Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SPTA1	6708	broad.mit.edu	37	1	158585171	158585171	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158585171G>A	uc001fst.1	-	48	6822	c.6623C>T	c.(6622-6624)GCG>GTG	p.A2208V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2208	Spectrin 21.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ACGCTTCATCGCCTGGATCTC	0.468													83	146	---	---	---	---	capture	Missense_Mutation	SNP	158585171	158585171	SPTA1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15008	28
SERPINC1	462	broad.mit.edu	37	1	173878724	173878724	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173878724G>A	uc001gjt.2	-	5	1238	c.1119C>T	c.(1117-1119)GTC>GTT	p.V373V		NM_000488	NP_000479	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C, member 1	373					blood coagulation|regulation of proteolysis	extracellular space|plasma membrane	heparin binding|protease binding|serine-type endopeptidase inhibitor activity			ovary(1)	1					Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)	TGAACAGATCGACAAGGCCCA	0.527													65	94	---	---	---	---	capture	Silent	SNP	173878724	173878724	SERPINC1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14002	28
SYT2	127833	broad.mit.edu	37	1	202566072	202566072	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202566072G>A	uc001gye.2	-	9	1266	c.1073C>T	c.(1072-1074)ACC>ATC	p.T358I	SYT2_uc010pqb.1_Missense_Mutation_p.T358I|SYT2_uc009xaf.2_Missense_Mutation_p.T188I	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	358	Phospholipid binding (By similarity).|C2 2.|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GTCCAGCACGGTGACCACTAC	0.547													47	59	---	---	---	---	capture	Missense_Mutation	SNP	202566072	202566072	SYT2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	15362	28
HSD11B1	3290	broad.mit.edu	37	1	209907741	209907741	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209907741C>T	uc001hhj.2	+	7	861	c.754C>T	c.(754-756)CGC>TGC	p.R252C	HSD11B1_uc001hhk.2_Missense_Mutation_p.R252C	NM_181755	NP_861420	P28845	DHI1_HUMAN	11-beta-hydroxysteroid dehydrogenase 1	252	Lumenal (Potential).				glucocorticoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	11-beta-hydroxysteroid dehydrogenase (NADP+) activity|11-beta-hydroxysteroid dehydrogenase|binding			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	NADH(DB00157)	GGGAGCTCTGCGCCAAGAAGA	0.463													44	62	---	---	---	---	capture	Missense_Mutation	SNP	209907741	209907741	HSD11B1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7300	28
RYR2	6262	broad.mit.edu	37	1	237777626	237777626	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237777626C>T	uc001hyl.1	+	37	5318	c.5198C>T	c.(5197-5199)ACG>ATG	p.T1733M		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1733	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACGGAGGAGACGAAGAGCATC	0.557													20	35	---	---	---	---	capture	Missense_Mutation	SNP	237777626	237777626	RYR2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13661	28
HSPA12A	259217	broad.mit.edu	37	10	118439024	118439024	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118439024G>A	uc001lct.2	-	10	1381	c.1276C>T	c.(1276-1278)CGG>TGG	p.R426W	HSPA12A_uc001lcu.2_Missense_Mutation_p.R343W	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	426							ATP binding			ovary(1)	1				all cancers(201;0.0158)		TTGCTTTTCCGCAAGGCGTGC	0.547													10	70	---	---	---	---	capture	Missense_Mutation	SNP	118439024	118439024	HSPA12A	10	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	7329	28
KCNQ1	3784	broad.mit.edu	37	11	2466624	2466624	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:2466624C>T	uc001lwn.2	+	1	404	c.296C>T	c.(295-297)CCG>CTG	p.P99L	KCNQ1_uc009ydo.1_Missense_Mutation_p.P99L	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like	99				TRRPVLARTHV -> METRGSRLTGG (in Ref. 6; AAC51781).	blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	ACGCGCCGCCCGGTGTTGGCG	0.582													15	18	---	---	---	---	capture	Missense_Mutation	SNP	2466624	2466624	KCNQ1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8004	28
OR5M8	219484	broad.mit.edu	37	11	56258561	56258561	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56258561A>G	uc001nix.1	-	1	286	c.286T>C	c.(286-288)TGT>CGT	p.C96R		NM_001005282	NP_001005282	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	Esophageal squamous(21;0.00352)					TGCACAAGACAGGCAGGATAG	0.473													5	92	---	---	---	---	capture	Missense_Mutation	SNP	56258561	56258561	OR5M8	11	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	11080	28
VWF	7450	broad.mit.edu	37	12	6122757	6122757	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6122757C>T	uc001qnn.1	-	32	5760	c.5510G>A	c.(5509-5511)CGG>CAG	p.R1837Q	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1837	VWFA 3; main binding site for collagens type I and III.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TGCCAAGATCCGTAGCTGGGC	0.532													34	60	---	---	---	---	capture	Missense_Mutation	SNP	6122757	6122757	VWF	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17128	28
TAS2R13	50838	broad.mit.edu	37	12	11061487	11061487	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11061487G>A	uc001qzg.1	-	1	675	c.411C>T	c.(409-411)ACC>ACT	p.T137T	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron	NM_023920	NP_076409	Q9NYV9	T2R13_HUMAN	taste receptor, type 2, member 13	137	Helical; Name=4; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			breast(1)|skin(1)	2						AGAAGACCAAGGTTCCTAGCA	0.353													50	68	---	---	---	---	capture	Silent	SNP	11061487	11061487	TAS2R13	12	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	15455	28
TRPV4	59341	broad.mit.edu	37	12	110236432	110236432	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:110236432G>A	uc001tpj.1	-	5	1234	c.1139C>T	c.(1138-1140)ACG>ATG	p.T380M	TRPV4_uc001tpg.1_Missense_Mutation_p.T346M|TRPV4_uc001tph.1_Missense_Mutation_p.T333M|TRPV4_uc001tpi.1_Missense_Mutation_p.T333M|TRPV4_uc001tpk.1_Missense_Mutation_p.T380M|TRPV4_uc001tpl.1_Missense_Mutation_p.T380M	NM_021625	NP_067638	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel,	380	Cytoplasmic (Potential).|ANK 3.				actin cytoskeleton reorganization|actin filament organization|calcium ion import|cell death|cell volume homeostasis|cell-cell junction assembly|cellular hypotonic response|cortical microtubule organization|elevation of cytosolic calcium ion concentration|microtubule polymerization|negative regulation of neuron projection development|osmosensory signaling pathway|positive regulation of microtubule depolymerization|response to mechanical stimulus	cortical actin cytoskeleton|filopodium|focal adhesion|growth cone|integral to membrane|lamellipodium|ruffle membrane	actin filament binding|alpha-tubulin binding|beta-tubulin binding|calcium channel activity|calmodulin binding|microtubule binding|protein binding|protein kinase C binding|SH2 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						AATCTTGCCCGTCTTGGCAGC	0.612													32	36	---	---	---	---	capture	Missense_Mutation	SNP	110236432	110236432	TRPV4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16481	28
HPD	3242	broad.mit.edu	37	12	122292681	122292681	+	Silent	SNP	G	A	A	rs61742674	byFrequency	TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122292681G>A	uc001ubj.2	-	7	382	c.342C>T	c.(340-342)GGC>GGT	p.G114G	HPD_uc001ubk.2_Silent_p.G75G	NM_002150	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase	114					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	TGATTTTGGCGCCCCGTTCCC	0.597													56	83	---	---	---	---	capture	Silent	SNP	122292681	122292681	HPD	12	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7257	28
COL4A1	1282	broad.mit.edu	37	13	110895031	110895031	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:110895031C>T	uc001vqw.3	-	2	257	c.135G>A	c.(133-135)AAG>AAA	p.K45K	COL4A1_uc010agl.2_Silent_p.K45K	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	45					angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCTTTTGTCCCTTCACTCCAT	0.408													164	288	---	---	---	---	capture	Silent	SNP	110895031	110895031	COL4A1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	3654	28
KCNH5	27133	broad.mit.edu	37	14	63316465	63316465	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:63316465A>T	uc001xfx.2	-	8	1526	c.1475T>A	c.(1474-1476)CTA>CAA	p.L492Q	KCNH5_uc001xfy.2_Missense_Mutation_p.L492Q|KCNH5_uc001xfz.1_Missense_Mutation_p.L434Q	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	492	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ATAGAGTTTTAGGAAGTCCCG	0.393													43	128	---	---	---	---	capture	Missense_Mutation	SNP	63316465	63316465	KCNH5	14	A	T	T	T	1	0	0	0	0	1	0	0	0	195	15	4	4	7957	28
IGF1R	3480	broad.mit.edu	37	15	99250943	99250943	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:99250943G>T	uc002bul.2	+	2	297	c.247G>T	c.(247-249)GAG>TAG	p.E83*	IGF1R_uc010urq.1_Nonsense_Mutation_p.E83*|IGF1R_uc010bon.2_Nonsense_Mutation_p.E83*	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor	83					anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	GGTCATTACCGAGTACTTGCT	0.597													3	73	---	---	---	---	capture	Nonsense_Mutation	SNP	99250943	99250943	IGF1R	15	G	T	T	T	1	0	0	0	0	0	1	0	0	481	37	5	4	7496	28
WDR90	197335	broad.mit.edu	37	16	701986	701986	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:701986G>A	uc002cii.1	+	9	1054	c.1000G>A	c.(1000-1002)GTG>ATG	p.V334M	WDR90_uc002cig.1_Missense_Mutation_p.V334M|WDR90_uc002cih.1_Missense_Mutation_p.V335M|WDR90_uc002cij.1_RNA	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	334										ovary(1)	1		Hepatocellular(780;0.0218)				CGGCACCCACGTGTTGACTCA	0.687													3	10	---	---	---	---	capture	Missense_Mutation	SNP	701986	701986	WDR90	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17218	28
RHBDL1	9028	broad.mit.edu	37	16	727080	727080	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:727080G>A	uc002cis.1	+	3	758	c.731G>A	c.(730-732)CGC>CAC	p.R244H	RHBDL1_uc002cir.1_Missense_Mutation_p.R179H|RHBDL1_uc010uun.1_Missense_Mutation_p.R179H	NM_003961	NP_003952	O75783	RHBL1_HUMAN	rhomboid protease 1	244					proteolysis|signal transduction	integral to plasma membrane|membrane fraction	calcium ion binding|serine-type endopeptidase activity				0		Hepatocellular(780;0.0218)				CACCGTGCCCGCGCCTGGCGC	0.617													37	58	---	---	---	---	capture	Missense_Mutation	SNP	727080	727080	RHBDL1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13213	28
SLC12A4	6560	broad.mit.edu	37	16	67984224	67984224	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67984224G>A	uc002euz.2	-	12	1768	c.1627C>T	c.(1627-1629)CGG>TGG	p.R543W	SLC12A4_uc010ceu.2_Missense_Mutation_p.R537W|SLC12A4_uc010vkh.1_Missense_Mutation_p.R512W|SLC12A4_uc010vki.1_Missense_Mutation_p.R543W|SLC12A4_uc010vkj.1_Missense_Mutation_p.R545W|SLC12A4_uc002eva.2_Missense_Mutation_p.R543W|SLC12A4_uc010cev.1_5'Flank|SLC12A4_uc002evb.2_RNA	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	543					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GGGCTCACCCGGAGGAAGGGG	0.642													29	52	---	---	---	---	capture	Missense_Mutation	SNP	67984224	67984224	SLC12A4	16	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	14278	28
CDH15	1013	broad.mit.edu	37	16	89261311	89261311	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89261311C>T	uc002fmt.2	+	14	2270	c.2193C>T	c.(2191-2193)TAC>TAT	p.Y731Y		NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	731	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		TGCCGCCTTACGACACAGCCC	0.637													12	13	---	---	---	---	capture	Silent	SNP	89261311	89261311	CDH15	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3071	28
DNAH9	1770	broad.mit.edu	37	17	11648135	11648135	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11648135C>T	uc002gne.2	+	31	6201	c.6133C>T	c.(6133-6135)CGG>TGG	p.R2045W	DNAH9_uc010coo.2_Missense_Mutation_p.R1339W	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2045	AAA 1 (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTGGGGCCTACGGGCCATCAA	0.557													32	70	---	---	---	---	capture	Missense_Mutation	SNP	11648135	11648135	DNAH9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	4564	28
SNX11	29916	broad.mit.edu	37	17	46198838	46198838	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:46198838C>A	uc002inf.1	+	8	1135	c.781C>A	c.(781-783)CCT>ACT	p.P261T	SNX11_uc010wlg.1_Missense_Mutation_p.P253T|SNX11_uc010wlh.1_Missense_Mutation_p.P253T|SNX11_uc010wli.1_Missense_Mutation_p.P200T|SNX11_uc010wlj.1_Missense_Mutation_p.P117T|SNX11_uc002ing.1_Missense_Mutation_p.P261T|SNX11_uc002inh.1_Missense_Mutation_p.P261T	NM_152244	NP_689450	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	261					cell communication|protein transport	membrane	phosphatidylinositol binding				0						GCCTTTGGACCCTGGTCAGTT	0.522													98	182	---	---	---	---	capture	Missense_Mutation	SNP	46198838	46198838	SNX11	17	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	14774	28
TNRC6C	57690	broad.mit.edu	37	17	76089149	76089149	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76089149G>A	uc002jud.2	+	16	4706	c.4106G>A	c.(4105-4107)CGT>CAT	p.R1369H	TNRC6C_uc002juf.2_Missense_Mutation_p.R1366H	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2	1369					gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGCTGGTCACGTGCCAAATCT	0.502													23	39	---	---	---	---	capture	Missense_Mutation	SNP	76089149	76089149	TNRC6C	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16225	28
UTS2R	2837	broad.mit.edu	37	17	80332216	80332216	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80332216G>A	uc010wvl.1	+	1	16	c.16G>A	c.(16-18)GAG>AAG	p.E6K		NM_018949	NP_061822	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	6	Extracellular (Potential).					integral to membrane|plasma membrane				breast(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			GCTGACCCCCGAGTCCCCGAG	0.721													4	7	---	---	---	---	capture	Missense_Mutation	SNP	80332216	80332216	UTS2R	17	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16988	28
LAMA1	284217	broad.mit.edu	37	18	7023335	7023335	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7023335G>A	uc002knm.2	-	19	2623	c.2529C>T	c.(2527-2529)GGC>GGT	p.G843G	LAMA1_uc010wzj.1_Silent_p.G319G	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	843	Laminin EGF-like 7.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CACAAGATTCGCCAGGCACTG	0.527													47	44	---	---	---	---	capture	Silent	SNP	7023335	7023335	LAMA1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8525	28
MUC16	94025	broad.mit.edu	37	19	9063659	9063659	+	Silent	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9063659A>T	uc002mkp.2	-	3	23991	c.23787T>A	c.(23785-23787)TCT>TCA	p.S7929S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7931	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCATTGTCAAAGAGGTTGTGC	0.458													64	90	---	---	---	---	capture	Silent	SNP	9063659	9063659	MUC16	19	A	T	T	T	1	0	0	0	0	0	0	0	1	28	3	4	4	9883	28
FFAR1	2864	broad.mit.edu	37	19	35842837	35842837	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35842837C>T	uc002nzc.2	+	1	393	c.383C>T	c.(382-384)GCG>GTG	p.A128V		NM_005303	NP_005294	O14842	FFAR1_HUMAN	free fatty acid receptor 1	128	Helical; Name=4; (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to plasma membrane	G-protein coupled receptor activity|guanyl-nucleotide exchange factor activity|lipid binding			central_nervous_system(1)	1	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;4.58e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.67e-19)|all cancers(14;2.01e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		Icosapent(DB00159)	GGGGTGTGCGCGGCCATCTGG	0.667													16	167	---	---	---	---	capture	Missense_Mutation	SNP	35842837	35842837	FFAR1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5773	28
ZFP82	284406	broad.mit.edu	37	19	36884449	36884449	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36884449C>T	uc002ody.1	-	5	1028	c.793G>A	c.(793-795)GTA>ATA	p.V265I		NM_133466	NP_597723	Q8N141	ZFP82_HUMAN	zinc finger protein 82 homolog	265	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						TGTCCTCGTACCCTAAAAGCC	0.433													200	256	---	---	---	---	capture	Missense_Mutation	SNP	36884449	36884449	ZFP82	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	17533	28
MEIS3	56917	broad.mit.edu	37	19	47910342	47910342	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47910342G>A	uc002pgu.2	-	10	1435	c.988C>T	c.(988-990)CGC>TGC	p.R330C	MEIS3_uc010xyp.1_RNA|MEIS3_uc002pgo.2_Missense_Mutation_p.R129C|MEIS3_uc002pgp.2_Missense_Mutation_p.R162C|MEIS3_uc002pgq.2_Missense_Mutation_p.R411C|MEIS3_uc002pgr.2_Missense_Mutation_p.R198C|MEIS3_uc002pgt.2_Missense_Mutation_p.R313C|MEIS3_uc002pgv.2_Missense_Mutation_p.R359C|MEIS3_uc002pgs.2_Missense_Mutation_p.R376C|MEIS3_uc010eld.2_Missense_Mutation_p.R376C	NM_001009813	NP_001009813	Q99687	MEIS3_HUMAN	Meis1, myeloid ecotropic viral integration site	330						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		GTACCTGTGCGGTTGGATTGA	0.612													4	27	---	---	---	---	capture	Missense_Mutation	SNP	47910342	47910342	MEIS3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9382	28
SIGLEC5	8778	broad.mit.edu	37	19	52129355	52129355	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52129355C>T	uc002pxe.2	-	8	1533	c.1394G>A	c.(1393-1395)CGC>CAC	p.R465H		NM_003830	NP_003821	O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5 precursor	465	Cytoplasmic (Potential).				cell adhesion	integral to membrane	sugar binding			skin(2)|breast(1)|central_nervous_system(1)	4		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TTGCTTCCTGCGGGCTTTCAC	0.527													10	145	---	---	---	---	capture	Missense_Mutation	SNP	52129355	52129355	SIGLEC5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14204	28
ZNF845	91664	broad.mit.edu	37	19	53856730	53856730	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53856730G>A	uc010ydv.1	+	4	2919	c.2802G>A	c.(2800-2802)AAG>AAA	p.K934K	ZNF845_uc010ydw.1_Silent_p.K934K	NM_138374	NP_612383	Q96IR2	ZN845_HUMAN	zinc finger protein 845	934	C2H2-type 26.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAATTCATAAGACAATTCATA	0.368													3	49	---	---	---	---	capture	Silent	SNP	53856730	53856730	ZNF845	19	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	18067	28
ZNF419	79744	broad.mit.edu	37	19	58004984	58004984	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58004984C>T	uc002qov.2	+	5	1299	c.1059C>T	c.(1057-1059)AGC>AGT	p.S353S	ZNF547_uc002qpm.3_Intron|ZNF419_uc010ety.1_Silent_p.S354S|ZNF419_uc010etz.1_Silent_p.S341S|ZNF419_uc010eua.1_Silent_p.S340S|ZNF419_uc002qow.2_Silent_p.S321S|ZNF419_uc010eub.1_Silent_p.S308S|ZNF419_uc010euc.1_Silent_p.S307S	NM_024691	NP_078967	Q96HQ0	ZN419_HUMAN	zinc finger protein 419 isoform 2	353	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		AATTCTATAGCCACAAGTCCA	0.413													49	131	---	---	---	---	capture	Silent	SNP	58004984	58004984	ZNF419	19	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	17776	28
ZNF773	374928	broad.mit.edu	37	19	58018486	58018486	+	Silent	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58018486C>T	uc002qox.2	+	4	1163	c.1023C>T	c.(1021-1023)AGC>AGT	p.S341S	ZNF547_uc002qpm.3_Intron|ZNF773_uc002qoy.2_Silent_p.S340S|ZNF773_uc002qoz.2_Intron	NM_198542	NP_940944	Q6PK81	ZN773_HUMAN	zinc finger protein 773	341	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		AATTCTATAGCCACAAGTCCA	0.418													6	220	---	---	---	---	capture	Silent	SNP	58018486	58018486	ZNF773	19	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	18022	28
C2orf16	84226	broad.mit.edu	37	2	27803330	27803330	+	Silent	SNP	T	C	C			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27803330T>C	uc002rkz.3	+	1	3942	c.3891T>C	c.(3889-3891)CTT>CTC	p.L1297L	ZNF512_uc010ylv.1_5'Flank|ZNF512_uc010ylw.1_5'Flank|ZNF512_uc002rlb.2_5'Flank|ZNF512_uc010ylx.1_5'Flank|ZNF512_uc002rlc.2_5'Flank|ZNF512_uc002rla.2_5'Flank|ZNF512_uc010yly.1_5'Flank|ZNF512_uc010ylz.1_5'Flank	NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	1297										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					CCAAGCGACTTAGAAAACACA	0.403													5	119	---	---	---	---	capture	Silent	SNP	27803330	27803330	C2orf16	2	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	2137	28
SNRNP200	23020	broad.mit.edu	37	2	96964138	96964138	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:96964138C>T	uc002svu.2	-	9	1089	c.1003G>A	c.(1003-1005)GCC>ACC	p.A335T		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	335						catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TGTGCACTGGCCAGCAAGGTA	0.433													30	52	---	---	---	---	capture	Missense_Mutation	SNP	96964138	96964138	SNRNP200	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14744	28
TBR1	10716	broad.mit.edu	37	2	162280004	162280004	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:162280004A>G	uc002ubw.1	+	6	1617	c.1315A>G	c.(1315-1317)AAC>GAC	p.N439D	TBR1_uc010foy.2_Missense_Mutation_p.N152D	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1	439						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						GTTCGTGAGCAACTACGCCAA	0.597													4	15	---	---	---	---	capture	Missense_Mutation	SNP	162280004	162280004	TBR1	2	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	15534	28
TTN	7273	broad.mit.edu	37	2	179542633	179542633	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179542633G>A	uc010zfg.1	-	143	30498	c.30274C>T	c.(30274-30276)CGT>TGT	p.R10092C	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R6753C|TTN_uc010fre.1_Intron|TTN_uc002una.1_RNA|TTN_uc010frf.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11019							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTGGTTCACGTTTCTTTGGC	0.363													14	106	---	---	---	---	capture	Missense_Mutation	SNP	179542633	179542633	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16617	28
PDE1A	5136	broad.mit.edu	37	2	183053766	183053766	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183053766C>T	uc002uos.2	-	12	1279	c.1195G>A	c.(1195-1197)GGG>AGG	p.G399R	PDE1A_uc010zfp.1_Missense_Mutation_p.G295R|PDE1A_uc002uoq.1_Missense_Mutation_p.G399R|PDE1A_uc010zfq.1_Missense_Mutation_p.G399R|PDE1A_uc002uor.2_Missense_Mutation_p.G383R|PDE1A_uc002uou.2_Missense_Mutation_p.G365R	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2	399	Catalytic (By similarity).				activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			AATGGAAGCCCTAATTCAGCT	0.413													117	158	---	---	---	---	capture	Missense_Mutation	SNP	183053766	183053766	PDE1A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	11536	28
C20orf27	54976	broad.mit.edu	37	20	3735070	3735070	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3735070C>T	uc002wji.1	-	5	627	c.398G>A	c.(397-399)CGC>CAC	p.R133H	C20orf27_uc002wjf.1_3'UTR|C20orf27_uc002wjh.1_Missense_Mutation_p.R158H	NM_001039140	NP_001034229	Q9GZN8	CT027_HUMAN	hypothetical protein LOC54976	133											0						CACCGTCACGCGCACACAGGT	0.602													94	123	---	---	---	---	capture	Missense_Mutation	SNP	3735070	3735070	C20orf27	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2088	28
HAO1	54363	broad.mit.edu	37	20	7864254	7864254	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:7864254C>T	uc002wmw.1	-	8	1123	c.1099G>A	c.(1099-1101)GTT>ATT	p.V367I		NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	367					cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						ATCTTGGAAACGGCCAAAGGA	0.373													46	97	---	---	---	---	capture	Missense_Mutation	SNP	7864254	7864254	HAO1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6878	28
TMEM90B	79953	broad.mit.edu	37	20	24565630	24565630	+	Splice_Site	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:24565630G>A	uc002wtw.1	+	3	1251	c.618_splice	c.e3+1	p.E206_splice		NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						GTCCCATGAGGTAAGGCCTCC	0.627													111	118	---	---	---	---	capture	Splice_Site	SNP	24565630	24565630	TMEM90B	20	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	16102	28
PTK6	5753	broad.mit.edu	37	20	62168644	62168644	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62168644G>T	uc002yfg.2	-	1	64	c.24C>A	c.(22-24)CAC>CAA	p.H8Q	PTK6_uc011aay.1_5'UTR|PTK6_uc011aba.1_Missense_Mutation_p.H8Q	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6	8						cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)			TGGGGCCCAGGTGAGCCTGGT	0.716													8	11	---	---	---	---	capture	Missense_Mutation	SNP	62168644	62168644	PTK6	20	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	12659	28
KRTAP13-2	337959	broad.mit.edu	37	21	31744289	31744289	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31744289G>A	uc002ynz.3	-	1	269	c.243C>T	c.(241-243)TAC>TAT	p.Y81Y		NM_181621	NP_853652	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	81	4.|5 X 10 AA approximate repeats.					intermediate filament					0						TTCTGGGGCGGTAGCAGGAGG	0.602													36	67	---	---	---	---	capture	Silent	SNP	31744289	31744289	KRTAP13-2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	8443	28
KRTAP10-12	386685	broad.mit.edu	37	21	46117748	46117748	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46117748T>C	uc002zfw.1	+	1	662	c.632T>C	c.(631-633)GTC>GCC	p.V211A	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198699	NP_941972	P60413	KR10C_HUMAN	keratin associated protein 10-12	211	19 X 5 AA repeats of C-C-X(3).					keratin filament					0						CGCGTGCCCGTCCCCTCCTGC	0.726													3	108	---	---	---	---	capture	Missense_Mutation	SNP	46117748	46117748	KRTAP10-12	21	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	8428	28
STXBP5L	9515	broad.mit.edu	37	3	121126274	121126274	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121126274G>C	uc003eec.3	+	24	2984	c.2844G>C	c.(2842-2844)CAG>CAC	p.Q948H	STXBP5L_uc011bji.1_Missense_Mutation_p.Q924H	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	948	WD 12.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		GAGATCATCAGTATACAATAA	0.378													3	120	---	---	---	---	capture	Missense_Mutation	SNP	121126274	121126274	STXBP5L	3	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	15247	28
UGT2B4	7363	broad.mit.edu	37	4	70361103	70361103	+	Silent	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70361103C>G	uc003hek.3	-	1	524	c.477G>C	c.(475-477)CTG>CTC	p.L159L	UGT2B4_uc011cap.1_Silent_p.L23L|UGT2B4_uc003hel.3_Silent_p.L159L	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	159					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						ACTCGGCCAGCAGCTCACCAA	0.428													20	35	---	---	---	---	capture	Silent	SNP	70361103	70361103	UGT2B4	4	C	G	G	G	1	0	0	0	0	0	0	0	1	314	25	4	4	16843	28
OTUD4	54726	broad.mit.edu	37	4	146059041	146059041	+	Silent	SNP	A	G	G			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:146059041A>G	uc003ika.3	-	21	2829	c.2691T>C	c.(2689-2691)CAT>CAC	p.H897H	OTUD4_uc003ijz.3_Silent_p.H896H	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	961							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					GAGTGGGAGGATGAGCCTTTC	0.478													4	286	---	---	---	---	capture	Silent	SNP	146059041	146059041	OTUD4	4	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	11218	28
IRX1	79192	broad.mit.edu	37	5	3601124	3601124	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:3601124G>A	uc003jde.2	+	4	1465	c.1413G>A	c.(1411-1413)CCG>CCA	p.P471P		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	471						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						AGGGAACGCCGCGGATCCTAG	0.652													40	63	---	---	---	---	capture	Silent	SNP	3601124	3601124	IRX1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	7766	28
TARS	6897	broad.mit.edu	37	5	33461376	33461376	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33461376C>G	uc003jhy.2	+	13	1822	c.1527C>G	c.(1525-1527)ATC>ATG	p.I509M	TARS_uc011cob.1_Missense_Mutation_p.I497M|TARS_uc010iup.1_Missense_Mutation_p.I450M|TARS_uc011coc.1_Missense_Mutation_p.I530M|TARS_uc003jhz.2_Missense_Mutation_p.I405M|TARS_uc011cod.1_Missense_Mutation_p.I388M	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	509					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)	TTGGAGATATCGAAGTATGGG	0.373													80	95	---	---	---	---	capture	Missense_Mutation	SNP	33461376	33461376	TARS	5	C	G	G	G	1	0	0	0	0	1	0	0	0	395	31	4	4	15447	28
RPS12	6206	broad.mit.edu	37	6	133137703	133137703	+	Splice_Site	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:133137703G>T	uc003qdx.2	+	4	316	c.234_splice	c.e4+1	p.K78_splice	RPS12_uc003qdy.1_3'UTR	NM_001016	NP_001007	P25398	RS12_HUMAN	ribosomal protein S12						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	structural constituent of ribosome				0	Breast(56;0.214)			OV - Ovarian serous cystadenocarcinoma(155;0.00284)|GBM - Glioblastoma multiforme(226;0.0256)		CCTAATTAAGGTAAGGCTGCT	0.438													41	50	---	---	---	---	capture	Splice_Site	SNP	133137703	133137703	RPS12	6	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	13514	28
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			848	83	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	28
PCLO	27445	broad.mit.edu	37	7	82784773	82784773	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82784773G>A	uc003uhx.2	-	2	1473	c.1184C>T	c.(1183-1185)CCT>CTT	p.P395L	PCLO_uc003uhv.2_Missense_Mutation_p.P395L	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	346	Gln-rich.|Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TCCAACTCCAGGAGGCTGAGC	0.592													64	176	---	---	---	---	capture	Missense_Mutation	SNP	82784773	82784773	PCLO	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	11486	28
GATA4	2626	broad.mit.edu	37	8	11607632	11607632	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11607632C>T	uc003wuc.2	+	4	1350	c.796C>T	c.(796-798)CGA>TGA	p.R266*	GATA4_uc003wub.1_Nonsense_Mutation_p.R60*|GATA4_uc011kxc.1_Nonsense_Mutation_p.R267*	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4	266					atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		CGCCTCCCGCCGAGTGGGCCT	0.632													24	37	---	---	---	---	capture	Nonsense_Mutation	SNP	11607632	11607632	GATA4	8	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	6196	28
SLC18A1	6570	broad.mit.edu	37	8	20022464	20022464	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:20022464A>T	uc011kyq.1	-	11	1402	c.931T>A	c.(931-933)TTT>ATT	p.F311I	SLC18A1_uc003wzl.2_Missense_Mutation_p.F98I|SLC18A1_uc003wzm.2_Missense_Mutation_p.F311I|SLC18A1_uc011kyr.1_Missense_Mutation_p.F311I|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	311	Helical; (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		ATGTTGGCAAAGCAGATGGAC	0.612													47	55	---	---	---	---	capture	Missense_Mutation	SNP	20022464	20022464	SLC18A1	8	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	14318	28
RANBP6	26953	broad.mit.edu	37	9	6012658	6012658	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6012658T>G	uc003zjr.2	-	1	2961	c.2950A>C	c.(2950-2952)ATA>CTA	p.I984L	RANBP6_uc011lmf.1_Missense_Mutation_p.I632L|RANBP6_uc003zjs.2_Missense_Mutation_p.I572L	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	984	HEAT 7.				protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATCTTCCCTATTGCTGAGATA	0.363													3	158	---	---	---	---	capture	Missense_Mutation	SNP	6012658	6012658	RANBP6	9	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	12926	28
AQP7	364	broad.mit.edu	37	9	33385701	33385701	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33385701T>C	uc003zst.2	-	7	861	c.689A>G	c.(688-690)GAC>GGC	p.D230G	SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Missense_Mutation_p.D173G|AQP7_uc010mjs.2_Missense_Mutation_p.D138G|AQP7_uc010mjt.2_Missense_Mutation_p.D138G|AQP7_uc011lnx.1_Missense_Mutation_p.D230G|AQP7_uc011lny.1_Missense_Mutation_p.D229G|AQP7_uc003zss.3_Missense_Mutation_p.D138G|AQP7_uc011lnz.1_Missense_Mutation_p.D138G|AQP7_uc011loa.1_Silent_p.G98G	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	230	Extracellular (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		GGGGGGCAGGTCCCGGGACGG	0.587													75	106	---	---	---	---	capture	Missense_Mutation	SNP	33385701	33385701	AQP7	9	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	824	28
EGFL6	25975	broad.mit.edu	37	X	13637337	13637337	+	Silent	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:13637337G>A	uc004cvi.2	+	9	1398	c.1158G>A	c.(1156-1158)GCG>GCA	p.A386A	EGFL6_uc004cvj.2_Silent_p.A386A|EGFL6_uc011mik.1_Silent_p.A287A	NM_015507	NP_056322	Q8IUX8	EGFL6_HUMAN	epidermal growth factor-like protein 6	386					cell adhesion|cell cycle|cell differentiation|multicellular organismal development	basement membrane|extracellular space|membrane	calcium ion binding|integrin binding			breast(2)	2						AAAGGAAAGCGCTAACTTCCA	0.388													77	83	---	---	---	---	capture	Silent	SNP	13637337	13637337	EGFL6	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4918	28
RPS6KA3	6197	broad.mit.edu	37	X	20193367	20193367	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:20193367A>T	uc004czu.2	-	14	1142	c.1142T>A	c.(1141-1143)CTT>CAT	p.L381H	RPS6KA3_uc011mjk.1_Missense_Mutation_p.L352H|RPS6KA3_uc004czv.2_Missense_Mutation_p.L369H|RPS6KA3_uc011mjl.1_Missense_Mutation_p.L353H|RPS6KA3_uc011mjm.1_Missense_Mutation_p.L353H	NM_004586	NP_004577	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	381	AGC-kinase C-terminal.				axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity	p.L381H(1)		central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8						CCCCCGAAAAAGCTGATGTGC	0.393													60	71	---	---	---	---	capture	Missense_Mutation	SNP	20193367	20193367	RPS6KA3	23	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	13544	28
XK	7504	broad.mit.edu	37	X	37553630	37553630	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37553630G>T	uc004ddq.2	+	2	419	c.337G>T	c.(337-339)GGC>TGC	p.G113C		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	113	Extracellular (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				GCCAAAAAATGGCCTCTCAGA	0.488													26	43	---	---	---	---	capture	Missense_Mutation	SNP	37553630	37553630	XK	23	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	17312	28
SYP	6855	broad.mit.edu	37	X	49048172	49048172	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49048172C>T	uc004dmz.1	-	6	680	c.664G>A	c.(664-666)GTG>ATG	p.V222M	SYP_uc011mmz.1_Missense_Mutation_p.V104M|SYP_uc004dna.1_Missense_Mutation_p.V216M	NM_003179	NP_003170	P08247	SYPH_HUMAN	synaptophysin	222	Helical; (Potential).|MARVEL.				regulation of long-term neuronal synaptic plasticity|regulation of short-term neuronal synaptic plasticity|synaptic vesicle maturation|synaptic vesicle membrane organization	cell junction|integral to synaptic vesicle membrane|synaptosome	calcium ion binding|cholesterol binding|transporter activity	p.V222M(1)		ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(315;0.00016)				TCCTTAAACACGAACCACAGG	0.682													16	26	---	---	---	---	capture	Missense_Mutation	SNP	49048172	49048172	SYP	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15349	28
AWAT1	158833	broad.mit.edu	37	X	69455983	69455983	+	Silent	SNP	C	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69455983C>A	uc004dxy.2	+	3	290	c.249C>A	c.(247-249)CCC>CCA	p.P83P		NM_001013579	NP_001013597	Q58HT5	AWAT1_HUMAN	wax synthase 1	83					lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity			ovary(3)	3						ACTATTTCCCCATTACGGTAA	0.483													35	60	---	---	---	---	capture	Silent	SNP	69455983	69455983	AWAT1	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	1224	28
NONO	4841	broad.mit.edu	37	X	70516705	70516705	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70516705C>T	uc004dzo.2	+	8	1461	c.751C>T	c.(751-753)CGA>TGA	p.R251*	BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Nonsense_Mutation_p.R251*|NONO_uc004dzp.2_Nonsense_Mutation_p.R251*|NONO_uc011mpv.1_Nonsense_Mutation_p.R162*|NONO_uc004dzq.2_Nonsense_Mutation_p.R120*	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	251	DBHS.				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					CTATAGGGAACGAGAGCAGCC	0.493			T	TFE3	papillary renal cancer								26	38	---	---	---	---	capture	Nonsense_Mutation	SNP	70516705	70516705	NONO	23	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	10441	28
GPR101	83550	broad.mit.edu	37	X	136113395	136113395	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:136113395G>A	uc011mwh.1	-	1	439	c.439C>T	c.(439-441)CGC>TGC	p.R147C		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	147	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					AGGTAACCGCGGCGCTGGGTC	0.597													21	44	---	---	---	---	capture	Missense_Mutation	SNP	136113395	136113395	GPR101	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6556	28
PTEN	5728	broad.mit.edu	37	10	89690819	89690820	+	Frame_Shift_Del	DEL	TA	-	-			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89690819_89690820delTA	uc001kfb.2	+	5	1257_1258	c.226_227delTA	c.(226-228)TATfs	p.Y76fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	76	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Y76fs*1(12)|p.L70fs*7(4)|p.R55fs*1(4)|p.?(2)|p.C71fs*6(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.Y76Y(1)|p.Y76*(1)|p.Y76del(1)|p.H75_T78del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGAAAGACATTATGACACCGCC	0.272		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			25	25	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89690819	89690820	PTEN	10	TA	-	-	-	1	0	1	0	1	0	0	0	0	793	61	5	5	12633	28
JAKMIP3	282973	broad.mit.edu	37	10	133949482	133949482	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:133949482delA	uc001lkx.3	+	5	1018	c.1018delA	c.(1018-1020)AAAfs	p.K340fs		NM_001105521	NP_001098991			Janus kinase and microtubule interacting protein											breast(1)	1		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TCTGCTGGATAAAAACAAGCG	0.443													13	3	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	133949482	133949482	JAKMIP3	10	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	7865	28
DNAJB11	51726	broad.mit.edu	37	3	186302367	186302367	+	Frame_Shift_Del	DEL	A	-	-			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186302367delA	uc003fqi.2	+	9	1221	c.1001delA	c.(1000-1002)GAAfs	p.E334fs		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	334					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TTAACAGAGGAAGCGAGAGAA	0.303													34	49	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	186302367	186302367	DNAJB11	3	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	4572	28
MRPL13	28998	broad.mit.edu	37	8	121432169	121432170	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-0157-01	TCGA-06-0157-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121432169_121432170insT	uc003ypa.2	-	5	628_629	c.315_316insA	c.(313-318)AAACTAfs	p.K105fs	MRPL13_uc010mdf.2_RNA	NM_014078	NP_054797	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	105_106					translation	mitochondrial large ribosomal subunit	protein binding|structural constituent of ribosome			central_nervous_system(1)	1	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TAAATAGCTAGTTTTACAATCT	0.356													11	41	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	121432169	121432170	MRPL13	8	-	T	T	T	1	0	1	1	0	0	0	0	0	464	36	5	5	9688	28
