc010ipj.2	-	22	3203	c.2729G>A	c.(2728-2730)CGT>CAT	p.R910H	LRBA_uc003ilu.3_Missense_Mutation_p.R910H	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	910						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					TACCCATACACGCCAGCCACC	0.343													50	58	---	---	---	---	capture	Missense_Mutation	SNP	151788860	151788860	LRBA	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8847	25
PCDHGB3	56102	broad.mit.edu	37	5	140752102	140752102	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140752102G>A	uc003ljw.1	+	1	2141	c.2141G>A	c.(2140-2142)CGC>CAC	p.R714H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.R714H|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	714	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTCCCTGCGCCTGCGATGC	0.582													28	65	---	---	---	---	capture	Missense_Mutation	SNP	140752102	140752102	PCDHGB3	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11467	25
FLT4	2324	broad.mit.edu	37	5	180048197	180048197	+	Silent	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180048197G>A	uc003mma.3	-	14	2155	c.2076C>T	c.(2074-2076)AGC>AGT	p.S692S	FLT4_uc003mlz.3_Silent_p.S692S|FLT4_uc003mmb.1_Silent_p.S225S|FLT4_uc011dgy.1_Silent_p.S692S	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	692	Ig-like C2-type 7.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	CCAGCGAGTCGCTCACGTTCA	0.632									Congenital_Hereditary_Lymphedema				41	62	---	---	---	---	capture	Silent	SNP	180048197	180048197	FLT4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	5888	25
GRM4	2914	broad.mit.edu	37	6	34004373	34004373	+	Missense_Mutation	SNP	C	T	T	rs142049660	by1000genomes	TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:34004373C>T	uc003oir.3	-	8	1684	c.1514G>A	c.(1513-1515)CGG>CAG	p.R505Q	GRM4_uc011dsn.1_Missense_Mutation_p.R458Q|GRM4_uc010jvh.2_Missense_Mutation_p.R505Q|GRM4_uc010jvi.2_Missense_Mutation_p.R197Q|GRM4_uc003oio.2_Missense_Mutation_p.R197Q|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.R365Q|GRM4_uc003oiq.2_Missense_Mutation_p.R372Q|GRM4_uc011dsm.1_Missense_Mutation_p.R336Q	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	505	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CCAGTGCATCCGCTCTATCTG	0.647													17	22	---	---	---	---	capture	Missense_Mutation	SNP	34004373	34004373	GRM4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6732	25
DNAH8	1769	broad.mit.edu	37	6	38957817	38957817	+	Silent	SNP	G	A	A	rs143472136	byFrequency	TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38957817G>A	uc003ooe.1	+	86	13032	c.12432G>A	c.(12430-12432)CCG>CCA	p.P4144P		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TGTTTGAACCGTCATTCTGCT	0.368													88	178	---	---	---	---	capture	Silent	SNP	38957817	38957817	DNAH8	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4563	25
OPN5	221391	broad.mit.edu	37	6	47763200	47763200	+	Silent	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47763200C>T	uc003ozc.2	+	4	662	c.657C>T	c.(655-657)TAC>TAT	p.Y219Y	OPN5_uc003ozd.2_Silent_p.Y54Y	NM_181744	NP_859528	Q6U736	OPN5_HUMAN	opsin 5 isoform 1	219	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1						TGTTCTCCTACGTAAAGATCA	0.512													58	123	---	---	---	---	capture	Silent	SNP	47763200	47763200	OPN5	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10787	25
PKHD1	5314	broad.mit.edu	37	6	51889738	51889738	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51889738G>A	uc003pah.1	-	32	5146	c.4870C>T	c.(4870-4872)CGG>TGG	p.R1624W	PKHD1_uc003pai.2_Missense_Mutation_p.R1624W	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1624	Extracellular (Potential).|IPT/TIG 11.		R -> W (in ARPKD).		cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity	p.R1624W(1)		lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ACAATGCACCGGATGAGCTCA	0.507													107	173	---	---	---	---	capture	Missense_Mutation	SNP	51889738	51889738	PKHD1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	11874	25
OOEP	441161	broad.mit.edu	37	6	74079390	74079390	+	Silent	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74079390C>T	uc003pgu.3	-	1	126	c.126G>A	c.(124-126)CCG>CCA	p.P42P	OOEP_uc003pgv.3_Intron	NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog	42						cytoplasm					0						GTTCCTGCACCGGAAACCACC	0.622													43	119	---	---	---	---	capture	Silent	SNP	74079390	74079390	OOEP	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10774	25
FILIP1	27145	broad.mit.edu	37	6	76024625	76024625	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76024625G>T	uc003pia.2	-	5	1296	c.923C>A	c.(922-924)TCG>TAG	p.S308*	FILIP1_uc003phy.1_Nonsense_Mutation_p.S308*|FILIP1_uc003phz.2_Nonsense_Mutation_p.S209*|FILIP1_uc010kbe.2_Nonsense_Mutation_p.S311*|FILIP1_uc003pib.1_Nonsense_Mutation_p.S60*	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	308	Potential.									skin(3)|ovary(1)	4						AGAAAACCTCGAAGCCTTGTG	0.423													63	117	---	---	---	---	capture	Nonsense_Mutation	SNP	76024625	76024625	FILIP1	6	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	5839	25
SEC63	11231	broad.mit.edu	37	6	108225906	108225906	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:108225906T>G	uc003psc.3	-	11	1250	c.981A>C	c.(979-981)AAA>AAC	p.K327N	SEC63_uc003psb.3_Missense_Mutation_p.K187N	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein	327	SEC63 1.|Cytoplasmic (Potential).				protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CAGGACACTTTTTTAGCATGA	0.348													128	164	---	---	---	---	capture	Missense_Mutation	SNP	108225906	108225906	SEC63	6	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	13898	25
GPR126	57211	broad.mit.edu	37	6	142736937	142736937	+	Silent	SNP	T	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:142736937T>C	uc010khc.2	+	20	3085	c.2674T>C	c.(2674-2676)TTG>CTG	p.L892L	GPR126_uc010khd.2_Silent_p.L864L|GPR126_uc010khe.2_Silent_p.L892L|GPR126_uc010khf.2_Silent_p.L864L	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	892	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		TTTTAGGAAATTGCGAAGGGA	0.403													46	71	---	---	---	---	capture	Silent	SNP	142736937	142736937	GPR126	6	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	6574	25
RUNDC3B	154661	broad.mit.edu	37	7	87258211	87258211	+	Silent	SNP	G	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:87258211G>C	uc003ujb.2	+	1	483	c.72G>C	c.(70-72)CTG>CTC	p.L24L	ABCB1_uc003uiz.1_Intron|ABCB1_uc003uja.1_Intron|ABCB1_uc010lei.1_Intron|RUNDC3B_uc011khd.1_Silent_p.L24L|RUNDC3B_uc011khe.1_Silent_p.L24L|RUNDC3B_uc003ujc.2_Silent_p.L24L	NM_138290	NP_612147	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B isoform a	24										skin(1)	1	Esophageal squamous(14;0.00164)					AGAAAAGCCTGAGCGCCCGCA	0.716													2	10	---	---	---	---	capture	Silent	SNP	87258211	87258211	RUNDC3B	7	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	13637	25
RELN	5649	broad.mit.edu	37	7	103338350	103338350	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103338350C>T	uc003vca.2	-	10	1253	c.1093G>A	c.(1093-1095)GAC>AAC	p.D365N	RELN_uc010liz.2_Missense_Mutation_p.D365N	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	365					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCCACTGGGTCGAGACTATCT	0.423													42	184	---	---	---	---	capture	Missense_Mutation	SNP	103338350	103338350	RELN	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13115	25
CHCHD3	54927	broad.mit.edu	37	7	132754903	132754903	+	Silent	SNP	T	C	C			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:132754903T>C	uc003vre.2	-	2	304	c.168A>G	c.(166-168)TCA>TCG	p.S56S	CHCHD3_uc010lmi.2_RNA|CHCHD3_uc003vrf.2_Silent_p.S56S|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Silent_p.S56S	NM_017812	NP_060282	Q9NX63	CHCH3_HUMAN	coiled-coil-helix-coiled-coil-helix domain	56					inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0						CAGCAATACCTGAGGCACCAT	0.378													3	103	---	---	---	---	capture	Silent	SNP	132754903	132754903	CHCHD3	7	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	3283	25
KEL	3792	broad.mit.edu	37	7	142655026	142655026	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142655026G>T	uc003wcb.2	-	6	770	c.560C>A	c.(559-561)TCC>TAC	p.S187Y		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	187	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					AAAGTTTAAGGAAGTCCATTT	0.517													30	55	---	---	---	---	capture	Missense_Mutation	SNP	142655026	142655026	KEL	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	8064	25
CLCN1	1180	broad.mit.edu	37	7	143036401	143036401	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143036401C>G	uc003wcr.1	+	13	1544	c.1457C>G	c.(1456-1458)CCT>CGT	p.P486R	CLCN1_uc011ktc.1_Missense_Mutation_p.P98R	NM_000083	NP_000074	P35523	CLCN1_HUMAN	chloride channel 1, skeletal muscle	486	Helical; (By similarity).|Selectivity filter part_3 (By similarity).				muscle contraction	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Melanoma(164;0.205)					GGCTTCATGCCTGTGTTTGTG	0.517													56	342	---	---	---	---	capture	Missense_Mutation	SNP	143036401	143036401	CLCN1	7	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	3427	25
ARHGEF10	9639	broad.mit.edu	37	8	1806268	1806268	+	Silent	SNP	C	A	A	rs111294316	byFrequency	TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1806268C>A	uc003wpr.2	+	3	358	c.180C>A	c.(178-180)GCC>GCA	p.A60A	ARHGEF10_uc003wpq.1_Silent_p.A84A|ARHGEF10_uc003wps.2_Silent_p.A60A|ARHGEF10_uc003wpt.2_5'Flank|ARHGEF10_uc010lrd.1_5'Flank|ARHGEF10_uc003wpu.2_5'Flank	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	84					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CCAGTGAAGCCCCTGCACCCA	0.323													7	14	---	---	---	---	capture	Silent	SNP	1806268	1806268	ARHGEF10	8	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	887	25
TRIM55	84675	broad.mit.edu	37	8	67062093	67062093	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:67062093G>T	uc003xvv.2	+	5	1043	c.817G>T	c.(817-819)GAA>TAA	p.E273*	TRIM55_uc003xvu.2_Nonsense_Mutation_p.E273*|TRIM55_uc003xvw.2_Nonsense_Mutation_p.E273*|TRIM55_uc003xvx.2_Intron	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	273	COS.					cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			GGATGAGCCAGAAATGGCAGT	0.378													48	60	---	---	---	---	capture	Nonsense_Mutation	SNP	67062093	67062093	TRIM55	8	G	T	T	T	1	0	0	0	0	0	1	0	0	429	33	5	4	16412	25
DENND4C	55667	broad.mit.edu	37	9	19346294	19346294	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19346294C>T	uc003znq.2	+	18	2705	c.2672C>T	c.(2671-2673)CCG>CTG	p.P891L	DENND4C_uc011lnc.1_Missense_Mutation_p.P221L|DENND4C_uc011lnd.1_Missense_Mutation_p.P179L|DENND4C_uc003znr.2_Missense_Mutation_p.P179L|DENND4C_uc003zns.2_Missense_Mutation_p.P73L|DENND4C_uc003znt.2_Missense_Mutation_p.P73L	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	891						integral to membrane				ovary(1)|skin(1)	2						AGATCATCTCCGGTGCCAGAG	0.443													76	129	---	---	---	---	capture	Missense_Mutation	SNP	19346294	19346294	DENND4C	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4393	25
PGM5	5239	broad.mit.edu	37	9	71080089	71080089	+	Missense_Mutation	SNP	G	A	A	rs141668530		TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:71080089G>A	uc004agr.2	+	7	1353	c.1124G>A	c.(1123-1125)CGT>CAT	p.R375H		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	375					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						GACTCAGGACGTTGCAATCTG	0.473													89	169	---	---	---	---	capture	Missense_Mutation	SNP	71080089	71080089	PGM5	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11704	25
APBA1	320	broad.mit.edu	37	9	72130983	72130983	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:72130983G>A	uc004ahh.2	-	2	1420	c.1144C>T	c.(1144-1146)CGC>TGC	p.R382C		NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,	382	LIN-2/CASK binding.|Pro-rich.				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						ATGTCCTGGCGCATGACCCAG	0.622													5	197	---	---	---	---	capture	Missense_Mutation	SNP	72130983	72130983	APBA1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	749	25
SOHLH1	402381	broad.mit.edu	37	9	138586907	138586907	+	Silent	SNP	C	T	T			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138586907C>T	uc004cgl.2	-	6	925	c.864G>A	c.(862-864)GCG>GCA	p.A288A	SOHLH1_uc010nbe.2_Silent_p.A288A	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic	288					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			breast(1)|central_nervous_system(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CGGCCTCCTGCGCCAGCATGG	0.697													6	12	---	---	---	---	capture	Silent	SNP	138586907	138586907	SOHLH1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14815	25
HMCN1	83872	broad.mit.edu	37	1	186017944	186017945	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186017944_186017945insA	uc001grq.1	+	42	6779_6780	c.6550_6551insA	c.(6550-6552)GAAfs	p.E2184fs		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2184	Ig-like C2-type 19.			E -> EK (in Ref. 1).	response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TGGAAAAACTGAAAAAAACTAC	0.361													59	53	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	186017944	186017945	HMCN1	1	-	A	A	A	1	0	1	1	0	0	0	0	0	585	45	5	5	7145	25
ZNF45	7596	broad.mit.edu	37	19	44417709	44417709	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44417709delG	uc002oxu.1	-	4	1978	c.1879delC	c.(1879-1881)CTTfs	p.L627fs	ZNF45_uc002oxw.1_Frame_Shift_Del_p.L627fs|ZNF45_uc002oxv.1_Frame_Shift_Del_p.L627fs	NM_003425	NP_003416	Q02386	ZNF45_HUMAN	zinc finger protein 45	627	C2H2-type 17.				multicellular organismal development	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						TGGGCTTGAAGGTATGAGCTC	0.488													52	207	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44417709	44417709	ZNF45	19	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	17800	25
DIMT1L	27292	broad.mit.edu	37	5	61686705	61686705	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:61686705delG	uc003jta.2	-	11	1026	c.897delC	c.(895-897)ATCfs	p.I299fs		NM_014473	NP_055288	Q9UNQ2	DIMT1_HUMAN	dimethyladenosine transferase	299				Missing (in Ref. 2; AAH02841).		nucleolus	RNA binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			central_nervous_system(1)	1		Lung NSC(810;8.94e-06)|Prostate(74;0.0235)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.122)		GTAATTACCTGATGAAGTCAT	0.383													93	153	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	61686705	61686705	DIMT1L	5	G	-	-	-	1	0	1	0	1	0	0	0	0	577	45	5	5	4481	25
GOLGA2	2801	broad.mit.edu	37	9	131020819	131020821	+	In_Frame_Del	DEL	TCC	-	-			TCGA-06-0152-01	TCGA-06-0152-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131020819_131020821delTCC	uc011maw.1	-	21	2134_2136	c.2121_2123delGGA	c.(2119-2124)GAGGAT>GAT	p.E707del	GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004buh.2_In_Frame_Del_p.E180del	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2	707	Potential.|Poly-Glu.					Golgi cisterna membrane	protein binding			ovary(1)	1						ctcctcctcatcctcctcctcct	0.527													3	6	---	---	---	---	capture_indel	In_Frame_Del	DEL	131020819	131020821	GOLGA2	9	TCC	-	-	-	1	0	1	0	1	0	0	0	0	650	50	5	5	6488	25
